Home Life Sciences Transfer RNA-derived fragment tRF-36 modulates varicose vein progression via human vascular smooth muscle cell Notch signaling
Article Open Access

Transfer RNA-derived fragment tRF-36 modulates varicose vein progression via human vascular smooth muscle cell Notch signaling

  • Guojun Chen , Chong Yu , Yu Shi , Danna Cai and Bin Zhou EMAIL logo
Published/Copyright: April 24, 2025
Download Article (PDF)
Open Life Sciences
From the journal Open Life Sciences Volume 20 Issue 1

Abstract

Varicose veins are a prevalent vascular disorder affecting millions of individuals worldwide, and we previously reported transfer RNA-derived fragment (tRF) involvement in varicose veins. This study investigated the role of tRF-36 in varicose vein pathogenesis. Varicose veins and adjacent normal vascular tissues were collected to measure the expression of Notch 1, 2, and 3 and the smooth muscle cell (SMC) markers SMA-α, and SM22α. Human vascular SMCs (HVSMCs) were transfected to alter tRF-36 levels and examine the effects on Notch 1–3, tRF-36, SMA-α, and SM22α expression. Notch 1–3 and tRF-36 levels were higher in varicose veins than in adjacent normal vascular tissues. tRF-36 knockdown decreased HVSMC viability, downregulated Notch 1, 2, and 3 expression, and upregulated SMC markers (SMA-α and SM22α) compared with control HVSMCs. When the Notch pathway was inhibited, the expression of tRF-36 was significantly reduced. Additionally, Notch pathway inhibition showed similar effects to tRF-36 knockdown on HVSMC viability and the expression of SMA-α and SM22α. Furthermore, a Notch pathway inhibitor reversed the effects of the tRF-36 mimic on HVSMCs. Our study suggests a critical role for tRF-36 in varicose veins and demonstrates that tRF-36 knockdown may suppress varicose vein progression by inhibiting the Notch signaling pathway.

Keywords: varicose veins; tRF-36; human vascular smooth muscle cells; Notch pathway; phenotypic switching

1 Introduction

Varicose veins, characterized by the dilation and tortuosity of superficial veins, are prevalent vascular disorders affecting millions of individuals worldwide [1]. This condition not only leads to aesthetic concerns but also poses significant health risks, including chronic venous insufficiency, skin ulcers, and deep vein thrombosis [2,3,4]. Treatment options for varicose veins include conservative management and surgery, depending on the clinical presentation and patient preferences [5,6,7]. Despite the availability of various treatment options, the pathogenesis of varicose veins remains unknown, and current therapies frequently do not target the underlying molecular mechanisms, resulting in high recurrence rates and limited long-term effectiveness [8]. Therefore, in-depth research into the molecular mechanisms underlying varicose veins is necessary to develop more effective treatment strategies.

In recent years, the role of non-coding RNAs in the regulation of gene expression and disease pathogenesis has gained considerable attention [9]. Transfer RNA-derived fragments (tRFs) are members of the small RNA family that have diverse biological functions, such as regulating mRNA stability, epigenetic modifications, cell proliferation, and apoptosis [10]. tRFs are reported to participate in many human diseases, such as neurodegenerative diseases [11], infectious diseases [12], and cancer [13]. Our previous study demonstrated the involvement of tRFs in varicose veins using small RNA sequencing [14]. Moreover, three differentially expressed tRFs (tRF-36 [upregulated], tRF-23 [upregulated], and tRF-40 [downregulated]) were shortlisted according to their high abundance and fold changes, and their expression levels were validated by real-time quantitative polymerase chain reaction (RT-qPCR) (P < 0.01 for tRF-36; P < 0.05 for tRF-23 and tRF-40). Based on these significant differences, we selected tRF-36 for further analysis. To the best of our knowledge, tRF-36 has only been reported in acute pancreatitis [15]. That report revealed that tRF-36 was upregulated in the serum of patients with acute pancreatitis and may act as a prospective target for acute pancreatitis. However, the exact mechanism of action of tRF-36 in varicose veins has not been elucidated.

The Notch pathway, a highly conserved intercellular communication system, plays a critical role in the decision of cell fate, tissue homeostasis, and disease progression [16,17]. In mammals, there are four Notch family receptors (Notch 1, 2, 3, and 4) and five ligands (delta-like [DLL]-1, -3, -4, Jagged-1, and -2) [18]. During angiogenesis, the Notch pathway not only regulates the proliferation and differentiation of endothelial cells, the formation of vascular branches, and the morphogenesis of blood vessels but also helps maintain the integrity of vascular endothelial cells and regulates the proliferation, migration, and contraction of vascular smooth muscle cells (VSMCs) [19]. Dysregulation of the Notch pathway has been implicated in various pathological conditions, including vascular diseases [20]. Zhao et al. [21] demonstrated that PM2.5 exposure could induce and aggravate atherosclerosis in rats by disrupting lipid metabolism, in which the Notch signaling pathway may play an important role. Another study showed that linarin improved restenosis after vascular injury in type 2 diabetes by modulating the disintegrin and metalloproteinase domain-containing protein 10-mediated Notch signaling pathway [22]. In addition, a recent investigation reported that in the arterial system, a transcriptional activator of endothelial Notch causes endothelial dysfunction in varicose veins through Notch4/DLL-4 signaling [23], which suggests a function of the Notch pathway in varicose veins. However, the interplay between tRF-36 and the Notch pathway in varicose veins has not yet been thoroughly investigated.

Smooth muscle cells (SMCs) play a role in vascular homeostasis in vein walls. Any alteration in the SMCs can alter the structure and function of other venous layers, resulting in increased endothelial permeability and substance release [25]. The development of varicose veins is closely related to phenotypic switching of VSMCs [24]. SMA-α and SM22α are SMC markers and are closely associated with the phenotypic switching of VSMCs, thereby playing important roles in varicose veins. Therefore, in this study, human VSMCs (HVSMCs) were used to elucidate the role of tRF-36 in varicose veins and explore its potential mechanisms of action via the Notch pathway. Understanding the molecular underpinnings of varicose veins may facilitate the development of more effective and targeted treatment strategies, ultimately improving patient outcomes and quality of life.

2 Materials and methods

2.1 Patient recruitment and sample collection

Between March and June 2021, three patients diagnosed with varicose veins were recruited at Shanghai East Hospital, Tongji University School of Medicine. Varicose vein tissues and their corresponding adjacent normal vascular tissues were collected from all patients. Collected tissues were fixed in 4% paraformaldehyde for 24 h.

  1. Informed consent: Informed consent has been obtained from all individuals included in this study.

  2. Ethical approval: The research related to human use has been complied with all the relevant national regulations and institutional policies and in accordance with the tenets of the Helsinki Declaration and has been approved by the Institutional Ethics Committee of Shanghai East Hospital, Tongji University School of Medicine.

2.2 Immunofluorescence (IF)

The fixed tissue samples were decalcified in ethylenediaminetetraacetic acid for 72 h, dehydrated with graded ethanol solutions, and embedded in paraffin. After blocks were cut into 4–5 μm thick slices, dewaxing, rehydration, antigen retrieval, and blocking with goat serum and for endogenous peroxidases were performed. Then, the tissue sections were incubated with anti-Notch 1 antibody (1:50, Notch 1# AF5307; Affinity, USA), anti-Notch 2 antibody (1:20, Notch 1# AF5296; Affinity), anti-Notch 3 antibody (1:20, Notch 1# DF7193), anti-SMA-α (1:20, SMA-α# AF1032; Affinity), or anti-SM22α (1:20, SM22α# AF9266; Affinity) at 4°C overnight. After washing, the sections were incubated with a secondary antibody at 37°C for 35 min. After washing, 4,6-diaminidine 2-phenylindole was used to stain the sections, which were then sealed with anti-fluorescence quenching sealing tablets. Images were acquired using a confocal microscope (Leica, Heidelberg, Germany).

2.3 Cell culture and transfection

HVSMCs were purchased from the Cell Bank, Chinese Academy of Sciences (Shanghai, China) and maintained in Dulbecco’s modified Eagle’s medium (Corning, Manassas, VA, USA; Cat # 10-013-CVR) containing 10% fetal bovine serum (Gibco, Gaithersburg, MD, USA) and 1% penicillin/streptomycin (E607011; Sangon, Shanghai, China). Then, the HVSMCs were cultured at 37°C and were passaged upon reaching 80–90% confluence.

For cell transfection, the mimics/inhibitor negative control (NC), and tRF-36 mimics/inhibitor were prepared and purchased from General Biology (Anhui, China), and cell transfection was performed as described previously [26]. Briefly, HVSMCs were seeded in 6-well plates at a density of 3 × 105 cells/well. After the cell confluency reached 80–90%, the medium was changed into serum-free medium, and the HVSMCs were transfected with 5 μL mimics/inhibitor NC or tRF-36 mimics/inhibitor using Lipofectamine™ 2000 (Invitrogen, USA). After 6 h, the serum-free medium was replaced with a complete medium. Transfection efficacy was evaluated by determining the expression of tRF-36 using RT-qPCR.

2.4 Cell treatment

HVSMCs were seeded in 6-well plates at a density of 3 × 105 cells/well. To select the optimal concentration of a kind of γ-secretase inhibitor GSI-IX (DAPT) (Notch signaling pathway inhibitor; Selleck, Houston, TX, USA; # S2215), different concentrations of DAPT (0, 2.5, 5, 10, or 20 μM) were used to treat the HVSMCs with 0 μM DAPT as the control, and the expression of Notch 1, 2, and 3 were measured using RT-qPCR. To investigate the role of tRF-36 in HVSMC growth, cells were transfected with tRF-36 mimic or inhibitor, with HVSMCs transfected with mimic NC or inhibitor NC as controls. To further explore the effects of Notch signaling pathway inhibitors, HVMSCs were divided into four groups: DMSO (control), DAPT, tRF-36 inhibitor, and DAPT + tRF-36 inhibitor.

2.5 Cell viability assay

The viability of HVSMCs was determined using cell counting kit-8 (CCK-8; Beyotime, Shanghai, China). HVSMCs were incubated with different treatments for 24, 48, 72, and 96 h. Then, 10 μL of CCK-8 reagent was added to cells and incubated for 2 h. The absorbance at 450 nm was determined by a microplate reader (Infinite M1000; Tecan, Switzerland).

2.6 RT-qPCR

Total RNA was extracted from HVSMCs after different treatments by TRIzol (Invitrogen) and reverse transcribed into cDNA with PrimeScript™ II 1st Strand cDNA synthesis kit (Takara Biomedical Technology (Beijing) Co., Ltd). The RT-qPCR reaction was carried out using SYBR green PCR master mix on an ABI Q6 system (Applied Biosystems, USA) and was initiated at 50°C for 3 min, 95°C for 3 min, followed by 40 cycles at 95°C for 10 s and 60°C for 30 s. The relative expression levels of tRF-36, Notch 1, 2, 3, and 4, SMA-α, and SM22α were calculated using the 2−△△Ct method. The primers are listed in Table 1.

