Home Life Sciences Dapagliflozin attenuates atrial fibrosis via the HMGB1/RAGE pathway in atrial fibrillation rats
Article Open Access

Dapagliflozin attenuates atrial fibrosis via the HMGB1/RAGE pathway in atrial fibrillation rats

  • Zhenni Tan , Jianxiang Chang , Yin Li , Xiang Sun , Fanxiang Liu , Yang Chen and Lin Pan EMAIL logo
Published/Copyright: September 8, 2025
Download Article (PDF)
Open Life Sciences
From the journal Open Life Sciences Volume 20 Issue 1

Abstract

Atrial fibrillation (AF) is the most prevalent sustained cardiac arrhythmia. A key pathological feature of AF is atrial fibrosis, which promotes arrhythmogenic remodeling. While myocardial fibrosis has been widely observed in AF models, the underlying molecular mechanisms driving fibrotic progression remain incompletely understood. AF rats were modeled using acetylcholine, followed by treatment with different concentrations of dapagliflozin (DAPA) or positive control amiodarone. To elucidate the role of the high-mobility group box 1 (HMGB1)/receptor for advanced glycation end products (RAGE) pathway in AF, lipopolysaccharide (LPS; an HMGB1/RAGE pathway activator) and FPS-ZM1 (a RAGE inhibitor) were employed. Cardiac function, myocardial fibrosis, and inflammation-related proteins were assessed using echocardiography, enzyme-linked immunosorbent assay, histological staining, Western blotting, and reverse transcription quantitative polymerase chain reaction. AF rats exhibited marked cardiac dysfunction, fibrosis, and increased expression of inflammatory markers. DAPA restored cardiac function, attenuating fibrosis and inflammation. LPS aggravated cardiac injury, while DAPA attenuated the damage, with the greatest protective effects observed in the LPS + DAPA + FPS-ZM1 group. DAPA attenuates atrial fibrosis and cardiac dysfunction in AF rats by inhibiting the HMGB1/RAGE pathway. This study suggests the potential of DAPA as a therapeutic option for AF.

Keywords: HMGB1/RAGE pathway; DAPA; atrial fibrillation rats; myocardial fibrosis

1 Introduction

Atrial fibrillation (AF) ranks among the most prevalent sustained cardiac arrhythmias encountered in clinical practice and is associated with increased morbidity, mortality, and healthcare burden worldwide [1,2]. Under normal physiological conditions, the atria contract in a regular manner to ensure effective pumping function of the heart [3,4]. However, in patients with AF, rapid and disorganized atrial electrical activity impairs atrial contraction, leading to reduced cardiac efficiency, thromboembolic events, stroke, heart failure, and myocardial ischemia [5,6]. These complications greatly impact patient prognosis and quality of life. Although catheter ablation remains a cornerstone of AF treatment, its high cost and recurrence rate limit broad applicability [7], underscoring the urgent need for novel, safe, and effective therapeutic strategies.

Atrial fibrosis, characterized by excessive extracellular matrix deposition and structural remodeling of the atrial myocardium, is a hallmark of atrial cardiomyopathy and plays a pivotal role in the initiation and maintenance of AF [8]. Meanwhile, atrial remodeling, particularly structural remodeling driven by myocardial fibrosis, is a key contributor to the progression of AF [9]. Myocardial fibrosis refers to the accumulation of fibrotic tissue within the heart, which disrupts normal atrial structure and function [10]. This process is primarily mediated by activated cardiac fibroblasts that differentiate into myofibroblasts, producing large quantities of collagen and fibrotic proteins [11]. Targeting the pathways that regulate fibroblast activation and fibrotic protein synthesis has therefore become a key therapeutic focus in efforts to mitigate atrial remodeling in AF.

Dapagliflozin (DAPA), a sodium-glucose co-transporter 2 (SGLT2) inhibitor, was initially developed for the treatment of diabetes [12,13]. Research suggests that DAPA can alleviate cardiac fibrosis and inflammation by inhibiting multiple inflammatory signaling pathways, thereby improving cardiac function [14,15]. Notably, recent studies have shown that DAPA is capable of regulating the high mobility group box 1 (HMGB1) signaling pathway in various disease models, including kidney and inflammatory disorders [16,17]. HMGB1, normally a nuclear protein, is released extracellularly following cellular stress or injury. Binding of HMGB1 to receptor for advanced glycation end products (RAGE) triggers pro-inflammatory and pro-fibrotic signaling cascades, contributing to cardiac remodeling and fibrosis [18,19]. The HMGB1/RAGE signaling pathway has garnered increasing attention as a damage-associated molecular pattern (DAMP) pathway [20,21]. However, the potential role of DAPA in mitigating AF-related myocardial fibrosis via HMGB1/RAGE signaling remains insufficiently defined.

This study aims to investigate whether DAPA attenuates myocardial fibrosis in AF rats by modulating the HMGB1/RAGE signaling pathway. The findings may provide mechanistic insights and support the therapeutic potential of DAPA in the management of AF.

2 Materials and methods

2.1 Animal experiment

A total of 54 male Sprague-Dawley rats (8 weeks old, 230–250 g) were purchased from Slack Jingda Laboratory Animal (Changsha, Hunan, China). All animals were kept in specific pathogen-free environment with temperature of 20–22°C, a 12-h light–dark cycle, and ad libitum access to food and water. After a 7-day acclimatization period, 48 rats were randomly chosen to establish AF models by tail vein injection of acetylcholine (60 μg/mL, 1 mL/kg; B50001, Wuyejia Technology, Beijing, China) and calcium chloride (10 mg/mL) once daily for 7 consecutive days [22]. The remaining 6 rats received saline (1 mL/kg) daily for the same duration and served as the control group.

Rats were allocated randomly into nine groups (n = 6/group): (1) control group; (2) AF group; (3) DAPA-L group (low-dose DAPA, 0.5 mg/kg, administered via oral gavage); (4) DAPA-M group (medium-dose DAPA, 1 mg/kg, administered via oral gavage) [23]; (5) DAPA-H group (high-dose DAPA, 2 mg/kg, administered via oral gavage); (6) amiodarone (AMIO) group (positive control for AF treatment, 50 mg/kg, administered via oral gavage) [24]; (7) lipopolysaccharide (LPS) group (HMGB1 agonist, 1 mg/mL, administered intraperitoneally) [25]; (8) LPS + DAPA group (2 mg/kg DAPA by gavage + 1 mg/mL LPS, administered intraperitoneally); and (9) LPS + DAPA + FPS-ZM1 group (2 mg/kg DAPA, administered via oral gavage + 1 mg/mL LPS administered intraperitoneally + 1 mg/mL FPS-ZM1, a RAGE inhibitor, administered intraperitoneally.

At the end of the experiment, AF induction was confirmed using electrocardiogram. Rats were euthanized via intraperitoneal injection of 2% sodium pentobarbital (150 mg/kg). Hearts were harvested, washed with phosphate buffer saline, and stored at −80°C for further analysis. The experimental process is shown in Figure 1.

Figure 1 Schematic representation of the animal experimental design.
Figure 1

Schematic representation of the animal experimental design.

  1. Ethical approval: The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals and has been approved by the Ethics Committee of The First Affiliated Hospital of Shaoyang University (SY20241131).

2.2 Blood glucose (Glu) measurement

Fasting Glu was measured in rats from each group using a glucometer (Contour Plus, Bayer Healthcare, Germany). Blood samples were collected from the tail vein of the rats following overnight fasting. Glu concentrations were determined according to the manufacturer’s instructions.

2.3 Electrocardiography (ECG)

ECG was recorded using the FX8322 system (Fukuda Denshi, Japan). Signals were filtered (0.5–150 Hz), amplified (20 mm/mV), and recorded at a paper speed of 50 mm/s. For baseline ECG recordings, a paper speed of 25–100 mm/s and an amplitude of 1 mm/mV were used.

2.4 Ultrasonic chocardiography analysis

Under isoflurane anesthesia, rats were subjected to echocardiographic examinations. Transthoracic ECG was performed using a Doppler ultrasound system. Images were obtained and analyzed using the VisualSonics Vevo 2100 imaging system (VisualSonics Inc., Toronto, Canada). Parameters included left ventricular end-systolic diameter (LVESD), left ventricular end-diastolic diameter (LVEDD), left atrial diameter (LAD), left ventricular ejection fraction (LVEF), and left ventricular fractional shortening (LVFS) were tested. Data were averaged over three cardiac cycles for accuracy.

2.5 Assay for biomarkers of myocardial injury

Blood samples were obtained from the rat abdominal aorta and allowed to clot for 1 h at room temperature. Serum was separated by centrifugation at 3,500 × g for 15 min, and the resulting supernatant was collected. The levels of serum cardiac troponin I (cTnI, ml059111, Shanghai Enzyme-Linked Biotechnology Co., Ltd), creatine kinase-MB (CK-MB, D731144, Shanghai Sangon Biotech Co., Ltd), lactate dehydrogenase (LDH, ml106660, Shanghai Enzyme-Linked Biotechnology Co., Ltd), atrial natriuretic peptide (ANP, ml106992, Shanghai Enzyme-Linked Biotechnology Co., Ltd), and N-terminal pro–brain natriuretic peptide (NT-Pro BNP, D731098, Shanghai Sangon Biotech Co., Ltd) were measured using an automated biochemical analyzer (BS-240VET, Mindray, Shenzhen, China).

2.6 Westen blotting (WB)

Tissue samples were homogenized in RIPA lysis buffer (P0013B, Beyotime, Shanghai, China) supplemented with protease inhibitors. The protein concentration of each lysate was determined using a BCA protein assay kit (A55860, Thermo Scientific, Shanghai, China) according to the manufacturer’s instructions. Equal amounts of proteins (20 μg per lane) were loaded onto 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis and subsequently transferred to a polyvinylidene fluoride membrane. After blocking with 5% non-fat milk in tris-buffered saline with Tween-20 (TBST) for 1 h at room temperature, the membranes were incubated overnight at 4°C with the following primary antibodies: HMGB1 (1:1,000, A2553; ABclonal, Wuhan, China), RAGE (1:1,000, A23422; ABclonal), IL-1β (1:1,000, A1112; ABclonal), TNF-α (1:1,000, A11534; ABclonal), IL-6 (1:1,000, A0286; ABclonal), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:1,000, ab8245, Abcam, UK) as an internal control. The membranes were washed three times with TBST and then incubated with a horseradish peroxidase-conjugated secondary antibody (1:1,000, AS014; ABclonal) at room temperature for 2 h. Protein bands were visualized using an enhanced chemiluminescence detection system (Amersham Pharmacia, Sweden) and quantified by ImageJ software (NIH, USA).

2.7 Reverse transcription quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted using TRIzol reagent kit (Invitrogen, Carlsbad, CA, USA), and mRNA was converted to cDNA using the EasyScript First-Strand cDNA Synthesis SuperMix (AE301-02, TransGen Biotech). PCR amplification was carried out with the SYBR Green I fluorochrome Pro Taq HS premix qPCR kit (AG11756, Accurate Biotechnology, Changsha, China) following the manufacturer’s guidelines. RT-qPCR analysis was performed using the Applied Biosystems (Foster City, CA, USA) QuantStudio 5 Real-Time PCR system. GAPDH served as the internal control, and the relative expression levels were determined using the 2−ΔΔCt method. Each experiment was performed in triplicate. The primer sequences are shown in Table 1.

