Mechanism of KLF4 Inhibition of epithelial-mesenchymal transition in gastric cancer cells

Yue Fu; Ze Lu; Xia Liu; Chunming Li

doi:10.1515/biol-2025-1247

Article Open Access

Mechanism of KLF4 Inhibition of epithelial-mesenchymal transition in gastric cancer cells

, , and

Published/Copyright: December 31, 2025

Published by

Become an author with De Gruyter Brill

Submit Manuscript Author Information Explore this Subject

From the journal Open Life Sciences Volume 20 Issue 1

Abstract

This study investigates the mechanism by which Krüppel-like Factor 4 (KLF4) suppresses epithelial-mesenchymal transition (EMT) in gastric cancer cells. Using Western blot (WB) and reverse transcription-quantitative PCR (RT-qPCR), we evaluated KLF4 protein and mRNA expression levels across gastric cancer cell lines with varying degrees of differentiation. The BGC-823 cell line, which exhibited the lowest KLF4 expression at both protein and mRNA levels, was selected for transfection with a KLF4-overexpressing lentivirus. Following transfection, the Wnt signaling pathway inhibitor XAV-939 and agonist SKL2001 were administered to the KLF4-overexpressing cells. Subsequent Western blot and RT-qPCR analyses were performed to assess the expression of Wnt signaling components and EMT-related markers. Results demonstrated that KLF4 overexpression inhibits EMT in gastric cancer cells through the Wnt/β-catenin signaling pathway. Thus, this study concludes that KLF4 may modulate EMT in gastric cancer cells via the Wnt/β-catenin pathway.

Keywords: gastric cancer cells; KLF4; EMT; Wnt/β-catenin signaling pathway; XAV-939; SKL2001

1 Introduction

Gastric cancer (GC) is a major global health challenge, with an estimated annual incidence of 990,000 cases and approximately 738,000 fatalities worldwide [1]. Dietary habits are significant risk factors for GC. In particular, processed foods, red and processed meats, alcohol, and diets high in salt, fat, and cholesterol elevate the risk [2]. Given the crucial roles of microbes and chronic inflammation in GC pathogenesis highlighted by recent research, it is imperative to further investigate their underlying mechanisms [3]. The prognosis for intermediate and advanced GC remains poor, with limited therapeutic options. Consequently, chemotherapy, targeted therapy, and immunotherapy have become the cornerstone of treatment for these disease stages [4]. Nevertheless, the efficacy of these treatments is often limited by drug resistance, thus highlighting the critical need to identify new therapeutic targets for novel GC treatment strategies.

Krüppel-like Factor 4 (KLF4) is a critical transcription factor that maps to chromosome 9q31 and encodes a protein consisting of 513 amino acids [5]. KLF4 is implicated in the pathogenesis of a spectrum of malignancies, including non-small cell lung cancer, gastric cancer, hepatocellular carcinoma, pancreatic cancer, renal cell carcinoma, and breast cancer [6], [7], [8], [9], [10], [11], [12]. While Sreeparna et al. [5] have investigated KLF4’s functions and regulatory mechanisms across various cancers, identifying it as a potential therapeutic target and clinical biomarker (particularly in pancreatic cancer), its mechanism of action in GC remains unclear.

Epithelial-mesenchymal transition (EMT) is a dynamic and reversible process characterized by the transformation of cells from an epithelial to a mesenchymal phenotype [13], 14]. EMT is broadly classified into three types: Type 1, which is associated with embryonic and organ development; Type 2, involved in wound healing, tissue regeneration, and organ fibrosis; and Type 3, which is linked to cancer cell migration [15], 16]. Raghu et al. [17] demonstrated that KLF4 can delay the onset of EMT by suppressing multiple EMT transcription factors, thereby revealing its pivotal regulatory role in this process.

The canonical Wnt/β-catenin signaling pathway is characterized by the tight regulation of cytoplasmic β-catenin, a central mediator of this pathway [18]. The Wnt/β-catenin signaling pathway plays a pivotal role in promoting the proliferation, migration, and invasion of various cancers, including gastric, lung, and liver cancer. [19], [20], [21]. Extensive evidence indicates that inhibiting the Wnt/β-catenin signaling pathway effectively suppresses EMT [22], 23]. This study examines if KLF4, as a transcription factor, regulates EMT in gastric cancer cells via the Wnt/β-catenin signaling pathway.