Table 1

The sequences of all primers used in this study

Primers Primer sequence (5′–3′)
Actin-F AGCACAGAGCCTCGCCTTTG
Actin-R CTTCTGACCCATGCCCACCA
U6-F CGATACAGAGAAGATTAGCATGGC
U6-R AACGCTTCACGAATTTGCGT
Notch1-F CTCATCAACTCACACGCCGA
Notch1-R GGTGTCTCCTCCCTGTTGTTCT
Notch2-F GTATTGGCTCCCTGTTCCCC
Notch2-R AATGGTACACCGCTGACCTTG
Notch3-F AGGTGATCGGCTCGGTAGTAAT
Notch3-R CTGACAACGCTCCCAGGTAGT
Notch4-F GCCCCTCCCACTCTCGGT
Notch4-R TCACAGTCGTAGCCATCAAACAG
SMAα-F CCAGCTATGTGTGAAGAAGAGGAC
SMAα-R CTTTTTGTCCCATTCCCACCA
SM22α-F AATGGCGTGATTCTGAGCAAG
SM22α-R CCATAGTCCTCAGCCGCCT
tRF-36-RT GTCGTATCCAGTGCGTGTCGTGGAGTCGG
CAATTGCACTGGATACGACGGGTGAA
tRF-36-F ACATGGTCTAGCGGTTAGGATTC
Downstream universal primer AGTGCGTGTCGTGGAGTCG

2.7 Western blot

Total protein was isolated from HVSMCs after different treatments and quantified using a BCA protein assay kit (Boster Biological Technology Co., Ltd, Wuhan, China). Subsequently, the total protein (20 μg) was separated and transferred onto polyvinylidene fluoride membranes. After blocking with 5% skim milk, the membranes were incubated with the anti-Notch 1 antibody (1:1,000), anti-Notch 2 antibody (1:1,000), anti-Notch 3 antibody (1:500), or anti-GAPDH antibody (1:5,000) at 4°C overnight. Afterward, the membranes were incubated with an HRP-conjugated secondary antibody (1:1,000; Beyotime) at 37°C for 2 h. After washing, the bands were visualized using an enhanced chemiluminescence assay kit (Thermo).

2.8 Statistical analysis

Data are shown as mean ± standard deviation. Data were compared using Student’s t-test (for two groups) or one-way analysis of variance followed by Dunnett’s multiple comparison post hoc tests (for more than two groups) using GraphPad Prism software. Statistical significance was set at P < 0.05.

3 Results

3.1 Expression of Notch 1, 2, and 3 in varicose vein tissues

Varicose veins and adjacent normal vascular tissues were collected from participants to detect the expression of Notch 1, 2, and 3 by IF and RT-qPCR. IF showed that Notch 1 fluorescence intensity was significantly elevated in varicose vein tissues compared to adjacent normal tissues (P < 0.05); similar results were also observed for Notch 2 and 3 expressions (Figure 1a). In addition, the trend of Notch1/2/3 mRNA expression in varicose vein tissues and adjacent normal vascular tissues determined by RT-qPCR was consistent with that of Notch 1/2/3 fluorescence intensity detected by IF (Figure 1b). These results indicate that Notch 1/2/3 could be expressed at higher levels in varicose veins.

Figure 1 The expression of Notch 1, 2, and 3 in varicose vein (VV) tissues and adjacent normal vein (ANV) samples. (a) The fluorescence intensity of Notch 1, 2, and 3 detected by IF. (b) The mRNA expression of Notch 1, 2, and 3 measured by real-time quantitative PCR (RT-qPCR). *P < 0.05 compared to ANV.
Figure 1

The expression of Notch 1, 2, and 3 in varicose vein (VV) tissues and adjacent normal vein (ANV) samples. (a) The fluorescence intensity of Notch 1, 2, and 3 detected by IF. (b) The mRNA expression of Notch 1, 2, and 3 measured by real-time quantitative PCR (RT-qPCR). *P < 0.05 compared to ANV.

3.2 Expression of SMA-α and SM22α in varicose vein tissues

To further explore the varicose vein phenotype in human tissue samples, the expression of smooth muscle markers (SMA-α and SM22α) in varicose vein tissues and adjacent normal vascular tissues was measured by IF and RT-qPCR. The fluorescence intensity of SMA-α and SM22α was significantly reduced in the varicose vein tissues in comparison with the adjacent normal vascular tissues (P < 0.05; Figure 2a). Furthermore, RT-qPCR demonstrated similar reductions in the SMA-α and SM22α expression in varicose vein tissues compared with adjacent normal vasculature (Figure 2b).

Figure 2 Expression of SMA-α and SM22α in varicose vein tissues. (a) The fluorescence intensity of SMA-α and SM22α detected by IF. (b) The mRNA expression of SMA-α and SM22α measured by RT-qPCR. *P < 0.05 compared to ANV.
Figure 2

Expression of SMA-α and SM22α in varicose vein tissues. (a) The fluorescence intensity of SMA-α and SM22α detected by IF. (b) The mRNA expression of SMA-α and SM22α measured by RT-qPCR. *P < 0.05 compared to ANV.

3.3 Cell transfection efficiency and selection of the optimal DAPT concentration

Compared with adjacent normal vascular tissues, the level of tRF-36 was significantly higher in varicose vein tissues (P < 0.05; Figure 3a). Therefore, to study the effects of tRF-36 on the growth of HVSMCs, HVSMCs with tRF-36 overexpression and knockdown were established, and their transfection efficiency was confirmed by RT-qPCR. There was no significant difference in tRF-36 expression between the mimic NC and inhibitor NC groups (P > 0.05), and tRF-36 expression increased significantly after transfection with tRF-36 mimics (P < 0.05) but was decreased after transfection with the tRF-36 inhibitor (P < 0.05; Figure 3b). These results suggested that HVSMCs with tRF-36 overexpression and knockdown were successfully established.

Figure 3 Cell transfection efficiency and selection of the optimal DAPT concentration. (a) The level of tRF-36 in the varicose vein tissues measured by RT-qPCR. *P < 0.05 compared to ANV. (b) The expression level of tRF-36 after cell transfection detected by RT-qPCR. *P < 0.05 compared to mimic NC and # P < 0.05 compared to inhibitor NC. The expression of Notch 1 (c), 2 (d), and 3 (e) after cells treated with different concentrations of DAPT. *P < 0.05 compared to control, # P < 0.05 compared to DAPT 2.5, and $ P < 0.05 compared to DAPT 5.
Figure 3

Cell transfection efficiency and selection of the optimal DAPT concentration. (a) The level of tRF-36 in the varicose vein tissues measured by RT-qPCR. *P < 0.05 compared to ANV. (b) The expression level of tRF-36 after cell transfection detected by RT-qPCR. *P < 0.05 compared to mimic NC and # P < 0.05 compared to inhibitor NC. The expression of Notch 1 (c), 2 (d), and 3 (e) after cells treated with different concentrations of DAPT. *P < 0.05 compared to control, # P < 0.05 compared to DAPT 2.5, and $ P < 0.05 compared to DAPT 5.

To determine the optimal concentration of DAPT, HVSMCs were treated with different concentrations of DAPT, and the expression of Notch 1, 2, and 3 was measured. When the DAPT concentration was 20 μM, the expressions of Notch 1, 2, and 3 were significantly downregulated compared to the control cells (P < 0.05; Figure 3c–e) and showed an optimal inhibition effect on the Notch signaling pathway. Therefore, we selected 20 μM DAPT to treat HVSMCs in the subsequent experiments.

3.4 Effects of tRF-36 on the growth of HVSMCs

Subsequently, we examined the effects of tRF-36 on HVSMC growth. There was no significant difference in HVSMC viability between the inhibitor NC and tRF-36 inhibitor groups or the mimic NC and tRF-36 mimic groups after 24 h of culture (P > 0.05; Figure 4a). However, after culturing for 48, 72, and 96 h, the viability of HVSMCs was significantly inhibited in the tRF-36-knockdown HVSMCs compared to the cells transfected with inhibitor NC (P < 0.05), whereas viability was markedly enhanced in the tRF-36-overexpressed HVSMCs in comparison to the NC group (P < 0.05; Figure 4a). Next, the expression levels of Notch pathway-related genes (Notch 1, 2, 3, and 4) were measured. Compared to the corresponding NC group, the mRNA expression of Notch 1, 2, and 3 was significantly upregulated after tRF-36 overexpression (P < 0.05), whereas they were markedly downregulated after tRF-36 knockdown (P < 0.05; Figure 4b–d). Notch 4 mRNA expression was not significantly changed after transfection with the tRF-36 inhibitor (P > 0.05) but was upregulated after transfection with tRF-36 mimics (P < 0.05; Figure 4e). Smooth muscle marker (SMA-α and SM22α) expression was significantly higher in the HVSMCs with tRF-36 knockdown than that in the inhibitor NC group (P < 0.05) but was lower in the HVSMCs with tRF-36 overexpression than that in the mimics NC group (P < 0.05; Figure 4f and g). In addition, the tendencies of Notch 1, 2, and 3 protein levels were consistent with their mRNA levels (P < 0.05; Figure 4h).

Figure 4 Effects of tRF-36 on the growth of HVSMCs. (a) The cell viability in the HVSMCs after transfection with tRF-36 inhibitor or tRF-36 mimic detected by CCK-8. The mRNA expression levels of Notch 1 (b), 2 (c), 3 (d), and 4 (e) after cell transfection detected by RT-qPCR. The mRNA levels of SMA-α (f) and SM22α (g) after cell transfection detected by RT-qPCR. (h) The protein levels of Notch 1, 2, and 3 after cell transfection detected by western blot. *P < 0.05 compared to inhibitor NC and # P < 0.05 compared to mimics NC.
Figure 4

Effects of tRF-36 on the growth of HVSMCs. (a) The cell viability in the HVSMCs after transfection with tRF-36 inhibitor or tRF-36 mimic detected by CCK-8. The mRNA expression levels of Notch 1 (b), 2 (c), 3 (d), and 4 (e) after cell transfection detected by RT-qPCR. The mRNA levels of SMA-α (f) and SM22α (g) after cell transfection detected by RT-qPCR. (h) The protein levels of Notch 1, 2, and 3 after cell transfection detected by western blot. *P < 0.05 compared to inhibitor NC and # P < 0.05 compared to mimics NC.

3.5 Effects of the Notch pathway on the growth of HVSMCs

To further investigate whether tRF-36 regulates varicose vein progression through the Notch pathway, we inhibited the Notch pathway with DAPT and detected the expression of tRF-36. As expected, after HVSMCs were treated with DAPT, the expression of tRF-36 was significantly reduced compared to that in cells treated with DMSO (P < 0.05; Figure 5a). After 48, 72, and 96 h of culture, the viability of HVSMCs was significantly reduced after DAPT treatment compared to the DMSO group (P < 0.05), while viability was increased after transfection with tRF-36 mimics (P < 0.05). In the DAPT + tRF-36 mimics group, the viability was restored to a level similar to that in the DMSO group (P > 0.05; Figure 5b). Furthermore, the mRNA expression of SMA-α and SM22α was significantly upregulated after DAPT treatment compared with the DMSO group (P < 0.05), while they were downregulated after transfected with tRF-36 mimics (P < 0.05; Figure 5c and d). No significant difference in the SMA-α and SM22α mRNA expression was observed between the DMSO and DAPT + tRF-36 mimics groups (P > 0.05; Figure 5c and d). These outcomes implied that DAPT reversed the effects of tRF-36 mimics on the viability of HVSMCs and the expression of SMA-α and SM22α.

