Abstract
A-kinase anchor protein 12 (AKAP12) has been reported to be related to lung squamous cell carcinoma (LUSC) progression. However, its role and molecular mechanisms in LUSC have not been revealed. The mRNA and protein levels of AKAP12 and transcription factor 21 (TCF21) were tested by quantitative real-time PCR and western blot. Cell counting kit 8 assay, EdU assay, flow cytometry, wound healing assay, and transwell assay were used to evaluate cell proliferation, apoptosis, migration, and invasion. Cell glycolysis was measured by testing glucose consumption and lactate production. The interaction between AKAP12 and TCF21 was assessed by ChIP assay and dual-luciferase reporter assay. A mice xenograft model was constructed to explore AKAP12 and TCF21 roles in vivo. Our data showed that AKAP12 was underexpressed in LUSC tissues and cells, and its overexpression inhibited LUSC cell growth, metastasis, and glycolysis. TCF21 had decreased expression in LUSC, which facilitated AKAP12 expression through binding to its promoter region to enhance its transcription. Furthermore, TCF21 increased AKAP12 expression to repress LUSC cell growth, metastasis, and glycolysis. In vivo experiments showed that AKAP12 upregulation reduced LUSC tumorigenesis, and TCF21 knockdown reversed this effect. In conclusion, AKAP12 might be a tumor suppressor in LUSC, which was mediated by TCF21 and could inhibit cell growth, metastasis, and glycolysis to restrain LUSC malignant progression.
Graphical abstract

1 Introduction
According to the degree of differentiation and biological characteristics, lung cancer is currently divided into two categories, namely small-cell lung cancer (SCLC) and non-small-cell lung cancer (NSCLC) [1]. Lung squamous cell carcinoma (LUSC) is the second most prevalent type of lung cancer and is a pathological subtype of NSCLC [2,3]. Most LUSC patients are diagnosed at an advanced stage, resulting in high mortality [4,5]. At present, patients with advanced LUSC have no chance of radical surgery, and the treatment options are very limited due to lacking effective targeted drugs [6]. Gefitinib and erlotinib targeting epidermal growth factor receptors have been used in the treatment of lung cancer, and EGFR polymorphism has been found to be associated with toxicity associated with tyrosine kinase inhibitors [7]. Circulating neuroendocrine markers chromogranin A (CGA), pro-gastrin-releasing peptide, and neuron-specific enolase may play a potential role in the stage and prognosis of SCLC patients [8]. Although immunotherapy has brought new hope to advanced LUSC, it is not available to all patients [9]. Therefore, the search for specific molecular targets is of great importance for LUSC treatment.
A-kinase anchor protein 12 (AKAP12) is a novel potent scaffold protein for key signaling factors [10]. Studies had found that AKAP12 was lowly expressed in many cancers and had anti-tumor activity, such as esophageal squamous carcinoma cell [11] and breast cancer [10]. Importantly, AKAP12 was confirmed to be downregulated in lung adenocarcinoma, and its inhibition might block cancer malignant progression [12]. Besides, the methylation of AKAP12 was associated with the prognosis of lung cancer patients [13]. Chen et al. found that AKAP12, a pyroptosis-related gene, could be used as a prognostic marker for LUSC [14]. Through database analysis, we found that AKAP12 was underexpressed in LUSC tissues. However, its role and mechanism in LUSC remain unclear.
Transcription factor 21 (TCF21) is a member of the basic helix-loop-helix protein family [15], which is expressed in many tissues and may be involved in regulating lineage-specific gene expression by forming heterodimers with proteins [16]. TCF21 has been found to mediate many biological processes by serving as a tumor suppressor [17]. TCF21 protein expression was confirmed to be reduced in lung cancer cells [18]. Through the LinkedOmics database, we discovered that there was a positive correlation between TCF21 and AKAP12 expression in LUSC tissues. However, as a transcription factor, whether TCF21-regulated LUSC progression by mediating AKAP12 transcription and expression is unknown.
Here, we revealed the role and mechanism of AKAP12 in LUSC progression. Based on the above, we hypothesized that AKAP12 might be regulated by TCF21 to inhibit the malignant progression of LUSC. Our study hopes to provide new ideas for developing clinical treatment options for LUSC.
2 Materials and methods
2.1 Samples
LUSC patients (n = 54) were recruited from No. 215 Hospital of Shaanxi Nuclear Industry, and their tumor tissues and adjacent normal tissues were obtained after surgical resections and stored at −80°C.
-
Informed consent: Informed consent has been obtained from all individuals included in this study.
-
Ethical approval: The research related to human use has been complied with all the relevant national regulations, institutional policies and in accordance with the tenets of the Helsinki Declaration, and has been approved by the Ethics Committee of No. 215 Hospital of Shaanxi Nuclear Industry.
2.2 Cell culture and transfection
Human normal bronchial epithelial cells (BEAS-2B) and LUSC cells (H1703 and H520) were purchased from ATCC (Manassas, VA, USA). BEAS-2B cells were cultured in BEGM medium (Lonza, Basel, Switzerland), and LUSC cells were grown at RPMI-1640 medium with 10% FBS (Gibco, Carlsbad, CA, USA). For in vitro experiments, transfections of AKAP12/TCF21 overexpression vector and shRNA were performed using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA).
2.3 Quantitative real-time PCR (qRT-PCR)
Total RNA was extracted by TRIzol reagent (Invitrogen). The extracted RNA was reverse-transcribed with the RevertAid RT Kit (Thermo Fisher Scientific, Waltham, MA, USA). SYBR Green (Thermo Fisher Scientific) was used for qRT-PCR with specific primers (Table 1). Relative expression was tested by the 2−ΔΔCt method. At present, various methods are used in the examination of lung tumors, including qRT-PCR [19].
Primer sequences used for qRT-PCR
| Name | Primers for PCR (5′–3′) | |
|---|---|---|
| AKAP12 | Forward | GAGATGGCTACTAAGTCAGCGG |
| Reverse | CAGTGGGTTGTGTTAGCTCTTC | |
| TCF21 | Forward | TCCTGGCTAACGACAAATACGA |
| Reverse | TTTCCCGGCCACCATAAAGG | |
| β-Actin | Forward | CTTCGCGGGCGACGAT |
| Reverse | CCACATAGGAATCCTTCTGACC |
2.4 Western blot (WB)
H1703 and H520 cells were lysed with RIPA (Beyotime, Shanghai, China) to extract proteins. Extracted proteins were separated and transferred to PVDF membranes. The membrane was blocked and incubated with antibodies. After that, the ECL reagent (Beyotime) was used to detect protein signals. Antibodies were listed as follows: anti-AKAP12 (ab198895, 1:600, Abcam), anti-TCF21 (ab182134, 1:2000, Abcam), anti-β-actin (66009-1-Ig, 1:20,000, Proteintech, Rosemont, IL, USA), and secondary antibody (ab205718 or ab205719, Abcam). The method of WB was consistent with previously described [20].
2.5 Cell counting kit 8 (CCK8) assay
H1703 and H520 cells in 96-well plates were treated with CCK8 reagent (Beyotime) after incubation for 24, 48, 72, and 96 h, respectively. Cell viability was evaluated by detecting the OD value at 450 nm by a microplate reader.
2.6 EdU assay
H1703 and H520 cells in 96-well plates were labeled with EdU solution and DAPI solution using EdU Cell Proliferation Kit (Beyotime). A fluorescence microscope was used to observe the fluorescence signals, and the EdU positive cell rate was analyzed by ImageJ software.
2.7 Flow cytometry
H1703 and H520 cells (5 × 105 cells) were collected and resuspended with binding buffer (Beyotime). Cells were incubated with Annexin V-FITC (Beyotime) away from light for 15 min. Afterwards, cells were treated with PI dyeing solution (Beyotime). Cell apoptotic rate was analyzed by FACScalibur flow cytometer (BD Biosciences, San Diego, CA, USA) with CellQuest Pro software (BD Biosciences). The method of flow cytometry was consistent with previously described [21].
2.8 Wound healing assay
H1703 and H520 cells were inoculated in 24-well plates. Using the ruler as a reference, a wound was created using a pipette. After being cultured for 24 h, the cell wound area was photographed to count the wound closure rate.
2.9 Transwell assay
H1703 and H520 cells were inoculated into the upper of transwell chamber (BD Biosciences, San Jose, CA, USA) pre-coated with diluted Matrigel, and the completed medium was filled into the lower chamber. After being cultured for 24 h, invaded cell numbers were counted under a microscope.
2.10 Cell glycolysis detection
According to the product instructions, Glucose Content Assay Kit and Lactic Acid Content Assay Kit (Solarbio, Beijing, China) were used to evaluate glucose consumption and lactate production in H1703 and H520 cells, respectively.
2.11 ChIP assay
Based on ChIP Kit (Beyotime) instructions, H1703 and H520 cells were incubated with formaldehyde, and the cross-linked chromatins were fragments. Supernatants were extracted and incubated with anti-TCF21, anti-IgG, and protein A + G agarose. The precipitate was eluted to collect the chromatin-containing supernatant. Then, the enrichment of the AKAP12 promoter was examined by qRT-PCR.
2.12 Dual-luciferase reporter assay
The promoter sequence of AKAP12 bound to TCF21 was cloned into a pGL3-basic vector (Promega, Madison, WI, USA) to construct a WT/MUT-AKAP12 vector. 293T cells were co-transfected with sh-NC/sh-TCF21/Mock/TCF21 and WT/MUT-AKAP12. Luciferase activity was tested using the related kit (Promega).
2.13 Mice xenograft models
BALB/c nude mice (4 weeks; Vital River, Beijing, China) were subcutaneously injected with H1703 cells transfected with lentivirus AKAP12 overexpression vector and sh-TCF21 in the right side of the back (n = 5/group). Tumor volume and weight were evaluated every 7 days. After 35 days, mice were sacrificed to collect tumor tissues. Additionally, tumor tissues were prepared as paraffin sections to perform immunohistochemical (IHC) staining with anti-TCF21 (ab182134, Abcam), anti-AKAP12 (ab198895, Abcam), anti-Ki67 (27309-1-AP, Proteintech), and anti-E-cadherin (20874-1-AP, Proteintech).
-
Ethical approval: The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals. Animal studies were approved by the Animal Ethics Committee of No. 215 Hospital of Shaanxi Nuclear Industry and performed according to the Guide for the Care and Use of Laboratory Animals.
2.14 Statistical analysis
Data were expressed as mean ± SD in GraphPad Prism 7 software. Statistical analyses were performed using Student’s t-test or analysis of variance. Statistical significance was set as P < 0.05.