2 Materials and methods

Cells and Cell Culture. Cell Lines and Culture: The following human gastric adenocarcinoma cell lines were used: MKN-28 (highly differentiated), SGC-7901 (moderately differentiated), and BGC-823 (poorly differentiated). Cells were cultured in complete medium (RPMI-1640 with 10 % FBS and 1 % penicillin-streptomycin) at 37 °C and 5 % CO₂, with medium changes every two days.

Lentiviral Transfection and Stable Line Construction. Following seeding in 24-well plates (5 × 10ˆ4 cells/well), BGC-823 cells were infected with lentivirus at 30 % confluency. The groups included: BGC823-Blank (uninfected), BGC823-Control (empty vector), and BGC823-OE_KLF4 (KLF4-overexpressing lentivirus from Shanghai He Yuan Biologicals). Using an optimized MOI of 10 and 5 μg/ml Polybrene, the virus-containing medium was added. After 12 h, this medium was replaced with fresh medium. Fluorescence microscopy at 72 h confirmed infection efficiency, after which successful transductants were selected with 5 μg/ml puromycin for downstream applications.

Reverse Transcription-Quantitative PCR (RT-qPCR). Total RNA was extracted from cells using RNAiso (Takara) reagent (1 mL per vial) followed by incubation on ice for complete lysis. The lysate was centrifuged at 12,000×g for 20 min at 4 °C. The resulting supernatant was mixed with 200 μL of chloroform, vigorously shaken, and incubated for 5 min. After centrifugation at 12,000×g for 15 min at 4 °C, the aqueous phase was collected and combined with 500 μL of isopropanol. The mixture was inverted thoroughly, incubated for 10 min, and centrifuged again (12,000×g, 15 min, 4 °C) to pellet the RNA. The pellet was washed with 500 μL of 75 % ethanol, centrifuged (12,000×g, 5 min, 4 °C), and air-dried for 5 min with the tube lid open. Finally, the RNA was dissolved in 60 μL of DEPC-treated water. RNA concentration and purity were determined using a spectrophotometer. cDNA was synthesized on ice using a reverse transcription kit (Takara) according to the manufacturer’s instructions. Quantitative PCR was performed using a fluorescence-based PCR system under the following cycling conditions: 95 °C for 30 s, followed by 45 cycles of 95 °C for 20 s, 60 °C for 20 s, and 72 °C for 30 s. Gene expression levels were analyzed via the 2–ΔΔCq method. The primer sequences (Qingke Biotechnology) used are listed in Table 1.

Table 1:

Gene primers

Gene	Gene sequence (5^/-3^/)
KLF4	Forward: CGGACCTACTTACTCGCCTT
	Reverse: CCTGAACCCCAAAGTCAACG
β-catenin	Forward: GCCGGCTATTGTAGAAGCTG
	Reverse: GTCCCAAGGAGACCTTCCATC
Cyclin D1	Forward: GAAGGAGACCATCCCCCTGA
	Reverse: CAATGAAATCGTGCGGGGTC
E-Cadherin	Forward: CTTTGACGCCGAGAGCTACA
	Reverse: TTTGAATCGGGTGTCGAGGG
N-Cadherin	Forward: CATCCAGACCGACCCAAACA
	Reverse: ACAGACACGGTTGCAGTTGA
β-actin	Forward: GCCGGCTATTGTAGAAGCTG
	Reverse: GTCCCAAGGAGACCTTCCATC

Western Blot. Proteins were extracted by lysing cells in RIPA buffer containing PMSF (Solarbio) for 30 min. Following centrifugation (15,000×g, 10 min, 4 °C), the supernatant was collected and quantified (Solarbio kit). Proteins were separated via 10 % SDS-PAGE and transferred to PVDF membranes (Millipore). After blocking with 5 % skim milk (2 h, RT), membranes were incubated with primary antibodies (overnight, 4 °C) against KLF4 (1:1,000), β-catenin (1:8,000), Cyclin D1 (1:5,000), E-cadherin (1:1,000), N-cadherin (1:1,000), β-Tubulin (1:5,000), and GAPDH (1:5,000). Subsequently, membranes were incubated with a secondary antibody (1 h, RT, 1:5,000). Signals were developed with ECL reagent (Solarbio), captured using Image Lab™ software (BioRad), and analyzed with ImageJ.

