Abstract
This study investigates the mechanism by which Krüppel-like Factor 4 (KLF4) suppresses epithelial-mesenchymal transition (EMT) in gastric cancer cells. Using Western blot (WB) and reverse transcription-quantitative PCR (RT-qPCR), we evaluated KLF4 protein and mRNA expression levels across gastric cancer cell lines with varying degrees of differentiation. The BGC-823 cell line, which exhibited the lowest KLF4 expression at both protein and mRNA levels, was selected for transfection with a KLF4-overexpressing lentivirus. Following transfection, the Wnt signaling pathway inhibitor XAV-939 and agonist SKL2001 were administered to the KLF4-overexpressing cells. Subsequent Western blot and RT-qPCR analyses were performed to assess the expression of Wnt signaling components and EMT-related markers. Results demonstrated that KLF4 overexpression inhibits EMT in gastric cancer cells through the Wnt/β-catenin signaling pathway. Thus, this study concludes that KLF4 may modulate EMT in gastric cancer cells via the Wnt/β-catenin pathway.
1 Introduction
Gastric cancer (GC) is a major global health challenge, with an estimated annual incidence of 990,000 cases and approximately 738,000 fatalities worldwide [1]. Dietary habits are significant risk factors for GC. In particular, processed foods, red and processed meats, alcohol, and diets high in salt, fat, and cholesterol elevate the risk [2]. Given the crucial roles of microbes and chronic inflammation in GC pathogenesis highlighted by recent research, it is imperative to further investigate their underlying mechanisms [3]. The prognosis for intermediate and advanced GC remains poor, with limited therapeutic options. Consequently, chemotherapy, targeted therapy, and immunotherapy have become the cornerstone of treatment for these disease stages [4]. Nevertheless, the efficacy of these treatments is often limited by drug resistance, thus highlighting the critical need to identify new therapeutic targets for novel GC treatment strategies.
Krüppel-like Factor 4 (KLF4) is a critical transcription factor that maps to chromosome 9q31 and encodes a protein consisting of 513 amino acids [5]. KLF4 is implicated in the pathogenesis of a spectrum of malignancies, including non-small cell lung cancer, gastric cancer, hepatocellular carcinoma, pancreatic cancer, renal cell carcinoma, and breast cancer [6], [7], [8], [9], [10], [11], [12]. While Sreeparna et al. [5] have investigated KLF4’s functions and regulatory mechanisms across various cancers, identifying it as a potential therapeutic target and clinical biomarker (particularly in pancreatic cancer), its mechanism of action in GC remains unclear.
Epithelial-mesenchymal transition (EMT) is a dynamic and reversible process characterized by the transformation of cells from an epithelial to a mesenchymal phenotype [13], 14]. EMT is broadly classified into three types: Type 1, which is associated with embryonic and organ development; Type 2, involved in wound healing, tissue regeneration, and organ fibrosis; and Type 3, which is linked to cancer cell migration [15], 16]. Raghu et al. [17] demonstrated that KLF4 can delay the onset of EMT by suppressing multiple EMT transcription factors, thereby revealing its pivotal regulatory role in this process.
The canonical Wnt/β-catenin signaling pathway is characterized by the tight regulation of cytoplasmic β-catenin, a central mediator of this pathway [18]. The Wnt/β-catenin signaling pathway plays a pivotal role in promoting the proliferation, migration, and invasion of various cancers, including gastric, lung, and liver cancer. [19], [20], [21]. Extensive evidence indicates that inhibiting the Wnt/β-catenin signaling pathway effectively suppresses EMT [22], 23]. This study examines if KLF4, as a transcription factor, regulates EMT in gastric cancer cells via the Wnt/β-catenin signaling pathway.
2 Materials and methods
Cells and Cell Culture. Cell Lines and Culture: The following human gastric adenocarcinoma cell lines were used: MKN-28 (highly differentiated), SGC-7901 (moderately differentiated), and BGC-823 (poorly differentiated). Cells were cultured in complete medium (RPMI-1640 with 10 % FBS and 1 % penicillin-streptomycin) at 37 °C and 5 % CO2, with medium changes every two days.
Lentiviral Transfection and Stable Line Construction. Following seeding in 24-well plates (5 × 10ˆ4 cells/well), BGC-823 cells were infected with lentivirus at 30 % confluency. The groups included: BGC823-Blank (uninfected), BGC823-Control (empty vector), and BGC823-OEKLF4 (KLF4-overexpressing lentivirus from Shanghai He Yuan Biologicals). Using an optimized MOI of 10 and 5 μg/ml Polybrene, the virus-containing medium was added. After 12 h, this medium was replaced with fresh medium. Fluorescence microscopy at 72 h confirmed infection efficiency, after which successful transductants were selected with 5 μg/ml puromycin for downstream applications.
Reverse Transcription-Quantitative PCR (RT-qPCR). Total RNA was extracted from cells using RNAiso (Takara) reagent (1 mL per vial) followed by incubation on ice for complete lysis. The lysate was centrifuged at 12,000×g for 20 min at 4 °C. The resulting supernatant was mixed with 200 μL of chloroform, vigorously shaken, and incubated for 5 min. After centrifugation at 12,000×g for 15 min at 4 °C, the aqueous phase was collected and combined with 500 μL of isopropanol. The mixture was inverted thoroughly, incubated for 10 min, and centrifuged again (12,000×g, 15 min, 4 °C) to pellet the RNA. The pellet was washed with 500 μL of 75 % ethanol, centrifuged (12,000×g, 5 min, 4 °C), and air-dried for 5 min with the tube lid open. Finally, the RNA was dissolved in 60 μL of DEPC-treated water. RNA concentration and purity were determined using a spectrophotometer. cDNA was synthesized on ice using a reverse transcription kit (Takara) according to the manufacturer’s instructions. Quantitative PCR was performed using a fluorescence-based PCR system under the following cycling conditions: 95 °C for 30 s, followed by 45 cycles of 95 °C for 20 s, 60 °C for 20 s, and 72 °C for 30 s. Gene expression levels were analyzed via the 2–ΔΔCq method. The primer sequences (Qingke Biotechnology) used are listed in Table 1.