Figure 5 Effects of Notch pathway on the growth of HVSMCs. (a) The mRNA expression of tRF-36 after cells treated with DAPT detected by RT-qPCR. (b) The viability of HVSMCs after cell transfection or DAPT treatment detected by CCK-8. The mRNA expression of SMA-α (c) and SM22α (d) after cell transfection or DAPT treatment detected by RT-qPCR. *P < 0.05 compared to the DMSO group, # P < 0.05 compared to the DAPT group, and $ P < 0.05 compared to the tRF-36 mimics group.
Figure 5

Effects of Notch pathway on the growth of HVSMCs. (a) The mRNA expression of tRF-36 after cells treated with DAPT detected by RT-qPCR. (b) The viability of HVSMCs after cell transfection or DAPT treatment detected by CCK-8. The mRNA expression of SMA-α (c) and SM22α (d) after cell transfection or DAPT treatment detected by RT-qPCR. *P < 0.05 compared to the DMSO group, # P < 0.05 compared to the DAPT group, and $ P < 0.05 compared to the tRF-36 mimics group.

4 Discussion

Varicose veins can damage blood vessels, cause painful swelling, lead to thrombosis, increase in prevalence with age, and affect a person’s productivity and quality of life [27,28]. The global prevalence of varicose veins remains high, occurring in 1–73% of women and 2–56% of men [29,30]. However, the pathogenesis of varicose veins remains unclear and the pathogenic mechanisms remain elusive preventing the development of new treatments [31]. tRF-36 is upregulated in the vascular tissue of patients with varicose veins [14] and the Notch signaling pathway has been implicated in varicose veins [23]. However, the interaction between tRF-36 and the Notch pathway in varicose veins had not previously been explored. Here, we found that the Notch pathway was potentially activated in varicose veins and that tRF-36 levels were significantly higher in varicose vein tissues than in adjacent normal vascular tissues. Compared with the NC groups, tRF-36 knockdown significantly decreased the viability of HVSMCs, downregulated the expression of Notch 1, 2, and 3, and upregulated smooth muscle markers (SMA-α and SM22α). In addition, DAPT (a Notch pathway inhibitor) had similar effects to tRF-36 knockdown and could reverse the effects of tRF-36 mimics on the viability of HVSMCs and the expression of SMA-α and SM22α. Therefore, we speculated that tRF-36 knockdown may suppress varicose vein progression by inhibiting the Notch signaling pathway.

Varicose veins are associated with abnormal dilation and dysfunction of blood vessel wall [29]. HVSMCs play a central role in the normal functioning of blood vessels, including vasoconstriction, vessel wall maintenance, and repair [32]. Additionally, abnormal behavior of SMCs, such as excessive proliferation, migration, or apoptosis, may be related to the development of varicose veins [33,34]. Phenotypic abnormalities of SMCs in varicose veins have been reported to cause functional disturbance [34]. Therefore, in this study, we used HVSMCs to investigate the function of tRF-36 in varicose veins.

Although the role of tRFs in many biological processes has been extensively investigated, their role in varicose veins has not been fully explored [35]. A previous study suggested that tRFs, including tRF-36, tRF-23, and tRF-40, are differentially expressed in varicose veins [14]. Recently, Mahmutoglu et al. [36] investigated the correlation between tRF-36, tRF-23, and tRF-40 and varicocele progression. The results showed that tRF-36 may play a role in varicocele progression; however, the exact mechanism remained unclear. This study showed that tRF-36 was highly expressed in the varicose veins, and tRF-36 knockdown significantly decreased the viability of HVSMCs and increased the expression of SMA-α and SM22α. As non-terminally differentiated cells, VSMCs have two characteristic phenotypes: contractile and synthetic [37]. The VSMCs in adults are mainly of the contractile phenotype, and the SM22α is highly expressed in the cytoplasm. When the intima of the vascular wall is damaged or the vascular wall is stimulated by various factors, the VSMCs transform from a contractile phenotype into a synthetic one [38]. SMA-α is a vascular smooth muscle actin, which is mainly synthesized and expressed in contractile phenotype VSMCs [39]. Chen et al. [40] reported that SM22α and SMA-α were downregulated in varicose veins, indicating that VSMCs had transformed the contractile phenotype into a synthetic phenotype. Phenotypic changes in VSMCs promote venous wall remodeling, leading to the development of varicose veins. Taken together, it can be inferred that tRF-36 knockdown could upregulate the expression of α-SMA and SM22α. Thus, tRF-36 knockdown may be conducive to the transformation of VSMCs into a contractile phenotype, indicating the significance of tRF-36 in veins.

The Notch pathway is involved in many biological processes, including cell proliferation, fate determination, differentiation, and apoptosis. In the vascular system, the Notch pathway is critical for normal development and functional maintenance of blood vessels [41]. Notch signaling regulates the proliferation and migration of VSMCs, which play a critical role in the development of varicose veins [42]. Aberrant Notch signaling may lead to excessive proliferation and migration of VSMCs, resulting in abnormal dilation of the vessel wall [43]. In the present study, Notch 1, 2, and 3 were upregulated in varicose vein tissue samples, as detected by IF, suggesting that the Notch signaling pathway is potentially activated in varicose veins. The expression of tRF-36 was significantly decreased when the Notch pathway was inhibited. Additionally, inhibition of the Notch pathway resulted in similar effects as tRF-36 knockdown on the viability of HVSMCs and the expression of SMA-α and SM22α. Further studies revealed that Notch pathway inhibition reversed the effects of the tRF-36 mimic on the viability of HVSMCs. A previous study by Sreelakshmi et al. [23] demonstrated that Notch components are highly expressed in the neointima of varicose veins, and in vitro experiments have shown that even small changes in the venous flow pattern can enhance the ETS1/Notch signaling pathway, indicating that the Notch pathway plays an important role in the progression of varicose veins. Another study showed that forkhead box C2 (FOXC2) and FOXC2 antisense RNA 1 (FOXC2-AS1) were upregulated in varicose veins, and the overexpression of FOXC2-AS1 promoted phenotypic transition, proliferation, and migration of human great saphenous vein SMCs by activating the Notch pathway. However, both FOXC2 silencing and the Notch signaling inhibitor FLI-06 could eliminate the effects of FOXC2-AS1 overexpression [44]. Taken together with our results, these reports suggest that tRF-36 knockdown may inhibit the growth and phenotypic transition of HVSMCs by inhibiting the Notch pathway, thereby suppressing varicose vein development. However, it should be noted that the specific roles and mechanisms of Notch signaling in varicose veins are quite complex and require further exploration.

This study has some limitations. First, the sample size of three patients was small, which limits the generalizability of the findings. Therefore, our conclusions need to be further verified in a larger cohort. Second, the limitations of the assays used, such as the potential cross-reactivity of antibodies in IF and the efficiency and specificity of transfection reagents, should be considered in the future. In addition, our results must be verified through in vivo experiments.

In conclusion, our study suggested the critical role of tRF-36 in varicose veins. Importantly, we demonstrated for the first time that tRF-36 knockdown suppressed varicose vein development by inhibiting the Notch pathway (Figure 6). Our study provides new evidence for the functional roles of tRF-36 in varicose veins and lays the foundation for the development of effective therapeutic strategies based on the knockdown of tRF-36 and inhibition of the Notch pathway in varicose veins.

Figure 6 The relationships between varicose vein, tRF-36, and Notch signaling.
Figure 6

The relationships between varicose vein, tRF-36, and Notch signaling.

tel: +86-13917814518

  1. Funding information: Authors state no funding involved.

  2. Author contributions: G.J.C. and B.Z. designed the experiments. G.J.C., C.Y., Y.S., and D.N.C. carried out the experiments. G.J.C., C.Y., Y.S., and D.N.C. provided the clinical samples and statistical analysis. G.J.C. and B.Z. wrote and revised the manuscript. All authors have read and agreed to the published version of the manuscript.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Wang M, Sharma AK. Varicose veins. J Radiol Nurs. 2019;38:150–4.10.1016/j.jradnu.2019.04.004Search in Google Scholar

[2] Angle N, Bergan JJ. Varicose veins: chronic venous insufficiency. Vascular surgery: A comprehensive review, 5th edn. Philadelphia, PA: Saunders; 1998. p. 800–7.Search in Google Scholar

[3] Alsaigh T, Fukaya E. Varicose veins and chronic venous disease. Cardiol Clin. 2021;39:567–81.10.1016/j.ccl.2021.06.009Search in Google Scholar PubMed

[4] Raetz J, Wilson M, Collins K. Varicose veins: diagnosis and treatment. Am Fam Physician. 2019;99:682–8.Search in Google Scholar

[5] Li X, Yang B, Li X, Ren S. Prospective comparison of effect of ligation and foam sclerotherapy with foam sclerotherapy alone for varicose veins. Ann Vasc Surg. 2018;49:75–9.10.1016/j.avsg.2018.01.004Search in Google Scholar PubMed

[6] Li X, Ren S, Li X. Outcomes of foam sclerotherapy plus ligation versus foam sclerotherapy alone for venous ulcers in lower extremities. Ann Vasc Surg. 2017;45:160–5.10.1016/j.avsg.2017.06.055Search in Google Scholar PubMed

[7] Gao R-D, Qian S-Y, Wang H-H, Liu Y-S, Ren S-Y. Strategies and challenges in treatment of varicose veins and venous insufficiency. World J Clin Cases. 2022;10:5946.10.12998/wjcc.v10.i18.5946Search in Google Scholar PubMed PubMed Central

[8] Dwerryhouse S, Davies B, Harradine K, Earnshaw JJ. Stripping the long saphenous vein reduces the rate of reoperation for recurrent varicose veins: five-year results of a randomized trial. J Vasc Surg. 1999;29:589–92.10.1016/S0741-5214(99)70302-2Search in Google Scholar

[9] Leeper NJ, Maegdefessel L. Non-coding RNAs: key regulators of smooth muscle cell fate in vascular disease. Cardiovasc Res. 2018;114:611–21.10.1093/cvr/cvx249Search in Google Scholar PubMed PubMed Central

[10] Zhao Y, Wang K, Zhao C, Liu N, Wang Z, Yang W, et al. The function of tRNA-derived small RNAs in cardiovascular diseases. Mol Therapy-Nucleic Acids. 2024;35(1):102114.10.1016/j.omtn.2024.102114Search in Google Scholar PubMed PubMed Central

[11] Ivanov P, Emara MM, Villen J, Gygi SP, Anderson P. Angiogenin-induced tRNA fragments inhibit translation initiation. Mol Cell. 2011;43:613–23.10.1016/j.molcel.2011.06.022Search in Google Scholar PubMed PubMed Central