Statistical analysis. All data were analyzed with GraphPad Prism 5.01 (Dotmatics) and are presented as the mean ± standard deviation. Comparisons between two groups were performed using the Student’s t-test, while the Chi-square test was used for categorical data. Correlations were assessed by Spearman’s rank correlation analysis. A p-value of less than 0.05 was considered statistically significant.

3 Results

The expression levels of KLF4 mRNA and protein were quantified in gastric cancer cell lines with varying differentiation degrees. Both KLF4 mRNA and protein showed a gradual reduction from the well-differentiated MKN-28 cells to the moderately differentiated SGC-7901 and poorly differentiated BGC-823 cells, with statistically significant differences (p < 0.05; Figure 1). Spearman’s correlation analysis confirmed a strong positive correlation between the expression levels of both KLF4 mRNA (r = 0.949, p < 0.05) and protein (r = 0.949, p < 0.05) with the differentiation degree of the gastric cancer cells.

Figure 1:

Expression levels of KLF4mRNA and protein in three strains of gastric cancer cells. (A) Histogram of relative mRNA expression levels of KLF4 in the three gastric cancer cells. (B) Protein expression level of KLF4 in three gastric cancer cells. (C) Histogram of relative protein expression of KLF4 in three gastric cancer cell lines. Three individual experiments with at least three replicates were performed. *p < 0.05, three strains of gastric cancer cells were compared two by two separately.

Construction of KLF4 overexpressed cell line. To investigate KLF4’s function, we established an overexpression model in BGC-823 cells, which exhibited the lowest endogenous KLF4 levels. Transfection efficiency was confirmed by the presence of green fluorescence in the BGC823-Control and BGC823-OE_KLF4 groups, but not in the non-transfected BGC823-Blank group, demonstrating successful lentiviral delivery (Figure 2).

Figure 2:

Fluorescence and white light images of each group of cells under inverted fluorescence microscope.

KLF4 protein and mRNA expression levels in BGC-823 cells post-transfection with KLF4 gene. Successful KLF4 overexpression was achieved in BGC-823 cells, as evidenced by significantly higher levels of KLF4 mRNA and protein in the BGC823-OEKLF4 group compared to both the BGC823-Blank and BGC823-Control groups (p < 0.05), validating the efficacy of the lentiviral transduction (Figure 3).

Figure 3:

Expression levels of KLF4 protein and mRNA in BGC-823 cells after transfection of KLF4 gene. (A) Histogram of relative expression levels of KLF4 mRNA in three groups of cells. (B) Expression levels of KLF4 protein in three groups of cells. (C) Histogram of relative expression of KLF4 protein in three groups of cells. *p < 0.05, BGC823-OEKLF4 group versus BGC823-Control group. ns, BGC823-Blank group versus BGC823-Control group. ns, no significant.

Role of the Wnt/β-catenin pathway in KLF4-mediated EMT regulation using agonist and inhibitor treatments. The effective concentrations of the Wnt/β-catenin pathway modulators were first determined. It was found that β-catenin was most effectively suppressed by 5 μM XAV-939 and activated by 20 μM SKL2001 in KLF4-overexpressing BGC-823 cells (p < 0.05; Figure 4). Furthermore, the potential cytotoxic interference of the solvent DMSO was investigated. A control group treated with 20 μM DMSO, the highest concentration used, showed β-catenin expression levels comparable to the OEKLF4 group alone (p > 0.05), confirming that the observed effects were devoid of solvent-related artifacts.

Figure 4:

Results after addition of XAV-939 and SKL-2001. (A) β-catenin protein expression level. (B) Histogram of the relative expression of β-catenin protein. *p < 0.05, OEKLF4 group versus 5 μmol/L XAV-939 group, OEKLF4 group versus 20 μmol/L SKL-2001 group. ns, OEKLF4 group versus OEKLF4+20 μmol/L DMSO group. ns, no significant.

KLF4 inhibition of EMT in gastric cancer cells via the Wnt/β-Catenin signaling pathway. We observed a concomitant reduction in the expression of Wnt/β-catenin components (Cyclin D1, β-catenin) and an induction of the epithelial marker E-cadherin in KLF4-overexpressing cells (p < 0.05). These findings indicate that KLF4 suppresses EMT in BGC-823 cells, likely by inhibiting the Wnt/β-catenin pathway.