Gene primers
| Gene | Gene sequence (5/-3/) |
|---|---|
| KLF4 | Forward: CGGACCTACTTACTCGCCTT |
| Reverse: CCTGAACCCCAAAGTCAACG | |
| β-catenin | Forward: GCCGGCTATTGTAGAAGCTG |
| Reverse: GTCCCAAGGAGACCTTCCATC | |
| Cyclin D1 | Forward: GAAGGAGACCATCCCCCTGA |
| Reverse: CAATGAAATCGTGCGGGGTC | |
| E-Cadherin | Forward: CTTTGACGCCGAGAGCTACA |
| Reverse: TTTGAATCGGGTGTCGAGGG | |
| N-Cadherin | Forward: CATCCAGACCGACCCAAACA |
| Reverse: ACAGACACGGTTGCAGTTGA | |
| β-actin | Forward: GCCGGCTATTGTAGAAGCTG |
| Reverse: GTCCCAAGGAGACCTTCCATC |
Western Blot. Proteins were extracted by lysing cells in RIPA buffer containing PMSF (Solarbio) for 30 min. Following centrifugation (15,000×g, 10 min, 4 °C), the supernatant was collected and quantified (Solarbio kit). Proteins were separated via 10 % SDS-PAGE and transferred to PVDF membranes (Millipore). After blocking with 5 % skim milk (2 h, RT), membranes were incubated with primary antibodies (overnight, 4 °C) against KLF4 (1:1,000), β-catenin (1:8,000), Cyclin D1 (1:5,000), E-cadherin (1:1,000), N-cadherin (1:1,000), β-Tubulin (1:5,000), and GAPDH (1:5,000). Subsequently, membranes were incubated with a secondary antibody (1 h, RT, 1:5,000). Signals were developed with ECL reagent (Solarbio), captured using Image Lab™ software (BioRad), and analyzed with ImageJ.
Statistical analysis. All data were analyzed with GraphPad Prism 5.01 (Dotmatics) and are presented as the mean ± standard deviation. Comparisons between two groups were performed using the Student’s t-test, while the Chi-square test was used for categorical data. Correlations were assessed by Spearman’s rank correlation analysis. A p-value of less than 0.05 was considered statistically significant.
3 Results
The expression levels of KLF4 mRNA and protein were quantified in gastric cancer cell lines with varying differentiation degrees. Both KLF4 mRNA and protein showed a gradual reduction from the well-differentiated MKN-28 cells to the moderately differentiated SGC-7901 and poorly differentiated BGC-823 cells, with statistically significant differences (p < 0.05; Figure 1). Spearman’s correlation analysis confirmed a strong positive correlation between the expression levels of both KLF4 mRNA (r = 0.949, p < 0.05) and protein (r = 0.949, p < 0.05) with the differentiation degree of the gastric cancer cells.

Expression levels of KLF4mRNA and protein in three strains of gastric cancer cells. (A) Histogram of relative mRNA expression levels of KLF4 in the three gastric cancer cells. (B) Protein expression level of KLF4 in three gastric cancer cells. (C) Histogram of relative protein expression of KLF4 in three gastric cancer cell lines. Three individual experiments with at least three replicates were performed. *p < 0.05, three strains of gastric cancer cells were compared two by two separately.
Construction of KLF4 overexpressed cell line. To investigate KLF4’s function, we established an overexpression model in BGC-823 cells, which exhibited the lowest endogenous KLF4 levels. Transfection efficiency was confirmed by the presence of green fluorescence in the BGC823-Control and BGC823-OEKLF4 groups, but not in the non-transfected BGC823-Blank group, demonstrating successful lentiviral delivery (Figure 2).

Fluorescence and white light images of each group of cells under inverted fluorescence microscope.
KLF4 protein and mRNA expression levels in BGC-823 cells post-transfection with KLF4 gene. Successful KLF4 overexpression was achieved in BGC-823 cells, as evidenced by significantly higher levels of KLF4 mRNA and protein in the BGC823-OEKLF4 group compared to both the BGC823-Blank and BGC823-Control groups (p < 0.05), validating the efficacy of the lentiviral transduction (Figure 3).

Expression levels of KLF4 protein and mRNA in BGC-823 cells after transfection of KLF4 gene. (A) Histogram of relative expression levels of KLF4 mRNA in three groups of cells. (B) Expression levels of KLF4 protein in three groups of cells. (C) Histogram of relative expression of KLF4 protein in three groups of cells. *p < 0.05, BGC823-OEKLF4 group versus BGC823-Control group. ns, BGC823-Blank group versus BGC823-Control group. ns, no significant.
Role of the Wnt/β-catenin pathway in KLF4-mediated EMT regulation using agonist and inhibitor treatments. The effective concentrations of the Wnt/β-catenin pathway modulators were first determined. It was found that β-catenin was most effectively suppressed by 5 μM XAV-939 and activated by 20 μM SKL2001 in KLF4-overexpressing BGC-823 cells (p < 0.05; Figure 4). Furthermore, the potential cytotoxic interference of the solvent DMSO was investigated. A control group treated with 20 μM DMSO, the highest concentration used, showed β-catenin expression levels comparable to the OEKLF4 group alone (p > 0.05), confirming that the observed effects were devoid of solvent-related artifacts.

Results after addition of XAV-939 and SKL-2001. (A) β-catenin protein expression level. (B) Histogram of the relative expression of β-catenin protein. *p < 0.05, OEKLF4 group versus 5 μmol/L XAV-939 group, OEKLF4 group versus 20 μmol/L SKL-2001 group. ns, OEKLF4 group versus OEKLF4+20 μmol/L DMSO group. ns, no significant.