3 Results
3.1 AKAP12 had decreased expression in LUSC tissues and cells
The TIMER database showed that AKAP12 was differentially expressed in the Cancer Genome Atlas (TCGA) pan-cancer dataset (Figure 1a). Besides, the GEPIA database revealed that AKAP12 was lowly expressed in LUSC tumor tissues compared to normal tissues (Figure 1b). Through qRT-PCR and WB, we detected a downregulated mRNA and protein expression of AKAP12 in LUSC tissues (Figure 1c and d). Moreover, AKAP12 protein expression was lower in LUSC cells (H1703 and H520) than in BEAS-2B cells (Figure 1e).

AKAP12 expression in LUSC tissues and cells. (a) TIMER database showed AKAP12 expression in TCGA pan-cancer dataset. (b) GEPIA database revealed AKAP12 expression in LUSC tumor tissues and normal tissues. (c) AKAP12 mRNA level in LUSC tumor tissues (n = 54) and adjacent normal tissues (n = 54) was detected by qRT-PCR. (d) AKAP12 protein level was detected by WB in LUSC tumor tissues (n = 3) and adjacent normal tissues (n = 3). (e) AKAP12 protein level in BEAS-2B, H1703, and H520 cells was measured using WB. *P < 0.05, **P < 0.01, ***P < 0.001.
3.2 AKAP12 suppressed LUSC cell growth, metastasis, and glycolysis
Further analysis was performed to reveal AKAP12 roles in LUSC cell behaviors. We overexpressed AKAP12 at the protein level in H1703 and H520 cells by transfection of AKAP12 overexpression vector (Figure 2a). The results of CCK8 assay, EdU assay, and flow cytometry suggested that AKAP12 overexpression decreased LUSC cell viability, reduced EdU positive cell rate, and enhanced apoptotic cell rate (Figure 2b–d). Meanwhile, we also observed that upregulation of AKAP12 inhibited wound closure rate, invaded cell numbers, glucose consumption, and lactate production in H1703 and H520 cells (Figure 2e–h).

Effects of AKAP12 on LUSC cell growth, metastasis, and glycolysis. H1703 and H520 cells were transfected with Mock and AKAP12 overexpression vectors. (a) AKAP12 protein level was detected by WB. CCK8 assay (b), EdU assay (c), flow cytometry (d), wound healing assay (e), and transwell assay (f) were used to measure cell proliferation, apoptosis, migration, and invasion. (g and h) Cell glycolysis was assessed via testing glucose consumption and lactate production. *P < 0.05, **P < 0.01, ***P < 0.001.
3.3 TCF21 was positively correlated with AKAP12 expression in LUSC tissues
Volcano plot revealed the genes associated with AKAP12 expression in LUSC tissues in the LinkedOmics database (Figure 3a), where TOP50 genes with positive (left) and negative (right) correlations (Pearson correlation >0.5, P < 0.05) are shown in Figure 3b. To search for the upstream transcription factors of AKAP12, LinkedOmics database (selected genes positively correlated with AKAP12 expression in LUSC tissues, Pearson correlation >0.5, P < 0.05), GEPIA dataset (selected the downregulated genes in LUSC tissues, P < 0.05, log2FoldChange <−1) and AnimalTFDB database (selected the transcription factors with binding sites to AKAP12 promoters) were selected, and the intersection was taken to screen out four genes (Figure 3c). TCF21 has been confirmed to play tumor suppressor effect in lung cancer [18], but its mechanism in LUSC is still unclear. Therefore, TCF21 was selected for further exploration. The LinkedOmics database indicated that TCF21 was positively correlated with AKAP12 expression in LUSC tissues (Figure 3d), and the GEPIA database suggested that TCF21 was downregulated in LUSC tissues (Figure 3e). Through qRT-PCR, we confirmed the decreased TCD21 expression in LUSC tissues (Figure 3f), and further analysis confirmed the positive correlation between AKAP12 and TCF21 levels (Figure 3g). The detection of TCF21 protein expression suggested that TCF21 was lowly expressed in LUSC tissues and cells (Figure 3h and i).

TCF21 expression in LUSC tissues and cells. (a) LinkedOmics database showed the genes associated with AKAP12 expression in LUSC tissues (green-negative, red-positive). (b) TOP50 genes with positive (left) and negative (right) correlations were shown. (c) Venn diagram screened the genes from LinkedOmics database, GEPIA dataset, and AnimalTFDB database. (d) LinkedOmics database showed the correlation between TCF21 and AKAP12 expression in LUSC tissues. (e) GEPIA database revealed TCF21 expression in LUSC tumor tissues and normal tissues. (f) TCF21 mRNA level was measured using qRT-PCR in LUSC tumor tissues (n = 54) and adjacent normal tissues (n = 54). (g) Pearson correlation coefficient analyzed the correlation between TCF21 and AKAP12 expression in LUSC tissues. (h) TCF21 protein level in LUSC tumor tissues (n = 3) and adjacent normal tissues (n = 3) was examined by WB. (i) TCF21 protein level was tested using WB in BEAS-2B, H1703, and H520 cells. *P < 0.05, **P < 0.01, ***P < 0.001.
3.4 TCF21 promoted AKAP12 expression through binding to its promoter region
Animal TFDB database predicted that TCF21 had binding sites in the promoter region of AKAP12 (Figure 4a). Then, a ChIP assay was performed, and we confirmed that immunoprecipitated AKAP12 promoter fragments were significantly enriched in anti-TCF21 (Figure 4b). Moreover, only the luciferase activity of the WT-AKAP12 vector rather than the MUT-AKAP12 vector could be reduced by sh-TCF21 and promoted by TCF21 overexpression (Figure 4c and d). Besides, downregulated TCF21 using sh-TCF21 could significantly decrease AKAP12 protein level (Figure 4e and f), and upregulated TCF21 using TCF21 overexpression vector also markedly increased AKAP12 protein level (Figure 4g and h). Similarly, we obtained the same results at the mRNA level (Figure 4i and j).

TCF21 interacted with AKAP12. (a) The binding sites of TCF21 in AKAP12 promoter region were shown. ChIP assay (b) and dual-luciferase reporter assay (c and d) were performed to confirm the interaction between TCF21 and AKAP12. (e–h) TCF21 and AKAP12 protein levels were tested by WB in H1703 and H520 cells transfected with sh-NC/sh-TCF21/Mock/TCF21 overexpression vector. (i and j) AKAP12 mRNA level was tested by qRT-PCR in H1703 and H520 cells transfected with sh-NC/sh-TCF21/Mock/TCF21 overexpression vector. *P < 0.05, **P < 0.01, ***P < 0.001.
3.5 TCF21 reduced LUSC cell functions by decreasing AKAP12 expression
To explore TCF21 roles in LUSC progression and whether TCF21 regulates AKAP12 to mediate the LUSC process, H1703 and H520 cells were transfected with TCF21 overexpression vector and sh-AKAP12. AKAP12 protein expression enhanced by TCF21 overexpression vector could be abolished by sh-AKAP12 (Figure 5a). TCF21 overexpression inhibited LUSC cell viability, decreased EdU positive cell rate, and promoted apoptotic cell rate, while these effects were reversed by AKAP12 knockdown (Figure 5b–d). Elevated TCF21 expression also contributed to the reduction of wound closure rate, invaded cell numbers, glucose consumption and lactate production in H1703 and H520 cells, and AKAP12 knockdown eliminated these effects (Figure 5e–h).

Effects of TCF21 and sh-AKAP12 on LUSC cell functions. H1703 and H520 cells were transfected with Mock, TCF21 overexpression vector, and sh-AKAP12. (a) AKAP12 protein level was tested using WB. Cell proliferation, apoptosis, migration, and invasion were determined using CCK8 assay (b), EdU assay (c), flow cytometry (d), wound healing assay (e), and transwell assay (f). (g and h) Glucose consumption and lactate production were detected to measure cell glycolysis. *P < 0.05, **P < 0.01, ***P < 0.001.
3.6 AKAP12 reduced LUSC tumorigenesis in vivo
To further confirm this, we constructed xenograft tumor models. AKAP12 overexpression significantly reduced tumor volume and weight, while this effect was partially abolished by TCF21 knockdown (Figure 6a and b). Through IHC staining, we observed that AKAP12 overexpression enhanced the positive cells of AKAP12 and metastasis marker E-cadherin while decreased the positive cells of proliferation marker Ki-67, without affecting TCF21 positive cells. However, the positive cells of TCF21, AKAP12, and metastasis marker E-cadherin were reduced, while proliferation marker Ki67-positive cells were enhanced in the tumor tissues of the AKAP12 + sh-TCF21 group (Figure 6c). These data confirmed that TCF21-mediated AKAP12 could reduce LUSC tumorigenesis.

Effects of AKAP12 and sh-TCF21 on LUSC tumorigenesis in vivo. (a) Tumor volume was detected in each group every week. (b) Tumor weight was measured in each group. (c) TCF21-, AKAP12-, Ki-67-, and E-cadherin-positive cells in tumor tissues of each group were examined by IHC staining. *P < 0.05, ***P < 0.001.
4 Discussion
LUSC is a pathological type of lung cancer with a very poor prognosis, characterized by rapid progression and aggressive growth [22,23]. Due to the lack of specific driver genes as therapeutic targets, the prognosis of LUSC patients is poor [24]. Therefore, the present study aims to investigate the underlying molecular mechanisms of LUSC to provide an effective target for its treatment.
AKAP12 can regulate key mediators to control oncogenic signaling pathways in a spatiotemporal manner [25]. In many cancers, AKAP12 downregulation is usually associated with malignant tumor progression and metastasis [25]. Reportedly, both AKAP12 mRNA and protein levels were downregulated in patients with gastric adenocarcinoma, which might have good clinical prospects as a prognostic target [26]. AKAP12 has been reported to be involved in regulating LUSC progression and could provide guidance for the clinical treatment of LUSC [14]. However, there are fewer studies on the mechanism of AKAP12 in LUSC. Through database analysis, we clarified the low expression of AKAP12 in LUSC tissues, which was confirmed by further qRT-PCR and WB. Furthermore, we detected that AKAP12 suppressed LUSC cell growth, metastasis, and glycolysis in vitro, as well as restrained LUSC tumorigenesis in vivo, showing that AKAP12 might be an effective target to inhibit LUSC progression.