To functionally test this mechanism, we employed the Wnt/β-catenin inhibitor XAV-939 and agonist SKL2001. As expected, the inhibitor XAV-939 further reduced Cyclin D1 expression in KLF4-overexpressing cells, while the agonist SKL2001 restored it (p < 0.05), confirming effective pathway modulation. Consequently, XAV-939 treatment promoted an epithelial state by increasing E-cadherin and decreasing N-cadherin. Conversely, SKL2001 treatment reversed this effect, driving a mesenchymal phenotype with decreased E-cadherin and increased N-cadherin (p < 0.05; Figure 5). These rescue experiments demonstrate that KLF4 may inhibits EMT in BGC-823 cells specifically through the Wnt/β-catenin pathway.

Figure 5:

EMT changes after agonism and inhibition of the Wnt/β-catenin signaling pathway. (A) Histogram of mRNA expression levels of Wnt signaling pathway markers and EMT markers in overexpressing KLF4 BGC-823 cells after addition of XAV-939 and SKL 2001. (B) Protein expression levels of Wnt signaling pathway markers and EMT markers in overexpressing KLF4 BGC-823 cells after addition of XAV-939 and SKL 2001 and (C) relative expression histograms. *p < 0.05.

4 Discussion

Globally, gastric cancer represents the fifth most frequently diagnosed cancer (approximately 6 % of all cases) and is responsible for the third highest number of cancer-associated fatalities [24]. KLF4, a member of the Krüppel-like factor (KLF) family, is a zinc-finger transcription factor predominantly expressed in terminally differentiated epithelial tissues, including the skin, lungs, and gastrointestinal tract. It exhibits a dual role in tumorigenesis, acting as either an oncogene or a tumor suppressor, and participates in diverse molecular pathways and cellular processes [25]. Although the downregulation of KLF4 in gastric cancer has been well-documented and is strongly associated with disease progression, the precise molecular mechanisms through which KLF4 influences cancer cell metastasis remain unclear [24], [25], [26], [27]. EMT is fundamentally linked to cancer metastasis, as evidenced in numerous tumours including those of the breast, ovary, and colorectum [28], [29], [30]. In hepatocellular carcinoma, low KLF4 expression predicts poorer overall and recurrence-free survival [10]. We therefore hypothesized that KLF4 expression might be linked to the differentiation status of gastric cancer. We subsequently observed a clear positive correlation between the two. In addition, while our previous work confirmed that KLF4 overexpression inhibits gastric cancer cell proliferation and migration, the mechanistic basis for this effect remained unclear [31]. Given the unclear mechanism, this study prioritized elucidating the underlying pathways. We focused on the Wnt signaling pathway, given its critical roles in embryonic development and physiology, and its well-established dysregulation in disease, particularly cancer [32]. Wnt signaling pathways are broadly categorized into two types: the canonical, β-catenin-dependent pathway and the non-canonical, β-catenin-independent pathway [33]. The Wnt/β-catenin signaling pathway is well-established as a key regulator of EMT [34], 35], although the underlying mechanisms require further investigation. KLF4, the Wnt/β-catenin pathway, and type 1 EMT are all inextricably linked to embryogenesis and organogenesis. Conversely, dysregulation of KLF4, disruption of Wnt/β-catenin signaling, and type 3 EMT are associated with tumorigenesis and a range of diseases [36], [37], [38]. Based on these findings, we investigated the relationship among these three factors. Our results demonstrated that KLF4 overexpression inhibited both the Wnt/β-catenin signaling pathway and EMT. This suggests that KLF4 may suppress EMT in gastric cancer cells by inhibiting the Wnt/β-catenin pathway; however, the precise mechanism underlying this effect requires further investigation. A limitation of this study is the use of a single gastric cancer cell line. Therefore, future research should be extended to include multiple cell models to validate these findings.