KLF4 inhibition of EMT in gastric cancer cells via the Wnt/β-Catenin signaling pathway. We observed a concomitant reduction in the expression of Wnt/β-catenin components (Cyclin D1, β-catenin) and an induction of the epithelial marker E-cadherin in KLF4-overexpressing cells (p < 0.05). These findings indicate that KLF4 suppresses EMT in BGC-823 cells, likely by inhibiting the Wnt/β-catenin pathway.
To functionally test this mechanism, we employed the Wnt/β-catenin inhibitor XAV-939 and agonist SKL2001. As expected, the inhibitor XAV-939 further reduced Cyclin D1 expression in KLF4-overexpressing cells, while the agonist SKL2001 restored it (p < 0.05), confirming effective pathway modulation. Consequently, XAV-939 treatment promoted an epithelial state by increasing E-cadherin and decreasing N-cadherin. Conversely, SKL2001 treatment reversed this effect, driving a mesenchymal phenotype with decreased E-cadherin and increased N-cadherin (p < 0.05; Figure 5). These rescue experiments demonstrate that KLF4 may inhibits EMT in BGC-823 cells specifically through the Wnt/β-catenin pathway.

EMT changes after agonism and inhibition of the Wnt/β-catenin signaling pathway. (A) Histogram of mRNA expression levels of Wnt signaling pathway markers and EMT markers in overexpressing KLF4 BGC-823 cells after addition of XAV-939 and SKL 2001. (B) Protein expression levels of Wnt signaling pathway markers and EMT markers in overexpressing KLF4 BGC-823 cells after addition of XAV-939 and SKL 2001 and (C) relative expression histograms. *p < 0.05.
4 Discussion
Globally, gastric cancer represents the fifth most frequently diagnosed cancer (approximately 6 % of all cases) and is responsible for the third highest number of cancer-associated fatalities [24]. KLF4, a member of the Krüppel-like factor (KLF) family, is a zinc-finger transcription factor predominantly expressed in terminally differentiated epithelial tissues, including the skin, lungs, and gastrointestinal tract. It exhibits a dual role in tumorigenesis, acting as either an oncogene or a tumor suppressor, and participates in diverse molecular pathways and cellular processes [25]. Although the downregulation of KLF4 in gastric cancer has been well-documented and is strongly associated with disease progression, the precise molecular mechanisms through which KLF4 influences cancer cell metastasis remain unclear [24], [25], [26], [27]. EMT is fundamentally linked to cancer metastasis, as evidenced in numerous tumours including those of the breast, ovary, and colorectum [28], [29], [30]. In hepatocellular carcinoma, low KLF4 expression predicts poorer overall and recurrence-free survival [10]. We therefore hypothesized that KLF4 expression might be linked to the differentiation status of gastric cancer. We subsequently observed a clear positive correlation between the two. In addition, while our previous work confirmed that KLF4 overexpression inhibits gastric cancer cell proliferation and migration, the mechanistic basis for this effect remained unclear [31]. Given the unclear mechanism, this study prioritized elucidating the underlying pathways. We focused on the Wnt signaling pathway, given its critical roles in embryonic development and physiology, and its well-established dysregulation in disease, particularly cancer [32]. Wnt signaling pathways are broadly categorized into two types: the canonical, β-catenin-dependent pathway and the non-canonical, β-catenin-independent pathway [33]. The Wnt/β-catenin signaling pathway is well-established as a key regulator of EMT [34], 35], although the underlying mechanisms require further investigation. KLF4, the Wnt/β-catenin pathway, and type 1 EMT are all inextricably linked to embryogenesis and organogenesis. Conversely, dysregulation of KLF4, disruption of Wnt/β-catenin signaling, and type 3 EMT are associated with tumorigenesis and a range of diseases [36], [37], [38]. Based on these findings, we investigated the relationship among these three factors. Our results demonstrated that KLF4 overexpression inhibited both the Wnt/β-catenin signaling pathway and EMT. This suggests that KLF4 may suppress EMT in gastric cancer cells by inhibiting the Wnt/β-catenin pathway; however, the precise mechanism underlying this effect requires further investigation. A limitation of this study is the use of a single gastric cancer cell line. Therefore, future research should be extended to include multiple cell models to validate these findings.
The Wnt pathway is modulated by agonists, which promote signaling to drive cell growth and development, and inhibitors, which attenuate signaling to curb aberrant proliferation and tumor development [39], 40]. The precise modulation of the Wnt pathway holds significant therapeutic promise. This is exemplified by XAV-939, a potent tankyrase (TNKS1/2) inhibitor that suppresses Wnt/β-catenin signaling by stabilizing AXIN and facilitating β-catenin degradation [41]. SKL2001 functions by disrupting the Axin/β-catenin interaction, thereby leading to the stabilization of intracellular β-catenin [42]. In this study, we observed that the inhibitory effect of XAV939 on β-catenin was attenuated at higher concentrations. This paradoxical effect may be attributed to the distinct roles of Axin1 and Axin2, both of which are regulated by TNKS1/2. Specifically, Axin2 is a known target gene of Wnt/β-catenin signaling and functions as part of a negative feedback loop. We hypothesize that at elevated concentrations, the compensatory induction of Axin2 via this feedback mechanism may counteract the inhibitor’s intended effect [43]. Consequently, at high concentrations, TNKS1/2 inhibitors may over-activate the Axin2-mediated negative feedback loop, thereby attenuating the suppressive effect of XAV-939 on β-catenin. However, this remains a preliminary hypothesis. The observed effects could be due to drug toxicity or off-target effects. The specific underlying mechanism requires further investigation.
In summary, our work reveals novel aspects of KLF4-regulated EMT signaling in gastric cancer, providing a foundation for new therapeutic strategies. It also highlights the need to further decipher the precise mechanism of XAV-939’s action on the Wnt/β-catenin pathway. Investigating these deeper mechanisms sets the stage for our future research.
Funding source: Graduate Student Research Fund of Guizhou Province
Award Identifier / Grant number: YJSKYJJJ[2021]181
Funding source: Joint Fund of Zunyi Science and Technology Bureau
Funding source: Guizhou Province
Award Identifier / Grant number: Zunshi Kehe HZZZi(2020)52
-
Funding information: The present study was supported by Graduate Student Research Fund of Guizhou Province (No. YJSKYJJJ[2021]181); Joint Fund of Zunyi Science and Technology Bureau, Guizhou Province [No. Zunshi Kehe HZZZi(2020)52].