Studies have found that TCF21 binds to DNA to mediate cell fate and differentiation [27]. Ni et al. suggested that TCF21 was low-expressed in pancreatitis mice, and its upregulation promoted pancreatic stellate cell proliferation and migration [28]. Besides, TCF21 inhibited melanoma cell proliferation and invasion via miR-10a-5p/LIN28B [17]. Tian et al. revealed that LINC01936 hindered LUSC cell growth and metastasis, which was achieved by regulating TCF21 expression [29]. Previous studies have revealed that promoter methylation of the p16INK4a gene occurs more frequently in NSCLC patients before treatment and in patients with leukopenia, suggesting that promoter methylation of the p16INK4a gene may be associated with late clinical stage [30]. TCF21 DNA methylation levels were higher in hepatocellular carcinoma tissues than in adjacent non-tumor lung tissues [31]. However, the role of TCF21 in LUSC progression remains to be revealed. In this, we found that TCF21 was an upstream transcription factor of AKAP12, and TCF21 expression was related to AKAP21 expression in LUSC tissues. In terms of mechanisms, TCF21 bound the AKAP12 promoter region to facilitate its expression. Meanwhile, we observed that AKAP12 knockdown reversed the reduction effect of TCF21 overexpression on LUSC cell growth, metastasis, and glycolysis. In an animal study, we observed the number of positive cells of proliferation marker Ki-67 and metastasis marker E-cadherin using IHC staining to evaluate the proliferation and metastasis of tumor tissue. The results showed that Ki-67-positive cells were enhanced and E-cadherin-positive cells were reduced in the AKAP12 + sh-TCF21 group, showing that sh-TCF21 reversed AKAP12-mediated LUSC tumorigenesis inhibition. Thus, we believed that TCF21 enhanced AKAP12 expression to repress LUSC cell progression.
Of course, there are some limitations to this study. AKAP12 is a member of the AKAP family and can act as a scaffold protein to be involved in the regulation of several signaling molecules. AKAP12 mitigates liver damage by targeting the PI3K/AKT/PCSK6 pathway, which is one of the main mechanisms of AKAP12 in liver cells [32]. AKAP12 may also affect cell proliferation, migration, and tumor metastasis in LUSC through other pathways, but these mechanisms require further research to clarify in the future.
Taken together, our study revealed a novel mechanism of AKAP12 as a tumor suppressor in LUSC. These data showed that AKAP12, regulated by TCF21, repressed LUSC malignant progression by inhibiting cell growth, metastasis, and glycolysis (Figure 7). The proposed TCF21/AKAP12 axis might provide a potential target for LUSC treatment. However, the deficiency of this study is that the downstream pathway has not been investigated, which will be further revealed in the future.

Mechanistic diagram of this study. AKAP12 inhibited LUSC cell proliferation, migration, invasion, glycolysis, and promoted apoptosis, which expression was promoted by TCF21.
-
Funding information: Authors state no funding involved.
-
Author contributions: Conceptualization and methodology: Hehe Liao and Kaibin Wang; formal analysis and data curation: Tan Yan, Shaofei Ma, and Guodong Bai; validation and investigation: Juan Chen and Hehe Liao; writing – original draft preparation and writing – review and editing: Juan Chen, Hehe Liao, and Kaibin Wang; and approval of final manuscript: all authors.
-
Conflict of interest: Authors state no conflict of interest.
-
Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
References
[1] Thai AA, Solomon BJ, Sequist LV, Gainor JF, Heist RS. Lung cancer. Lancet. 2021;398:535–54.10.1016/S0140-6736(21)00312-3Search in Google Scholar PubMed
[2] Chen JW, Dhahbi J. Lung adenocarcinoma and lung squamous cell carcinoma cancer classification, biomarker identification, and gene expression analysis using overlapping feature selection methods. Sci Rep. 2021;11:13323.10.1038/s41598-021-92725-8Search in Google Scholar PubMed PubMed Central
[3] Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer statistics, 2022. CA Cancer J Clin. 2022;72:7–33.10.3322/caac.21708Search in Google Scholar PubMed
[4] Lau SCM, Pan Y, Velcheti V, Wong KK. Squamous cell lung cancer: Current landscape and future therapeutic options. Cancer Cell. 2022;40:1279–93.10.1016/j.ccell.2022.09.018Search in Google Scholar PubMed
[5] Joon HK, Thalor A, Gupta D. Machine learning analysis of lung squamous cell carcinoma gene expression datasets reveals novel prognostic signatures. Comput Biol Med. 2023;165:107430.10.1016/j.compbiomed.2023.107430Search in Google Scholar PubMed
[6] Kwon J, Zhang J, Mok B, Allsup S, Kim C, Toretsky J, et al. USP13 drives lung squamous cell carcinoma by switching lung club cell lineage plasticity. Mol Cancer. 2023;22:204.10.1186/s12943-023-01892-xSearch in Google Scholar PubMed PubMed Central
[7] Obradovic J, Todosijevic J, Jurisic V. Side effects of tyrosine kinase inhibitors therapy in patients with non-small cell lung cancer and associations with EGFR polymorphisms: A systematic review and meta-analysis. Oncol Lett. 2023;25:62.10.3892/ol.2022.13649Search in Google Scholar PubMed PubMed Central
[8] Petrovic M, Bukumiric Z, Zdravkovic V, Mitrovic S, Atkinson HD, Jurisic V. The prognostic significance of the circulating neuroendocrine markers chromogranin A, pro-gastrin-releasing peptide, and neuron-specific enolase in patients with small-cell lung cancer. Med Oncol. 2014;31:823.10.1007/s12032-013-0823-1Search in Google Scholar PubMed
[9] Liu C, Zheng S, Lu Z, Wang Z, Wang S, Feng X, et al. S100A7 attenuates immunotherapy by enhancing immunosuppressive tumor microenvironment in lung squamous cell carcinoma. Signal Transduct Target Ther. 2022;7:368.10.1038/s41392-022-01196-4Search in Google Scholar PubMed PubMed Central
[10] Fonseca-Camarillo G, Furuzawa-Carballeda J, Priego-Ranero AA, Zuniga RB, Martinez-Benitez B, Yamamoto-Furusho JK. AKAP12/Gravin is over-expressed in patients with ulcerative colitis. Immunol Res. 2021;69:429–35.10.1007/s12026-021-09214-3Search in Google Scholar PubMed
[11] Li X, Dong H, Zheng Y, Ding S, Li Y, Li H, et al. AKAP12 inhibits esophageal squamous carcinoma cell proliferation, migration, and cell cycle via the PI3K/AKT signaling pathway. Mol Cell Probes. 2023;72:101939.10.1016/j.mcp.2023.101939Search in Google Scholar PubMed
[12] Chang J, Liu S, Li B, Huo Z, Wang X, Zhang H. MiR-338-3p improved lung adenocarcinoma by AKAP12 suppression. Arch Med Sci. 2021;17:462–73.10.5114/aoms.2019.90913Search in Google Scholar PubMed PubMed Central
[13] Liang Q, Peng J, Xu Z, Li Z, Jiang F, Ouyang L, et al. Pan-cancer analysis of the prognosis and immunological role of AKAP12: A potential biomarker for resistance to anti-VEGF inhibitors. Front Genet. 2022;13:943006.10.3389/fgene.2022.943006Search in Google Scholar PubMed PubMed Central
[14] Chen W, Wen MY, Yang KB, Zheng LT, Li X. A pyroptosis expression pattern score predicts prognosis and immune microenvironment of lung squamous cell carcinoma. Front Genet. 2022;13:996444.10.3389/fgene.2022.996444Search in Google Scholar PubMed PubMed Central
[15] Li L, Diao S, Chen Z, Zhang J, Chen W, Wang T, et al. DNMT3a-mediated methylation of TCF21/hnRNPA1 aggravates hepatic fibrosis by regulating the NF-kappaB signaling pathway. Pharmacol Res. 2023;193:106808.10.1016/j.phrs.2023.106808Search in Google Scholar PubMed
[16] Lotfi CFP, Passaia BS, Kremer JL. Role of the bHLH transcription factor TCF21 in development and tumorigenesis. Braz J Med Biol Res. 2021;54:e10637.10.1590/1414-431x202010637Search in Google Scholar PubMed PubMed Central
[17] Zhu H, Kang M, Bai X. TCF21 regulates miR-10a-5p/LIN28B signaling to block the proliferation and invasion of melanoma cells. PLoS One. 2021;16:e0255971.10.1371/journal.pone.0255971Search in Google Scholar PubMed PubMed Central
[18] Liu H, He R, Yang X, Huang B, Liu H. Mechanism of TCF21 downregulation leading to immunosuppression of tumor-associated macrophages in non-small cell lung cancer. Pharmaceutics. 2023;15:2295.10.3390/pharmaceutics15092295Search in Google Scholar PubMed PubMed Central
[19] Obradovic J, Todosijevic J, Jurisic V. Application of the conventional and novel methods in testing EGFR variants for NSCLC patients in the last 10 years through different regions: a systematic review. Mol Biol Rep. 2021;48:3593–604.10.1007/s11033-021-06379-wSearch in Google Scholar PubMed
[20] Scherbakov AM, Vorontsova SK, Khamidullina AI, Mrdjanovic J, Andreeva OE, Bogdanov FB, et al. Novel pentacyclic derivatives and benzylidenes of the progesterone series cause anti-estrogenic and antiproliferative effects and induce apoptosis in breast cancer cells. Invest New Drugs. 2023;41:142–52.10.1007/s10637-023-01332-zSearch in Google Scholar PubMed PubMed Central
[21] Jurisic V, Srdic-Rajic T, Konjevic G, Bogdanovic G, Colic M. TNF-alpha induced apoptosis is accompanied with rapid CD30 and slower CD45 shedding from K-562 cells. J Membr Biol. 2011;239:115–22.10.1007/s00232-010-9309-7Search in Google Scholar PubMed
[22] Denisov EV, Schegoleva AA, Gervas PA, Ponomaryova AA, Tashireva LA, Boyarko VV, et al. Premalignant lesions of squamous cell carcinoma of the lung: The molecular make-up and factors affecting their progression. Lung Cancer. 2019;135:21–8.10.1016/j.lungcan.2019.07.001Search in Google Scholar PubMed
[23] Roberts M, Ogden J, Hossain ASM, Chaturvedi A, Kerr ARW, Dive C, et al. Interrogating the precancerous evolution of pathway dysfunction in lung squamous cell carcinoma using XTABLE. Elife. 2023;12:e77507.10.7554/eLife.77507Search in Google Scholar PubMed PubMed Central
[24] Wu R, Ma R, Duan X, Zhang J, Li K, Yu L, et al. Identification of specific prognostic markers for lung squamous cell carcinoma based on tumor progression, immune infiltration, and stem index. Front Immunol. 2023;14:1236444.10.3389/fimmu.2023.1236444Search in Google Scholar PubMed PubMed Central
[25] Zhang C, Wang S, Chao F, Jia G, Ye X, Han D, et al. The short inverted repeats-induced circEXOC6B inhibits prostate cancer metastasis by enhancing the binding of RBMS1 and HuR. Mol Ther. 2023;31:1705–21.10.1016/j.ymthe.2022.08.006Search in Google Scholar PubMed PubMed Central