Table 1

Primer sequences

Gene Forward primer Reverse primer
HMGB1 AGTGAGGGAGAGAGTGGGTAA GAACACTACAGCCTGCCGAG
RAGE GGGTCACAGAAACCGGTGAT ATCATGTGGGCTCTGGTTGG
IL-1β AGCTTCAGGAAGGCAGTGTC TCAGACAGCACGAGGCATTT
IL-6 CCAGTTGCCTTCTTGGGACT CTGGTCTGTTGTGGGTGGTA
GAPDH GACAGTCAGCCGCATCTTCT GCGCCCAATACGACCAAATC

2.8 Hematoxylin and eosin (HE) staining

HE staining was used to assess the histological structure and pathological injury of the atrial tissue. Left atrial tissues were fixed in 4% paraformaldehyde (P0099, Beyotime, Shanghai, China), dehydrated using gradient ethanol, paraffin-embedded, sectioned at 4 μm, and stained using HE staining (Sigma Aldrich, St. Louis, MO, USA). The stained sections were observed using a light microscope (Leica Microsystems, Wetzlar, Germany).

2.9 Masson’s trichrome staining

Masson’s trichrome staining was performed to evaluate myocardial fibrosis (collagen deposition) in the atrial tissue. Paraffin-embedded left atrial tissues (4 μm) were subjected to Masson’s trichrome staining, followed by examination under an optical microscope (CKX41, Olympus, Tokyo, Japan) at 400× magnification. Collagen volume fraction (CVF) was quantified using ImageJ software in three random fields per section.

2.10 Immunohistochemistry (IHC)

IHC staining for COLI, FGF-2, and α-SMA was conducted on left atrial tissue sections to identify fibrosis-related protein expression. Briefly, samples were fixed, paraffin-embedded, and sectioned into 4 μm thickness. Sections were incubated overnight at 4°C with primary antibodies against COLI (1:1,000, ab270993; Abcam, UK), FGF-2 (1:200, A3908; ABclonal), and α-SMA (1:200, A2235; ABclonal), followed by incubation with a goat anti-rabbit secondary antibody (1:200, AS014; ABclonal) at room temperature for 2 h. DAB (ZY6SK2020; Zeye-BIO, Shanghai, China) was used for visualization and hematoxylin for counterstaining. Staining was observed under a microscope (Nikon, Tokyo, Japan) and analysis using an ImageJ analysis software.

2.11 Statistical analysis

Statistical analyses were performed using GraphPad Prism 9 (Dotmatics, Boston, MA, USA). All data are presented as mean ± standard deviation. Comparisons between two groups were performed using a t-test, whereas one-way analysis of variance with Tukey’s post hoc test was utilized for multiple group comparisons. A p-value of less than 0.05 was considered as statistically significant.

3 Results

3.1 DAPA restores cardiac function in AF rats

Glu levels did not differ significantly among the Control, AF, DAPA-L, DAPA-M, DAPA-H, and AMIO groups. Although Glu concentrations showed a downward trend as DAPA concentrations increased, the differences were not statistically significant (p > 0.05). ECG confirmed successful induction of AF in rats, as rats in the AF group exhibited P wave disappearance, irregular rhythm, and unstable R–R intervals, whereas rats in the Control group displayed regular P waves and a stable sinus rhythm. DAPA treatment led to a dose-dependent suppression of arrhythmic changes, with the DAPA-H group showing the most significant improvement (Figure 2a). Regarding cardiac function, the AF group showed significantly elevated levels of LVESD, LVEDD and LAD, while LVEF and LVFS were markedly decreased (Figure 2b, p < 0.05). Treatment with DAPA (all doses) significantly reduced LVESD, LVEDD, and LAD and improved LVEF and LVFS compared to the AF group, with the most notable effects in the DAPA-H group (p < 0.05). Additionally, the AMIO group demonstrated further enhancement in cardiac function compared to the DAPA-H group (p < 0.05). Biomarkers of cardiac injury (cTnT, CK-MB, ANP, and NT-proBNP) were significantly elevated in the AF group (Figure 2c, p < 0.05). DAPA treatment significantly reduced the levels of these markers in a dose-dependent manner, with the DAPA-H group showing the greatest reduction. The AMIO group displayed even lower levels of these biomarkers than the DAPA-H group (p < 0.05).

Figure 2 Effects of DAPA on restoring cardiac function in AF rats. (a) ECG assessment of AF in rats. (b) Echocardiographic measurements of cardiac function parameters in AF rats (LVESV, LVEDV, LAD, LVEF, LVFS). (c) Biochemical analysis of myocardial injury markers (cTnI, CK-MB, LDH, ANP, NT-pro BNP) in left atrium tissue from AF rats. n = 6. *p < 0.05 vs control, # p < 0.05 vs AF, ^p < 0.05 vs DAPA-H.
Figure 2

Effects of DAPA on restoring cardiac function in AF rats. (a) ECG assessment of AF in rats. (b) Echocardiographic measurements of cardiac function parameters in AF rats (LVESV, LVEDV, LAD, LVEF, LVFS). (c) Biochemical analysis of myocardial injury markers (cTnI, CK-MB, LDH, ANP, NT-pro BNP) in left atrium tissue from AF rats. n = 6. *p < 0.05 vs control, # p < 0.05 vs AF, ^p < 0.05 vs DAPA-H.

3.2 DAPA alleviates myocardial fibrosis in AF rats

HE staining revealed that atrial tissues in the AF group exhibited irregular cell morphology, disordered arrangement, increased interstitial cells, and notable collagen deposition. Additionally, the CVF% was significantly increased, and elevated expression of fibrosis-related proteins COLI, FGF-2, and α-SMA was observed in the AF group (Figure 3a and b, p < 0.05). DAPA treatment led to dose-dependent improvements in myocardial architecture, with more regular morphology, reduced interstitial cells, and diminished fibrosis. The expression of fibrosis-related markers was significantly reduced in all DAPA-treated groups, especially in the DAPA-H group (Figure 3c–e, p < 0.05). AMIO further attenuated myocardial fibrosis compared to the DAPA-H group (p < 0.05).

Figure 3 DAPA alleviates myocardial fibrosis in AF rats. (a) HE staining evaluating pathological damage in the left atrial tissue of AF rats. (b) Masson’s trichrome staining assessing myocardial fibrosis in the left atrium of AF rats. (c–e) IHC staining evaluating the expression of COL1, FGF-2, and α-SMA in left atrial tissue. n = 6. *p < 0.05 vs control. # p < 0.05 vs AF. ^p < 0.05 vs DAPA-H.
Figure 3

DAPA alleviates myocardial fibrosis in AF rats. (a) HE staining evaluating pathological damage in the left atrial tissue of AF rats. (b) Masson’s trichrome staining assessing myocardial fibrosis in the left atrium of AF rats. (c–e) IHC staining evaluating the expression of COL1, FGF-2, and α-SMA in left atrial tissue. n = 6. *p < 0.05 vs control. # p < 0.05 vs AF. ^p < 0.05 vs DAPA-H.

3.3 DAPA curtails the activity of HMGB1/RAGE pathway

The AF group exhibited significantly elevated levels of HMGB1, RAGE, IL-1β, and IL-6 compared to the control group (p < 0.05). DAPA administration resulted in a dose-dependent reduction in these inflammatory markers, with the DAPA-H group showing the most pronounced effect (Figure 4a, p < 0.05). AMIO also suppressed HMGB1/RAGE pathway-related proteins more effectively than DAPA-H.

Figure 4 DAPA suppresses the activity of the HMGB1/RAGE inflammatory pathway. (a) WB analysis of the expression levels of HMGB1, RAGE, IL-1β, and IL-6 in left atrial tissues. n = 6. *p < 0.05 vs control. # p < 0.05 vs AF. ^p < 0.05 vs DAPA-H.
Figure 4

DAPA suppresses the activity of the HMGB1/RAGE inflammatory pathway. (a) WB analysis of the expression levels of HMGB1, RAGE, IL-1β, and IL-6 in left atrial tissues. n = 6. *p < 0.05 vs control. # p < 0.05 vs AF. ^p < 0.05 vs DAPA-H.

3.4 HMGB1/RAGE pathway contributes to the cardioprotective effects of DAPA

ECG and echocardiographic data showed that AF rats developed significant arrhythmias, along with increased LVESD, LVEDD, and LAD, and reduced LVEF and LVFS (Figure 5a and b, p < 0.05). Arrhythmic changes and cardiac dysfunction were further exacerbated in the LPS group, as evidenced by more upregulated LVESD, LVEDD, and LAD as well as further downregulated LVEF and LVFS (p < 0.05). DAPA treatment partially restored cardiac function in the presence of LPS, while the addition of FPS-ZM1 to the LPS + DAPA group further enhanced cardiac function restoration (p < 0.05). Cardiac injury biomarkers (cTnI, CK-MB, ANP, NT-proBNP) were significantly elevated in the AF and LPS groups, indicating myocardial damage (Figure 5c, p < 0.05). DAPA significantly reduced these markers, although levels rose again in the LPS + DAPA group. Co-administration of FPS-ZM1 led to further reductions in injury markers, confirming enhanced cardioprotection via RAGE inhibition (p < 0.05).

Figure 5 DAPA improves AF-induced cardiac dysfunction by inhibiting the HMGB1/RAGE pathway. (a) ECG assessing the degree of AF in rats. (b) Echocardiographic assessment of cardiac function indices, including LVESD, LVEDD, LAD, LVEF, and LVFS in left atrial tissues. (c) Biochemical analysis of myocardial injury markers (cTnI, CK-MB, LDH, ANP, NT-proBNP) in blood samples. n = 6. *p < 0.05 vs control. # p < 0.05 vs AF. ^p < 0.05 vs DAPA. – p < 0.05 vs LPS + DAPA.
Figure 5

DAPA improves AF-induced cardiac dysfunction by inhibiting the HMGB1/RAGE pathway. (a) ECG assessing the degree of AF in rats. (b) Echocardiographic assessment of cardiac function indices, including LVESD, LVEDD, LAD, LVEF, and LVFS in left atrial tissues. (c) Biochemical analysis of myocardial injury markers (cTnI, CK-MB, LDH, ANP, NT-proBNP) in blood samples. n = 6. *p < 0.05 vs control. # p < 0.05 vs AF. ^p < 0.05 vs DAPA. – p < 0.05 vs LPS + DAPA.

3.5 DAPA mitigates AF-induced myocardial fibrosis through inhibition of the HMGB1/RAGE pathway

Myocardial fibrosis was more severe in the AF group than in the control group, with increased interstitial cells, disordered myocardial arrangement, and higher expression of COL I, FGF-2, and α-SMA (Figure 6a, p < 0.05). Myocardial fibrosis was further worsened in the LPS group compared to the AF group, indicating HMGB1-mediated enhancement of fibrosis (Figure 6b, p < 0.05). In contrast, DAPA treatment reduced fibrosis markers, particularly in the DAPA-H group (Figure 6c, p < 0.05). In the LPS + DAPA group, fibrosis was partially mitigated by DAPA, despite ongoing HMGB1 activation (Figure 6d, p < 0.05). Additionally, FPS-ZM1 co-treatment further suppressed fibrosis markers, suggesting synergistic inhibition of HMGB1/RAGE signaling (Figure 6e, p < 0.05).