-
Author contribution: Y.F. performed the majority of the experiments. Z.L. and X.L. were the main contributors to the collection and organisation of the experimental data and the writing of the article. C.L. was the experimental supervisor and financial supporter. Y.F. and C.L. confirm the authenticity of all the raw data. All authors have read and approved the final version of this manuscript.
-
Conflict of interest: Authors state no conflict of interest.
-
Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
References
1. Machlowska, J, Baj, J, Sitarz, M, Maciejewski, R, Sitarz, R. Gastric cancer: epidemiology, risk factors, classification, genomic characteristics and treatment strategies. IJMS 2020;21:4012. https://doi.org/10.3390/ijms21114012.Search in Google Scholar PubMed PubMed Central
2. Maddineni, G, Xie, JJ, Brahmbhatt, B, Mutha, P. Diet and carcinogenesis of gastric cancer. Curr Opin Gastroenterol 2022;38:588–91. https://doi.org/10.1097/mog.0000000000000875.Search in Google Scholar
3. Jaroenlapnopparat, A, Bhatia, K, Coban, S. Inflammation and gastric cancer. Diseases 2022;10:35. https://doi.org/10.3390/diseases10030035.Search in Google Scholar PubMed PubMed Central
4. Wang, G, Huang, Y, Zhou, L, Yang, H, Lin, H, Zhou, S, et al.. Immunotherapy and targeted therapy as first-line treatment for advanced gastric cancer. Crit Rev Oncol-Hematol 2023;198:104197. https://doi.org/10.1016/j.critrevonc.2023.104197.Search in Google Scholar PubMed
5. He, Z, He, J, Xie, K. KLF4 transcription factor in tumorigenesis. Cell Death Discov 2023;9:118. https://doi.org/10.1038/s41420-023-01416-y.Search in Google Scholar PubMed PubMed Central
6. Lu, G, Yao, Y, Zhang, X, Cui, D, Zhou, J. Deguelin attenuates non-small-cell lung cancer cell metastasis by upregulating PTEN/KLF4/EMT signaling pathway. Dis Marker 2022;2022:4090346. https://doi.org/10.1155/2022/4090346.Search in Google Scholar PubMed PubMed Central
7. Li, JC, Chen, QH, Jian, R, Zhou, JR, Xu, Y, Lu, F, et al.. The partial role of KLF4 and KLF5 in gastrointestinal tumors. Gastroenterol Res Pract 2021;2021:1–13. https://doi.org/10.1155/2021/2425356.10.1155/2021/2425356Search in Google Scholar PubMed PubMed Central
8. Jia, X, Li, L, Wang, F, Xue, Y, Wu, T, Jia, Q, et al.. DUB3/KLF4 combats tumor growth and chemoresistance in hepatocellular carcinoma. Cell Death Discov 2022;8:166. https://doi.org/10.1038/s41420-022-00988-5.Search in Google Scholar PubMed PubMed Central
9. Liu, D, Jin, Y, Wu, J, Zhu, H, Ye, D. MiR-135b-5p is an oncogene in pancreatic cancer to regulate GPRC5A expression by targeting transcription factor KLF4. Cell Death Discov 2022;8:23. https://doi.org/10.1038/s41420-022-00814-y.Search in Google Scholar PubMed PubMed Central
10. Xue, M, Zhou, C, Zheng, Y, Zhang, Z, Wang, S, Fu, Y, et al.. The association between KLF4 as a tumor suppressor and the prognosis of hepatocellular carcinoma after curative resection. Aging 2020;12:15566–80. https://doi.org/10.18632/aging.103592.Search in Google Scholar PubMed PubMed Central
11. Mishiro, T, Shibagaki, K, Fukuyama, C, Kataoka, M, Notsu, T, Yamashita, N, et al.. KLF4 mutation shapes pathologic characteristics of foveolar-type gastric adenoma in helicobacter pylori–naive patients. Am J Pathol 2022;192:1250–8. https://doi.org/10.1016/j.ajpath.2022.06.005.Search in Google Scholar PubMed
12. Jung, E, Lee, YH, Ou, S, Kim, TY, Shin, SY. EGR1 regulation of vasculogenic mimicry in the MDA-MB-231 triple-negative breast cancer cell line through the upregulation of KLF4 expression. IJMS 2023;24:14375. https://doi.org/10.3390/ijms241814375.Search in Google Scholar PubMed PubMed Central
13. Lüönd, F, Sugiyama, N, Bill, R, Bornes, L, Hager, C, Tang, F, et al.. Distinct contributions of partial and full EMT to breast cancer malignancy. Dev Cell 2021;56:3203–21.e11. https://doi.org/10.1016/j.devcel.2021.11.006.Search in Google Scholar PubMed
14. Bakir, B, Chiarella, AM, Pitarresi, JR, Rustgi, AK. EMT, MET, plasticity, and tumor metastasis. Trends Cell Biol 2020;30:764–76. https://doi.org/10.1016/j.tcb.2020.07.003.Search in Google Scholar PubMed PubMed Central
15. Marconi, GD, Fonticoli, L, Rajan, TS, Pierdomenico, SD, Trubiani, O, Pizzicannella, J, et al.. Epithelial-mesenchymal transition (EMT): the Type-2 EMT in wound healing, tissue regeneration and organ fibrosis. Cells 2021;10:1587. https://doi.org/10.3390/cells10071587.Search in Google Scholar PubMed PubMed Central
16. Manfioletti, G, Fedele, M. Epithelial–mesenchymal transition (EMT) 2021. IJMS 2022;23:5848. https://doi.org/10.3390/ijms23105848.Search in Google Scholar PubMed PubMed Central
17. Subbalakshmi, AR, Sahoo, S, McMullen, I, Saxena, AN, Venugopal, SK, Somarelli, JA, et al.. KLF4 induces mesenchymal–epithelial transition (MET) by suppressing multiple EMT-inducing transcription factors. Cancers 2021;13:5135. https://doi.org/10.3390/cancers13205135.Search in Google Scholar PubMed PubMed Central
18. Wang, Z, Li, Z, Ji, H. Direct targeting of β-catenin in the Wnt signaling pathway: current progress and perspectives. Med Res Rev 2021;41:2109–29. https://doi.org/10.1002/med.21787.Search in Google Scholar PubMed PubMed Central