The Wnt pathway is modulated by agonists, which promote signaling to drive cell growth and development, and inhibitors, which attenuate signaling to curb aberrant proliferation and tumor development [39], 40]. The precise modulation of the Wnt pathway holds significant therapeutic promise. This is exemplified by XAV-939, a potent tankyrase (TNKS1/2) inhibitor that suppresses Wnt/β-catenin signaling by stabilizing AXIN and facilitating β-catenin degradation [41]. SKL2001 functions by disrupting the Axin/β-catenin interaction, thereby leading to the stabilization of intracellular β-catenin [42]. In this study, we observed that the inhibitory effect of XAV939 on β-catenin was attenuated at higher concentrations. This paradoxical effect may be attributed to the distinct roles of Axin1 and Axin2, both of which are regulated by TNKS1/2. Specifically, Axin2 is a known target gene of Wnt/β-catenin signaling and functions as part of a negative feedback loop. We hypothesize that at elevated concentrations, the compensatory induction of Axin2 via this feedback mechanism may counteract the inhibitor’s intended effect [43]. Consequently, at high concentrations, TNKS1/2 inhibitors may over-activate the Axin2-mediated negative feedback loop, thereby attenuating the suppressive effect of XAV-939 on β-catenin. However, this remains a preliminary hypothesis. The observed effects could be due to drug toxicity or off-target effects. The specific underlying mechanism requires further investigation.

In summary, our work reveals novel aspects of KLF4-regulated EMT signaling in gastric cancer, providing a foundation for new therapeutic strategies. It also highlights the need to further decipher the precise mechanism of XAV-939’s action on the Wnt/β-catenin pathway. Investigating these deeper mechanisms sets the stage for our future research.

Corresponding author: Chunming Li, Zunyi Medical University, Zunyi, Guizhou 563003, P.R. China, E-mail: cmli@zmu.edu.cn

Funding source: Graduate Student Research Fund of Guizhou Province

Award Identifier / Grant number: YJSKYJJJ[2021]181

Funding source: Joint Fund of Zunyi Science and Technology Bureau

Funding source: Guizhou Province

Award Identifier / Grant number: Zunshi Kehe HZZZi(2020)52

Funding information: The present study was supported by Graduate Student Research Fund of Guizhou Province (No. YJSKYJJJ[2021]181); Joint Fund of Zunyi Science and Technology Bureau, Guizhou Province [No. Zunshi Kehe HZZZi(2020)52].
Author contribution: Y.F. performed the majority of the experiments. Z.L. and X.L. were the main contributors to the collection and organisation of the experimental data and the writing of the article. C.L. was the experimental supervisor and financial supporter. Y.F. and C.L. confirm the authenticity of all the raw data. All authors have read and approved the final version of this manuscript.
Conflict of interest: Authors state no conflict of interest.
Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

1. Machlowska, J, Baj, J, Sitarz, M, Maciejewski, R, Sitarz, R. Gastric cancer: epidemiology, risk factors, classification, genomic characteristics and treatment strategies. IJMS 2020;21:4012. https://doi.org/10.3390/ijms21114012.Search in Google Scholar PubMed PubMed Central

2. Maddineni, G, Xie, JJ, Brahmbhatt, B, Mutha, P. Diet and carcinogenesis of gastric cancer. Curr Opin Gastroenterol 2022;38:588–91. https://doi.org/10.1097/mog.0000000000000875.Search in Google Scholar

3. Jaroenlapnopparat, A, Bhatia, K, Coban, S. Inflammation and gastric cancer. Diseases 2022;10:35. https://doi.org/10.3390/diseases10030035.Search in Google Scholar PubMed PubMed Central

4. Wang, G, Huang, Y, Zhou, L, Yang, H, Lin, H, Zhou, S, et al.. Immunotherapy and targeted therapy as first-line treatment for advanced gastric cancer. Crit Rev Oncol-Hematol 2023;198:104197. https://doi.org/10.1016/j.critrevonc.2023.104197.Search in Google Scholar PubMed

5. He, Z, He, J, Xie, K. KLF4 transcription factor in tumorigenesis. Cell Death Discov 2023;9:118. https://doi.org/10.1038/s41420-023-01416-y.Search in Google Scholar PubMed PubMed Central

6. Lu, G, Yao, Y, Zhang, X, Cui, D, Zhou, J. Deguelin attenuates non-small-cell lung cancer cell metastasis by upregulating PTEN/KLF4/EMT signaling pathway. Dis Marker 2022;2022:4090346. https://doi.org/10.1155/2022/4090346.Search in Google Scholar PubMed PubMed Central