[26] Xu Z, Xiang L, Peng L, Gu H, Wang Y. Comprehensive analysis of the immune implication of AKAP12 in stomach adenocarcinoma. Comput Math Methods Med. 2022;2022:3445230.10.1155/2022/3445230Search in Google Scholar PubMed PubMed Central
[27] Jiang X, Yang Z. Multiple biological functions of transcription factor 21 in the development of various cancers. Onco Targets Ther. 2018;11:3533–9.10.2147/OTT.S164033Search in Google Scholar PubMed PubMed Central
[28] Ni YH, Wang R, Wang W, Li DZ, Liu G, Jiang CS, et al. Tcf21 alleviates pancreatic fibrosis by regulating the epithelial-mesenchymal transformation of pancreatic stellate cells. Dig Dis Sci. 2023;68:3032–42.10.1007/s10620-023-07849-wSearch in Google Scholar PubMed
[29] Tian Q, Liu X, Li A, Wu H, Xie Y, Zhang H, et al. LINC01936 inhibits the proliferation and metastasis of lung squamous cell carcinoma probably by EMT signaling and immune infiltration. PeerJ. 2023;11:e16447.10.7717/peerj.16447Search in Google Scholar PubMed PubMed Central
[30] Jurisic V, Obradovic J, Nikolic N, Javorac J, Perin B, Milasin J. Analyses of P16(INK4a) gene promoter methylation relative to molecular, demographic and clinical parameters characteristics in non-small cell lung cancer patients: A pilot study. Mol Biol Rep. 2023;50:971–9.10.1007/s11033-022-07982-1Search in Google Scholar PubMed
[31] Dong ZR, Ke AW, Li T, Cai JB, Yang YF, Zhou W, et al. CircMEMO1 modulates the promoter methylation and expression of TCF21 to regulate hepatocellular carcinoma progression and sorafenib treatment sensitivity. Mol Cancer. 2021;20:75.10.1186/s12943-021-01361-3Search in Google Scholar PubMed PubMed Central
[32] Wu X, Luo Y, Wang S, Li Y, Bao M, Shang Y, et al. AKAP12 ameliorates liver injury via targeting PI3K/AKT/PCSK6 pathway. Redox Biol. 2022;53:102328.10.1016/j.redox.2022.102328Search in Google Scholar PubMed PubMed Central
© 2025 the author(s), published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Articles in the same Issue
- Safety assessment and modulation of hepatic CYP3A4 and UGT enzymes by Glycyrrhiza glabra aqueous extract in female Sprague–Dawley rats
- Adult-onset Still’s disease with hemophagocytic lymphohistiocytosis and minimal change disease
- Role of DZ2002 in reducing corneal graft rejection in rats by influencing Th17 activation via inhibition of the PI3K/AKT pathway and downregulation of TRAF1
- Biomedical Sciences
- Mechanism of triptolide regulating proliferation and apoptosis of hepatoma cells by inhibiting JAK/STAT pathway
- Maslinic acid improves mitochondrial function and inhibits oxidative stress and autophagy in human gastric smooth muscle cells
- Comparative analysis of inflammatory biomarkers for the diagnosis of neonatal sepsis: IL-6, IL-8, SAA, CRP, and PCT
- Post-pandemic insights on COVID-19 and premature ovarian insufficiency
- Proteome differences of dental stem cells between permanent and deciduous teeth by data-independent acquisition proteomics
- Optimizing a modified cetyltrimethylammonium bromide protocol for fungal DNA extraction: Insights from multilocus gene amplification
- Preliminary analysis of the role of small hepatitis B surface proteins mutations in the pathogenesis of occult hepatitis B infection via the endoplasmic reticulum stress-induced UPR-ERAD pathway
- Efficacy of alginate-coated gold nanoparticles against antibiotics-resistant Staphylococcus and Streptococcus pathogens of acne origins
- Battling COVID-19 leveraging nanobiotechnology: Gold and silver nanoparticle–B-escin conjugates as SARS-CoV-2 inhibitors
- Neurodegenerative diseases and neuroinflammation-induced apoptosis
- Impact of fracture fixation surgery on cognitive function and the gut microbiota in mice with a history of stroke
- COLEC10: A potential tumor suppressor and prognostic biomarker in hepatocellular carcinoma through modulation of EMT and PI3K-AKT pathways
- High-temperature requirement serine protease A2 inhibitor UCF-101 ameliorates damaged neurons in traumatic brain-injured rats by the AMPK/NF-κB pathway
- SIK1 inhibits IL-1β-stimulated cartilage apoptosis and inflammation in vitro through the CRTC2/CREB1 signaling
- Rutin–chitooligosaccharide complex: Comprehensive evaluation of its anti-inflammatory and analgesic properties in vitro and in vivo
- Knockdown of Aurora kinase B alleviates high glucose-triggered trophoblast cells damage and inflammation during gestational diabetes
- Calcium-sensing receptors promoted Homer1 expression and osteogenic differentiation in bone marrow mesenchymal stem cells
- ABI3BP can inhibit the proliferation, invasion, and epithelial–mesenchymal transition of non-small-cell lung cancer cells
- Changes in blood glucose and metabolism in hyperuricemia mice
- Rapid detection of the GJB2 c.235delC mutation based on CRISPR-Cas13a combined with lateral flow dipstick
- IL-11 promotes Ang II-induced autophagy inhibition and mitochondrial dysfunction in atrial fibroblasts
- Short-chain fatty acid attenuates intestinal inflammation by regulation of gut microbial composition in antibiotic-associated diarrhea
- Application of metagenomic next-generation sequencing in the diagnosis of pathogens in patients with diabetes complicated by community-acquired pneumonia
- NAT10 promotes radiotherapy resistance in non-small cell lung cancer by regulating KPNB1-mediated PD-L1 nuclear translocation
- Phytol-mixed micelles alleviate dexamethasone-induced osteoporosis in zebrafish: Activation of the MMP3–OPN–MAPK pathway-mediating bone remodeling
- Association between TGF-β1 and β-catenin expression in the vaginal wall of patients with pelvic organ prolapse
- Primary pleomorphic liposarcoma involving bilateral ovaries: Case report and literature review
- Effects of de novo donor-specific Class I and II antibodies on graft outcomes after liver transplantation: A pilot cohort study
- Sleep architecture in Alzheimer’s disease continuum: The deep sleep question
- Ephedra fragilis plant extract: A groundbreaking corrosion inhibitor for mild steel in acidic environments – electrochemical, EDX, DFT, and Monte Carlo studies
- Langerhans cell histiocytosis in an adult patient with upper jaw and pulmonary involvement: A case report
- Inhibition of mast cell activation by Jaranol-targeted Pirin ameliorates allergic responses in mouse allergic rhinitis
- Aeromonas veronii-induced septic arthritis of the hip in a child with acute lymphoblastic leukemia
- Clusterin activates the heat shock response via the PI3K/Akt pathway to protect cardiomyocytes from high-temperature-induced apoptosis
- Research progress on fecal microbiota transplantation in tumor prevention and treatment
- Low-pressure exposure influences the development of HAPE
- Stigmasterol alleviates endplate chondrocyte degeneration through inducing mitophagy by enhancing PINK1 mRNA acetylation via the ESR1/NAT10 axis
- AKAP12, mediated by transcription factor 21, inhibits cell proliferation, metastasis, and glycolysis in lung squamous cell carcinoma
- Association between PAX9 or MSX1 gene polymorphism and tooth agenesis risk: A meta-analysis
- A case of bloodstream infection caused by Neisseria gonorrhoeae
- Case of nasopharyngeal tuberculosis complicated with cervical lymph node and pulmonary tuberculosis
- p-Cymene inhibits pro-fibrotic and inflammatory mediators to prevent hepatic dysfunction
- GFPT2 promotes paclitaxel resistance in epithelial ovarian cancer cells via activating NF-κB signaling pathway
- Transfer RNA-derived fragment tRF-36 modulates varicose vein progression via human vascular smooth muscle cell Notch signaling
- RTA-408 attenuates the hepatic ischemia reperfusion injury in mice possibly by activating the Nrf2/HO-1 signaling pathway
- Decreased serum TIMP4 levels in patients with rheumatoid arthritis
- Sirt1 protects lupus nephritis by inhibiting the NLRP3 signaling pathway in human glomerular mesangial cells
- Sodium butyrate aids brain injury repair in neonatal rats
- Interaction of MTHFR polymorphism with PAX1 methylation in cervical cancer
- Convallatoxin inhibits proliferation and angiogenesis of glioma cells via regulating JAK/STAT3 pathway
- The effect of the PKR inhibitor, 2-aminopurine, on the replication of influenza A virus, and segment 8 mRNA splicing
- Effects of Ire1 gene on virulence and pathogenicity of Candida albicans
- Small cell lung cancer with small intestinal metastasis: Case report and literature review
- GRB14: A prognostic biomarker driving tumor progression in gastric cancer through the PI3K/AKT signaling pathway by interacting with COBLL1
- 15-Lipoxygenase-2 deficiency induces foam cell formation that can be restored by salidroside through the inhibition of arachidonic acid effects
- FTO alleviated the diabetic nephropathy progression by regulating the N6-methyladenosine levels of DACT1
- Clinical relevance of inflammatory markers in the evaluation of severity of ulcerative colitis: A retrospective study
- Zinc valproic acid complex promotes osteoblast differentiation and exhibits anti-osteoporotic potential
- Primary pulmonary synovial sarcoma in the bronchial cavity: A case report
- Metagenomic next-generation sequencing of alveolar lavage fluid improves the detection of pulmonary infection
- Uterine tumor resembling ovarian sex cord tumor with extensive rhabdoid differentiation: A case report
- Genomic analysis of a novel ST11(PR34365) Clostridioides difficile strain isolated from the human fecal of a CDI patient in Guizhou, China
- Effects of tiered cardiac rehabilitation on CRP, TNF-α, and physical endurance in older adults with coronary heart disease
- Changes in T-lymphocyte subpopulations in patients with colorectal cancer before and after acupoint catgut embedding acupuncture observation
- Modulating the tumor microenvironment: The role of traditional Chinese medicine in improving lung cancer treatment
- Alterations of metabolites related to microbiota–gut–brain axis in plasma of colon cancer, esophageal cancer, stomach cancer, and lung cancer patients
- Research on individualized drug sensitivity detection technology based on bio-3D printing technology for precision treatment of gastrointestinal stromal tumors
- CEBPB promotes ulcerative colitis-associated colorectal cancer by stimulating tumor growth and activating the NF-κB/STAT3 signaling pathway
- Oncolytic bacteria: A revolutionary approach to cancer therapy
- A de novo meningioma with rapid growth: A possible malignancy imposter?