19. Wang, Y, Zheng, L, Shang, W, Yang, Z, Li, T, Liu, F, et al.. Wnt/beta-catenin signaling confers ferroptosis resistance by targeting GPX4 in gastric cancer. Cell Death Differ 2022;29:2190–202. https://doi.org/10.1038/s41418-022-01008-w.Search in Google Scholar PubMed PubMed Central
20. Zhang, J, Zhang, X, Yang, S, Bao, Y, Xu, D, Liu, L. FOXH1 promotes lung cancer progression by activating the Wnt/β-catenin signaling pathway. Cancer Cell Int 2021;21:293. https://doi.org/10.1186/s12935-021-01995-9.Search in Google Scholar PubMed PubMed Central
21. Zhao, J, Wang, Y, Han, M, Lu, H, Chen, X, Liu, S, et al.. P7TP3 inhibits tumor development, migration, invasion and adhesion of liver cancer through the Wnt/β-catenin signaling pathway. Cancer Sci 2020;111:994–1007. https://doi.org/10.1111/cas.14243.Search in Google Scholar PubMed PubMed Central
22. Cheng, Z, Wang, H, Yang, Z, Li, J, Chen, X. LMP2 and TAP2 impair tumor growth and metastasis by inhibiting Wnt/β-catenin signaling pathway and EMT in cervical cancer. BMC Cancer 2023;23:1128. https://doi.org/10.1186/s12885-023-11639-y.Search in Google Scholar PubMed PubMed Central
23. Song, Y, Yuan, H, Wang, J, Wu, Y, Xiao, Y, Mao, S. KLHL22 regulates the EMT and proliferation in colorectal cancer cells in part via the Wnt/β-catenin signaling pathway. Cancer Manag Res 2020;12:3981–93. https://doi.org/10.2147/cmar.s252232.Search in Google Scholar PubMed PubMed Central
24. Chen, Z, Gao, Y, Gao, S, Song, D, Feng, Y. MiR-135b-5p promotes viability, proliferation, migration and invasion of gastric cancer cells by targeting Krüppel-like factor 4 (KLF4). Aoms 2020;16:167–76. https://doi.org/10.5114/aoms.2019.87761.Search in Google Scholar PubMed PubMed Central
25. Zhao, R, Liu, Z, Xu, W, Song, L, Ren, H, Ou, Y, et al.. Helicobacter pylori infection leads to KLF4 inactivation in gastric cancer through a TET1-mediated DNA methylation mechanism. Cancer Med 2020;9:2551–63. https://doi.org/10.1002/cam4.2892.Search in Google Scholar PubMed PubMed Central
26. Mishiro, T, Shibagaki, K, Fukuyama, C, Kataoka, M, Notsu, T, Yamashita, N, et al.. KLF4 mutation shapes pathologic characteristics of foveolar-type gastric adenoma in helicobacter pylori-naive patients. Am J Pathol 2022;192:1250–8. https://doi.org/10.1016/j.ajpath.2022.06.005.Search in Google Scholar PubMed
27. Chen, Z, Jiang, Z, Meng, L, Wang, Y, Lin, M, Wei, Z, et al.. SAMHD1, positively regulated by KLF4, suppresses the proliferation of gastric cancer cells through MAPK p38 signaling pathway. Cell Cycle 2022;21:2065–78. https://doi.org/10.1080/15384101.2022.2085356.Search in Google Scholar PubMed PubMed Central
28. Chatterjee, P, Ghosh, D, Chowdhury, SR, Roy, SS. ETS1 drives EGF-induced glycolytic shift and metastasis of epithelial ovarian cancer cells. Biochim Biophys Acta Mol Cell Res 2024;17:119805. https://doi.org/10.1016/j.bbamcr.2024.119805.Search in Google Scholar PubMed
29. Gampa, SC, Garimella, S. Targeting the molecules in EMT: a potential therapeutic opportunity in breast cancer. Curr Mol Med 2024;25:567–88. https://doi.org/10.2174/0115665240310780240805114133.Search in Google Scholar PubMed
30. Yin, J, Zhu, W, Feng, S, Yan, P, Qin, S. The role of cancer-associated fibroblasts in the invasion and metastasis of colorectal cancer. Front Cell Dev Biol 2024;12:1375543. https://doi.org/10.3389/fcell.2024.1375543.Search in Google Scholar PubMed PubMed Central
31. Fu, Y, Liang, N, Chunming, L. Experimental study on inhibition of EMT and cell cycle of gastric cancer cells by overexpression of KLF4 through Wnt/β-catenin signal pathway. J Mod Oncol 2023;31:991–6.Search in Google Scholar
32. Gajos-Michniewicz, A, Czyz, M. WNT signaling in melanoma. Int J Mol Sci 2020;21:4852. https://doi.org/10.3390/ijms21144852.Search in Google Scholar PubMed PubMed Central
33. Shah, K, Kazi, JU. Phosphorylation-dependent regulation of WNT/beta-catenin signaling. Front Oncol 2022;12:858782. https://doi.org/10.3389/fonc.2022.858782.Search in Google Scholar PubMed PubMed Central
34. Gonzalez, ME, Brophy, B, Eido, A, Leonetti, AE, Djomehri, SI, Augimeri, G, et al.. CCN6 suppresses metaplastic breast carcinoma by antagonizing WNT/β-catenin signaling to inhibit EZH2-driven EMT. Cancer Res 2024;18.10.1158/0008-5472.c.7474597Search in Google Scholar
35. Tao, C, Ni, X. MPP7 mediates EMT via Wnt/β-catenin pathway to promote polarity changes in epithelial ovarian cancer cells. J Cancer 2024;15:4490–502. https://doi.org/10.7150/jca.96185.Search in Google Scholar PubMed PubMed Central
36. Cao, Q, Zhang, X, Lu, L, Yang, L, Gao, J, Gao, Y, et al.. Klf4 is required for germ-layer differentiation and body axis patterning during xenopus embryogenesis. Development 2012;139:3950–61. https://doi.org/10.1242/dev.082024.Search in Google Scholar PubMed
37. Wang, Y, Ge, H, Chen, P, Wang, Y. Wnt/β-catenin signaling in corneal epithelium development, homeostasis, and pathobiology. Exp Eye Res 2024;246:110022. https://doi.org/10.1016/j.exer.2024.110022.Search in Google Scholar PubMed