7. Li, JC, Chen, QH, Jian, R, Zhou, JR, Xu, Y, Lu, F, et al.. The partial role of KLF4 and KLF5 in gastrointestinal tumors. Gastroenterol Res Pract 2021;2021:1–13. https://doi.org/10.1155/2021/2425356.10.1155/2021/2425356Search in Google Scholar PubMed PubMed Central

8. Jia, X, Li, L, Wang, F, Xue, Y, Wu, T, Jia, Q, et al.. DUB3/KLF4 combats tumor growth and chemoresistance in hepatocellular carcinoma. Cell Death Discov 2022;8:166. https://doi.org/10.1038/s41420-022-00988-5.Search in Google Scholar PubMed PubMed Central

9. Liu, D, Jin, Y, Wu, J, Zhu, H, Ye, D. MiR-135b-5p is an oncogene in pancreatic cancer to regulate GPRC5A expression by targeting transcription factor KLF4. Cell Death Discov 2022;8:23. https://doi.org/10.1038/s41420-022-00814-y.Search in Google Scholar PubMed PubMed Central

10. Xue, M, Zhou, C, Zheng, Y, Zhang, Z, Wang, S, Fu, Y, et al.. The association between KLF4 as a tumor suppressor and the prognosis of hepatocellular carcinoma after curative resection. Aging 2020;12:15566–80. https://doi.org/10.18632/aging.103592.Search in Google Scholar PubMed PubMed Central

11. Mishiro, T, Shibagaki, K, Fukuyama, C, Kataoka, M, Notsu, T, Yamashita, N, et al.. KLF4 mutation shapes pathologic characteristics of foveolar-type gastric adenoma in helicobacter pylori–naive patients. Am J Pathol 2022;192:1250–8. https://doi.org/10.1016/j.ajpath.2022.06.005.Search in Google Scholar PubMed

12. Jung, E, Lee, YH, Ou, S, Kim, TY, Shin, SY. EGR1 regulation of vasculogenic mimicry in the MDA-MB-231 triple-negative breast cancer cell line through the upregulation of KLF4 expression. IJMS 2023;24:14375. https://doi.org/10.3390/ijms241814375.Search in Google Scholar PubMed PubMed Central

13. Lüönd, F, Sugiyama, N, Bill, R, Bornes, L, Hager, C, Tang, F, et al.. Distinct contributions of partial and full EMT to breast cancer malignancy. Dev Cell 2021;56:3203–21.e11. https://doi.org/10.1016/j.devcel.2021.11.006.Search in Google Scholar PubMed

14. Bakir, B, Chiarella, AM, Pitarresi, JR, Rustgi, AK. EMT, MET, plasticity, and tumor metastasis. Trends Cell Biol 2020;30:764–76. https://doi.org/10.1016/j.tcb.2020.07.003.Search in Google Scholar PubMed PubMed Central

15. Marconi, GD, Fonticoli, L, Rajan, TS, Pierdomenico, SD, Trubiani, O, Pizzicannella, J, et al.. Epithelial-mesenchymal transition (EMT): the Type-2 EMT in wound healing, tissue regeneration and organ fibrosis. Cells 2021;10:1587. https://doi.org/10.3390/cells10071587.Search in Google Scholar PubMed PubMed Central

16. Manfioletti, G, Fedele, M. Epithelial–mesenchymal transition (EMT) 2021. IJMS 2022;23:5848. https://doi.org/10.3390/ijms23105848.Search in Google Scholar PubMed PubMed Central

17. Subbalakshmi, AR, Sahoo, S, McMullen, I, Saxena, AN, Venugopal, SK, Somarelli, JA, et al.. KLF4 induces mesenchymal–epithelial transition (MET) by suppressing multiple EMT-inducing transcription factors. Cancers 2021;13:5135. https://doi.org/10.3390/cancers13205135.Search in Google Scholar PubMed PubMed Central

18. Wang, Z, Li, Z, Ji, H. Direct targeting of β-catenin in the Wnt signaling pathway: current progress and perspectives. Med Res Rev 2021;41:2109–29. https://doi.org/10.1002/med.21787.Search in Google Scholar PubMed PubMed Central

19. Wang, Y, Zheng, L, Shang, W, Yang, Z, Li, T, Liu, F, et al.. Wnt/beta-catenin signaling confers ferroptosis resistance by targeting GPX4 in gastric cancer. Cell Death Differ 2022;29:2190–202. https://doi.org/10.1038/s41418-022-01008-w.Search in Google Scholar PubMed PubMed Central