Figure 6 DAPA ameliorates AF-induced myocardial fibrosis by inhibiting the HMGB1/RAGE pathway. (a) HE staining for assessing pathological damage in left atrial tissues. (b) Masson’s trichrome staining assessing myocardial fibrosis in the left atrium. (c–e) IHC staining evaluating the expression of COL1, FGF-2, and α-SMA in left atrial tissues. n = 6. *p < 0.05 vs control. # p < 0.05 vs AF. ^p < 0.05 vs DAPA. – p < 0.05 vs LPS + DAPA.
Figure 6

DAPA ameliorates AF-induced myocardial fibrosis by inhibiting the HMGB1/RAGE pathway. (a) HE staining for assessing pathological damage in left atrial tissues. (b) Masson’s trichrome staining assessing myocardial fibrosis in the left atrium. (c–e) IHC staining evaluating the expression of COL1, FGF-2, and α-SMA in left atrial tissues. n = 6. *p < 0.05 vs control. # p < 0.05 vs AF. ^p < 0.05 vs DAPA. – p < 0.05 vs LPS + DAPA.

3.6 DAPA reduces AF-induced myocardial inflammation via suppression of the HMGB1/RAGE pathway

The AF group exhibited significantly elevated levels of HMGB1, RAGE, IL-1β, and IL-6, confirming an inflammatory response (p < 0.05). These markers were further elevated in the LPS group (Figure 7a, p < 0.05). DAPA significantly suppressed the expression of HMGB1, RAGE, IL-1β, and IL-6, which suggests that DAPA inhibits the HMGB1/RAGE pathway and mitigates the inflammatory response induced by AF (Figure 7b, p < 0.05). In the LPS + DAPA group, inflammation persisted but was partially reduced by DAPA. Co-administration of FPS-ZM1 in the LPS + DAPA + FPS-ZM1 group led to further reductions, indicating enhanced anti-inflammatory effects through RAGE inhibition (p < 0.05).

Figure 7 Effect of DAPA on myocardial inflammation in AF via the HMGB1/RAGE pathway. (a) and b) Expression levels of HMGB1, RAGE, IL-1β, and IL-6 in tissue measured by WB and RT-qPCR. n = 6. *p < 0.05 vs control. # p < 0.05 vs AF. ^p < 0.05 vs DAPA. – p < 0.05 vs LPS + DAPA.
Figure 7

Effect of DAPA on myocardial inflammation in AF via the HMGB1/RAGE pathway. (a) and b) Expression levels of HMGB1, RAGE, IL-1β, and IL-6 in tissue measured by WB and RT-qPCR. n = 6. *p < 0.05 vs control. # p < 0.05 vs AF. ^p < 0.05 vs DAPA. – p < 0.05 vs LPS + DAPA.

4 Discussion

DAPA, a SGLT2 inhibitor, has emerged as a therapeutic agent of considerable interest due to its proven efficacy in diabetes and cardiovascular diseases [26,27]. However, its therapeutic potential and underlying mechanisms in AF remain insufficiently understood. To address this gap, we employed a rat model of AF to systematically evaluate DAPA’s effects on cardiac function, myocardial fibrosis, and inflammation, and found that DAPA exerts its cardioprotective actions in part by inhibiting the HMGB1/RAGE signaling pathway. These findings provide mechanistic insight and a potential translational framework for DAPA use in AF.

In our AF rat models, we observed significant cardiac dysfunction, characterized by increased LVESD, LVEDD, LAD, cTnT, CK-MB, ANP, and NT-proBNP, as well as decreased LVEF and LVFS, indicating marked aggravation of structural and functional remodeling. DAPA treatment significantly improved cardiac function in AF rats. ECG and echocardiographic analyses showed that high-dose DAPA (DAPA-H) reduced structural indices such as LVESD, LVEDD, and LAD, while restoring LVEF and LVFS. These results are consistent with studies demonstrating SGLT2 inhibitors’ protective effects in cardiovascular models independent of diabetes, such as ischemic cardiomyopathy, where benefits are attributed to improved myocardial energetics and reduced oxidative stress [28].

In terms of fibrosis, AF rats exhibited elevated CVF and increased expression of fibrotic markers such as COL1, FGF-2, and α-SMA. DAPA treatment reversed these fibrotic changes in a dose-dependent manner. Consistently, several studies have reported that DAPA can reduce the expression of cardiac inflammatory factors and fibrosis markers, with potential mechanisms involving the NLRP3 inflammasome and TGF-β/Smad pathways [29,30]. These findings also align with prior studies showing that SGLT2 inhibitors reduce ventricular fibrosis in pressure overload models [31], and our work extends this antifibrotic potential to AF. DAPA also demonstrated robust anti-inflammatory effects. It dose-dependently downregulated HMGB1, RAGE, and pro-inflammatory cytokines including IL-1β, TNF-α, and IL-6. HMGB1, a nuclear DAMP protein, translocates to the extracellular space under stress, activating RAGE and triggering NF-κB-mediated inflammatory signaling [32]. Moreover, HMGB1 remains persistently elevated in various cardiovascular diseases, including AF, and plays a particularly prominent role in atrial structural remodeling [8,33,34]. Our results suggested that DAPA’s anti-inflammatory action may involve interference with HMGB1-RAGE interaction, rather than HMGB1 suppression itself. This is supported by the finding that combined treatment with DAPA and FPS-ZM1 further reduced RAGE and cytokine levels without significantly altering HMGB1 expression. This aligns with structural studies proposing that SGLT2 inhibitors may hinder ligand-receptor interactions via steric or allosteric mechanisms [35,36,37], though this hypothesis warrants further molecular validation.

Although AMIO demonstrated greater efficacy in the direct improvement of certain cardiac functional parameters in our study, accumulating evidence highlights several unique advantages of DAPA in the management of patients with AF, particularly those with complex comorbidities. DAPA is generally well tolerated, and unlike AMIO, which is often limited by adverse effects such as thyroid dysfunction, pulmonary fibrosis, and hepatotoxicity DAPA is typically suitable for long-term use, especially in patients with heart failure or diabetes [38,39,40]. In addition, DAPA has been shown to reduce major cardiovascular events and provide renal protection in large clinical trials involving patients with chronic kidney disease and heart failure [41]. These broader benefits are rarely observed with traditional antiarrhythmic agents. Furthermore, recent studies suggest that DAPA and other SGLT2 inhibitors may exert antiarrhythmic effects via multi-pathway mechanisms, including the regulation of HMGB1/RAGE and TGF-β/Smad signaling [42,43], indicating integrated cardiovascular benefits beyond arrhythmia control alone. Nevertheless, it is important to acknowledge that, despite its relatively good safety profile, DAPA may be associated with adverse effects such as genitourinary infections and euglycemic diabetic ketoacidosis, particularly among susceptible populations [44,45]. These side effects are generally infrequent and manageable, but clinicians should remain vigilant and conduct individualized risk-benefit assessments when considering DAPA for AF patients. Further long-term and real-world studies are warranted to fully clarify the safety profile of SGLT2 inhibitors in diverse patient populations.

It should be noted that there is a current consensus that persistent activation of inflammation is a key driving force in the development of myocardial fibrosis. Our study also observed that inflammatory and fibrotic markers were simultaneously and significantly elevated in the AF group, indicating a close association between the two processes. However, the specific temporal and causal dynamics between inflammation and fibrosis in AF-associated fibrosis remain incompletely clarified. Some basic studies suggest that inflammation activation usually precedes collagen deposition, while the persistence of inflammation contributes to the progression of fibrosis [46,47]. As our study was based on data from a single time point, it could not dynamically illustrate the spatiotemporal evolution of the inflammation-fibrosis process. Therefore, future studies are recommended to employ multi-time-point tracking to more precisely elucidate their interactions.

5 Conclusion

This study demonstrated that DAPA treatment significantly reduced myocardial fibrosis, restored cardiac function, and inhibited the HMGB1/RAGE signaling activity in AF.

  1. Funding information: This research is supported by Hunan Provincial Natural Science Foundation Project (Regional Joint Fund) (2023JJ50278).

  2. Author contributions: All authors have accepted responsibility for the entire content of this manuscript and consented to its submission to the journal, reviewed all the results, and approved the final version of the manuscript. Zhenni Tan and Jianxiang Chang designed the experiments and Yin Li carried them out. Xiang Sun and Fanxiang Liu collected and analyzed the data. Yang Chen and Lin Pan prepared the manuscript with contributions from all co-authors.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Saleh K, Haldar S. Atrial fibrillation: a contemporary update. Clin Med (Lond). 2023;23(5):437–41.10.7861/clinmed.2023-23.5.Cardio2Search in Google Scholar PubMed PubMed Central

[2] Erhard N, Metzner A, Fink T. Late arrhythmia recurrence after atrial fibrillation ablation: incidence, mechanisms and clinical implications. Herzschr Elektrophysiol. 2022;33(1):71–6.10.1007/s00399-021-00836-6Search in Google Scholar PubMed PubMed Central

[3] Bell A, Andrade JG, Macle L, Connelly KA, LaBine L, Singer AG. Approach to atrial fibrillation: Essentials for primary care. Can Fam Physician. 2023;69(4):245–56.10.46747/cfp.6904245Search in Google Scholar PubMed PubMed Central

[4] Capucci A, Reiffel JA. Atrial fibrillation progression: another step in the RACE to full understanding. Europace. 2023;25(5):1–3.10.1093/europace/euad071Search in Google Scholar PubMed PubMed Central

[5] Schnabel RB, Ameri P, Siller-Matula JM, Diemberger I, Gwechenberger M, Pecen L, et al. Outcomes of patients with atrial fibrillation on oral anticoagulation with and without heart failure: the ETNA-AF-Europe registry. Europace. 2023;25(9):1–12.10.1093/europace/euad280Search in Google Scholar PubMed PubMed Central

[6] Uehara H, Gunji T. Differentiation between Takotsubo syndrome and coronary spastic angina in subjects undergoing catheter ablation for atrial fibrillation. J Arrhythm. 2023;39(5):838.10.1002/joa3.12908Search in Google Scholar PubMed PubMed Central

[7] Benali K, Khairy P, Hammache N, Petzl A, Da Costa A, Verma A, et al. Procedure-related complications of catheter ablation for atrial fibrillation. J Am Coll Cardiol. 2023;81(21):2089–99.10.1016/j.jacc.2023.03.418Search in Google Scholar PubMed

[8] Karakasis P, Theofilis P, Vlachakis PK, Korantzopoulos P, Patoulias D, Antoniadis AP, et al. Atrial fibrosis in atrial fibrillation: mechanistic insights, diagnostic challenges, and emerging therapeutic targets. Int J Mol Sci. 2024;26(1):209.10.3390/ijms26010209Search in Google Scholar PubMed PubMed Central

[9] Pozios I, Vouliotis AI, Dilaveris P, Tsioufis C. Electro-mechanical alterations in atrial fibrillation: Structural, electrical, and functional correlates. J Cardiovasc Dev Dis. 2023;10(4):149.10.3390/jcdd10040149Search in Google Scholar PubMed PubMed Central

[10] Fu F, Pietropaolo M, Cui L, Pandit S, Li W, Tarnavski O, et al. Lack of authentic atrial fibrillation in commonly used murine atrial fibrillation models. PLoS One. 2022;17(1):e0256512.10.1371/journal.pone.0256512Search in Google Scholar PubMed PubMed Central

[11] Zhu L, Wang Y, Zhao S, Lu M. Detection of myocardial fibrosis: Where we stand. Front Cardiovasc Med. 2022;9:926378.10.3389/fcvm.2022.926378Search in Google Scholar PubMed PubMed Central

[12] Dhillon S. Dapagliflozin: A review in type 2 diabetes. Drugs. 2019;79(10):1135–46.10.1007/s40265-019-01148-3Search in Google Scholar PubMed PubMed Central