38. Jin, X, Wang, S, Luo, L, Yan, F, He, Q. Targeting the Wnt/β-catenin signal pathway for the treatment of gastrointestinal cancer: potential for advancement. Biochem Pharmacol 2024;227:116463. https://doi.org/10.1016/j.bcp.2024.116463.Search in Google Scholar PubMed
39. Scott, KM, Cohen, DJ, Boyan, BD, Schwartz, Z. miR-122 and the WNT/β-catenin pathway inhibit effects of both interleukin-1β and tumor necrosis factor-α in articular chondrocytes in vitro. J Cell Biochem 2022;123:1053–63. https://doi.org/10.1002/jcb.30244.Search in Google Scholar PubMed PubMed Central
40. Cheng, J, Li, M, Bai, R. The Wnt signaling cascade in the pathogenesis of osteoarthritis and related promising treatment strategies. Front Physiol 2022;13:954454. https://doi.org/10.3389/fphys.2022.954454.Search in Google Scholar PubMed PubMed Central
41. De Vos, K, Mavrogiannis, A, Wolters, JC, Schlenner, S, Wierda, K, Cortés Calabuig, Á, et al.. Tankyrase1/2 inhibitor XAV-939 reverts EMT and suggests that PARylation partially regulates aerobic activities in human hepatocytes and HepG2 cells. Biochem Pharmacol 2024;227:116445. https://doi.org/10.1016/j.bcp.2024.116445.Search in Google Scholar PubMed
42. Huang, HL, Tang, GD, Liang, ZH, Qin, MB, Wang, XM, Chang, RJ, et al.. Role of Wnt/β-catenin pathway agonist SKL2001 in caerulein-induced acute pancreatitis. Can J Physiol Pharmacol 2019;97:15–22. https://doi.org/10.1139/cjpp-2018-0226.Search in Google Scholar PubMed
43. Damale, MG, Pathan, SK, Shinde, DB, Patil, RH, Arote, RB, Sangshetti, JN. Insights of tankyrases: a novel target for drug discovery. Eur J Med Chem 2020;207:112712. https://doi.org/10.1016/j.ejmech.2020.112712.Search in Google Scholar PubMed
© 2025 the author(s), published by De Gruyter, Berlin/Boston
This work is licensed under the Creative Commons Attribution 4.0 International License.
Articles in the same Issue
- Safety assessment and modulation of hepatic CYP3A4 and UGT enzymes by Glycyrrhiza glabra aqueous extract in female Sprague–Dawley rats
- Adult-onset Still’s disease with hemophagocytic lymphohistiocytosis and minimal change disease
- Role of DZ2002 in reducing corneal graft rejection in rats by influencing Th17 activation via inhibition of the PI3K/AKT pathway and downregulation of TRAF1
- Biomedical Sciences
- Mechanism of triptolide regulating proliferation and apoptosis of hepatoma cells by inhibiting JAK/STAT pathway
- Maslinic acid improves mitochondrial function and inhibits oxidative stress and autophagy in human gastric smooth muscle cells
- Comparative analysis of inflammatory biomarkers for the diagnosis of neonatal sepsis: IL-6, IL-8, SAA, CRP, and PCT
- Post-pandemic insights on COVID-19 and premature ovarian insufficiency
- Proteome differences of dental stem cells between permanent and deciduous teeth by data-independent acquisition proteomics
- Optimizing a modified cetyltrimethylammonium bromide protocol for fungal DNA extraction: Insights from multilocus gene amplification
- Preliminary analysis of the role of small hepatitis B surface proteins mutations in the pathogenesis of occult hepatitis B infection via the endoplasmic reticulum stress-induced UPR-ERAD pathway
- Efficacy of alginate-coated gold nanoparticles against antibiotics-resistant Staphylococcus and Streptococcus pathogens of acne origins
- Battling COVID-19 leveraging nanobiotechnology: Gold and silver nanoparticle–B-escin conjugates as SARS-CoV-2 inhibitors
- Neurodegenerative diseases and neuroinflammation-induced apoptosis
- Impact of fracture fixation surgery on cognitive function and the gut microbiota in mice with a history of stroke
- COLEC10: A potential tumor suppressor and prognostic biomarker in hepatocellular carcinoma through modulation of EMT and PI3K-AKT pathways
- High-temperature requirement serine protease A2 inhibitor UCF-101 ameliorates damaged neurons in traumatic brain-injured rats by the AMPK/NF-κB pathway
- SIK1 inhibits IL-1β-stimulated cartilage apoptosis and inflammation in vitro through the CRTC2/CREB1 signaling
- Rutin–chitooligosaccharide complex: Comprehensive evaluation of its anti-inflammatory and analgesic properties in vitro and in vivo
- Knockdown of Aurora kinase B alleviates high glucose-triggered trophoblast cells damage and inflammation during gestational diabetes
- Calcium-sensing receptors promoted Homer1 expression and osteogenic differentiation in bone marrow mesenchymal stem cells
- ABI3BP can inhibit the proliferation, invasion, and epithelial–mesenchymal transition of non-small-cell lung cancer cells
- Changes in blood glucose and metabolism in hyperuricemia mice
- Rapid detection of the GJB2 c.235delC mutation based on CRISPR-Cas13a combined with lateral flow dipstick
- IL-11 promotes Ang II-induced autophagy inhibition and mitochondrial dysfunction in atrial fibroblasts
- Short-chain fatty acid attenuates intestinal inflammation by regulation of gut microbial composition in antibiotic-associated diarrhea
- Application of metagenomic next-generation sequencing in the diagnosis of pathogens in patients with diabetes complicated by community-acquired pneumonia
- NAT10 promotes radiotherapy resistance in non-small cell lung cancer by regulating KPNB1-mediated PD-L1 nuclear translocation