20. Zhang, J, Zhang, X, Yang, S, Bao, Y, Xu, D, Liu, L. FOXH1 promotes lung cancer progression by activating the Wnt/β-catenin signaling pathway. Cancer Cell Int 2021;21:293. https://doi.org/10.1186/s12935-021-01995-9.Search in Google Scholar PubMed PubMed Central

21. Zhao, J, Wang, Y, Han, M, Lu, H, Chen, X, Liu, S, et al.. P7TP3 inhibits tumor development, migration, invasion and adhesion of liver cancer through the Wnt/β-catenin signaling pathway. Cancer Sci 2020;111:994–1007. https://doi.org/10.1111/cas.14243.Search in Google Scholar PubMed PubMed Central

22. Cheng, Z, Wang, H, Yang, Z, Li, J, Chen, X. LMP2 and TAP2 impair tumor growth and metastasis by inhibiting Wnt/β-catenin signaling pathway and EMT in cervical cancer. BMC Cancer 2023;23:1128. https://doi.org/10.1186/s12885-023-11639-y.Search in Google Scholar PubMed PubMed Central

23. Song, Y, Yuan, H, Wang, J, Wu, Y, Xiao, Y, Mao, S. KLHL22 regulates the EMT and proliferation in colorectal cancer cells in part via the Wnt/β-catenin signaling pathway. Cancer Manag Res 2020;12:3981–93. https://doi.org/10.2147/cmar.s252232.Search in Google Scholar PubMed PubMed Central

24. Chen, Z, Gao, Y, Gao, S, Song, D, Feng, Y. MiR-135b-5p promotes viability, proliferation, migration and invasion of gastric cancer cells by targeting Krüppel-like factor 4 (KLF4). Aoms 2020;16:167–76. https://doi.org/10.5114/aoms.2019.87761.Search in Google Scholar PubMed PubMed Central

25. Zhao, R, Liu, Z, Xu, W, Song, L, Ren, H, Ou, Y, et al.. Helicobacter pylori infection leads to KLF4 inactivation in gastric cancer through a TET1-mediated DNA methylation mechanism. Cancer Med 2020;9:2551–63. https://doi.org/10.1002/cam4.2892.Search in Google Scholar PubMed PubMed Central

26. Mishiro, T, Shibagaki, K, Fukuyama, C, Kataoka, M, Notsu, T, Yamashita, N, et al.. KLF4 mutation shapes pathologic characteristics of foveolar-type gastric adenoma in helicobacter pylori-naive patients. Am J Pathol 2022;192:1250–8. https://doi.org/10.1016/j.ajpath.2022.06.005.Search in Google Scholar PubMed

27. Chen, Z, Jiang, Z, Meng, L, Wang, Y, Lin, M, Wei, Z, et al.. SAMHD1, positively regulated by KLF4, suppresses the proliferation of gastric cancer cells through MAPK p38 signaling pathway. Cell Cycle 2022;21:2065–78. https://doi.org/10.1080/15384101.2022.2085356.Search in Google Scholar PubMed PubMed Central

28. Chatterjee, P, Ghosh, D, Chowdhury, SR, Roy, SS. ETS1 drives EGF-induced glycolytic shift and metastasis of epithelial ovarian cancer cells. Biochim Biophys Acta Mol Cell Res 2024;17:119805. https://doi.org/10.1016/j.bbamcr.2024.119805.Search in Google Scholar PubMed

29. Gampa, SC, Garimella, S. Targeting the molecules in EMT: a potential therapeutic opportunity in breast cancer. Curr Mol Med 2024;25:567–88. https://doi.org/10.2174/0115665240310780240805114133.Search in Google Scholar PubMed

30. Yin, J, Zhu, W, Feng, S, Yan, P, Qin, S. The role of cancer-associated fibroblasts in the invasion and metastasis of colorectal cancer. Front Cell Dev Biol 2024;12:1375543. https://doi.org/10.3389/fcell.2024.1375543.Search in Google Scholar PubMed PubMed Central

31. Fu, Y, Liang, N, Chunming, L. Experimental study on inhibition of EMT and cell cycle of gastric cancer cells by overexpression of KLF4 through Wnt/β-catenin signal pathway. J Mod Oncol 2023;31:991–6.Search in Google Scholar