[13] Arow M, Waldman M, Yadin D, Nudelman V, Shainberg A, Abraham NG, et al. Sodium-glucose cotransporter 2 inhibitor Dapagliflozin attenuates diabetic cardiomyopathy. Cardiovasc Diabetol. 2020;19(1):7.10.1186/s12933-019-0980-4Search in Google Scholar PubMed PubMed Central

[14] Wu J, Liu T, Shi S, Fan Z, Hiram R, Xiong F, et al. Dapagliflozin reduces the vulnerability of rats with pulmonary arterial hypertension-induced right heart failure to ventricular arrhythmia by restoring calcium handling. Cardiovasc Diabetol. 2022;21(1):197.10.1186/s12933-022-01614-5Search in Google Scholar PubMed PubMed Central

[15] Abd Elmaaboud MA, Estfanous RS, Atef A, Kabel AM, Alnemari KA, Naguib TM, et al. Dapagliflozin/hesperidin combination mitigates lipopolysaccharide-induced Alzheimer’s disease in rats. Pharmaceuticals (Basel). 2023;16(10).10.3390/ph16101370Search in Google Scholar PubMed PubMed Central

[16] Yuan Y, Sun M, Jin Z, Zheng C, Ye H, Weng H. Dapagliflozin ameliorates diabetic renal injury through suppressing the self-perpetuating cycle of inflammation mediated by HMGB1 feedback signaling in the kidney. Eur J Pharmacol. 2023;943:175560.10.1016/j.ejphar.2023.175560Search in Google Scholar PubMed

[17] Arab HH, Al-Shorbagy MY, Saad MA. Activation of autophagy and suppression of apoptosis by dapagliflozin attenuates experimental inflammatory bowel disease in rats: Targeting AMPK/mTOR, HMGB1/RAGE and Nrf2/HO-1 pathways. Chem Biol Interact. 2021;335:109368.10.1016/j.cbi.2021.109368Search in Google Scholar PubMed

[18] Amornsupak K, Thongchot S, Thinyakul C, Box C, Hedayat S, Thuwajit P, et al. HMGB1 mediates invasion and PD-L1 expression through RAGE-PI3K/AKT signaling pathway in MDA-MB-231 breast cancer cells. BMC Cancer. 2022;22(1):578.10.1186/s12885-022-09675-1Search in Google Scholar PubMed PubMed Central

[19] Su C, Jia S, Ma Z, Zhang H, Wei L, Liu H. HMGB1 promotes lymphangiogenesis through the activation of RAGE on M2 macrophages in laryngeal squamous cell carcinoma. Dis Markers. 2022;2022:4487435.10.1155/2022/4487435Search in Google Scholar PubMed PubMed Central

[20] Zhang D, Wu C, Ba D, Wang N, Wang Y, Li X, et al. Ferroptosis contribute to neonicotinoid imidacloprid-evoked pyroptosis by activating the HMGB1-RAGE/TLR4-NF-kappaB signaling pathway. Ecotoxicol Environ Saf. 2023;253:114655.10.1016/j.ecoenv.2023.114655Search in Google Scholar PubMed

[21] Gkouveris I, Hadaya D, Elzakra N, Soundia A, Bezouglaia O, Dry SM, et al. Inhibition of HMGB1/RAGE signaling reduces the incidence of medication-related osteonecrosis of the jaw (MRONJ) in mice. J Bone Min Res. 2022;37(9):1775–86.10.1002/jbmr.4637Search in Google Scholar PubMed PubMed Central

[22] Wang J, Zhang Q, Yao L, He T, Chen X, Su Y, et al. Modulating activity of PVN neurons prevents atrial fibrillation induced circulation dysfunction by electroacupuncture at BL15. Chin Med. 2023;18(1):135.10.1186/s13020-023-00841-6Search in Google Scholar PubMed PubMed Central

[23] Zhao X, Liu Y, Han X, Wang X, Qu C, Liu X, et al. Dapagliflozin attenuates the vulnerability to atrial fibrillation in rats with lipopolysaccharide-induced myocardial injury. Int Immunopharmacol. 2023;125(Pt A):111038.10.1016/j.intimp.2023.111038Search in Google Scholar PubMed

[24] Parent S, Amant JS, Remortel SV, Kahn S, Vaka R, Courtman D, et al. Atrial fibrosis and inflammation in postoperative atrial fibrillation: Comparative effects of amiodarone, colchicine, or exosomes. JACC Clin Electrophysiol. 2024;10(6):1037–49.10.1016/j.jacep.2024.02.019Search in Google Scholar PubMed

[25] Wang G, Jin S, Huang W, Li Y, Wang J, Ling X, et al. LPS-induced macrophage HMGB1-loaded extracellular vesicles trigger hepatocyte pyroptosis by activating the NLRP3 inflammasome. Cell Death Discov. 2021;7(1):337.10.1038/s41420-021-00729-0Search in Google Scholar PubMed PubMed Central

[26] Talha KM, Anker SD, Butler J. SGLT-2 inhibitors in heart failure: a review of current evidence. Int J Heart Fail. 2023;5(2):82–90.10.36628/ijhf.2022.0030Search in Google Scholar PubMed PubMed Central

[27] Fu Q, Zhou L, Fan Y, Liu F, Fan Y, Zhang X, et al. Effect of SGLT-2 inhibitor, dapagliflozin, on left ventricular remodeling in patients with type 2 diabetes and HFrEF. BMC Cardiovasc Disord. 2023;23(1):544.10.1186/s12872-023-03591-3Search in Google Scholar PubMed PubMed Central

[28] Jhund PS, Kondo T, Butt JH, Docherty KF, Claggett BL, Desai AS, et al. Dapagliflozin across the range of ejection fraction in patients with heart failure: a patient-level, pooled meta-analysis of DAPA-HF and DELIVER. Nat Med. 2022;28(9):1956–64.10.1038/s41591-022-01971-4Search in Google Scholar PubMed PubMed Central

[29] Chen X, Yang Q, Bai W, Yao W, Liu L, Xing Y, et al. Dapagliflozin attenuates myocardial fibrosis by inhibiting the TGF-beta1/Smad signaling pathway in a normoglycemic rabbit model of chronic heart failure. Front Pharmacol. 2022;13:873108.10.3389/fphar.2022.873108Search in Google Scholar PubMed PubMed Central

[30] Tian J, Zhang M, Suo M, Liu D, Wang X, Liu M, et al. Dapagliflozin alleviates cardiac fibrosis through suppressing EndMT and fibroblast activation via AMPKalpha/TGF-beta/Smad signalling in type 2 diabetic rats. J Cell Mol Med. 2021;25(16):7642–59.10.1111/jcmm.16601Search in Google Scholar PubMed PubMed Central

[31] Chen X, Hocher CF, Shen L, Kramer BK, Hocher B. Reno- and cardioprotective molecular mechanisms of SGLT2 inhibitors beyond glycemic control: from bedside to bench. Am J Physiol Cell Physiol. 2023;325(3):C661–81.10.1152/ajpcell.00177.2023Search in Google Scholar PubMed

[32] Bangert A, Andrassy M, Muller AM, Bockstahler M, Fischer A, Volz CH, et al. Critical role of RAGE and HMGB1 in inflammatory heart disease. Proc Natl Acad Sci U S A. 2016;113(2):E155–64.10.1073/pnas.1522288113Search in Google Scholar PubMed PubMed Central

[33] Wang B, Jiang T, Qi Y, Luo S, Xia Y, Lang B, et al. AGE-RAGE axis and cardiovascular diseases: pathophysiologic mechanisms and prospects for clinical applications. Cardiovasc Drugs Ther. 2024. 10.1007/s10557-024-07639-0.Search in Google Scholar PubMed

[34] Wang X, Chen L, Wei J, Zheng H, Zhou N, Xu X, et al. The immune system in cardiovascular diseases: from basic mechanisms to therapeutic implications. Signal Transduct Target Ther. 2025;10(1):166.10.1038/s41392-025-02220-zSearch in Google Scholar PubMed PubMed Central

[35] Rykova EY, Klimontov VV, Shmakova E, Korbut AI, Merkulova TI, Kzhyshkowska J. Anti-inflammatory effects of SGLT2 inhibitors: Focus on macrophages. Int J Mol Sci. 2025;26(4):1670.10.3390/ijms26041670Search in Google Scholar PubMed PubMed Central

[36] Xu Y, Zhang C, Jiang K, Yang X, Chen F, Cheng Z, et al. Structural repurposing of SGLT2 inhibitor empagliflozin for strengthening anti-heart failure activity with lower glycosuria. Acta Pharm Sin B. 2023;13(4):1671–85.10.1016/j.apsb.2022.08.023Search in Google Scholar PubMed PubMed Central

[37] Alsereidi FR, Khashim Z, Marzook H, Gupta A, Al-Rawi AM, Ramadan MM, et al. Targeting inflammatory signaling pathways with SGLT2 inhibitors: Insights into cardiovascular health and cardiac cell improvement. Curr Probl Cardiol. 2024;49(5):102524.10.1016/j.cpcardiol.2024.102524Search in Google Scholar PubMed

[38] Martinez FA, Serenelli M, Nicolau JC, Petrie MC, Chiang CE, Tereshchenko S, et al. Efficacy and safety of dapagliflozin in heart failure with reduced ejection fraction according to age: insights from DAPA-HF. Circulation. 2020;141(2):100–11.10.1161/CIRCULATIONAHA.119.044133Search in Google Scholar PubMed

[39] Vart P, Butt JH, Jongs N, Schechter M, Chertow GM, Wheeler DC, et al. Efficacy and safety of dapagliflozin in patients with chronic kidney disease across the spectrum of frailty. J Gerontol A Biol Sci Med Sci. 2024;79(2):1–10.10.1093/gerona/glad181Search in Google Scholar PubMed PubMed Central

[40] You HS, Yoon JH, Cho SB, Choi YD, Kim YH, Choi W, et al. Amiodarone-induced multi-systemic toxicity involving the liver, lungs, thyroid, and eyes: a case report. Front Cardiovasc Med. 2022;9:839441.10.3389/fcvm.2022.839441Search in Google Scholar PubMed PubMed Central

[41] Chertow GM, Correa-Rotter R, Vart P, Jongs N, McMurray JJV, Rossing P, et al. Effects of dapagliflozin in chronic kidney disease, with and without other cardiovascular medications: DAPA-CKD trial. J Am Heart Assoc. 2023;12(9):e028739.10.1161/JAHA.122.028739Search in Google Scholar PubMed PubMed Central

[42] Duan HY, Barajas-Martinez H, Antzelevitch C, Hu D. The potential anti-arrhythmic effect of SGLT2 inhibitors. Cardiovasc Diabetol. 2024;23(1):252.10.1186/s12933-024-02312-0Search in Google Scholar PubMed PubMed Central

[43] Rolski F, Maczewski M. Cardiac fibrosis: mechanistic discoveries linked to SGLT2 inhibitors. Pharmaceuticals (Basel). 2025;18(3):313.10.3390/ph18030313Search in Google Scholar PubMed PubMed Central

[44] Zhou Z, Yao X. Safety assessment of dapagliflozin: Real-world adverse event analysis based on the FAERS database from 2012 to 2023. Heliyon. 2024;10(12):e33306.10.1016/j.heliyon.2024.e33306Search in Google Scholar PubMed PubMed Central

[45] Gorgojo-Martinez JJ, Gorriz JL, Cebrian-Cuenca A, Castro Conde A, Velasco Arribas M. Clinical recommendations for managing genitourinary adverse effects in patients treated with SGLT-2 inhibitors: a multidisciplinary expert consensus. J Clin Med. 2024;13(21):6509.10.3390/jcm13216509Search in Google Scholar PubMed PubMed Central