- Diagnosis of secondary tuberculosis infection in an asymptomatic elderly with cancer using next-generation sequencing: Case report
- Hesperidin and its zinc(ii) complex enhance osteoblast differentiation and bone formation: In vitro and in vivo evaluations
- Research progress on the regulation of autophagy in cardiovascular diseases by chemokines
- Anti-arthritic, immunomodulatory, and inflammatory regulation by the benzimidazole derivative BMZ-AD: Insights from an FCA-induced rat model
- Immunoassay for pyruvate kinase M1/2 as an Alzheimer’s biomarker in CSF
- The role of HDAC11 in age-related hearing loss: Mechanisms and therapeutic implications
- Evaluation and application analysis of animal models of PIPNP based on data mining
- Therapeutic approaches for liver fibrosis/cirrhosis by targeting pyroptosis
- Fabrication of zinc oxide nanoparticles using Ruellia tuberosa leaf extract induces apoptosis through P53 and STAT3 signalling pathways in prostate cancer cells
- Haplo-hematopoietic stem cell transplantation and immunoradiotherapy for severe aplastic anemia complicated with nasopharyngeal carcinoma: A case report
- Modulation of the KEAP1-NRF2 pathway by Erianin: A novel approach to reduce psoriasiform inflammation and inflammatory signaling
- The expression of epidermal growth factor receptor 2 and its relationship with tumor-infiltrating lymphocytes and clinical pathological features in breast cancer patients
- Innovations in MALDI-TOF Mass Spectrometry: Bridging modern diagnostics and historical insights
- BAP1 complexes with YY1 and RBBP7 and its downstream targets in ccRCC cells
- Hypereosinophilic syndrome with elevated IgG4 and T-cell clonality: A report of two cases
- Electroacupuncture alleviates sciatic nerve injury in sciatica rats by regulating BDNF and NGF levels, myelin sheath degradation, and autophagy
- Polydatin prevents cholesterol gallstone formation by regulating cholesterol metabolism via PPAR-γ signaling
- RNF144A and RNF144B: Important molecules for health
- Analysis of the detection rate and related factors of thyroid nodules in the healthy population
- Artesunate inhibits hepatocellular carcinoma cell migration and invasion through OGA-mediated O-GlcNAcylation of ZEB1
- Endovascular management of post-pancreatectomy hemorrhage caused by a hepatic artery pseudoaneurysm: Case report and review of the literature
- Efficacy and safety of anti-PD-1/PD-L1 antibodies in patients with relapsed refractory diffuse large B-cell lymphoma: A meta-analysis
- SATB2 promotes humeral fracture healing in rats by activating the PI3K/AKT pathway
- Overexpression of the ferroptosis-related gene, NFS1, corresponds to gastric cancer growth and tumor immune infiltration
- Understanding risk factors and prognosis in diabetic foot ulcers
- Atractylenolide I alleviates the experimental allergic response in mice by suppressing TLR4/NF-kB/NLRP3 signalling
- FBXO31 inhibits the stemness characteristics of CD147 (+) melanoma stem cells
- Immune molecule diagnostics in colorectal cancer: CCL2 and CXCL11
- Inhibiting CXCR6 promotes senescence of activated hepatic stellate cells with limited proinflammatory SASP to attenuate hepatic fibrosis
- Cadmium toxicity, health risk and its remediation using low-cost biochar adsorbents
- Pulmonary cryptococcosis with headache as the first presentation: A case report
- Solitary pulmonary metastasis with cystic airspaces in colon cancer: A rare case report
- RUNX1 promotes denervation-induced muscle atrophy by activating the JUNB/NF-κB pathway and driving M1 macrophage polarization
- Morphometric analysis and immunobiological investigation of Indigofera oblongifolia on the infected lung with Plasmodium chabaudi
- The NuA4/TIP60 histone-modifying complex and Hr78 modulate the Lobe2 mutant eye phenotype
- Experimental study on salmon demineralized bone matrix loaded with recombinant human bone morphogenetic protein-2: In vitro and in vivo study
- A case of IgA nephropathy treated with a combination of telitacicept and half-dose glucocorticoids
- Analgesic and toxicological evaluation of cannabidiol-rich Moroccan Cannabis sativa L. (Khardala variety) extract: Evidence from an in vivo and in silico study
- Wound healing and signaling pathways
- Combination of immunotherapy and whole-brain radiotherapy on prognosis of patients with multiple brain metastases: A retrospective cohort study
- To explore the relationship between endometrial hyperemia and polycystic ovary syndrome
- Research progress on the impact of curcumin on immune responses in breast cancer
- Biogenic Cu/Ni nanotherapeutics from Descurainia sophia (L.) Webb ex Prantl seeds for the treatment of lung cancer
- Dapagliflozin attenuates atrial fibrosis via the HMGB1/RAGE pathway in atrial fibrillation rats
- Glycitein alleviates inflammation and apoptosis in keratinocytes via ROS-associated PI3K–Akt signalling pathway
- ADH5 inhibits proliferation but promotes EMT in non-small cell lung cancer cell through activating Smad2/Smad3
- Apoptotic efficacies of AgNPs formulated by Syzygium aromaticum leaf extract on 32D-FLT3-ITD human leukemia cell line with PI3K/AKT/mTOR signaling pathway
- Novel cuproptosis-related genes C1QBP and PFKP identified as prognostic and therapeutic targets in lung adenocarcinoma
- Bee venom promotes exosome secretion and alters miRNA cargo in T cells
- Treatment of pure red cell aplasia in a chronic kidney disease patient with roxadustat: A case report
- Comparative bioinformatics analysis of the Wnt pathway in breast cancer: Selection of novel biomarker panels associated with ER status
- Kynurenine facilitates renal cell carcinoma progression by suppressing M2 macrophage pyroptosis through inhibition of CASP1 cleavage
- RFX5 promotes the growth, motility, and inhibits apoptosis of gastric adenocarcinoma cells through the SIRT1/AMPK axis
- ALKBH5 exacerbates early cardiac damage after radiotherapy for breast cancer via m6A demethylation of TLR4
- Phytochemicals of Roman chamomile: Antioxidant, anti-aging, and whitening activities of distillation residues
- Circadian gene Cry1 inhibits the tumorigenicity of hepatocellular carcinoma by the BAX/BCL2-mediated apoptosis pathway
- The TNFR-RIPK1/RIPK3 signalling pathway mediates the effect of lanthanum on necroptosis of nerve cells
- Longitudinal monitoring of autoantibody dynamics in patients with early-stage non-small-cell lung cancer undergoing surgery
- The potential role of rutin, a flavonoid, in the management of cancer through modulation of cell signaling pathways
- Construction of pectinase gene engineering microbe and its application in tobacco sheets
- Construction of a microbial abundance prognostic scoring model based on intratumoral microbial data for predicting the prognosis of lung squamous cell carcinoma
- Sepsis complicated by haemophagocytic lymphohistiocytosis triggered by methicillin-resistant Staphylococcus aureus and human herpesvirus 8 in an immunocompromised elderly patient: A case report
- Sarcopenia in liver transplantation: A comprehensive bibliometric study of current research trends and future directions
- Advances in cancer immunotherapy and future directions in personalized medicine
- Can coronavirus disease 2019 affect male fertility or cause spontaneous abortion? A two-sample Mendelian randomization analysis
- Heat stroke associated with novel leukaemia inhibitory factor receptor gene variant in a Chinese infant
- PSME2 exacerbates ulcerative colitis by disrupting intestinal barrier function and promoting autophagy-dependent inflammation
- Hyperosmolar hyperglycemic state with severe hypernatremia coexisting with central diabetes insipidus: A case report and literature review
- Efficacy and mechanism of escin in improving the tissue microenvironment of blood vessel walls via anti-inflammatory and anticoagulant effects: Implications for clinical practice
- Merkel cell carcinoma: Clinicopathological analysis of three patients and literature review
- Genetic variants in VWF exon 26 and their implications for type 1 Von Willebrand disease in a Saudi Arabian population
- Lipoxin A4 improves myocardial ischemia/reperfusion injury through the Notch1-Nrf2 signaling pathway
- High levels of EPHB2 expression predict a poor prognosis and promote tumor progression in endometrial cancer
- Knockdown of SHP-2 delays renal tubular epithelial cell injury in diabetic nephropathy by inhibiting NLRP3 inflammasome-mediated pyroptosis
- Exploring the toxicity mechanisms and detoxification methods of Rhizoma Paridis
- Concomitant gastric carcinoma and primary hepatic angiosarcoma in a patient: A case report
- YAP1 inhibition protects retinal vascular endothelial cells under high glucose by inhibiting autophagy
- Identification of secretory protein related biomarkers for primary biliary cholangitis based on machine learning and experimental validation
- Integrated genomic and clinical modeling for prognostic assessment of radiotherapy response in rectal neoplasms
- Stem cell-based approaches for glaucoma treatment: a mini review
- Bacteriophage titering by optical density means: KOTE assays
- Neutrophil-related signature characterizes immune landscape and predicts prognosis of esophageal squamous cell carcinoma
- Integrated bioinformatic analysis and machine learning strategies to identify new potential immune biomarkers for Alzheimer’s disease and their targeting prediction with geniposide
- TRIM21 accelerates ferroptosis in intervertebral disc degeneration by promoting SLC7A11 ubiquitination and degradation
- TRIM21 accelerates ferroptosis in intervertebral disc degeneration by promoting SLC7A11 ubiquitination and degradation
- Histone modification and non-coding RNAs in skin aging: emerging therapeutic avenues
- A multiplicative behavioral model of DNA replication initiation in cells
- Biogenic gold nanoparticles synthesized from Pergularia daemia leaves: a novel approach for nasopharyngeal carcinoma therapy
- Creutzfeldt-Jakob disease mimicking Hashimoto’s encephalopathy: steroid response followed by decline
- Impact of semaphorin, Sema3F, on the gene transcription and protein expression of CREB and its binding protein CREBBP in primary hippocampal neurons of rats
- Iron overloaded M0 macrophages regulate hematopoietic stem cell proliferation and senescence via the Nrf2/Keap1/HO-1 pathway
- Revisiting the link between NADPH oxidase p22phox C242T polymorphism and ischemic stroke risk: an updated meta-analysis
- Exercise training preferentially modulates α1D-adrenergic receptor expression in peripheral arteries of hypertensive rats
- Overexpression of HE4/WFDC2 gene in mice leads to keratitis and corneal opacity
- Tumoral calcinosis complicating CKD-MBD in hemodialysis: a case report
- Mechanism of KLF4 Inhibition of epithelial-mesenchymal transition in gastric cancer cells
- Dissecting the molecular mechanisms of T cell infiltration in psoriatic lesions via cell-cell communication and regulatory network analysis
- Circadian rhythm-based prognostic features predict immune infiltration and tumor microenvironment in molecular subtypes of hepatocellular carcinoma
- Ecology and Environmental Science
- Optimization and comparative study of Bacillus consortia for cellulolytic potential and cellulase enzyme activity
- The complete mitochondrial genome analysis of Haemaphysalis hystricis Supino, 1897 (Ixodida: Ixodidae) and its phylogenetic implications
- Epidemiological characteristics and risk factors analysis of multidrug-resistant tuberculosis among tuberculosis population in Huzhou City, Eastern China
- Indices of human impacts on landscapes: How do they reflect the proportions of natural habitats?