- Phytol-mixed micelles alleviate dexamethasone-induced osteoporosis in zebrafish: Activation of the MMP3–OPN–MAPK pathway-mediating bone remodeling
- Association between TGF-β1 and β-catenin expression in the vaginal wall of patients with pelvic organ prolapse
- Primary pleomorphic liposarcoma involving bilateral ovaries: Case report and literature review
- Effects of de novo donor-specific Class I and II antibodies on graft outcomes after liver transplantation: A pilot cohort study
- Sleep architecture in Alzheimer’s disease continuum: The deep sleep question
- Ephedra fragilis plant extract: A groundbreaking corrosion inhibitor for mild steel in acidic environments – electrochemical, EDX, DFT, and Monte Carlo studies
- Langerhans cell histiocytosis in an adult patient with upper jaw and pulmonary involvement: A case report
- Inhibition of mast cell activation by Jaranol-targeted Pirin ameliorates allergic responses in mouse allergic rhinitis
- Aeromonas veronii-induced septic arthritis of the hip in a child with acute lymphoblastic leukemia
- Clusterin activates the heat shock response via the PI3K/Akt pathway to protect cardiomyocytes from high-temperature-induced apoptosis
- Research progress on fecal microbiota transplantation in tumor prevention and treatment
- Low-pressure exposure influences the development of HAPE
- Stigmasterol alleviates endplate chondrocyte degeneration through inducing mitophagy by enhancing PINK1 mRNA acetylation via the ESR1/NAT10 axis
- AKAP12, mediated by transcription factor 21, inhibits cell proliferation, metastasis, and glycolysis in lung squamous cell carcinoma
- Association between PAX9 or MSX1 gene polymorphism and tooth agenesis risk: A meta-analysis
- A case of bloodstream infection caused by Neisseria gonorrhoeae
- Case of nasopharyngeal tuberculosis complicated with cervical lymph node and pulmonary tuberculosis
- p-Cymene inhibits pro-fibrotic and inflammatory mediators to prevent hepatic dysfunction
- GFPT2 promotes paclitaxel resistance in epithelial ovarian cancer cells via activating NF-κB signaling pathway
- Transfer RNA-derived fragment tRF-36 modulates varicose vein progression via human vascular smooth muscle cell Notch signaling
- RTA-408 attenuates the hepatic ischemia reperfusion injury in mice possibly by activating the Nrf2/HO-1 signaling pathway
- Decreased serum TIMP4 levels in patients with rheumatoid arthritis
- Sirt1 protects lupus nephritis by inhibiting the NLRP3 signaling pathway in human glomerular mesangial cells
- Sodium butyrate aids brain injury repair in neonatal rats
- Interaction of MTHFR polymorphism with PAX1 methylation in cervical cancer
- Convallatoxin inhibits proliferation and angiogenesis of glioma cells via regulating JAK/STAT3 pathway
- The effect of the PKR inhibitor, 2-aminopurine, on the replication of influenza A virus, and segment 8 mRNA splicing
- Effects of Ire1 gene on virulence and pathogenicity of Candida albicans
- Small cell lung cancer with small intestinal metastasis: Case report and literature review
- GRB14: A prognostic biomarker driving tumor progression in gastric cancer through the PI3K/AKT signaling pathway by interacting with COBLL1
- 15-Lipoxygenase-2 deficiency induces foam cell formation that can be restored by salidroside through the inhibition of arachidonic acid effects
- FTO alleviated the diabetic nephropathy progression by regulating the N6-methyladenosine levels of DACT1
- Clinical relevance of inflammatory markers in the evaluation of severity of ulcerative colitis: A retrospective study
- Zinc valproic acid complex promotes osteoblast differentiation and exhibits anti-osteoporotic potential
- Primary pulmonary synovial sarcoma in the bronchial cavity: A case report
- Metagenomic next-generation sequencing of alveolar lavage fluid improves the detection of pulmonary infection
- Uterine tumor resembling ovarian sex cord tumor with extensive rhabdoid differentiation: A case report
- Genomic analysis of a novel ST11(PR34365) Clostridioides difficile strain isolated from the human fecal of a CDI patient in Guizhou, China
- Effects of tiered cardiac rehabilitation on CRP, TNF-α, and physical endurance in older adults with coronary heart disease
- Changes in T-lymphocyte subpopulations in patients with colorectal cancer before and after acupoint catgut embedding acupuncture observation
- Modulating the tumor microenvironment: The role of traditional Chinese medicine in improving lung cancer treatment
- Alterations of metabolites related to microbiota–gut–brain axis in plasma of colon cancer, esophageal cancer, stomach cancer, and lung cancer patients
- Research on individualized drug sensitivity detection technology based on bio-3D printing technology for precision treatment of gastrointestinal stromal tumors
- CEBPB promotes ulcerative colitis-associated colorectal cancer by stimulating tumor growth and activating the NF-κB/STAT3 signaling pathway
- Oncolytic bacteria: A revolutionary approach to cancer therapy
- A de novo meningioma with rapid growth: A possible malignancy imposter?