[46] Ariyama N, Aguero B, Valdes V, Berrios F, Bucarey S, Mor S, et al. Update of genetic diversity of porcine circovirus type 2 in Chile evidences the emergence of PCV2d genotype. Front Vet Sci. 2021;8:789491.10.3389/fvets.2021.789491Search in Google Scholar PubMed PubMed Central

[47] Colpani V, Soares Falcetta F, Bacelo Bidinotto A, Kops NL, Falavigna M, Serpa Hammes L, et al. Prevalence of human papillomavirus (HPV) in Brazil: A systematic review and meta-analysis. PLoS One. 2020;15(2):e0229154.10.1371/journal.pone.0229154Search in Google Scholar PubMed PubMed Central

Received: 2025-02-21
Revised: 2025-06-18
Accepted: 2025-07-20
Published Online: 2025-09-08

© 2025 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Mechanism of triptolide regulating proliferation and apoptosis of hepatoma cells by inhibiting JAK/STAT pathway
  3. Maslinic acid improves mitochondrial function and inhibits oxidative stress and autophagy in human gastric smooth muscle cells
  4. Comparative analysis of inflammatory biomarkers for the diagnosis of neonatal sepsis: IL-6, IL-8, SAA, CRP, and PCT
  5. Post-pandemic insights on COVID-19 and premature ovarian insufficiency
  6. Proteome differences of dental stem cells between permanent and deciduous teeth by data-independent acquisition proteomics
  7. Optimizing a modified cetyltrimethylammonium bromide protocol for fungal DNA extraction: Insights from multilocus gene amplification
  8. Preliminary analysis of the role of small hepatitis B surface proteins mutations in the pathogenesis of occult hepatitis B infection via the endoplasmic reticulum stress-induced UPR-ERAD pathway
  9. Efficacy of alginate-coated gold nanoparticles against antibiotics-resistant Staphylococcus and Streptococcus pathogens of acne origins
  10. Battling COVID-19 leveraging nanobiotechnology: Gold and silver nanoparticle–B-escin conjugates as SARS-CoV-2 inhibitors
  11. Neurodegenerative diseases and neuroinflammation-induced apoptosis
  12. Impact of fracture fixation surgery on cognitive function and the gut microbiota in mice with a history of stroke
  13. COLEC10: A potential tumor suppressor and prognostic biomarker in hepatocellular carcinoma through modulation of EMT and PI3K-AKT pathways
  14. High-temperature requirement serine protease A2 inhibitor UCF-101 ameliorates damaged neurons in traumatic brain-injured rats by the AMPK/NF-κB pathway
  15. SIK1 inhibits IL-1β-stimulated cartilage apoptosis and inflammation in vitro through the CRTC2/CREB1 signaling
  16. Rutin–chitooligosaccharide complex: Comprehensive evaluation of its anti-inflammatory and analgesic properties in vitro and in vivo
  17. Knockdown of Aurora kinase B alleviates high glucose-triggered trophoblast cells damage and inflammation during gestational diabetes
  18. Calcium-sensing receptors promoted Homer1 expression and osteogenic differentiation in bone marrow mesenchymal stem cells
  19. ABI3BP can inhibit the proliferation, invasion, and epithelial–mesenchymal transition of non-small-cell lung cancer cells
  20. Changes in blood glucose and metabolism in hyperuricemia mice
  21. Rapid detection of the GJB2 c.235delC mutation based on CRISPR-Cas13a combined with lateral flow dipstick
  22. IL-11 promotes Ang II-induced autophagy inhibition and mitochondrial dysfunction in atrial fibroblasts
  23. Short-chain fatty acid attenuates intestinal inflammation by regulation of gut microbial composition in antibiotic-associated diarrhea
  24. Application of metagenomic next-generation sequencing in the diagnosis of pathogens in patients with diabetes complicated by community-acquired pneumonia
  25. NAT10 promotes radiotherapy resistance in non-small cell lung cancer by regulating KPNB1-mediated PD-L1 nuclear translocation
  26. Phytol-mixed micelles alleviate dexamethasone-induced osteoporosis in zebrafish: Activation of the MMP3–OPN–MAPK pathway-mediating bone remodeling
  27. Association between TGF-β1 and β-catenin expression in the vaginal wall of patients with pelvic organ prolapse
  28. Primary pleomorphic liposarcoma involving bilateral ovaries: Case report and literature review
  29. Effects of de novo donor-specific Class I and II antibodies on graft outcomes after liver transplantation: A pilot cohort study
  30. Sleep architecture in Alzheimer’s disease continuum: The deep sleep question
  31. Ephedra fragilis plant extract: A groundbreaking corrosion inhibitor for mild steel in acidic environments – electrochemical, EDX, DFT, and Monte Carlo studies
  32. Langerhans cell histiocytosis in an adult patient with upper jaw and pulmonary involvement: A case report
  33. Inhibition of mast cell activation by Jaranol-targeted Pirin ameliorates allergic responses in mouse allergic rhinitis
  34. Aeromonas veronii-induced septic arthritis of the hip in a child with acute lymphoblastic leukemia
  35. Clusterin activates the heat shock response via the PI3K/Akt pathway to protect cardiomyocytes from high-temperature-induced apoptosis
  36. Research progress on fecal microbiota transplantation in tumor prevention and treatment
  37. Low-pressure exposure influences the development of HAPE
  38. Stigmasterol alleviates endplate chondrocyte degeneration through inducing mitophagy by enhancing PINK1 mRNA acetylation via the ESR1/NAT10 axis
  39. AKAP12, mediated by transcription factor 21, inhibits cell proliferation, metastasis, and glycolysis in lung squamous cell carcinoma
  40. Association between PAX9 or MSX1 gene polymorphism and tooth agenesis risk: A meta-analysis
  41. A case of bloodstream infection caused by Neisseria gonorrhoeae
  42. Case of nasopharyngeal tuberculosis complicated with cervical lymph node and pulmonary tuberculosis
  43. p-Cymene inhibits pro-fibrotic and inflammatory mediators to prevent hepatic dysfunction
  44. GFPT2 promotes paclitaxel resistance in epithelial ovarian cancer cells via activating NF-κB signaling pathway
  45. Transfer RNA-derived fragment tRF-36 modulates varicose vein progression via human vascular smooth muscle cell Notch signaling
  46. RTA-408 attenuates the hepatic ischemia reperfusion injury in mice possibly by activating the Nrf2/HO-1 signaling pathway
  47. Decreased serum TIMP4 levels in patients with rheumatoid arthritis
  48. Sirt1 protects lupus nephritis by inhibiting the NLRP3 signaling pathway in human glomerular mesangial cells
  49. Sodium butyrate aids brain injury repair in neonatal rats
  50. Interaction of MTHFR polymorphism with PAX1 methylation in cervical cancer
  51. Convallatoxin inhibits proliferation and angiogenesis of glioma cells via regulating JAK/STAT3 pathway
  52. The effect of the PKR inhibitor, 2-aminopurine, on the replication of influenza A virus, and segment 8 mRNA splicing
  53. Effects of Ire1 gene on virulence and pathogenicity of Candida albicans
  54. Small cell lung cancer with small intestinal metastasis: Case report and literature review
  55. GRB14: A prognostic biomarker driving tumor progression in gastric cancer through the PI3K/AKT signaling pathway by interacting with COBLL1
  56. 15-Lipoxygenase-2 deficiency induces foam cell formation that can be restored by salidroside through the inhibition of arachidonic acid effects
  57. FTO alleviated the diabetic nephropathy progression by regulating the N6-methyladenosine levels of DACT1
  58. Clinical relevance of inflammatory markers in the evaluation of severity of ulcerative colitis: A retrospective study
  59. Zinc valproic acid complex promotes osteoblast differentiation and exhibits anti-osteoporotic potential
  60. Primary pulmonary synovial sarcoma in the bronchial cavity: A case report
  61. Metagenomic next-generation sequencing of alveolar lavage fluid improves the detection of pulmonary infection
  62. Uterine tumor resembling ovarian sex cord tumor with extensive rhabdoid differentiation: A case report
  63. Genomic analysis of a novel ST11(PR34365) Clostridioides difficile strain isolated from the human fecal of a CDI patient in Guizhou, China
  64. Effects of tiered cardiac rehabilitation on CRP, TNF-α, and physical endurance in older adults with coronary heart disease
  65. Changes in T-lymphocyte subpopulations in patients with colorectal cancer before and after acupoint catgut embedding acupuncture observation
  66. Modulating the tumor microenvironment: The role of traditional Chinese medicine in improving lung cancer treatment
  67. Alterations of metabolites related to microbiota–gut–brain axis in plasma of colon cancer, esophageal cancer, stomach cancer, and lung cancer patients
  68. Research on individualized drug sensitivity detection technology based on bio-3D printing technology for precision treatment of gastrointestinal stromal tumors
  69. CEBPB promotes ulcerative colitis-associated colorectal cancer by stimulating tumor growth and activating the NF-κB/STAT3 signaling pathway
  70. Oncolytic bacteria: A revolutionary approach to cancer therapy
  71. A de novo meningioma with rapid growth: A possible malignancy imposter?
  72. Diagnosis of secondary tuberculosis infection in an asymptomatic elderly with cancer using next-generation sequencing: Case report
  73. Hesperidin and its zinc(ii) complex enhance osteoblast differentiation and bone formation: In vitro and in vivo evaluations
  74. Research progress on the regulation of autophagy in cardiovascular diseases by chemokines
  75. Anti-arthritic, immunomodulatory, and inflammatory regulation by the benzimidazole derivative BMZ-AD: Insights from an FCA-induced rat model
  76. Immunoassay for pyruvate kinase M1/2 as an Alzheimer’s biomarker in CSF
  77. The role of HDAC11 in age-related hearing loss: Mechanisms and therapeutic implications
  78. Evaluation and application analysis of animal models of PIPNP based on data mining
  79. Therapeutic approaches for liver fibrosis/cirrhosis by targeting pyroptosis
  80. Fabrication of zinc oxide nanoparticles using Ruellia tuberosa leaf extract induces apoptosis through P53 and STAT3 signalling pathways in prostate cancer cells
  81. Haplo-hematopoietic stem cell transplantation and immunoradiotherapy for severe aplastic anemia complicated with nasopharyngeal carcinoma: A case report
  82. Modulation of the KEAP1-NRF2 pathway by Erianin: A novel approach to reduce psoriasiform inflammation and inflammatory signaling
  83. The expression of epidermal growth factor receptor 2 and its relationship with tumor-infiltrating lymphocytes and clinical pathological features in breast cancer patients
  84. Innovations in MALDI-TOF Mass Spectrometry: Bridging modern diagnostics and historical insights
  85. BAP1 complexes with YY1 and RBBP7 and its downstream targets in ccRCC cells
  86. Hypereosinophilic syndrome with elevated IgG4 and T-cell clonality: A report of two cases
  87. Electroacupuncture alleviates sciatic nerve injury in sciatica rats by regulating BDNF and NGF levels, myelin sheath degradation, and autophagy
  88. Polydatin prevents cholesterol gallstone formation by regulating cholesterol metabolism via PPAR-γ signaling
  89. RNF144A and RNF144B: Important molecules for health
  90. Analysis of the detection rate and related factors of thyroid nodules in the healthy population
  91. Artesunate inhibits hepatocellular carcinoma cell migration and invasion through OGA-mediated O-GlcNAcylation of ZEB1
  92. Endovascular management of post-pancreatectomy hemorrhage caused by a hepatic artery pseudoaneurysm: Case report and review of the literature
  93. Efficacy and safety of anti-PD-1/PD-L1 antibodies in patients with relapsed refractory diffuse large B-cell lymphoma: A meta-analysis
  94. SATB2 promotes humeral fracture healing in rats by activating the PI3K/AKT pathway
  95. Overexpression of the ferroptosis-related gene, NFS1, corresponds to gastric cancer growth and tumor immune infiltration
  96. Understanding risk factors and prognosis in diabetic foot ulcers
  97. Atractylenolide I alleviates the experimental allergic response in mice by suppressing TLR4/NF-kB/NLRP3 signalling