- Genetic analysis of the Siberian flying squirrel population in the northern Changbai Mountains, Northeast China: Insights into population status and conservation
- Diversity and environmental drivers of Suillus communities in Pinus sylvestris var. mongolica forests of Inner Mongolia
- Global assessment of the fate of nitrogen deposition in forest ecosystems: Insights from 15N tracer studies
- Fungal and bacterial pathogenic co-infections mainly lead to the assembly of microbial community in tobacco stems
- Influencing of coal industry related airborne particulate matter on ocular surface tear film injury and inflammatory factor expression in Sprague-Dawley rats
- Temperature-dependent development, predation, and life table of Sphaerophoria macrogaster (Thomson) (Diptera: Syrphidae) feeding on Myzus persicae (Sulzer) (Homoptera: Aphididae)
- Eleonora’s falcon trophic interactions with insects within its breeding range: A systematic review
- Agriculture
- Integrated analysis of transcriptome, sRNAome, and degradome involved in the drought-response of maize Zhengdan958
- Variation in flower frost tolerance among seven apple cultivars and transcriptome response patterns in two contrastingly frost-tolerant selected cultivars
- Heritability of durable resistance to stripe rust in bread wheat (Triticum aestivum L.)
- Molecular mechanism of follicular development in laying hens based on the regulation of water metabolism
- Molecular identification and control studies on Coridius sp. (Hemiptera: Dinidoridae) in Al-Khamra, south of Jeddah, Saudi Arabia
- 10.1515/biol-2025-1218
- Animal Science
- Effect of sex ratio on the life history traits of an important invasive species, Spodoptera frugiperda
- Plant Sciences
- Hairpin in a haystack: In silico identification and characterization of plant-conserved microRNA in Rafflesiaceae
- Widely targeted metabolomics of different tissues in Rubus corchorifolius
- The complete chloroplast genome of Gerbera piloselloides (L.) Cass., 1820 (Carduoideae, Asteraceae) and its phylogenetic analysis
- Field trial to correlate mineral solubilization activity of Pseudomonas aeruginosa and biochemical content of groundnut plants
- Correlation analysis between semen routine parameters and sperm DNA fragmentation index in patients with semen non-liquefaction: A retrospective study
- Plasticity of the anatomical traits of Rhododendron L. (Ericaceae) leaves and its implications in adaptation to the plateau environment
- Effects of Piriformospora indica and arbuscular mycorrhizal fungus on growth and physiology of Moringa oleifera under low-temperature stress
- Effects of different sources of potassium fertiliser on yield, fruit quality and nutrient absorption in “Harward” kiwifruit (Actinidia deliciosa)
- Comparative efficiency and residue levels of spraying programs against powdery mildew in grape varieties
- The DREB7 transcription factor enhances salt tolerance in soybean plants under salt stress
- Using plant electrical signals of water hyacinth (Eichhornia crassipes) for water pollution monitoring
- Response of hybrid grapes (Vitis spp.) to two biotic stress factors and their seedlessness status
- Metabolomic profiling reveals systemic metabolic reprogramming in Alternaria alternata under salt stress
- Effects of mixed salinity and alkali stress on photosynthetic characteristics and PEPC gene expression of vegetable soybean seedlings
- Food Science
- Phytochemical analysis of Stachys iva: Discovering the optimal extract conditions and its bioactive compounds
- Review on role of honey in disease prevention and treatment through modulation of biological activities
- Computational analysis of polymorphic residues in maltose and maltotriose transporters of a wild Saccharomyces cerevisiae strain
- Optimization of phenolic compound extraction from Tunisian squash by-products: A sustainable approach for antioxidant and antibacterial applications
- Liupao tea aqueous extract alleviates dextran sulfate sodium-induced ulcerative colitis in rats by modulating the gut microbiota
- Toxicological qualities and detoxification trends of fruit by-products for valorization: A review
- Polyphenolic spectrum of cornelian cherry fruits and their health-promoting effect
- Optimizing the encapsulation of the refined extract of squash peels for functional food applications: A sustainable approach to reduce food waste
- Advancements in curcuminoid formulations: An update on bioavailability enhancement strategies curcuminoid bioavailability and formulations
- Impact of saline sprouting on antioxidant properties and bioactive compounds in chia seeds
- The dilemma of food genetics and improvement
- Causal effects of trace elements on congenital foot deformities and their subtypes: a Mendelian randomization study with gut microbiota mediation
- Honey meets acidity: a novel biopreservative approach against foodborne pathogens
- Bioengineering and Biotechnology
- Impact of hyaluronic acid-modified hafnium metalorganic frameworks containing rhynchophylline on Alzheimer’s disease
- Emerging patterns in nanoparticle-based therapeutic approaches for rheumatoid arthritis: A comprehensive bibliometric and visual analysis spanning two decades
- Application of CRISPR/Cas gene editing for infectious disease control in poultry
- Preparation of hafnium nitride-coated titanium implants by magnetron sputtering technology and evaluation of their antibacterial properties and biocompatibility
- Preparation and characterization of lemongrass oil nanoemulsion: Antimicrobial, antibiofilm, antioxidant, and anticancer activities
- Fluorescent detection of sialic acid–binding lectins using functionalized quantum dots in ELISA format
- Smart tectorigenin-loaded ZnO hydrogel nanocomposites for targeted wound healing: synthesis, characterization, and biological evaluation
- Corrigendum
- Corrigendum to “Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells”
- Corrigendum to “Effects of Ire1 gene on virulence and pathogenicity of Candida albicans”
- Retraction
- Retraction of “Down-regulation of miR-539 indicates poor prognosis in patients with pancreatic cancer”
Articles in the same Issue
- Safety assessment and modulation of hepatic CYP3A4 and UGT enzymes by Glycyrrhiza glabra aqueous extract in female Sprague–Dawley rats
- Adult-onset Still’s disease with hemophagocytic lymphohistiocytosis and minimal change disease
- Role of DZ2002 in reducing corneal graft rejection in rats by influencing Th17 activation via inhibition of the PI3K/AKT pathway and downregulation of TRAF1
- Biomedical Sciences
- Mechanism of triptolide regulating proliferation and apoptosis of hepatoma cells by inhibiting JAK/STAT pathway
- Maslinic acid improves mitochondrial function and inhibits oxidative stress and autophagy in human gastric smooth muscle cells
- Comparative analysis of inflammatory biomarkers for the diagnosis of neonatal sepsis: IL-6, IL-8, SAA, CRP, and PCT
- Post-pandemic insights on COVID-19 and premature ovarian insufficiency
- Proteome differences of dental stem cells between permanent and deciduous teeth by data-independent acquisition proteomics
- Optimizing a modified cetyltrimethylammonium bromide protocol for fungal DNA extraction: Insights from multilocus gene amplification
- Preliminary analysis of the role of small hepatitis B surface proteins mutations in the pathogenesis of occult hepatitis B infection via the endoplasmic reticulum stress-induced UPR-ERAD pathway
- Efficacy of alginate-coated gold nanoparticles against antibiotics-resistant Staphylococcus and Streptococcus pathogens of acne origins
- Battling COVID-19 leveraging nanobiotechnology: Gold and silver nanoparticle–B-escin conjugates as SARS-CoV-2 inhibitors
- Neurodegenerative diseases and neuroinflammation-induced apoptosis
- Impact of fracture fixation surgery on cognitive function and the gut microbiota in mice with a history of stroke
- COLEC10: A potential tumor suppressor and prognostic biomarker in hepatocellular carcinoma through modulation of EMT and PI3K-AKT pathways
- High-temperature requirement serine protease A2 inhibitor UCF-101 ameliorates damaged neurons in traumatic brain-injured rats by the AMPK/NF-κB pathway
- SIK1 inhibits IL-1β-stimulated cartilage apoptosis and inflammation in vitro through the CRTC2/CREB1 signaling
- Rutin–chitooligosaccharide complex: Comprehensive evaluation of its anti-inflammatory and analgesic properties in vitro and in vivo
- Knockdown of Aurora kinase B alleviates high glucose-triggered trophoblast cells damage and inflammation during gestational diabetes
- Calcium-sensing receptors promoted Homer1 expression and osteogenic differentiation in bone marrow mesenchymal stem cells
- ABI3BP can inhibit the proliferation, invasion, and epithelial–mesenchymal transition of non-small-cell lung cancer cells
- Changes in blood glucose and metabolism in hyperuricemia mice
- Rapid detection of the GJB2 c.235delC mutation based on CRISPR-Cas13a combined with lateral flow dipstick
- IL-11 promotes Ang II-induced autophagy inhibition and mitochondrial dysfunction in atrial fibroblasts
- Short-chain fatty acid attenuates intestinal inflammation by regulation of gut microbial composition in antibiotic-associated diarrhea
- Application of metagenomic next-generation sequencing in the diagnosis of pathogens in patients with diabetes complicated by community-acquired pneumonia
- NAT10 promotes radiotherapy resistance in non-small cell lung cancer by regulating KPNB1-mediated PD-L1 nuclear translocation
- Phytol-mixed micelles alleviate dexamethasone-induced osteoporosis in zebrafish: Activation of the MMP3–OPN–MAPK pathway-mediating bone remodeling
- Association between TGF-β1 and β-catenin expression in the vaginal wall of patients with pelvic organ prolapse
- Primary pleomorphic liposarcoma involving bilateral ovaries: Case report and literature review
- Effects of de novo donor-specific Class I and II antibodies on graft outcomes after liver transplantation: A pilot cohort study
- Sleep architecture in Alzheimer’s disease continuum: The deep sleep question
- Ephedra fragilis plant extract: A groundbreaking corrosion inhibitor for mild steel in acidic environments – electrochemical, EDX, DFT, and Monte Carlo studies
- Langerhans cell histiocytosis in an adult patient with upper jaw and pulmonary involvement: A case report
- Inhibition of mast cell activation by Jaranol-targeted Pirin ameliorates allergic responses in mouse allergic rhinitis
- Aeromonas veronii-induced septic arthritis of the hip in a child with acute lymphoblastic leukemia
- Clusterin activates the heat shock response via the PI3K/Akt pathway to protect cardiomyocytes from high-temperature-induced apoptosis
- Research progress on fecal microbiota transplantation in tumor prevention and treatment