[12] Garcia-Silva MR, Cabrera-Cabrera F, Güida MC, Cayota A. Novel aspects of tRNA-derived small RNAs with potential impact in infectious diseases. Adv Biosci Biotechnol. 2013;4(5A):17–25.10.4236/abb.2013.45A002Search in Google Scholar

[13] Pekarsky Y, Balatti V, Palamarchuk A, Rizzotto L, Veneziano D, Nigita G, et al. Dysregulation of a family of short noncoding RNAs, tsRNAs, in human cancer. Proc Natl Acad Sci. 2016;113:5071–6.10.1073/pnas.1604266113Search in Google Scholar PubMed PubMed Central

[14] Yu C, Wang X, Hong Y, Chen G, Ge J, Cao H, et al. Expression profile of tRNA‑derived fragments and their potential roles in human varicose veins. Mol Med Rep. 2019;20:3191–201.10.3892/mmr.2019.10544Search in Google Scholar PubMed PubMed Central

[15] Fan X-R, Huang Y, Su Y, Chen S-J, Zhang Y-L, Huang W-K, et al. Exploring the regulatory mechanism of tRNA-derived fragments 36 in acute pancreatitis based on small RNA sequencing and experiments. World J Gastroenterol. 2023;29:4642.10.3748/wjg.v29.i30.4642Search in Google Scholar PubMed PubMed Central

[16] Artavanis-Tsakonas S, Rand MD, Lake RJ. Notch signaling: cell fate control and signal integration in development. Science. 1999;284:770–6.10.1126/science.284.5415.770Search in Google Scholar PubMed

[17] Gozlan O, Sprinzak D. Notch signaling in development and homeostasis. Development. 2023;150:dev201138.10.1242/dev.201138Search in Google Scholar PubMed

[18] Gridley T. Notch signaling in the vasculature. Curr Top Dev Biol. 2010;92:277–309.10.1016/S0070-2153(10)92009-7Search in Google Scholar PubMed PubMed Central

[19] Kukita K, Matsuzaka N, Takai M, Imamura Y, Shin Y. Notch signaling pathway induces expression of type IV collagen in angiogenesis. J Biochem. 2024;175:539–49.10.1093/jb/mvad120Search in Google Scholar PubMed

[20] Iso T, Hamamori Y, Kedes L. Notch signaling in vascular development. Arterioscler Thrombo Vasc Biol. 2003;23:543–53.10.1161/01.ATV.0000060892.81529.8FSearch in Google Scholar PubMed

[21] Zhao T, Li X, Qian H, Miao X, Zhu Y, Wang J, et al. PM(2.5) induces the abnormal lipid metabolism and leads to atherosclerosis via Notch signaling pathway in rats. Toxicology. 2023;485:153415.10.1016/j.tox.2022.153415Search in Google Scholar PubMed

[22] Jiang A, Liu L, Wang J, Liu Y, Deng S, Jiang T. Linarin ameliorates restenosis after vascular injury in type 2 diabetes mellitus via regulating ADAM10-mediated notch signaling pathway. Cardiovasc Toxicol. 2024;24:587–97.10.1007/s12012-024-09863-4Search in Google Scholar PubMed

[23] Sreelakshmi BJ, Karthika CL, Ahalya S, Kalpana SR, Kartha CC, Sumi S. Mechanoresponsive ETS1 causes endothelial dysfunction and arterialization in varicose veins via NOTCH4/DLL4 signaling. Eur J Cell Biol. 2024;103:151420.10.1016/j.ejcb.2024.151420Search in Google Scholar PubMed

[24] Xiao Y, Huang Z, Yin H, Lin Y, Wang S. In vitro differences between smooth muscle cells derived from varicose veins and normal veins. J Vasc Surg. 2009;50:1149–54.10.1016/j.jvs.2009.06.048Search in Google Scholar PubMed

[25] Ortega MA, Romero B, Asúnsolo Á, Sainz F, Martinez-Vivero C, Álvarez-Mon M, et al. Behavior of smooth muscle cells under hypoxic conditions: possible implications on the varicose vein endothelium. BioMed Res Int. 2018;2018:7156150.10.1155/2018/7156150Search in Google Scholar PubMed PubMed Central

[26] Zhou Q, Yang H, Pan H, Pan H, Zhou J. Exosomes isolated from the miR-215-modified bone marrow mesenchymal stem cells protect H2O2-induced rat myoblasts via the miR-215/FABP3 pathway. Exp Mol Pathol. 2021;119:104608.10.1016/j.yexmp.2021.104608Search in Google Scholar PubMed

[27] Whiteley MS. Current best practice in the management of varicose veins. Clin Cosmet Invest Dermatol. 2022;15:567–83.10.2147/CCID.S294990Search in Google Scholar PubMed PubMed Central

[28] Gawas M, Bains A, Janghu S, Kamat P, Chawla P. A comprehensive review on varicose veins: preventive measures and different treatments. J Am Nutr Assoc. 2022;41:499–510.10.1080/07315724.2021.1909510Search in Google Scholar PubMed

[29] Raffetto J, Khalil R. Mechanisms of varicose vein formation: valve dysfunction and wall dilation. Phlebology. 2008;23:85–98.10.1258/phleb.2007.007027Search in Google Scholar PubMed

[30] Beebe-Dimmer JL, Pfeifer JR, Engle JS, Schottenfeld D. The epidemiology of chronic venous insufficiency and varicose veins. Ann Epidemiol. 2005;15:175–84.10.1016/j.annepidem.2004.05.015Search in Google Scholar PubMed

[31] Chandran Latha K, Sreekumar A, Beena V, SS BR, Lakkappa RB, Kalyani R, et al. Shear stress alterations activate BMP4/pSMAD5 signaling and induce endothelial mesenchymal transition in varicose veins. Cells. 2021;10:3563.10.3390/cells10123563Search in Google Scholar PubMed PubMed Central

[32] Bacakova L, Travnickova M, Filova E, Matějka R, Stepanovska J, Musilkova J, et al. The role of vascular smooth muscle cells in the physiology and pathophysiology of blood vessels. Muscle Cell Tissue-Current Status Res Field. 2018;1:13.10.5772/intechopen.77115Search in Google Scholar

[33] Urbanek T, Skop B, Wiaderkiewicz R, Wilczok T, Ziaja K, Lebda-Wyborny T, et al. Smooth muscle cell apoptosis in primary varicose veins. Eur J Vasc Endovasc Surg. 2004;28:600–11.10.1016/j.ejvs.2004.09.008Search in Google Scholar PubMed

[34] Xu Y, Bei Y, Li Y, Chu H. Phenotypic and functional transformation in smooth muscle cells derived from varicose veins. J Vasc Surg: Venous Lymphatic Disord. 2017;5:723–33.10.1016/j.jvsv.2017.04.009Search in Google Scholar PubMed

[35] Weng Q, Wang Y, Xie Y, Yu X, Zhang S, Ge J, et al. Extracellular vesicles-associated tRNA-derived fragments (tRFs): biogenesis, biological functions, and their role as potential biomarkers in human diseases. J Mol Med. 2022;100:679–95.10.1007/s00109-022-02189-0Search in Google Scholar PubMed PubMed Central

[36] Mahmutoglu AM, Caniklioglu M, Caniklioglu A, Kaymak E, Terzi Y. Association between transfer RNA-derived fragments and varicocele. Fertil Steril. 2023;120:e274.10.1016/j.fertnstert.2023.08.807Search in Google Scholar

[37] Wen J-kHan, M, Zheng B, Yang S-L. Comparison of gene expression patterns and migration capability at quiescent and proliferating vascular smooth muscle cells stimulated by cytokines. Life Sci. 2002;70:799–807.10.1016/S0024-3205(01)01446-1Search in Google Scholar PubMed

[38] Lees-Miller JP, Heeley DH, Smillie LB. An abundant and novel protein of 22 kDa (SM22) is widely distributed in smooth muscles. Purification from bovine aorta. Biochem J. 1987;244:705–9.10.1042/bj2440705Search in Google Scholar PubMed PubMed Central

[39] Régent A, Ly KH, Lofek S, Clary G, Tamby M, Tamas N, et al. Proteomic analysis of vascular smooth muscle cells in physiological condition and in pulmonary arterial hypertension: Toward contractile versus synthetic phenotypes. Proteomics. 2016;16:2637–49.10.1002/pmic.201500006Search in Google Scholar PubMed

[40] Chen S, Qin S, Pei C, Zhang S. Expression and significance of NELIN and SM22α in varicose vein tissue. Exp Ther Med. 2015;9(3):345–9.10.3892/etm.2015.2170Search in Google Scholar PubMed PubMed Central

[41] Tetzlaff F, Fischer A. Control of blood vessel formation by notch signaling. Mol Mech Notch Signal. 2018;1066:319–8.10.1007/978-3-319-89512-3_16Search in Google Scholar PubMed

[42] Boucher J, Gridley T, Liaw L. Molecular pathways of notch signaling in vascular smooth muscle cells. Front Physiol. 2012;3:81.10.3389/fphys.2012.00081Search in Google Scholar PubMed PubMed Central

[43] Baeten J, Lilly B. Notch signaling in vascular smooth muscle cells. Adv Pharmacol. 2017;78:351–82.10.1016/bs.apha.2016.07.002Search in Google Scholar PubMed PubMed Central

[44] Zhang C, Li H, Guo X. FOXC2-AS1 regulates phenotypic transition, proliferation and migration of human great saphenous vein smooth muscle cells. Biol Res. 2019;52:59.10.1186/s40659-019-0266-zSearch in Google Scholar PubMed PubMed Central

Received: 2024-06-25
Revised: 2025-01-15
Accepted: 2025-02-11
Published Online: 2025-04-24