  98. FBXO31 inhibits the stemness characteristics of CD147 (+) melanoma stem cells
  99. Immune molecule diagnostics in colorectal cancer: CCL2 and CXCL11
  100. Inhibiting CXCR6 promotes senescence of activated hepatic stellate cells with limited proinflammatory SASP to attenuate hepatic fibrosis
  101. Cadmium toxicity, health risk and its remediation using low-cost biochar adsorbents
  102. Pulmonary cryptococcosis with headache as the first presentation: A case report
  103. Solitary pulmonary metastasis with cystic airspaces in colon cancer: A rare case report
  104. RUNX1 promotes denervation-induced muscle atrophy by activating the JUNB/NF-κB pathway and driving M1 macrophage polarization
  105. Morphometric analysis and immunobiological investigation of Indigofera oblongifolia on the infected lung with Plasmodium chabaudi
  106. The NuA4/TIP60 histone-modifying complex and Hr78 modulate the Lobe2 mutant eye phenotype
  107. Experimental study on salmon demineralized bone matrix loaded with recombinant human bone morphogenetic protein-2: In vitro and in vivo study
  108. A case of IgA nephropathy treated with a combination of telitacicept and half-dose glucocorticoids
  109. Analgesic and toxicological evaluation of cannabidiol-rich Moroccan Cannabis sativa L. (Khardala variety) extract: Evidence from an in vivo and in silico study
  110. Wound healing and signaling pathways
  111. Combination of immunotherapy and whole-brain radiotherapy on prognosis of patients with multiple brain metastases: A retrospective cohort study
  112. To explore the relationship between endometrial hyperemia and polycystic ovary syndrome
  113. Research progress on the impact of curcumin on immune responses in breast cancer
  114. Biogenic Cu/Ni nanotherapeutics from Descurainia sophia (L.) Webb ex Prantl seeds for the treatment of lung cancer
  115. Dapagliflozin attenuates atrial fibrosis via the HMGB1/RAGE pathway in atrial fibrillation rats
  116. Glycitein alleviates inflammation and apoptosis in keratinocytes via ROS-associated PI3K–Akt signalling pathway
  117. ADH5 inhibits proliferation but promotes EMT in non-small cell lung cancer cell through activating Smad2/Smad3
  118. Apoptotic efficacies of AgNPs formulated by Syzygium aromaticum leaf extract on 32D-FLT3-ITD human leukemia cell line with PI3K/AKT/mTOR signaling pathway
  119. Novel cuproptosis-related genes C1QBP and PFKP identified as prognostic and therapeutic targets in lung adenocarcinoma
  120. Bee venom promotes exosome secretion and alters miRNA cargo in T cells
  121. Treatment of pure red cell aplasia in a chronic kidney disease patient with roxadustat: A case report
  122. Comparative bioinformatics analysis of the Wnt pathway in breast cancer: Selection of novel biomarker panels associated with ER status
  123. Kynurenine facilitates renal cell carcinoma progression by suppressing M2 macrophage pyroptosis through inhibition of CASP1 cleavage
  124. RFX5 promotes the growth, motility, and inhibits apoptosis of gastric adenocarcinoma cells through the SIRT1/AMPK axis
  125. ALKBH5 exacerbates early cardiac damage after radiotherapy for breast cancer via m6A demethylation of TLR4
  126. Phytochemicals of Roman chamomile: Antioxidant, anti-aging, and whitening activities of distillation residues
  127. Circadian gene Cry1 inhibits the tumorigenicity of hepatocellular carcinoma by the BAX/BCL2-mediated apoptosis pathway
  128. The TNFR-RIPK1/RIPK3 signalling pathway mediates the effect of lanthanum on necroptosis of nerve cells
  129. Longitudinal monitoring of autoantibody dynamics in patients with early-stage non-small-cell lung cancer undergoing surgery
  130. The potential role of rutin, a flavonoid, in the management of cancer through modulation of cell signaling pathways
  131. Construction of pectinase gene engineering microbe and its application in tobacco sheets
  132. Construction of a microbial abundance prognostic scoring model based on intratumoral microbial data for predicting the prognosis of lung squamous cell carcinoma
  133. Sepsis complicated by haemophagocytic lymphohistiocytosis triggered by methicillin-resistant Staphylococcus aureus and human herpesvirus 8 in an immunocompromised elderly patient: A case report
  134. Sarcopenia in liver transplantation: A comprehensive bibliometric study of current research trends and future directions
  135. Advances in cancer immunotherapy and future directions in personalized medicine
  136. Can coronavirus disease 2019 affect male fertility or cause spontaneous abortion? A two-sample Mendelian randomization analysis
  137. Heat stroke associated with novel leukaemia inhibitory factor receptor gene variant in a Chinese infant
  138. PSME2 exacerbates ulcerative colitis by disrupting intestinal barrier function and promoting autophagy-dependent inflammation
  139. Hyperosmolar hyperglycemic state with severe hypernatremia coexisting with central diabetes insipidus: A case report and literature review
  140. Efficacy and mechanism of escin in improving the tissue microenvironment of blood vessel walls via anti-inflammatory and anticoagulant effects: Implications for clinical practice
  141. Merkel cell carcinoma: Clinicopathological analysis of three patients and literature review
  142. Genetic variants in VWF exon 26 and their implications for type 1 Von Willebrand disease in a Saudi Arabian population
  143. Lipoxin A4 improves myocardial ischemia/reperfusion injury through the Notch1-Nrf2 signaling pathway
  144. High levels of EPHB2 expression predict a poor prognosis and promote tumor progression in endometrial cancer
  145. Knockdown of SHP-2 delays renal tubular epithelial cell injury in diabetic nephropathy by inhibiting NLRP3 inflammasome-mediated pyroptosis
  146. Exploring the toxicity mechanisms and detoxification methods of Rhizoma Paridis
  147. Concomitant gastric carcinoma and primary hepatic angiosarcoma in a patient: A case report
  148. Ecology and Environmental Science
  149. Optimization and comparative study of Bacillus consortia for cellulolytic potential and cellulase enzyme activity
  150. The complete mitochondrial genome analysis of Haemaphysalis hystricis Supino, 1897 (Ixodida: Ixodidae) and its phylogenetic implications
  151. Epidemiological characteristics and risk factors analysis of multidrug-resistant tuberculosis among tuberculosis population in Huzhou City, Eastern China
  152. Indices of human impacts on landscapes: How do they reflect the proportions of natural habitats?
  153. Genetic analysis of the Siberian flying squirrel population in the northern Changbai Mountains, Northeast China: Insights into population status and conservation
  154. Diversity and environmental drivers of Suillus communities in Pinus sylvestris var. mongolica forests of Inner Mongolia
  155. Global assessment of the fate of nitrogen deposition in forest ecosystems: Insights from 15N tracer studies
  156. Fungal and bacterial pathogenic co-infections mainly lead to the assembly of microbial community in tobacco stems
  157. Influencing of coal industry related airborne particulate matter on ocular surface tear film injury and inflammatory factor expression in Sprague-Dawley rats
  158. Temperature-dependent development, predation, and life table of Sphaerophoria macrogaster (Thomson) (Diptera: Syrphidae) feeding on Myzus persicae (Sulzer) (Homoptera: Aphididae)
  159. Eleonora’s falcon trophic interactions with insects within its breeding range: A systematic review
  160. Agriculture
  161. Integrated analysis of transcriptome, sRNAome, and degradome involved in the drought-response of maize Zhengdan958
  162. Variation in flower frost tolerance among seven apple cultivars and transcriptome response patterns in two contrastingly frost-tolerant selected cultivars
  163. Heritability of durable resistance to stripe rust in bread wheat (Triticum aestivum L.)
  164. Molecular mechanism of follicular development in laying hens based on the regulation of water metabolism
  165. Animal Science
  166. Effect of sex ratio on the life history traits of an important invasive species, Spodoptera frugiperda
  167. Plant Sciences
  168. Hairpin in a haystack: In silico identification and characterization of plant-conserved microRNA in Rafflesiaceae
  169. Widely targeted metabolomics of different tissues in Rubus corchorifolius
  170. The complete chloroplast genome of Gerbera piloselloides (L.) Cass., 1820 (Carduoideae, Asteraceae) and its phylogenetic analysis
  171. Field trial to correlate mineral solubilization activity of Pseudomonas aeruginosa and biochemical content of groundnut plants
  172. Correlation analysis between semen routine parameters and sperm DNA fragmentation index in patients with semen non-liquefaction: A retrospective study
  173. Plasticity of the anatomical traits of Rhododendron L. (Ericaceae) leaves and its implications in adaptation to the plateau environment
  174. Effects of Piriformospora indica and arbuscular mycorrhizal fungus on growth and physiology of Moringa oleifera under low-temperature stress
  175. Effects of different sources of potassium fertiliser on yield, fruit quality and nutrient absorption in “Harward” kiwifruit (Actinidia deliciosa)
  176. Comparative efficiency and residue levels of spraying programs against powdery mildew in grape varieties
  177. The DREB7 transcription factor enhances salt tolerance in soybean plants under salt stress
  178. Using plant electrical signals of water hyacinth (Eichhornia crassipes) for water pollution monitoring
  179. Food Science
  180. Phytochemical analysis of Stachys iva: Discovering the optimal extract conditions and its bioactive compounds
  181. Review on role of honey in disease prevention and treatment through modulation of biological activities
  182. Computational analysis of polymorphic residues in maltose and maltotriose transporters of a wild Saccharomyces cerevisiae strain
  183. Optimization of phenolic compound extraction from Tunisian squash by-products: A sustainable approach for antioxidant and antibacterial applications
  184. Liupao tea aqueous extract alleviates dextran sulfate sodium-induced ulcerative colitis in rats by modulating the gut microbiota
  185. Toxicological qualities and detoxification trends of fruit by-products for valorization: A review
  186. Polyphenolic spectrum of cornelian cherry fruits and their health-promoting effect
  187. Optimizing the encapsulation of the refined extract of squash peels for functional food applications: A sustainable approach to reduce food waste
  188. Advancements in curcuminoid formulations: An update on bioavailability enhancement strategies curcuminoid bioavailability and formulations
  189. Impact of saline sprouting on antioxidant properties and bioactive compounds in chia seeds
  190. The dilemma of food genetics and improvement
  191. Bioengineering and Biotechnology
  192. Impact of hyaluronic acid-modified hafnium metalorganic frameworks containing rhynchophylline on Alzheimer’s disease
  193. Emerging patterns in nanoparticle-based therapeutic approaches for rheumatoid arthritis: A comprehensive bibliometric and visual analysis spanning two decades
  194. Application of CRISPR/Cas gene editing for infectious disease control in poultry
  195. Preparation of hafnium nitride-coated titanium implants by magnetron sputtering technology and evaluation of their antibacterial properties and biocompatibility
  196. Preparation and characterization of lemongrass oil nanoemulsion: Antimicrobial, antibiofilm, antioxidant, and anticancer activities
  197. Corrigendum
  198. Corrigendum to “Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells”
  199. Corrigendum to “Effects of Ire1 gene on virulence and pathogenicity of Candida albicans”
  200. Retraction
  201. Retraction of “Down-regulation of miR-539 indicates poor prognosis in patients with pancreatic cancer”
https://doi.org/10.1515/biol-2025-1163
Keywords for this article
HMGB1/RAGE pathway; DAPA; atrial fibrillation rats; myocardial fibrosis
Creative Commons
BY 4.0