- Low-pressure exposure influences the development of HAPE
- Stigmasterol alleviates endplate chondrocyte degeneration through inducing mitophagy by enhancing PINK1 mRNA acetylation via the ESR1/NAT10 axis
- AKAP12, mediated by transcription factor 21, inhibits cell proliferation, metastasis, and glycolysis in lung squamous cell carcinoma
- Association between PAX9 or MSX1 gene polymorphism and tooth agenesis risk: A meta-analysis
- A case of bloodstream infection caused by Neisseria gonorrhoeae
- Case of nasopharyngeal tuberculosis complicated with cervical lymph node and pulmonary tuberculosis
- p-Cymene inhibits pro-fibrotic and inflammatory mediators to prevent hepatic dysfunction
- GFPT2 promotes paclitaxel resistance in epithelial ovarian cancer cells via activating NF-κB signaling pathway
- Transfer RNA-derived fragment tRF-36 modulates varicose vein progression via human vascular smooth muscle cell Notch signaling
- RTA-408 attenuates the hepatic ischemia reperfusion injury in mice possibly by activating the Nrf2/HO-1 signaling pathway
- Decreased serum TIMP4 levels in patients with rheumatoid arthritis
- Sirt1 protects lupus nephritis by inhibiting the NLRP3 signaling pathway in human glomerular mesangial cells
- Sodium butyrate aids brain injury repair in neonatal rats
- Interaction of MTHFR polymorphism with PAX1 methylation in cervical cancer
- Convallatoxin inhibits proliferation and angiogenesis of glioma cells via regulating JAK/STAT3 pathway
- The effect of the PKR inhibitor, 2-aminopurine, on the replication of influenza A virus, and segment 8 mRNA splicing
- Effects of Ire1 gene on virulence and pathogenicity of Candida albicans
- Small cell lung cancer with small intestinal metastasis: Case report and literature review
- GRB14: A prognostic biomarker driving tumor progression in gastric cancer through the PI3K/AKT signaling pathway by interacting with COBLL1
- 15-Lipoxygenase-2 deficiency induces foam cell formation that can be restored by salidroside through the inhibition of arachidonic acid effects
- FTO alleviated the diabetic nephropathy progression by regulating the N6-methyladenosine levels of DACT1
- Clinical relevance of inflammatory markers in the evaluation of severity of ulcerative colitis: A retrospective study
- Zinc valproic acid complex promotes osteoblast differentiation and exhibits anti-osteoporotic potential
- Primary pulmonary synovial sarcoma in the bronchial cavity: A case report
- Metagenomic next-generation sequencing of alveolar lavage fluid improves the detection of pulmonary infection
- Uterine tumor resembling ovarian sex cord tumor with extensive rhabdoid differentiation: A case report
- Genomic analysis of a novel ST11(PR34365) Clostridioides difficile strain isolated from the human fecal of a CDI patient in Guizhou, China
- Effects of tiered cardiac rehabilitation on CRP, TNF-α, and physical endurance in older adults with coronary heart disease
- Changes in T-lymphocyte subpopulations in patients with colorectal cancer before and after acupoint catgut embedding acupuncture observation
- Modulating the tumor microenvironment: The role of traditional Chinese medicine in improving lung cancer treatment
- Alterations of metabolites related to microbiota–gut–brain axis in plasma of colon cancer, esophageal cancer, stomach cancer, and lung cancer patients
- Research on individualized drug sensitivity detection technology based on bio-3D printing technology for precision treatment of gastrointestinal stromal tumors
- CEBPB promotes ulcerative colitis-associated colorectal cancer by stimulating tumor growth and activating the NF-κB/STAT3 signaling pathway
- Oncolytic bacteria: A revolutionary approach to cancer therapy
- A de novo meningioma with rapid growth: A possible malignancy imposter?
- Diagnosis of secondary tuberculosis infection in an asymptomatic elderly with cancer using next-generation sequencing: Case report
- Hesperidin and its zinc(ii) complex enhance osteoblast differentiation and bone formation: In vitro and in vivo evaluations
- Research progress on the regulation of autophagy in cardiovascular diseases by chemokines
- Anti-arthritic, immunomodulatory, and inflammatory regulation by the benzimidazole derivative BMZ-AD: Insights from an FCA-induced rat model
- Immunoassay for pyruvate kinase M1/2 as an Alzheimer’s biomarker in CSF
- The role of HDAC11 in age-related hearing loss: Mechanisms and therapeutic implications
- Evaluation and application analysis of animal models of PIPNP based on data mining
- Therapeutic approaches for liver fibrosis/cirrhosis by targeting pyroptosis
- Fabrication of zinc oxide nanoparticles using Ruellia tuberosa leaf extract induces apoptosis through P53 and STAT3 signalling pathways in prostate cancer cells
- Haplo-hematopoietic stem cell transplantation and immunoradiotherapy for severe aplastic anemia complicated with nasopharyngeal carcinoma: A case report
- Modulation of the KEAP1-NRF2 pathway by Erianin: A novel approach to reduce psoriasiform inflammation and inflammatory signaling
- The expression of epidermal growth factor receptor 2 and its relationship with tumor-infiltrating lymphocytes and clinical pathological features in breast cancer patients
- Innovations in MALDI-TOF Mass Spectrometry: Bridging modern diagnostics and historical insights
- BAP1 complexes with YY1 and RBBP7 and its downstream targets in ccRCC cells
- Hypereosinophilic syndrome with elevated IgG4 and T-cell clonality: A report of two cases
- Electroacupuncture alleviates sciatic nerve injury in sciatica rats by regulating BDNF and NGF levels, myelin sheath degradation, and autophagy
- Polydatin prevents cholesterol gallstone formation by regulating cholesterol metabolism via PPAR-γ signaling
- RNF144A and RNF144B: Important molecules for health
- Analysis of the detection rate and related factors of thyroid nodules in the healthy population
- Artesunate inhibits hepatocellular carcinoma cell migration and invasion through OGA-mediated O-GlcNAcylation of ZEB1
- Endovascular management of post-pancreatectomy hemorrhage caused by a hepatic artery pseudoaneurysm: Case report and review of the literature
- Efficacy and safety of anti-PD-1/PD-L1 antibodies in patients with relapsed refractory diffuse large B-cell lymphoma: A meta-analysis
- SATB2 promotes humeral fracture healing in rats by activating the PI3K/AKT pathway
- Overexpression of the ferroptosis-related gene, NFS1, corresponds to gastric cancer growth and tumor immune infiltration
- Understanding risk factors and prognosis in diabetic foot ulcers
- Atractylenolide I alleviates the experimental allergic response in mice by suppressing TLR4/NF-kB/NLRP3 signalling
- FBXO31 inhibits the stemness characteristics of CD147 (+) melanoma stem cells
- Immune molecule diagnostics in colorectal cancer: CCL2 and CXCL11
- Inhibiting CXCR6 promotes senescence of activated hepatic stellate cells with limited proinflammatory SASP to attenuate hepatic fibrosis
- Cadmium toxicity, health risk and its remediation using low-cost biochar adsorbents
- Pulmonary cryptococcosis with headache as the first presentation: A case report
- Solitary pulmonary metastasis with cystic airspaces in colon cancer: A rare case report
- RUNX1 promotes denervation-induced muscle atrophy by activating the JUNB/NF-κB pathway and driving M1 macrophage polarization
- Morphometric analysis and immunobiological investigation of Indigofera oblongifolia on the infected lung with Plasmodium chabaudi
- The NuA4/TIP60 histone-modifying complex and Hr78 modulate the Lobe2 mutant eye phenotype
- Experimental study on salmon demineralized bone matrix loaded with recombinant human bone morphogenetic protein-2: In vitro and in vivo study
- A case of IgA nephropathy treated with a combination of telitacicept and half-dose glucocorticoids
- Analgesic and toxicological evaluation of cannabidiol-rich Moroccan Cannabis sativa L. (Khardala variety) extract: Evidence from an in vivo and in silico study
- Wound healing and signaling pathways
- Combination of immunotherapy and whole-brain radiotherapy on prognosis of patients with multiple brain metastases: A retrospective cohort study
- To explore the relationship between endometrial hyperemia and polycystic ovary syndrome
- Research progress on the impact of curcumin on immune responses in breast cancer
- Biogenic Cu/Ni nanotherapeutics from Descurainia sophia (L.) Webb ex Prantl seeds for the treatment of lung cancer
- Dapagliflozin attenuates atrial fibrosis via the HMGB1/RAGE pathway in atrial fibrillation rats
- Glycitein alleviates inflammation and apoptosis in keratinocytes via ROS-associated PI3K–Akt signalling pathway
- ADH5 inhibits proliferation but promotes EMT in non-small cell lung cancer cell through activating Smad2/Smad3
- Apoptotic efficacies of AgNPs formulated by Syzygium aromaticum leaf extract on 32D-FLT3-ITD human leukemia cell line with PI3K/AKT/mTOR signaling pathway
- Novel cuproptosis-related genes C1QBP and PFKP identified as prognostic and therapeutic targets in lung adenocarcinoma
- Bee venom promotes exosome secretion and alters miRNA cargo in T cells
- Treatment of pure red cell aplasia in a chronic kidney disease patient with roxadustat: A case report
- Comparative bioinformatics analysis of the Wnt pathway in breast cancer: Selection of novel biomarker panels associated with ER status
- Kynurenine facilitates renal cell carcinoma progression by suppressing M2 macrophage pyroptosis through inhibition of CASP1 cleavage
- RFX5 promotes the growth, motility, and inhibits apoptosis of gastric adenocarcinoma cells through the SIRT1/AMPK axis
- ALKBH5 exacerbates early cardiac damage after radiotherapy for breast cancer via m6A demethylation of TLR4
- Phytochemicals of Roman chamomile: Antioxidant, anti-aging, and whitening activities of distillation residues
- Circadian gene Cry1 inhibits the tumorigenicity of hepatocellular carcinoma by the BAX/BCL2-mediated apoptosis pathway
- The TNFR-RIPK1/RIPK3 signalling pathway mediates the effect of lanthanum on necroptosis of nerve cells
- Longitudinal monitoring of autoantibody dynamics in patients with early-stage non-small-cell lung cancer undergoing surgery
- The potential role of rutin, a flavonoid, in the management of cancer through modulation of cell signaling pathways
- Construction of pectinase gene engineering microbe and its application in tobacco sheets
- Construction of a microbial abundance prognostic scoring model based on intratumoral microbial data for predicting the prognosis of lung squamous cell carcinoma
- Sepsis complicated by haemophagocytic lymphohistiocytosis triggered by methicillin-resistant Staphylococcus aureus and human herpesvirus 8 in an immunocompromised elderly patient: A case report