32. Gajos-Michniewicz, A, Czyz, M. WNT signaling in melanoma. Int J Mol Sci 2020;21:4852. https://doi.org/10.3390/ijms21144852.Search in Google Scholar PubMed PubMed Central

33. Shah, K, Kazi, JU. Phosphorylation-dependent regulation of WNT/beta-catenin signaling. Front Oncol 2022;12:858782. https://doi.org/10.3389/fonc.2022.858782.Search in Google Scholar PubMed PubMed Central

34. Gonzalez, ME, Brophy, B, Eido, A, Leonetti, AE, Djomehri, SI, Augimeri, G, et al.. CCN6 suppresses metaplastic breast carcinoma by antagonizing WNT/β-catenin signaling to inhibit EZH2-driven EMT. Cancer Res 2024;18.10.1158/0008-5472.c.7474597Search in Google Scholar

35. Tao, C, Ni, X. MPP7 mediates EMT via Wnt/β-catenin pathway to promote polarity changes in epithelial ovarian cancer cells. J Cancer 2024;15:4490–502. https://doi.org/10.7150/jca.96185.Search in Google Scholar PubMed PubMed Central

36. Cao, Q, Zhang, X, Lu, L, Yang, L, Gao, J, Gao, Y, et al.. Klf4 is required for germ-layer differentiation and body axis patterning during xenopus embryogenesis. Development 2012;139:3950–61. https://doi.org/10.1242/dev.082024.Search in Google Scholar PubMed

37. Wang, Y, Ge, H, Chen, P, Wang, Y. Wnt/β-catenin signaling in corneal epithelium development, homeostasis, and pathobiology. Exp Eye Res 2024;246:110022. https://doi.org/10.1016/j.exer.2024.110022.Search in Google Scholar PubMed

38. Jin, X, Wang, S, Luo, L, Yan, F, He, Q. Targeting the Wnt/β-catenin signal pathway for the treatment of gastrointestinal cancer: potential for advancement. Biochem Pharmacol 2024;227:116463. https://doi.org/10.1016/j.bcp.2024.116463.Search in Google Scholar PubMed

39. Scott, KM, Cohen, DJ, Boyan, BD, Schwartz, Z. miR-122 and the WNT/β-catenin pathway inhibit effects of both interleukin-1β and tumor necrosis factor-α in articular chondrocytes in vitro. J Cell Biochem 2022;123:1053–63. https://doi.org/10.1002/jcb.30244.Search in Google Scholar PubMed PubMed Central

40. Cheng, J, Li, M, Bai, R. The Wnt signaling cascade in the pathogenesis of osteoarthritis and related promising treatment strategies. Front Physiol 2022;13:954454. https://doi.org/10.3389/fphys.2022.954454.Search in Google Scholar PubMed PubMed Central

41. De Vos, K, Mavrogiannis, A, Wolters, JC, Schlenner, S, Wierda, K, Cortés Calabuig, Á, et al.. Tankyrase1/2 inhibitor XAV-939 reverts EMT and suggests that PARylation partially regulates aerobic activities in human hepatocytes and HepG2 cells. Biochem Pharmacol 2024;227:116445. https://doi.org/10.1016/j.bcp.2024.116445.Search in Google Scholar PubMed

42. Huang, HL, Tang, GD, Liang, ZH, Qin, MB, Wang, XM, Chang, RJ, et al.. Role of Wnt/β-catenin pathway agonist SKL2001 in caerulein-induced acute pancreatitis. Can J Physiol Pharmacol 2019;97:15–22. https://doi.org/10.1139/cjpp-2018-0226.Search in Google Scholar PubMed

43. Damale, MG, Pathan, SK, Shinde, DB, Patil, RH, Arote, RB, Sangshetti, JN. Insights of tankyrases: a novel target for drug discovery. Eur J Med Chem 2020;207:112712. https://doi.org/10.1016/j.ejmech.2020.112712.Search in Google Scholar PubMed

Received: 2025-09-27

Accepted: 2025-12-02

Published Online: 2025-12-31

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

https://doi.org/10.1515/biol-2025-1247

Keywords for this article

gastric cancer cells; KLF4; EMT; Wnt/β-catenin signaling pathway; XAV-939; SKL2001

Creative Commons

BY 4.0