Articles in the same Issue

  1. Biomedical Sciences
  2. Mechanism of triptolide regulating proliferation and apoptosis of hepatoma cells by inhibiting JAK/STAT pathway
  3. Maslinic acid improves mitochondrial function and inhibits oxidative stress and autophagy in human gastric smooth muscle cells
  4. Comparative analysis of inflammatory biomarkers for the diagnosis of neonatal sepsis: IL-6, IL-8, SAA, CRP, and PCT
  5. Post-pandemic insights on COVID-19 and premature ovarian insufficiency
  6. Proteome differences of dental stem cells between permanent and deciduous teeth by data-independent acquisition proteomics
  7. Optimizing a modified cetyltrimethylammonium bromide protocol for fungal DNA extraction: Insights from multilocus gene amplification
  8. Preliminary analysis of the role of small hepatitis B surface proteins mutations in the pathogenesis of occult hepatitis B infection via the endoplasmic reticulum stress-induced UPR-ERAD pathway
  9. Efficacy of alginate-coated gold nanoparticles against antibiotics-resistant Staphylococcus and Streptococcus pathogens of acne origins
  10. Battling COVID-19 leveraging nanobiotechnology: Gold and silver nanoparticle–B-escin conjugates as SARS-CoV-2 inhibitors
  11. Neurodegenerative diseases and neuroinflammation-induced apoptosis
  12. Impact of fracture fixation surgery on cognitive function and the gut microbiota in mice with a history of stroke
  13. COLEC10: A potential tumor suppressor and prognostic biomarker in hepatocellular carcinoma through modulation of EMT and PI3K-AKT pathways
  14. High-temperature requirement serine protease A2 inhibitor UCF-101 ameliorates damaged neurons in traumatic brain-injured rats by the AMPK/NF-κB pathway
  15. SIK1 inhibits IL-1β-stimulated cartilage apoptosis and inflammation in vitro through the CRTC2/CREB1 signaling
  16. Rutin–chitooligosaccharide complex: Comprehensive evaluation of its anti-inflammatory and analgesic properties in vitro and in vivo
  17. Knockdown of Aurora kinase B alleviates high glucose-triggered trophoblast cells damage and inflammation during gestational diabetes
  18. Calcium-sensing receptors promoted Homer1 expression and osteogenic differentiation in bone marrow mesenchymal stem cells
  19. ABI3BP can inhibit the proliferation, invasion, and epithelial–mesenchymal transition of non-small-cell lung cancer cells
  20. Changes in blood glucose and metabolism in hyperuricemia mice
  21. Rapid detection of the GJB2 c.235delC mutation based on CRISPR-Cas13a combined with lateral flow dipstick
  22. IL-11 promotes Ang II-induced autophagy inhibition and mitochondrial dysfunction in atrial fibroblasts
  23. Short-chain fatty acid attenuates intestinal inflammation by regulation of gut microbial composition in antibiotic-associated diarrhea
  24. Application of metagenomic next-generation sequencing in the diagnosis of pathogens in patients with diabetes complicated by community-acquired pneumonia
  25. NAT10 promotes radiotherapy resistance in non-small cell lung cancer by regulating KPNB1-mediated PD-L1 nuclear translocation
  26. Phytol-mixed micelles alleviate dexamethasone-induced osteoporosis in zebrafish: Activation of the MMP3–OPN–MAPK pathway-mediating bone remodeling
  27. Association between TGF-β1 and β-catenin expression in the vaginal wall of patients with pelvic organ prolapse
  28. Primary pleomorphic liposarcoma involving bilateral ovaries: Case report and literature review
  29. Effects of de novo donor-specific Class I and II antibodies on graft outcomes after liver transplantation: A pilot cohort study
  30. Sleep architecture in Alzheimer’s disease continuum: The deep sleep question
  31. Ephedra fragilis plant extract: A groundbreaking corrosion inhibitor for mild steel in acidic environments – electrochemical, EDX, DFT, and Monte Carlo studies
  32. Langerhans cell histiocytosis in an adult patient with upper jaw and pulmonary involvement: A case report
  33. Inhibition of mast cell activation by Jaranol-targeted Pirin ameliorates allergic responses in mouse allergic rhinitis
  34. Aeromonas veronii-induced septic arthritis of the hip in a child with acute lymphoblastic leukemia
  35. Clusterin activates the heat shock response via the PI3K/Akt pathway to protect cardiomyocytes from high-temperature-induced apoptosis
  36. Research progress on fecal microbiota transplantation in tumor prevention and treatment
  37. Low-pressure exposure influences the development of HAPE
  38. Stigmasterol alleviates endplate chondrocyte degeneration through inducing mitophagy by enhancing PINK1 mRNA acetylation via the ESR1/NAT10 axis
  39. AKAP12, mediated by transcription factor 21, inhibits cell proliferation, metastasis, and glycolysis in lung squamous cell carcinoma
  40. Association between PAX9 or MSX1 gene polymorphism and tooth agenesis risk: A meta-analysis
  41. A case of bloodstream infection caused by Neisseria gonorrhoeae
  42. Case of nasopharyngeal tuberculosis complicated with cervical lymph node and pulmonary tuberculosis
  43. p-Cymene inhibits pro-fibrotic and inflammatory mediators to prevent hepatic dysfunction
  44. GFPT2 promotes paclitaxel resistance in epithelial ovarian cancer cells via activating NF-κB signaling pathway
  45. Transfer RNA-derived fragment tRF-36 modulates varicose vein progression via human vascular smooth muscle cell Notch signaling
  46. RTA-408 attenuates the hepatic ischemia reperfusion injury in mice possibly by activating the Nrf2/HO-1 signaling pathway
  47. Decreased serum TIMP4 levels in patients with rheumatoid arthritis
  48. Sirt1 protects lupus nephritis by inhibiting the NLRP3 signaling pathway in human glomerular mesangial cells
  49. Sodium butyrate aids brain injury repair in neonatal rats
  50. Interaction of MTHFR polymorphism with PAX1 methylation in cervical cancer
  51. Convallatoxin inhibits proliferation and angiogenesis of glioma cells via regulating JAK/STAT3 pathway
  52. The effect of the PKR inhibitor, 2-aminopurine, on the replication of influenza A virus, and segment 8 mRNA splicing
  53. Effects of Ire1 gene on virulence and pathogenicity of Candida albicans
  54. Small cell lung cancer with small intestinal metastasis: Case report and literature review
  55. GRB14: A prognostic biomarker driving tumor progression in gastric cancer through the PI3K/AKT signaling pathway by interacting with COBLL1
  56. 15-Lipoxygenase-2 deficiency induces foam cell formation that can be restored by salidroside through the inhibition of arachidonic acid effects
  57. FTO alleviated the diabetic nephropathy progression by regulating the N6-methyladenosine levels of DACT1
  58. Clinical relevance of inflammatory markers in the evaluation of severity of ulcerative colitis: A retrospective study
  59. Zinc valproic acid complex promotes osteoblast differentiation and exhibits anti-osteoporotic potential
  60. Primary pulmonary synovial sarcoma in the bronchial cavity: A case report
  61. Metagenomic next-generation sequencing of alveolar lavage fluid improves the detection of pulmonary infection
  62. Uterine tumor resembling ovarian sex cord tumor with extensive rhabdoid differentiation: A case report
  63. Genomic analysis of a novel ST11(PR34365) Clostridioides difficile strain isolated from the human fecal of a CDI patient in Guizhou, China
  64. Effects of tiered cardiac rehabilitation on CRP, TNF-α, and physical endurance in older adults with coronary heart disease
  65. Changes in T-lymphocyte subpopulations in patients with colorectal cancer before and after acupoint catgut embedding acupuncture observation
  66. Modulating the tumor microenvironment: The role of traditional Chinese medicine in improving lung cancer treatment
  67. Alterations of metabolites related to microbiota–gut–brain axis in plasma of colon cancer, esophageal cancer, stomach cancer, and lung cancer patients
  68. Research on individualized drug sensitivity detection technology based on bio-3D printing technology for precision treatment of gastrointestinal stromal tumors
  69. CEBPB promotes ulcerative colitis-associated colorectal cancer by stimulating tumor growth and activating the NF-κB/STAT3 signaling pathway
  70. Oncolytic bacteria: A revolutionary approach to cancer therapy
  71. A de novo meningioma with rapid growth: A possible malignancy imposter?
  72. Diagnosis of secondary tuberculosis infection in an asymptomatic elderly with cancer using next-generation sequencing: Case report
  73. Hesperidin and its zinc(ii) complex enhance osteoblast differentiation and bone formation: In vitro and in vivo evaluations
  74. Research progress on the regulation of autophagy in cardiovascular diseases by chemokines
  75. Anti-arthritic, immunomodulatory, and inflammatory regulation by the benzimidazole derivative BMZ-AD: Insights from an FCA-induced rat model
  76. Immunoassay for pyruvate kinase M1/2 as an Alzheimer’s biomarker in CSF
  77. The role of HDAC11 in age-related hearing loss: Mechanisms and therapeutic implications
  78. Evaluation and application analysis of animal models of PIPNP based on data mining
  79. Therapeutic approaches for liver fibrosis/cirrhosis by targeting pyroptosis
  80. Fabrication of zinc oxide nanoparticles using Ruellia tuberosa leaf extract induces apoptosis through P53 and STAT3 signalling pathways in prostate cancer cells
  81. Haplo-hematopoietic stem cell transplantation and immunoradiotherapy for severe aplastic anemia complicated with nasopharyngeal carcinoma: A case report
  82. Modulation of the KEAP1-NRF2 pathway by Erianin: A novel approach to reduce psoriasiform inflammation and inflammatory signaling
  83. The expression of epidermal growth factor receptor 2 and its relationship with tumor-infiltrating lymphocytes and clinical pathological features in breast cancer patients
  84. Innovations in MALDI-TOF Mass Spectrometry: Bridging modern diagnostics and historical insights
  85. BAP1 complexes with YY1 and RBBP7 and its downstream targets in ccRCC cells
  86. Hypereosinophilic syndrome with elevated IgG4 and T-cell clonality: A report of two cases
  87. Electroacupuncture alleviates sciatic nerve injury in sciatica rats by regulating BDNF and NGF levels, myelin sheath degradation, and autophagy
  88. Polydatin prevents cholesterol gallstone formation by regulating cholesterol metabolism via PPAR-γ signaling
  89. RNF144A and RNF144B: Important molecules for health
  90. Analysis of the detection rate and related factors of thyroid nodules in the healthy population
  91. Artesunate inhibits hepatocellular carcinoma cell migration and invasion through OGA-mediated O-GlcNAcylation of ZEB1
  92. Endovascular management of post-pancreatectomy hemorrhage caused by a hepatic artery pseudoaneurysm: Case report and review of the literature
  93. Efficacy and safety of anti-PD-1/PD-L1 antibodies in patients with relapsed refractory diffuse large B-cell lymphoma: A meta-analysis
  94. SATB2 promotes humeral fracture healing in rats by activating the PI3K/AKT pathway
  95. Overexpression of the ferroptosis-related gene, NFS1, corresponds to gastric cancer growth and tumor immune infiltration
  96. Understanding risk factors and prognosis in diabetic foot ulcers
  97. Atractylenolide I alleviates the experimental allergic response in mice by suppressing TLR4/NF-kB/NLRP3 signalling
  98. FBXO31 inhibits the stemness characteristics of CD147 (+) melanoma stem cells
  99. Immune molecule diagnostics in colorectal cancer: CCL2 and CXCL11
  100. Inhibiting CXCR6 promotes senescence of activated hepatic stellate cells with limited proinflammatory SASP to attenuate hepatic fibrosis
  101. Cadmium toxicity, health risk and its remediation using low-cost biochar adsorbents