© 2025 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Mechanism of triptolide regulating proliferation and apoptosis of hepatoma cells by inhibiting JAK/STAT pathway
  3. Maslinic acid improves mitochondrial function and inhibits oxidative stress and autophagy in human gastric smooth muscle cells
  4. Comparative analysis of inflammatory biomarkers for the diagnosis of neonatal sepsis: IL-6, IL-8, SAA, CRP, and PCT
  5. Post-pandemic insights on COVID-19 and premature ovarian insufficiency
  6. Proteome differences of dental stem cells between permanent and deciduous teeth by data-independent acquisition proteomics
  7. Optimizing a modified cetyltrimethylammonium bromide protocol for fungal DNA extraction: Insights from multilocus gene amplification
  8. Preliminary analysis of the role of small hepatitis B surface proteins mutations in the pathogenesis of occult hepatitis B infection via the endoplasmic reticulum stress-induced UPR-ERAD pathway
  9. Efficacy of alginate-coated gold nanoparticles against antibiotics-resistant Staphylococcus and Streptococcus pathogens of acne origins
  10. Battling COVID-19 leveraging nanobiotechnology: Gold and silver nanoparticle–B-escin conjugates as SARS-CoV-2 inhibitors
  11. Neurodegenerative diseases and neuroinflammation-induced apoptosis
  12. Impact of fracture fixation surgery on cognitive function and the gut microbiota in mice with a history of stroke
  13. COLEC10: A potential tumor suppressor and prognostic biomarker in hepatocellular carcinoma through modulation of EMT and PI3K-AKT pathways
  14. High-temperature requirement serine protease A2 inhibitor UCF-101 ameliorates damaged neurons in traumatic brain-injured rats by the AMPK/NF-κB pathway
  15. SIK1 inhibits IL-1β-stimulated cartilage apoptosis and inflammation in vitro through the CRTC2/CREB1 signaling
  16. Rutin–chitooligosaccharide complex: Comprehensive evaluation of its anti-inflammatory and analgesic properties in vitro and in vivo
  17. Knockdown of Aurora kinase B alleviates high glucose-triggered trophoblast cells damage and inflammation during gestational diabetes
  18. Calcium-sensing receptors promoted Homer1 expression and osteogenic differentiation in bone marrow mesenchymal stem cells
  19. ABI3BP can inhibit the proliferation, invasion, and epithelial–mesenchymal transition of non-small-cell lung cancer cells
  20. Changes in blood glucose and metabolism in hyperuricemia mice
  21. Rapid detection of the GJB2 c.235delC mutation based on CRISPR-Cas13a combined with lateral flow dipstick
  22. IL-11 promotes Ang II-induced autophagy inhibition and mitochondrial dysfunction in atrial fibroblasts
  23. Short-chain fatty acid attenuates intestinal inflammation by regulation of gut microbial composition in antibiotic-associated diarrhea
  24. Application of metagenomic next-generation sequencing in the diagnosis of pathogens in patients with diabetes complicated by community-acquired pneumonia
  25. NAT10 promotes radiotherapy resistance in non-small cell lung cancer by regulating KPNB1-mediated PD-L1 nuclear translocation
  26. Phytol-mixed micelles alleviate dexamethasone-induced osteoporosis in zebrafish: Activation of the MMP3–OPN–MAPK pathway-mediating bone remodeling
  27. Association between TGF-β1 and β-catenin expression in the vaginal wall of patients with pelvic organ prolapse
  28. Primary pleomorphic liposarcoma involving bilateral ovaries: Case report and literature review
  29. Effects of de novo donor-specific Class I and II antibodies on graft outcomes after liver transplantation: A pilot cohort study
  30. Sleep architecture in Alzheimer’s disease continuum: The deep sleep question
  31. Ephedra fragilis plant extract: A groundbreaking corrosion inhibitor for mild steel in acidic environments – electrochemical, EDX, DFT, and Monte Carlo studies
  32. Langerhans cell histiocytosis in an adult patient with upper jaw and pulmonary involvement: A case report
  33. Inhibition of mast cell activation by Jaranol-targeted Pirin ameliorates allergic responses in mouse allergic rhinitis
  34. Aeromonas veronii-induced septic arthritis of the hip in a child with acute lymphoblastic leukemia
  35. Clusterin activates the heat shock response via the PI3K/Akt pathway to protect cardiomyocytes from high-temperature-induced apoptosis
  36. Research progress on fecal microbiota transplantation in tumor prevention and treatment
  37. Low-pressure exposure influences the development of HAPE
  38. Stigmasterol alleviates endplate chondrocyte degeneration through inducing mitophagy by enhancing PINK1 mRNA acetylation via the ESR1/NAT10 axis
  39. AKAP12, mediated by transcription factor 21, inhibits cell proliferation, metastasis, and glycolysis in lung squamous cell carcinoma
  40. Association between PAX9 or MSX1 gene polymorphism and tooth agenesis risk: A meta-analysis
  41. A case of bloodstream infection caused by Neisseria gonorrhoeae
  42. Case of nasopharyngeal tuberculosis complicated with cervical lymph node and pulmonary tuberculosis
  43. p-Cymene inhibits pro-fibrotic and inflammatory mediators to prevent hepatic dysfunction
  44. GFPT2 promotes paclitaxel resistance in epithelial ovarian cancer cells via activating NF-κB signaling pathway
  45. Transfer RNA-derived fragment tRF-36 modulates varicose vein progression via human vascular smooth muscle cell Notch signaling
  46. RTA-408 attenuates the hepatic ischemia reperfusion injury in mice possibly by activating the Nrf2/HO-1 signaling pathway
  47. Decreased serum TIMP4 levels in patients with rheumatoid arthritis
  48. Sirt1 protects lupus nephritis by inhibiting the NLRP3 signaling pathway in human glomerular mesangial cells
  49. Sodium butyrate aids brain injury repair in neonatal rats
  50. Interaction of MTHFR polymorphism with PAX1 methylation in cervical cancer
  51. Convallatoxin inhibits proliferation and angiogenesis of glioma cells via regulating JAK/STAT3 pathway
  52. The effect of the PKR inhibitor, 2-aminopurine, on the replication of influenza A virus, and segment 8 mRNA splicing
  53. Effects of Ire1 gene on virulence and pathogenicity of Candida albicans
  54. Small cell lung cancer with small intestinal metastasis: Case report and literature review
  55. GRB14: A prognostic biomarker driving tumor progression in gastric cancer through the PI3K/AKT signaling pathway by interacting with COBLL1
  56. 15-Lipoxygenase-2 deficiency induces foam cell formation that can be restored by salidroside through the inhibition of arachidonic acid effects
  57. FTO alleviated the diabetic nephropathy progression by regulating the N6-methyladenosine levels of DACT1
  58. Clinical relevance of inflammatory markers in the evaluation of severity of ulcerative colitis: A retrospective study
  59. Zinc valproic acid complex promotes osteoblast differentiation and exhibits anti-osteoporotic potential
  60. Primary pulmonary synovial sarcoma in the bronchial cavity: A case report
  61. Metagenomic next-generation sequencing of alveolar lavage fluid improves the detection of pulmonary infection
  62. Uterine tumor resembling ovarian sex cord tumor with extensive rhabdoid differentiation: A case report
  63. Genomic analysis of a novel ST11(PR34365) Clostridioides difficile strain isolated from the human fecal of a CDI patient in Guizhou, China
  64. Effects of tiered cardiac rehabilitation on CRP, TNF-α, and physical endurance in older adults with coronary heart disease
  65. Changes in T-lymphocyte subpopulations in patients with colorectal cancer before and after acupoint catgut embedding acupuncture observation
  66. Modulating the tumor microenvironment: The role of traditional Chinese medicine in improving lung cancer treatment
  67. Alterations of metabolites related to microbiota–gut–brain axis in plasma of colon cancer, esophageal cancer, stomach cancer, and lung cancer patients
  68. Research on individualized drug sensitivity detection technology based on bio-3D printing technology for precision treatment of gastrointestinal stromal tumors
  69. CEBPB promotes ulcerative colitis-associated colorectal cancer by stimulating tumor growth and activating the NF-κB/STAT3 signaling pathway
  70. Oncolytic bacteria: A revolutionary approach to cancer therapy
  71. A de novo meningioma with rapid growth: A possible malignancy imposter?
  72. Diagnosis of secondary tuberculosis infection in an asymptomatic elderly with cancer using next-generation sequencing: Case report
  73. Hesperidin and its zinc(ii) complex enhance osteoblast differentiation and bone formation: In vitro and in vivo evaluations
  74. Research progress on the regulation of autophagy in cardiovascular diseases by chemokines
  75. Anti-arthritic, immunomodulatory, and inflammatory regulation by the benzimidazole derivative BMZ-AD: Insights from an FCA-induced rat model
  76. Immunoassay for pyruvate kinase M1/2 as an Alzheimer’s biomarker in CSF
  77. The role of HDAC11 in age-related hearing loss: Mechanisms and therapeutic implications
  78. Evaluation and application analysis of animal models of PIPNP based on data mining
  79. Therapeutic approaches for liver fibrosis/cirrhosis by targeting pyroptosis
  80. Fabrication of zinc oxide nanoparticles using Ruellia tuberosa leaf extract induces apoptosis through P53 and STAT3 signalling pathways in prostate cancer cells
  81. Haplo-hematopoietic stem cell transplantation and immunoradiotherapy for severe aplastic anemia complicated with nasopharyngeal carcinoma: A case report
  82. Modulation of the KEAP1-NRF2 pathway by Erianin: A novel approach to reduce psoriasiform inflammation and inflammatory signaling
  83. The expression of epidermal growth factor receptor 2 and its relationship with tumor-infiltrating lymphocytes and clinical pathological features in breast cancer patients
  84. Innovations in MALDI-TOF Mass Spectrometry: Bridging modern diagnostics and historical insights
  85. BAP1 complexes with YY1 and RBBP7 and its downstream targets in ccRCC cells
  86. Hypereosinophilic syndrome with elevated IgG4 and T-cell clonality: A report of two cases
  87. Electroacupuncture alleviates sciatic nerve injury in sciatica rats by regulating BDNF and NGF levels, myelin sheath degradation, and autophagy
  88. Polydatin prevents cholesterol gallstone formation by regulating cholesterol metabolism via PPAR-γ signaling
  89. RNF144A and RNF144B: Important molecules for health
  90. Analysis of the detection rate and related factors of thyroid nodules in the healthy population
  91. Artesunate inhibits hepatocellular carcinoma cell migration and invasion through OGA-mediated O-GlcNAcylation of ZEB1
  92. Endovascular management of post-pancreatectomy hemorrhage caused by a hepatic artery pseudoaneurysm: Case report and review of the literature
  93. Efficacy and safety of anti-PD-1/PD-L1 antibodies in patients with relapsed refractory diffuse large B-cell lymphoma: A meta-analysis
  94. SATB2 promotes humeral fracture healing in rats by activating the PI3K/AKT pathway
  95. Overexpression of the ferroptosis-related gene, NFS1, corresponds to gastric cancer growth and tumor immune infiltration
  96. Understanding risk factors and prognosis in diabetic foot ulcers
  97. Atractylenolide I alleviates the experimental allergic response in mice by suppressing TLR4/NF-kB/NLRP3 signalling
  98. FBXO31 inhibits the stemness characteristics of CD147 (+) melanoma stem cells
  99. Immune molecule diagnostics in colorectal cancer: CCL2 and CXCL11
  100. Inhibiting CXCR6 promotes senescence of activated hepatic stellate cells with limited proinflammatory SASP to attenuate hepatic fibrosis
  101. Cadmium toxicity, health risk and its remediation using low-cost biochar adsorbents