- Sarcopenia in liver transplantation: A comprehensive bibliometric study of current research trends and future directions
- Advances in cancer immunotherapy and future directions in personalized medicine
- Can coronavirus disease 2019 affect male fertility or cause spontaneous abortion? A two-sample Mendelian randomization analysis
- Heat stroke associated with novel leukaemia inhibitory factor receptor gene variant in a Chinese infant
- PSME2 exacerbates ulcerative colitis by disrupting intestinal barrier function and promoting autophagy-dependent inflammation
- Hyperosmolar hyperglycemic state with severe hypernatremia coexisting with central diabetes insipidus: A case report and literature review
- Efficacy and mechanism of escin in improving the tissue microenvironment of blood vessel walls via anti-inflammatory and anticoagulant effects: Implications for clinical practice
- Merkel cell carcinoma: Clinicopathological analysis of three patients and literature review
- Genetic variants in VWF exon 26 and their implications for type 1 Von Willebrand disease in a Saudi Arabian population
- Lipoxin A4 improves myocardial ischemia/reperfusion injury through the Notch1-Nrf2 signaling pathway
- High levels of EPHB2 expression predict a poor prognosis and promote tumor progression in endometrial cancer
- Knockdown of SHP-2 delays renal tubular epithelial cell injury in diabetic nephropathy by inhibiting NLRP3 inflammasome-mediated pyroptosis
- Exploring the toxicity mechanisms and detoxification methods of Rhizoma Paridis
- Concomitant gastric carcinoma and primary hepatic angiosarcoma in a patient: A case report
- YAP1 inhibition protects retinal vascular endothelial cells under high glucose by inhibiting autophagy
- Identification of secretory protein related biomarkers for primary biliary cholangitis based on machine learning and experimental validation
- Integrated genomic and clinical modeling for prognostic assessment of radiotherapy response in rectal neoplasms
- Stem cell-based approaches for glaucoma treatment: a mini review
- Bacteriophage titering by optical density means: KOTE assays
- Neutrophil-related signature characterizes immune landscape and predicts prognosis of esophageal squamous cell carcinoma
- Integrated bioinformatic analysis and machine learning strategies to identify new potential immune biomarkers for Alzheimer’s disease and their targeting prediction with geniposide
- TRIM21 accelerates ferroptosis in intervertebral disc degeneration by promoting SLC7A11 ubiquitination and degradation
- TRIM21 accelerates ferroptosis in intervertebral disc degeneration by promoting SLC7A11 ubiquitination and degradation
- Histone modification and non-coding RNAs in skin aging: emerging therapeutic avenues
- A multiplicative behavioral model of DNA replication initiation in cells
- Biogenic gold nanoparticles synthesized from Pergularia daemia leaves: a novel approach for nasopharyngeal carcinoma therapy
- Creutzfeldt-Jakob disease mimicking Hashimoto’s encephalopathy: steroid response followed by decline
- Impact of semaphorin, Sema3F, on the gene transcription and protein expression of CREB and its binding protein CREBBP in primary hippocampal neurons of rats
- Iron overloaded M0 macrophages regulate hematopoietic stem cell proliferation and senescence via the Nrf2/Keap1/HO-1 pathway
- Revisiting the link between NADPH oxidase p22phox C242T polymorphism and ischemic stroke risk: an updated meta-analysis
- Exercise training preferentially modulates α1D-adrenergic receptor expression in peripheral arteries of hypertensive rats
- Overexpression of HE4/WFDC2 gene in mice leads to keratitis and corneal opacity
- Tumoral calcinosis complicating CKD-MBD in hemodialysis: a case report
- Mechanism of KLF4 Inhibition of epithelial-mesenchymal transition in gastric cancer cells
- Dissecting the molecular mechanisms of T cell infiltration in psoriatic lesions via cell-cell communication and regulatory network analysis
- Circadian rhythm-based prognostic features predict immune infiltration and tumor microenvironment in molecular subtypes of hepatocellular carcinoma
- Ecology and Environmental Science
- Optimization and comparative study of Bacillus consortia for cellulolytic potential and cellulase enzyme activity
- The complete mitochondrial genome analysis of Haemaphysalis hystricis Supino, 1897 (Ixodida: Ixodidae) and its phylogenetic implications
- Epidemiological characteristics and risk factors analysis of multidrug-resistant tuberculosis among tuberculosis population in Huzhou City, Eastern China
- Indices of human impacts on landscapes: How do they reflect the proportions of natural habitats?
- Genetic analysis of the Siberian flying squirrel population in the northern Changbai Mountains, Northeast China: Insights into population status and conservation
- Diversity and environmental drivers of Suillus communities in Pinus sylvestris var. mongolica forests of Inner Mongolia
- Global assessment of the fate of nitrogen deposition in forest ecosystems: Insights from 15N tracer studies
- Fungal and bacterial pathogenic co-infections mainly lead to the assembly of microbial community in tobacco stems
- Influencing of coal industry related airborne particulate matter on ocular surface tear film injury and inflammatory factor expression in Sprague-Dawley rats
- Temperature-dependent development, predation, and life table of Sphaerophoria macrogaster (Thomson) (Diptera: Syrphidae) feeding on Myzus persicae (Sulzer) (Homoptera: Aphididae)
- Eleonora’s falcon trophic interactions with insects within its breeding range: A systematic review
- Agriculture
- Integrated analysis of transcriptome, sRNAome, and degradome involved in the drought-response of maize Zhengdan958
- Variation in flower frost tolerance among seven apple cultivars and transcriptome response patterns in two contrastingly frost-tolerant selected cultivars
- Heritability of durable resistance to stripe rust in bread wheat (Triticum aestivum L.)
- Molecular mechanism of follicular development in laying hens based on the regulation of water metabolism
- Molecular identification and control studies on Coridius sp. (Hemiptera: Dinidoridae) in Al-Khamra, south of Jeddah, Saudi Arabia
- 10.1515/biol-2025-1218
- Animal Science
- Effect of sex ratio on the life history traits of an important invasive species, Spodoptera frugiperda
- Plant Sciences
- Hairpin in a haystack: In silico identification and characterization of plant-conserved microRNA in Rafflesiaceae
- Widely targeted metabolomics of different tissues in Rubus corchorifolius
- The complete chloroplast genome of Gerbera piloselloides (L.) Cass., 1820 (Carduoideae, Asteraceae) and its phylogenetic analysis
- Field trial to correlate mineral solubilization activity of Pseudomonas aeruginosa and biochemical content of groundnut plants
- Correlation analysis between semen routine parameters and sperm DNA fragmentation index in patients with semen non-liquefaction: A retrospective study
- Plasticity of the anatomical traits of Rhododendron L. (Ericaceae) leaves and its implications in adaptation to the plateau environment
- Effects of Piriformospora indica and arbuscular mycorrhizal fungus on growth and physiology of Moringa oleifera under low-temperature stress
- Effects of different sources of potassium fertiliser on yield, fruit quality and nutrient absorption in “Harward” kiwifruit (Actinidia deliciosa)
- Comparative efficiency and residue levels of spraying programs against powdery mildew in grape varieties
- The DREB7 transcription factor enhances salt tolerance in soybean plants under salt stress
- Using plant electrical signals of water hyacinth (Eichhornia crassipes) for water pollution monitoring
- Response of hybrid grapes (Vitis spp.) to two biotic stress factors and their seedlessness status
- Metabolomic profiling reveals systemic metabolic reprogramming in Alternaria alternata under salt stress
- Effects of mixed salinity and alkali stress on photosynthetic characteristics and PEPC gene expression of vegetable soybean seedlings
- Food Science
- Phytochemical analysis of Stachys iva: Discovering the optimal extract conditions and its bioactive compounds
- Review on role of honey in disease prevention and treatment through modulation of biological activities
- Computational analysis of polymorphic residues in maltose and maltotriose transporters of a wild Saccharomyces cerevisiae strain
- Optimization of phenolic compound extraction from Tunisian squash by-products: A sustainable approach for antioxidant and antibacterial applications
- Liupao tea aqueous extract alleviates dextran sulfate sodium-induced ulcerative colitis in rats by modulating the gut microbiota
- Toxicological qualities and detoxification trends of fruit by-products for valorization: A review
- Polyphenolic spectrum of cornelian cherry fruits and their health-promoting effect
- Optimizing the encapsulation of the refined extract of squash peels for functional food applications: A sustainable approach to reduce food waste
- Advancements in curcuminoid formulations: An update on bioavailability enhancement strategies curcuminoid bioavailability and formulations
- Impact of saline sprouting on antioxidant properties and bioactive compounds in chia seeds
- The dilemma of food genetics and improvement
- Causal effects of trace elements on congenital foot deformities and their subtypes: a Mendelian randomization study with gut microbiota mediation
- Honey meets acidity: a novel biopreservative approach against foodborne pathogens
- Bioengineering and Biotechnology
- Impact of hyaluronic acid-modified hafnium metalorganic frameworks containing rhynchophylline on Alzheimer’s disease
- Emerging patterns in nanoparticle-based therapeutic approaches for rheumatoid arthritis: A comprehensive bibliometric and visual analysis spanning two decades
- Application of CRISPR/Cas gene editing for infectious disease control in poultry
- Preparation of hafnium nitride-coated titanium implants by magnetron sputtering technology and evaluation of their antibacterial properties and biocompatibility
- Preparation and characterization of lemongrass oil nanoemulsion: Antimicrobial, antibiofilm, antioxidant, and anticancer activities
- Fluorescent detection of sialic acid–binding lectins using functionalized quantum dots in ELISA format
- Smart tectorigenin-loaded ZnO hydrogel nanocomposites for targeted wound healing: synthesis, characterization, and biological evaluation
- Corrigendum
- Corrigendum to “Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells”
- Corrigendum to “Effects of Ire1 gene on virulence and pathogenicity of Candida albicans”
- Retraction
- Retraction of “Down-regulation of miR-539 indicates poor prognosis in patients with pancreatic cancer”