  102. Pulmonary cryptococcosis with headache as the first presentation: A case report
  103. Solitary pulmonary metastasis with cystic airspaces in colon cancer: A rare case report
  104. RUNX1 promotes denervation-induced muscle atrophy by activating the JUNB/NF-κB pathway and driving M1 macrophage polarization
  105. Morphometric analysis and immunobiological investigation of Indigofera oblongifolia on the infected lung with Plasmodium chabaudi
  106. The NuA4/TIP60 histone-modifying complex and Hr78 modulate the Lobe2 mutant eye phenotype
  107. Experimental study on salmon demineralized bone matrix loaded with recombinant human bone morphogenetic protein-2: In vitro and in vivo study
  108. A case of IgA nephropathy treated with a combination of telitacicept and half-dose glucocorticoids
  109. Analgesic and toxicological evaluation of cannabidiol-rich Moroccan Cannabis sativa L. (Khardala variety) extract: Evidence from an in vivo and in silico study
  110. Wound healing and signaling pathways
  111. Combination of immunotherapy and whole-brain radiotherapy on prognosis of patients with multiple brain metastases: A retrospective cohort study
  112. To explore the relationship between endometrial hyperemia and polycystic ovary syndrome
  113. Research progress on the impact of curcumin on immune responses in breast cancer
  114. Biogenic Cu/Ni nanotherapeutics from Descurainia sophia (L.) Webb ex Prantl seeds for the treatment of lung cancer
  115. Dapagliflozin attenuates atrial fibrosis via the HMGB1/RAGE pathway in atrial fibrillation rats
  116. Glycitein alleviates inflammation and apoptosis in keratinocytes via ROS-associated PI3K–Akt signalling pathway
  117. ADH5 inhibits proliferation but promotes EMT in non-small cell lung cancer cell through activating Smad2/Smad3
  118. Apoptotic efficacies of AgNPs formulated by Syzygium aromaticum leaf extract on 32D-FLT3-ITD human leukemia cell line with PI3K/AKT/mTOR signaling pathway
  119. Novel cuproptosis-related genes C1QBP and PFKP identified as prognostic and therapeutic targets in lung adenocarcinoma
  120. Bee venom promotes exosome secretion and alters miRNA cargo in T cells
  121. Treatment of pure red cell aplasia in a chronic kidney disease patient with roxadustat: A case report
  122. Comparative bioinformatics analysis of the Wnt pathway in breast cancer: Selection of novel biomarker panels associated with ER status
  123. Kynurenine facilitates renal cell carcinoma progression by suppressing M2 macrophage pyroptosis through inhibition of CASP1 cleavage
  124. RFX5 promotes the growth, motility, and inhibits apoptosis of gastric adenocarcinoma cells through the SIRT1/AMPK axis
  125. ALKBH5 exacerbates early cardiac damage after radiotherapy for breast cancer via m6A demethylation of TLR4
  126. Phytochemicals of Roman chamomile: Antioxidant, anti-aging, and whitening activities of distillation residues
  127. Circadian gene Cry1 inhibits the tumorigenicity of hepatocellular carcinoma by the BAX/BCL2-mediated apoptosis pathway
  128. The TNFR-RIPK1/RIPK3 signalling pathway mediates the effect of lanthanum on necroptosis of nerve cells
  129. Longitudinal monitoring of autoantibody dynamics in patients with early-stage non-small-cell lung cancer undergoing surgery
  130. The potential role of rutin, a flavonoid, in the management of cancer through modulation of cell signaling pathways
  131. Construction of pectinase gene engineering microbe and its application in tobacco sheets
  132. Construction of a microbial abundance prognostic scoring model based on intratumoral microbial data for predicting the prognosis of lung squamous cell carcinoma
  133. Sepsis complicated by haemophagocytic lymphohistiocytosis triggered by methicillin-resistant Staphylococcus aureus and human herpesvirus 8 in an immunocompromised elderly patient: A case report
  134. Sarcopenia in liver transplantation: A comprehensive bibliometric study of current research trends and future directions
  135. Advances in cancer immunotherapy and future directions in personalized medicine
  136. Can coronavirus disease 2019 affect male fertility or cause spontaneous abortion? A two-sample Mendelian randomization analysis
  137. Heat stroke associated with novel leukaemia inhibitory factor receptor gene variant in a Chinese infant
  138. PSME2 exacerbates ulcerative colitis by disrupting intestinal barrier function and promoting autophagy-dependent inflammation
  139. Hyperosmolar hyperglycemic state with severe hypernatremia coexisting with central diabetes insipidus: A case report and literature review
  140. Efficacy and mechanism of escin in improving the tissue microenvironment of blood vessel walls via anti-inflammatory and anticoagulant effects: Implications for clinical practice
  141. Merkel cell carcinoma: Clinicopathological analysis of three patients and literature review
  142. Genetic variants in VWF exon 26 and their implications for type 1 Von Willebrand disease in a Saudi Arabian population
  143. Lipoxin A4 improves myocardial ischemia/reperfusion injury through the Notch1-Nrf2 signaling pathway
  144. High levels of EPHB2 expression predict a poor prognosis and promote tumor progression in endometrial cancer
  145. Knockdown of SHP-2 delays renal tubular epithelial cell injury in diabetic nephropathy by inhibiting NLRP3 inflammasome-mediated pyroptosis
  146. Exploring the toxicity mechanisms and detoxification methods of Rhizoma Paridis
  147. Concomitant gastric carcinoma and primary hepatic angiosarcoma in a patient: A case report
  148. Ecology and Environmental Science
  149. Optimization and comparative study of Bacillus consortia for cellulolytic potential and cellulase enzyme activity
  150. The complete mitochondrial genome analysis of Haemaphysalis hystricis Supino, 1897 (Ixodida: Ixodidae) and its phylogenetic implications
  151. Epidemiological characteristics and risk factors analysis of multidrug-resistant tuberculosis among tuberculosis population in Huzhou City, Eastern China
  152. Indices of human impacts on landscapes: How do they reflect the proportions of natural habitats?
  153. Genetic analysis of the Siberian flying squirrel population in the northern Changbai Mountains, Northeast China: Insights into population status and conservation
  154. Diversity and environmental drivers of Suillus communities in Pinus sylvestris var. mongolica forests of Inner Mongolia
  155. Global assessment of the fate of nitrogen deposition in forest ecosystems: Insights from 15N tracer studies
  156. Fungal and bacterial pathogenic co-infections mainly lead to the assembly of microbial community in tobacco stems
  157. Influencing of coal industry related airborne particulate matter on ocular surface tear film injury and inflammatory factor expression in Sprague-Dawley rats
  158. Temperature-dependent development, predation, and life table of Sphaerophoria macrogaster (Thomson) (Diptera: Syrphidae) feeding on Myzus persicae (Sulzer) (Homoptera: Aphididae)
  159. Eleonora’s falcon trophic interactions with insects within its breeding range: A systematic review
  160. Agriculture
  161. Integrated analysis of transcriptome, sRNAome, and degradome involved in the drought-response of maize Zhengdan958
  162. Variation in flower frost tolerance among seven apple cultivars and transcriptome response patterns in two contrastingly frost-tolerant selected cultivars
  163. Heritability of durable resistance to stripe rust in bread wheat (Triticum aestivum L.)
  164. Molecular mechanism of follicular development in laying hens based on the regulation of water metabolism
  165. Animal Science
  166. Effect of sex ratio on the life history traits of an important invasive species, Spodoptera frugiperda
  167. Plant Sciences
  168. Hairpin in a haystack: In silico identification and characterization of plant-conserved microRNA in Rafflesiaceae
  169. Widely targeted metabolomics of different tissues in Rubus corchorifolius
  170. The complete chloroplast genome of Gerbera piloselloides (L.) Cass., 1820 (Carduoideae, Asteraceae) and its phylogenetic analysis
  171. Field trial to correlate mineral solubilization activity of Pseudomonas aeruginosa and biochemical content of groundnut plants
  172. Correlation analysis between semen routine parameters and sperm DNA fragmentation index in patients with semen non-liquefaction: A retrospective study
  173. Plasticity of the anatomical traits of Rhododendron L. (Ericaceae) leaves and its implications in adaptation to the plateau environment
  174. Effects of Piriformospora indica and arbuscular mycorrhizal fungus on growth and physiology of Moringa oleifera under low-temperature stress
  175. Effects of different sources of potassium fertiliser on yield, fruit quality and nutrient absorption in “Harward” kiwifruit (Actinidia deliciosa)
  176. Comparative efficiency and residue levels of spraying programs against powdery mildew in grape varieties
  177. The DREB7 transcription factor enhances salt tolerance in soybean plants under salt stress
  178. Using plant electrical signals of water hyacinth (Eichhornia crassipes) for water pollution monitoring
  179. Food Science
  180. Phytochemical analysis of Stachys iva: Discovering the optimal extract conditions and its bioactive compounds
  181. Review on role of honey in disease prevention and treatment through modulation of biological activities
  182. Computational analysis of polymorphic residues in maltose and maltotriose transporters of a wild Saccharomyces cerevisiae strain
  183. Optimization of phenolic compound extraction from Tunisian squash by-products: A sustainable approach for antioxidant and antibacterial applications
  184. Liupao tea aqueous extract alleviates dextran sulfate sodium-induced ulcerative colitis in rats by modulating the gut microbiota
  185. Toxicological qualities and detoxification trends of fruit by-products for valorization: A review
  186. Polyphenolic spectrum of cornelian cherry fruits and their health-promoting effect
  187. Optimizing the encapsulation of the refined extract of squash peels for functional food applications: A sustainable approach to reduce food waste
  188. Advancements in curcuminoid formulations: An update on bioavailability enhancement strategies curcuminoid bioavailability and formulations
  189. Impact of saline sprouting on antioxidant properties and bioactive compounds in chia seeds
  190. The dilemma of food genetics and improvement
  191. Bioengineering and Biotechnology
  192. Impact of hyaluronic acid-modified hafnium metalorganic frameworks containing rhynchophylline on Alzheimer’s disease
  193. Emerging patterns in nanoparticle-based therapeutic approaches for rheumatoid arthritis: A comprehensive bibliometric and visual analysis spanning two decades
  194. Application of CRISPR/Cas gene editing for infectious disease control in poultry
  195. Preparation of hafnium nitride-coated titanium implants by magnetron sputtering technology and evaluation of their antibacterial properties and biocompatibility
  196. Preparation and characterization of lemongrass oil nanoemulsion: Antimicrobial, antibiofilm, antioxidant, and anticancer activities
  197. Corrigendum
  198. Corrigendum to “Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells”
  199. Corrigendum to “Effects of Ire1 gene on virulence and pathogenicity of Candida albicans”
  200. Retraction
  201. Retraction of “Down-regulation of miR-539 indicates poor prognosis in patients with pancreatic cancer”
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 25.12.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2025-1163/html
Scroll to top button