  102. Pulmonary cryptococcosis with headache as the first presentation: A case report
  103. Solitary pulmonary metastasis with cystic airspaces in colon cancer: A rare case report
  104. RUNX1 promotes denervation-induced muscle atrophy by activating the JUNB/NF-κB pathway and driving M1 macrophage polarization
  105. Morphometric analysis and immunobiological investigation of Indigofera oblongifolia on the infected lung with Plasmodium chabaudi
  106. The NuA4/TIP60 histone-modifying complex and Hr78 modulate the Lobe2 mutant eye phenotype
  107. Experimental study on salmon demineralized bone matrix loaded with recombinant human bone morphogenetic protein-2: In vitro and in vivo study
  108. A case of IgA nephropathy treated with a combination of telitacicept and half-dose glucocorticoids
  109. Analgesic and toxicological evaluation of cannabidiol-rich Moroccan Cannabis sativa L. (Khardala variety) extract: Evidence from an in vivo and in silico study
  110. Wound healing and signaling pathways
  111. Combination of immunotherapy and whole-brain radiotherapy on prognosis of patients with multiple brain metastases: A retrospective cohort study
  112. To explore the relationship between endometrial hyperemia and polycystic ovary syndrome
  113. Research progress on the impact of curcumin on immune responses in breast cancer
  114. Biogenic Cu/Ni nanotherapeutics from Descurainia sophia (L.) Webb ex Prantl seeds for the treatment of lung cancer
  115. Dapagliflozin attenuates atrial fibrosis via the HMGB1/RAGE pathway in atrial fibrillation rats
  116. Glycitein alleviates inflammation and apoptosis in keratinocytes via ROS-associated PI3K–Akt signalling pathway
  117. ADH5 inhibits proliferation but promotes EMT in non-small cell lung cancer cell through activating Smad2/Smad3
  118. Apoptotic efficacies of AgNPs formulated by Syzygium aromaticum leaf extract on 32D-FLT3-ITD human leukemia cell line with PI3K/AKT/mTOR signaling pathway
  119. Novel cuproptosis-related genes C1QBP and PFKP identified as prognostic and therapeutic targets in lung adenocarcinoma
  120. Bee venom promotes exosome secretion and alters miRNA cargo in T cells
  121. Treatment of pure red cell aplasia in a chronic kidney disease patient with roxadustat: A case report
  122. Comparative bioinformatics analysis of the Wnt pathway in breast cancer: Selection of novel biomarker panels associated with ER status
  123. Kynurenine facilitates renal cell carcinoma progression by suppressing M2 macrophage pyroptosis through inhibition of CASP1 cleavage
  124. RFX5 promotes the growth, motility, and inhibits apoptosis of gastric adenocarcinoma cells through the SIRT1/AMPK axis
  125. ALKBH5 exacerbates early cardiac damage after radiotherapy for breast cancer via m6A demethylation of TLR4
  126. Phytochemicals of Roman chamomile: Antioxidant, anti-aging, and whitening activities of distillation residues
  127. Circadian gene Cry1 inhibits the tumorigenicity of hepatocellular carcinoma by the BAX/BCL2-mediated apoptosis pathway
  128. The TNFR-RIPK1/RIPK3 signalling pathway mediates the effect of lanthanum on necroptosis of nerve cells
  129. Longitudinal monitoring of autoantibody dynamics in patients with early-stage non-small-cell lung cancer undergoing surgery
  130. The potential role of rutin, a flavonoid, in the management of cancer through modulation of cell signaling pathways
  131. Construction of pectinase gene engineering microbe and its application in tobacco sheets
  132. Construction of a microbial abundance prognostic scoring model based on intratumoral microbial data for predicting the prognosis of lung squamous cell carcinoma
  133. Sepsis complicated by haemophagocytic lymphohistiocytosis triggered by methicillin-resistant Staphylococcus aureus and human herpesvirus 8 in an immunocompromised elderly patient: A case report
  134. Sarcopenia in liver transplantation: A comprehensive bibliometric study of current research trends and future directions
  135. Advances in cancer immunotherapy and future directions in personalized medicine
  136. Can coronavirus disease 2019 affect male fertility or cause spontaneous abortion? A two-sample Mendelian randomization analysis
  137. Heat stroke associated with novel leukaemia inhibitory factor receptor gene variant in a Chinese infant
  138. PSME2 exacerbates ulcerative colitis by disrupting intestinal barrier function and promoting autophagy-dependent inflammation
  139. Hyperosmolar hyperglycemic state with severe hypernatremia coexisting with central diabetes insipidus: A case report and literature review
  140. Efficacy and mechanism of escin in improving the tissue microenvironment of blood vessel walls via anti-inflammatory and anticoagulant effects: Implications for clinical practice
  141. Merkel cell carcinoma: Clinicopathological analysis of three patients and literature review
  142. Genetic variants in VWF exon 26 and their implications for type 1 Von Willebrand disease in a Saudi Arabian population
  143. Lipoxin A4 improves myocardial ischemia/reperfusion injury through the Notch1-Nrf2 signaling pathway
  144. High levels of EPHB2 expression predict a poor prognosis and promote tumor progression in endometrial cancer
  145. Knockdown of SHP-2 delays renal tubular epithelial cell injury in diabetic nephropathy by inhibiting NLRP3 inflammasome-mediated pyroptosis
  146. Exploring the toxicity mechanisms and detoxification methods of Rhizoma Paridis
  147. Concomitant gastric carcinoma and primary hepatic angiosarcoma in a patient: A case report
  148. Ecology and Environmental Science
  149. Optimization and comparative study of Bacillus consortia for cellulolytic potential and cellulase enzyme activity
  150. The complete mitochondrial genome analysis of Haemaphysalis hystricis Supino, 1897 (Ixodida: Ixodidae) and its phylogenetic implications
  151. Epidemiological characteristics and risk factors analysis of multidrug-resistant tuberculosis among tuberculosis population in Huzhou City, Eastern China
  152. Indices of human impacts on landscapes: How do they reflect the proportions of natural habitats?
  153. Genetic analysis of the Siberian flying squirrel population in the northern Changbai Mountains, Northeast China: Insights into population status and conservation
  154. Diversity and environmental drivers of Suillus communities in Pinus sylvestris var. mongolica forests of Inner Mongolia
  155. Global assessment of the fate of nitrogen deposition in forest ecosystems: Insights from 15N tracer studies
  156. Fungal and bacterial pathogenic co-infections mainly lead to the assembly of microbial community in tobacco stems
  157. Influencing of coal industry related airborne particulate matter on ocular surface tear film injury and inflammatory factor expression in Sprague-Dawley rats
  158. Temperature-dependent development, predation, and life table of Sphaerophoria macrogaster (Thomson) (Diptera: Syrphidae) feeding on Myzus persicae (Sulzer) (Homoptera: Aphididae)
  159. Eleonora’s falcon trophic interactions with insects within its breeding range: A systematic review
  160. Agriculture
  161. Integrated analysis of transcriptome, sRNAome, and degradome involved in the drought-response of maize Zhengdan958
  162. Variation in flower frost tolerance among seven apple cultivars and transcriptome response patterns in two contrastingly frost-tolerant selected cultivars
  163. Heritability of durable resistance to stripe rust in bread wheat (Triticum aestivum L.)
  164. Molecular mechanism of follicular development in laying hens based on the regulation of water metabolism
  165. Animal Science
  166. Effect of sex ratio on the life history traits of an important invasive species, Spodoptera frugiperda
  167. Plant Sciences
  168. Hairpin in a haystack: In silico identification and characterization of plant-conserved microRNA in Rafflesiaceae
  169. Widely targeted metabolomics of different tissues in Rubus corchorifolius
  170. The complete chloroplast genome of Gerbera piloselloides (L.) Cass., 1820 (Carduoideae, Asteraceae) and its phylogenetic analysis
  171. Field trial to correlate mineral solubilization activity of Pseudomonas aeruginosa and biochemical content of groundnut plants
  172. Correlation analysis between semen routine parameters and sperm DNA fragmentation index in patients with semen non-liquefaction: A retrospective study
  173. Plasticity of the anatomical traits of Rhododendron L. (Ericaceae) leaves and its implications in adaptation to the plateau environment
  174. Effects of Piriformospora indica and arbuscular mycorrhizal fungus on growth and physiology of Moringa oleifera under low-temperature stress
  175. Effects of different sources of potassium fertiliser on yield, fruit quality and nutrient absorption in “Harward” kiwifruit (Actinidia deliciosa)
  176. Comparative efficiency and residue levels of spraying programs against powdery mildew in grape varieties
  177. The DREB7 transcription factor enhances salt tolerance in soybean plants under salt stress
  178. Using plant electrical signals of water hyacinth (Eichhornia crassipes) for water pollution monitoring
  179. Food Science
  180. Phytochemical analysis of Stachys iva: Discovering the optimal extract conditions and its bioactive compounds
  181. Review on role of honey in disease prevention and treatment through modulation of biological activities
  182. Computational analysis of polymorphic residues in maltose and maltotriose transporters of a wild Saccharomyces cerevisiae strain
  183. Optimization of phenolic compound extraction from Tunisian squash by-products: A sustainable approach for antioxidant and antibacterial applications
  184. Liupao tea aqueous extract alleviates dextran sulfate sodium-induced ulcerative colitis in rats by modulating the gut microbiota
  185. Toxicological qualities and detoxification trends of fruit by-products for valorization: A review
  186. Polyphenolic spectrum of cornelian cherry fruits and their health-promoting effect
  187. Optimizing the encapsulation of the refined extract of squash peels for functional food applications: A sustainable approach to reduce food waste
  188. Advancements in curcuminoid formulations: An update on bioavailability enhancement strategies curcuminoid bioavailability and formulations
  189. Impact of saline sprouting on antioxidant properties and bioactive compounds in chia seeds
  190. The dilemma of food genetics and improvement
  191. Bioengineering and Biotechnology
  192. Impact of hyaluronic acid-modified hafnium metalorganic frameworks containing rhynchophylline on Alzheimer’s disease
  193. Emerging patterns in nanoparticle-based therapeutic approaches for rheumatoid arthritis: A comprehensive bibliometric and visual analysis spanning two decades
  194. Application of CRISPR/Cas gene editing for infectious disease control in poultry
  195. Preparation of hafnium nitride-coated titanium implants by magnetron sputtering technology and evaluation of their antibacterial properties and biocompatibility
  196. Preparation and characterization of lemongrass oil nanoemulsion: Antimicrobial, antibiofilm, antioxidant, and anticancer activities
  197. Corrigendum
  198. Corrigendum to “Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells”
  199. Corrigendum to “Effects of Ire1 gene on virulence and pathogenicity of Candida albicans”
  200. Retraction
  201. Retraction of “Down-regulation of miR-539 indicates poor prognosis in patients with pancreatic cancer”
https://doi.org/10.1515/biol-2025-1075
Keywords for this article
varicose veins; tRF-36; human vascular smooth muscle cells; Notch pathway; phenotypic switching
Creative Commons
BY 4.0

Articles in the same Issue

  1. Biomedical Sciences
  2. Mechanism of triptolide regulating proliferation and apoptosis of hepatoma cells by inhibiting JAK/STAT pathway
  3. Maslinic acid improves mitochondrial function and inhibits oxidative stress and autophagy in human gastric smooth muscle cells
  4. Comparative analysis of inflammatory biomarkers for the diagnosis of neonatal sepsis: IL-6, IL-8, SAA, CRP, and PCT
  5. Post-pandemic insights on COVID-19 and premature ovarian insufficiency
  6. Proteome differences of dental stem cells between permanent and deciduous teeth by data-independent acquisition proteomics
  7. Optimizing a modified cetyltrimethylammonium bromide protocol for fungal DNA extraction: Insights from multilocus gene amplification
  8. Preliminary analysis of the role of small hepatitis B surface proteins mutations in the pathogenesis of occult hepatitis B infection via the endoplasmic reticulum stress-induced UPR-ERAD pathway
  9. Efficacy of alginate-coated gold nanoparticles against antibiotics-resistant Staphylococcus and Streptococcus pathogens of acne origins
  10. Battling COVID-19 leveraging nanobiotechnology: Gold and silver nanoparticle–B-escin conjugates as SARS-CoV-2 inhibitors
  11. Neurodegenerative diseases and neuroinflammation-induced apoptosis
  12. Impact of fracture fixation surgery on cognitive function and the gut microbiota in mice with a history of stroke
  13. COLEC10: A potential tumor suppressor and prognostic biomarker in hepatocellular carcinoma through modulation of EMT and PI3K-AKT pathways
  14. High-temperature requirement serine protease A2 inhibitor UCF-101 ameliorates damaged neurons in traumatic brain-injured rats by the AMPK/NF-κB pathway
  15. SIK1 inhibits IL-1β-stimulated cartilage apoptosis and inflammation in vitro through the CRTC2/CREB1 signaling
  16. Rutin–chitooligosaccharide complex: Comprehensive evaluation of its anti-inflammatory and analgesic properties in vitro and in vivo
  17. Knockdown of Aurora kinase B alleviates high glucose-triggered trophoblast cells damage and inflammation during gestational diabetes
  18. Calcium-sensing receptors promoted Homer1 expression and osteogenic differentiation in bone marrow mesenchymal stem cells
  19. ABI3BP can inhibit the proliferation, invasion, and epithelial–mesenchymal transition of non-small-cell lung cancer cells
  20. Changes in blood glucose and metabolism in hyperuricemia mice
  21. Rapid detection of the GJB2 c.235delC mutation based on CRISPR-Cas13a combined with lateral flow dipstick
  22. IL-11 promotes Ang II-induced autophagy inhibition and mitochondrial dysfunction in atrial fibroblasts
  23. Short-chain fatty acid attenuates intestinal inflammation by regulation of gut microbial composition in antibiotic-associated diarrhea
  24. Application of metagenomic next-generation sequencing in the diagnosis of pathogens in patients with diabetes complicated by community-acquired pneumonia
  25. NAT10 promotes radiotherapy resistance in non-small cell lung cancer by regulating KPNB1-mediated PD-L1 nuclear translocation
  26. Phytol-mixed micelles alleviate dexamethasone-induced osteoporosis in zebrafish: Activation of the MMP3–OPN–MAPK pathway-mediating bone remodeling
  27. Association between TGF-β1 and β-catenin expression in the vaginal wall of patients with pelvic organ prolapse
  28. Primary pleomorphic liposarcoma involving bilateral ovaries: Case report and literature review
  29. Effects of de novo donor-specific Class I and II antibodies on graft outcomes after liver transplantation: A pilot cohort study
  30. Sleep architecture in Alzheimer’s disease continuum: The deep sleep question
  31. Ephedra fragilis plant extract: A groundbreaking corrosion inhibitor for mild steel in acidic environments – electrochemical, EDX, DFT, and Monte Carlo studies
  32. Langerhans cell histiocytosis in an adult patient with upper jaw and pulmonary involvement: A case report
  33. Inhibition of mast cell activation by Jaranol-targeted Pirin ameliorates allergic responses in mouse allergic rhinitis
  34. Aeromonas veronii-induced septic arthritis of the hip in a child with acute lymphoblastic leukemia
  35. Clusterin activates the heat shock response via the PI3K/Akt pathway to protect cardiomyocytes from high-temperature-induced apoptosis
  36. Research progress on fecal microbiota transplantation in tumor prevention and treatment
  37. Low-pressure exposure influences the development of HAPE
  38. Stigmasterol alleviates endplate chondrocyte degeneration through inducing mitophagy by enhancing PINK1 mRNA acetylation via the ESR1/NAT10 axis
  39. AKAP12, mediated by transcription factor 21, inhibits cell proliferation, metastasis, and glycolysis in lung squamous cell carcinoma
  40. Association between PAX9 or MSX1 gene polymorphism and tooth agenesis risk: A meta-analysis
  41. A case of bloodstream infection caused by Neisseria gonorrhoeae
  42. Case of nasopharyngeal tuberculosis complicated with cervical lymph node and pulmonary tuberculosis
  43. p-Cymene inhibits pro-fibrotic and inflammatory mediators to prevent hepatic dysfunction
  44. GFPT2 promotes paclitaxel resistance in epithelial ovarian cancer cells via activating NF-κB signaling pathway
  45. Transfer RNA-derived fragment tRF-36 modulates varicose vein progression via human vascular smooth muscle cell Notch signaling
  46. RTA-408 attenuates the hepatic ischemia reperfusion injury in mice possibly by activating the Nrf2/HO-1 signaling pathway
  47. Decreased serum TIMP4 levels in patients with rheumatoid arthritis
  48. Sirt1 protects lupus nephritis by inhibiting the NLRP3 signaling pathway in human glomerular mesangial cells
  49. Sodium butyrate aids brain injury repair in neonatal rats
  50. Interaction of MTHFR polymorphism with PAX1 methylation in cervical cancer
  51. Convallatoxin inhibits proliferation and angiogenesis of glioma cells via regulating JAK/STAT3 pathway
  52. The effect of the PKR inhibitor, 2-aminopurine, on the replication of influenza A virus, and segment 8 mRNA splicing
  53. Effects of Ire1 gene on virulence and pathogenicity of Candida albicans
  54. Small cell lung cancer with small intestinal metastasis: Case report and literature review
  55. GRB14: A prognostic biomarker driving tumor progression in gastric cancer through the PI3K/AKT signaling pathway by interacting with COBLL1
  56. 15-Lipoxygenase-2 deficiency induces foam cell formation that can be restored by salidroside through the inhibition of arachidonic acid effects
  57. FTO alleviated the diabetic nephropathy progression by regulating the N6-methyladenosine levels of DACT1
  58. Clinical relevance of inflammatory markers in the evaluation of severity of ulcerative colitis: A retrospective study
  59. Zinc valproic acid complex promotes osteoblast differentiation and exhibits anti-osteoporotic potential
  60. Primary pulmonary synovial sarcoma in the bronchial cavity: A case report
  61. Metagenomic next-generation sequencing of alveolar lavage fluid improves the detection of pulmonary infection
  62. Uterine tumor resembling ovarian sex cord tumor with extensive rhabdoid differentiation: A case report
  63. Genomic analysis of a novel ST11(PR34365) Clostridioides difficile strain isolated from the human fecal of a CDI patient in Guizhou, China
  64. Effects of tiered cardiac rehabilitation on CRP, TNF-α, and physical endurance in older adults with coronary heart disease
  65. Changes in T-lymphocyte subpopulations in patients with colorectal cancer before and after acupoint catgut embedding acupuncture observation
  66. Modulating the tumor microenvironment: The role of traditional Chinese medicine in improving lung cancer treatment
  67. Alterations of metabolites related to microbiota–gut–brain axis in plasma of colon cancer, esophageal cancer, stomach cancer, and lung cancer patients
  68. Research on individualized drug sensitivity detection technology based on bio-3D printing technology for precision treatment of gastrointestinal stromal tumors
  69. CEBPB promotes ulcerative colitis-associated colorectal cancer by stimulating tumor growth and activating the NF-κB/STAT3 signaling pathway
  70. Oncolytic bacteria: A revolutionary approach to cancer therapy
  71. A de novo meningioma with rapid growth: A possible malignancy imposter?
  72. Diagnosis of secondary tuberculosis infection in an asymptomatic elderly with cancer using next-generation sequencing: Case report
  73. Hesperidin and its zinc(ii) complex enhance osteoblast differentiation and bone formation: In vitro and in vivo evaluations
  74. Research progress on the regulation of autophagy in cardiovascular diseases by chemokines
  75. Anti-arthritic, immunomodulatory, and inflammatory regulation by the benzimidazole derivative BMZ-AD: Insights from an FCA-induced rat model
  76. Immunoassay for pyruvate kinase M1/2 as an Alzheimer’s biomarker in CSF
  77. The role of HDAC11 in age-related hearing loss: Mechanisms and therapeutic implications
  78. Evaluation and application analysis of animal models of PIPNP based on data mining
  79. Therapeutic approaches for liver fibrosis/cirrhosis by targeting pyroptosis
  80. Fabrication of zinc oxide nanoparticles using Ruellia tuberosa leaf extract induces apoptosis through P53 and STAT3 signalling pathways in prostate cancer cells
  81. Haplo-hematopoietic stem cell transplantation and immunoradiotherapy for severe aplastic anemia complicated with nasopharyngeal carcinoma: A case report
  82. Modulation of the KEAP1-NRF2 pathway by Erianin: A novel approach to reduce psoriasiform inflammation and inflammatory signaling
  83. The expression of epidermal growth factor receptor 2 and its relationship with tumor-infiltrating lymphocytes and clinical pathological features in breast cancer patients
  84. Innovations in MALDI-TOF Mass Spectrometry: Bridging modern diagnostics and historical insights
  85. BAP1 complexes with YY1 and RBBP7 and its downstream targets in ccRCC cells
  86. Hypereosinophilic syndrome with elevated IgG4 and T-cell clonality: A report of two cases
  87. Electroacupuncture alleviates sciatic nerve injury in sciatica rats by regulating BDNF and NGF levels, myelin sheath degradation, and autophagy
  88. Polydatin prevents cholesterol gallstone formation by regulating cholesterol metabolism via PPAR-γ signaling
  89. RNF144A and RNF144B: Important molecules for health
  90. Analysis of the detection rate and related factors of thyroid nodules in the healthy population
  91. Artesunate inhibits hepatocellular carcinoma cell migration and invasion through OGA-mediated O-GlcNAcylation of ZEB1
  92. Endovascular management of post-pancreatectomy hemorrhage caused by a hepatic artery pseudoaneurysm: Case report and review of the literature
  93. Efficacy and safety of anti-PD-1/PD-L1 antibodies in patients with relapsed refractory diffuse large B-cell lymphoma: A meta-analysis
  94. SATB2 promotes humeral fracture healing in rats by activating the PI3K/AKT pathway
  95. Overexpression of the ferroptosis-related gene, NFS1, corresponds to gastric cancer growth and tumor immune infiltration
  96. Understanding risk factors and prognosis in diabetic foot ulcers
  97. Atractylenolide I alleviates the experimental allergic response in mice by suppressing TLR4/NF-kB/NLRP3 signalling
  98. FBXO31 inhibits the stemness characteristics of CD147 (+) melanoma stem cells
  99. Immune molecule diagnostics in colorectal cancer: CCL2 and CXCL11
  100. Inhibiting CXCR6 promotes senescence of activated hepatic stellate cells with limited proinflammatory SASP to attenuate hepatic fibrosis
  101. Cadmium toxicity, health risk and its remediation using low-cost biochar adsorbents
  102. Pulmonary cryptococcosis with headache as the first presentation: A case report
  103. Solitary pulmonary metastasis with cystic airspaces in colon cancer: A rare case report
  104. RUNX1 promotes denervation-induced muscle atrophy by activating the JUNB/NF-κB pathway and driving M1 macrophage polarization
  105. Morphometric analysis and immunobiological investigation of Indigofera oblongifolia on the infected lung with Plasmodium chabaudi
  106. The NuA4/TIP60 histone-modifying complex and Hr78 modulate the Lobe2 mutant eye phenotype
  107. Experimental study on salmon demineralized bone matrix loaded with recombinant human bone morphogenetic protein-2: In vitro and in vivo study
  108. A case of IgA nephropathy treated with a combination of telitacicept and half-dose glucocorticoids
  109. Analgesic and toxicological evaluation of cannabidiol-rich Moroccan Cannabis sativa L. (Khardala variety) extract: Evidence from an in vivo and in silico study
  110. Wound healing and signaling pathways
  111. Combination of immunotherapy and whole-brain radiotherapy on prognosis of patients with multiple brain metastases: A retrospective cohort study
  112. To explore the relationship between endometrial hyperemia and polycystic ovary syndrome
  113. Research progress on the impact of curcumin on immune responses in breast cancer
  114. Biogenic Cu/Ni nanotherapeutics from Descurainia sophia (L.) Webb ex Prantl seeds for the treatment of lung cancer
  115. Dapagliflozin attenuates atrial fibrosis via the HMGB1/RAGE pathway in atrial fibrillation rats
  116. Glycitein alleviates inflammation and apoptosis in keratinocytes via ROS-associated PI3K–Akt signalling pathway
  117. ADH5 inhibits proliferation but promotes EMT in non-small cell lung cancer cell through activating Smad2/Smad3
  118. Apoptotic efficacies of AgNPs formulated by Syzygium aromaticum leaf extract on 32D-FLT3-ITD human leukemia cell line with PI3K/AKT/mTOR signaling pathway
  119. Novel cuproptosis-related genes C1QBP and PFKP identified as prognostic and therapeutic targets in lung adenocarcinoma
  120. Bee venom promotes exosome secretion and alters miRNA cargo in T cells
  121. Treatment of pure red cell aplasia in a chronic kidney disease patient with roxadustat: A case report
  122. Comparative bioinformatics analysis of the Wnt pathway in breast cancer: Selection of novel biomarker panels associated with ER status
  123. Kynurenine facilitates renal cell carcinoma progression by suppressing M2 macrophage pyroptosis through inhibition of CASP1 cleavage
  124. RFX5 promotes the growth, motility, and inhibits apoptosis of gastric adenocarcinoma cells through the SIRT1/AMPK axis
  125. ALKBH5 exacerbates early cardiac damage after radiotherapy for breast cancer via m6A demethylation of TLR4
  126. Phytochemicals of Roman chamomile: Antioxidant, anti-aging, and whitening activities of distillation residues
  127. Circadian gene Cry1 inhibits the tumorigenicity of hepatocellular carcinoma by the BAX/BCL2-mediated apoptosis pathway
  128. The TNFR-RIPK1/RIPK3 signalling pathway mediates the effect of lanthanum on necroptosis of nerve cells
  129. Longitudinal monitoring of autoantibody dynamics in patients with early-stage non-small-cell lung cancer undergoing surgery
  130. The potential role of rutin, a flavonoid, in the management of cancer through modulation of cell signaling pathways
  131. Construction of pectinase gene engineering microbe and its application in tobacco sheets
  132. Construction of a microbial abundance prognostic scoring model based on intratumoral microbial data for predicting the prognosis of lung squamous cell carcinoma
  133. Sepsis complicated by haemophagocytic lymphohistiocytosis triggered by methicillin-resistant Staphylococcus aureus and human herpesvirus 8 in an immunocompromised elderly patient: A case report
  134. Sarcopenia in liver transplantation: A comprehensive bibliometric study of current research trends and future directions
  135. Advances in cancer immunotherapy and future directions in personalized medicine
  136. Can coronavirus disease 2019 affect male fertility or cause spontaneous abortion? A two-sample Mendelian randomization analysis
  137. Heat stroke associated with novel leukaemia inhibitory factor receptor gene variant in a Chinese infant
  138. PSME2 exacerbates ulcerative colitis by disrupting intestinal barrier function and promoting autophagy-dependent inflammation
  139. Hyperosmolar hyperglycemic state with severe hypernatremia coexisting with central diabetes insipidus: A case report and literature review
  140. Efficacy and mechanism of escin in improving the tissue microenvironment of blood vessel walls via anti-inflammatory and anticoagulant effects: Implications for clinical practice
  141. Merkel cell carcinoma: Clinicopathological analysis of three patients and literature review
  142. Genetic variants in VWF exon 26 and their implications for type 1 Von Willebrand disease in a Saudi Arabian population
  143. Lipoxin A4 improves myocardial ischemia/reperfusion injury through the Notch1-Nrf2 signaling pathway
  144. High levels of EPHB2 expression predict a poor prognosis and promote tumor progression in endometrial cancer
  145. Knockdown of SHP-2 delays renal tubular epithelial cell injury in diabetic nephropathy by inhibiting NLRP3 inflammasome-mediated pyroptosis
  146. Exploring the toxicity mechanisms and detoxification methods of Rhizoma Paridis
  147. Concomitant gastric carcinoma and primary hepatic angiosarcoma in a patient: A case report
  148. Ecology and Environmental Science
  149. Optimization and comparative study of Bacillus consortia for cellulolytic potential and cellulase enzyme activity
  150. The complete mitochondrial genome analysis of Haemaphysalis hystricis Supino, 1897 (Ixodida: Ixodidae) and its phylogenetic implications
  151. Epidemiological characteristics and risk factors analysis of multidrug-resistant tuberculosis among tuberculosis population in Huzhou City, Eastern China
  152. Indices of human impacts on landscapes: How do they reflect the proportions of natural habitats?
  153. Genetic analysis of the Siberian flying squirrel population in the northern Changbai Mountains, Northeast China: Insights into population status and conservation
  154. Diversity and environmental drivers of Suillus communities in Pinus sylvestris var. mongolica forests of Inner Mongolia
  155. Global assessment of the fate of nitrogen deposition in forest ecosystems: Insights from 15N tracer studies
  156. Fungal and bacterial pathogenic co-infections mainly lead to the assembly of microbial community in tobacco stems
  157. Influencing of coal industry related airborne particulate matter on ocular surface tear film injury and inflammatory factor expression in Sprague-Dawley rats
  158. Temperature-dependent development, predation, and life table of Sphaerophoria macrogaster (Thomson) (Diptera: Syrphidae) feeding on Myzus persicae (Sulzer) (Homoptera: Aphididae)
  159. Eleonora’s falcon trophic interactions with insects within its breeding range: A systematic review
  160. Agriculture
  161. Integrated analysis of transcriptome, sRNAome, and degradome involved in the drought-response of maize Zhengdan958
  162. Variation in flower frost tolerance among seven apple cultivars and transcriptome response patterns in two contrastingly frost-tolerant selected cultivars
  163. Heritability of durable resistance to stripe rust in bread wheat (Triticum aestivum L.)
  164. Molecular mechanism of follicular development in laying hens based on the regulation of water metabolism
  165. Animal Science
  166. Effect of sex ratio on the life history traits of an important invasive species, Spodoptera frugiperda
  167. Plant Sciences
  168. Hairpin in a haystack: In silico identification and characterization of plant-conserved microRNA in Rafflesiaceae
  169. Widely targeted metabolomics of different tissues in Rubus corchorifolius
  170. The complete chloroplast genome of Gerbera piloselloides (L.) Cass., 1820 (Carduoideae, Asteraceae) and its phylogenetic analysis
  171. Field trial to correlate mineral solubilization activity of Pseudomonas aeruginosa and biochemical content of groundnut plants
  172. Correlation analysis between semen routine parameters and sperm DNA fragmentation index in patients with semen non-liquefaction: A retrospective study
  173. Plasticity of the anatomical traits of Rhododendron L. (Ericaceae) leaves and its implications in adaptation to the plateau environment
  174. Effects of Piriformospora indica and arbuscular mycorrhizal fungus on growth and physiology of Moringa oleifera under low-temperature stress
  175. Effects of different sources of potassium fertiliser on yield, fruit quality and nutrient absorption in “Harward” kiwifruit (Actinidia deliciosa)
  176. Comparative efficiency and residue levels of spraying programs against powdery mildew in grape varieties
  177. The DREB7 transcription factor enhances salt tolerance in soybean plants under salt stress
  178. Using plant electrical signals of water hyacinth (Eichhornia crassipes) for water pollution monitoring
  179. Food Science
  180. Phytochemical analysis of Stachys iva: Discovering the optimal extract conditions and its bioactive compounds
  181. Review on role of honey in disease prevention and treatment through modulation of biological activities
  182. Computational analysis of polymorphic residues in maltose and maltotriose transporters of a wild Saccharomyces cerevisiae strain
  183. Optimization of phenolic compound extraction from Tunisian squash by-products: A sustainable approach for antioxidant and antibacterial applications
  184. Liupao tea aqueous extract alleviates dextran sulfate sodium-induced ulcerative colitis in rats by modulating the gut microbiota
  185. Toxicological qualities and detoxification trends of fruit by-products for valorization: A review
  186. Polyphenolic spectrum of cornelian cherry fruits and their health-promoting effect
  187. Optimizing the encapsulation of the refined extract of squash peels for functional food applications: A sustainable approach to reduce food waste
  188. Advancements in curcuminoid formulations: An update on bioavailability enhancement strategies curcuminoid bioavailability and formulations
  189. Impact of saline sprouting on antioxidant properties and bioactive compounds in chia seeds
  190. The dilemma of food genetics and improvement
  191. Bioengineering and Biotechnology
  192. Impact of hyaluronic acid-modified hafnium metalorganic frameworks containing rhynchophylline on Alzheimer’s disease
  193. Emerging patterns in nanoparticle-based therapeutic approaches for rheumatoid arthritis: A comprehensive bibliometric and visual analysis spanning two decades
  194. Application of CRISPR/Cas gene editing for infectious disease control in poultry
  195. Preparation of hafnium nitride-coated titanium implants by magnetron sputtering technology and evaluation of their antibacterial properties and biocompatibility
  196. Preparation and characterization of lemongrass oil nanoemulsion: Antimicrobial, antibiofilm, antioxidant, and anticancer activities
  197. Corrigendum
  198. Corrigendum to “Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells”
  199. Corrigendum to “Effects of Ire1 gene on virulence and pathogenicity of Candida albicans”
  200. Retraction
  201. Retraction of “Down-regulation of miR-539 indicates poor prognosis in patients with pancreatic cancer”
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 25.12.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2025-1075/html
Scroll to top button