- Diagnosis of secondary tuberculosis infection in an asymptomatic elderly with cancer using next-generation sequencing: Case report
- Hesperidin and its zinc(ii) complex enhance osteoblast differentiation and bone formation: In vitro and in vivo evaluations
- Research progress on the regulation of autophagy in cardiovascular diseases by chemokines
- Anti-arthritic, immunomodulatory, and inflammatory regulation by the benzimidazole derivative BMZ-AD: Insights from an FCA-induced rat model
- Immunoassay for pyruvate kinase M1/2 as an Alzheimer’s biomarker in CSF
- The role of HDAC11 in age-related hearing loss: Mechanisms and therapeutic implications
- Evaluation and application analysis of animal models of PIPNP based on data mining
- Therapeutic approaches for liver fibrosis/cirrhosis by targeting pyroptosis
- Fabrication of zinc oxide nanoparticles using Ruellia tuberosa leaf extract induces apoptosis through P53 and STAT3 signalling pathways in prostate cancer cells
- Haplo-hematopoietic stem cell transplantation and immunoradiotherapy for severe aplastic anemia complicated with nasopharyngeal carcinoma: A case report
- Modulation of the KEAP1-NRF2 pathway by Erianin: A novel approach to reduce psoriasiform inflammation and inflammatory signaling
- The expression of epidermal growth factor receptor 2 and its relationship with tumor-infiltrating lymphocytes and clinical pathological features in breast cancer patients
- Innovations in MALDI-TOF Mass Spectrometry: Bridging modern diagnostics and historical insights
- BAP1 complexes with YY1 and RBBP7 and its downstream targets in ccRCC cells
- Hypereosinophilic syndrome with elevated IgG4 and T-cell clonality: A report of two cases
- Electroacupuncture alleviates sciatic nerve injury in sciatica rats by regulating BDNF and NGF levels, myelin sheath degradation, and autophagy
- Polydatin prevents cholesterol gallstone formation by regulating cholesterol metabolism via PPAR-γ signaling
- RNF144A and RNF144B: Important molecules for health
- Analysis of the detection rate and related factors of thyroid nodules in the healthy population
- Artesunate inhibits hepatocellular carcinoma cell migration and invasion through OGA-mediated O-GlcNAcylation of ZEB1
- Endovascular management of post-pancreatectomy hemorrhage caused by a hepatic artery pseudoaneurysm: Case report and review of the literature
- Efficacy and safety of anti-PD-1/PD-L1 antibodies in patients with relapsed refractory diffuse large B-cell lymphoma: A meta-analysis
- SATB2 promotes humeral fracture healing in rats by activating the PI3K/AKT pathway
- Overexpression of the ferroptosis-related gene, NFS1, corresponds to gastric cancer growth and tumor immune infiltration
- Understanding risk factors and prognosis in diabetic foot ulcers
- Atractylenolide I alleviates the experimental allergic response in mice by suppressing TLR4/NF-kB/NLRP3 signalling
- FBXO31 inhibits the stemness characteristics of CD147 (+) melanoma stem cells
- Immune molecule diagnostics in colorectal cancer: CCL2 and CXCL11
- Inhibiting CXCR6 promotes senescence of activated hepatic stellate cells with limited proinflammatory SASP to attenuate hepatic fibrosis
- Cadmium toxicity, health risk and its remediation using low-cost biochar adsorbents
- Pulmonary cryptococcosis with headache as the first presentation: A case report
- Solitary pulmonary metastasis with cystic airspaces in colon cancer: A rare case report
- RUNX1 promotes denervation-induced muscle atrophy by activating the JUNB/NF-κB pathway and driving M1 macrophage polarization
- Morphometric analysis and immunobiological investigation of Indigofera oblongifolia on the infected lung with Plasmodium chabaudi
- The NuA4/TIP60 histone-modifying complex and Hr78 modulate the Lobe2 mutant eye phenotype
- Experimental study on salmon demineralized bone matrix loaded with recombinant human bone morphogenetic protein-2: In vitro and in vivo study
- A case of IgA nephropathy treated with a combination of telitacicept and half-dose glucocorticoids
- Analgesic and toxicological evaluation of cannabidiol-rich Moroccan Cannabis sativa L. (Khardala variety) extract: Evidence from an in vivo and in silico study
- Wound healing and signaling pathways
- Combination of immunotherapy and whole-brain radiotherapy on prognosis of patients with multiple brain metastases: A retrospective cohort study
- To explore the relationship between endometrial hyperemia and polycystic ovary syndrome
- Research progress on the impact of curcumin on immune responses in breast cancer
- Biogenic Cu/Ni nanotherapeutics from Descurainia sophia (L.) Webb ex Prantl seeds for the treatment of lung cancer
- Dapagliflozin attenuates atrial fibrosis via the HMGB1/RAGE pathway in atrial fibrillation rats
- Glycitein alleviates inflammation and apoptosis in keratinocytes via ROS-associated PI3K–Akt signalling pathway
- ADH5 inhibits proliferation but promotes EMT in non-small cell lung cancer cell through activating Smad2/Smad3
- Apoptotic efficacies of AgNPs formulated by Syzygium aromaticum leaf extract on 32D-FLT3-ITD human leukemia cell line with PI3K/AKT/mTOR signaling pathway
- Novel cuproptosis-related genes C1QBP and PFKP identified as prognostic and therapeutic targets in lung adenocarcinoma
- Bee venom promotes exosome secretion and alters miRNA cargo in T cells
- Treatment of pure red cell aplasia in a chronic kidney disease patient with roxadustat: A case report
- Comparative bioinformatics analysis of the Wnt pathway in breast cancer: Selection of novel biomarker panels associated with ER status
- Kynurenine facilitates renal cell carcinoma progression by suppressing M2 macrophage pyroptosis through inhibition of CASP1 cleavage
- RFX5 promotes the growth, motility, and inhibits apoptosis of gastric adenocarcinoma cells through the SIRT1/AMPK axis
- ALKBH5 exacerbates early cardiac damage after radiotherapy for breast cancer via m6A demethylation of TLR4
- Phytochemicals of Roman chamomile: Antioxidant, anti-aging, and whitening activities of distillation residues
- Circadian gene Cry1 inhibits the tumorigenicity of hepatocellular carcinoma by the BAX/BCL2-mediated apoptosis pathway
- The TNFR-RIPK1/RIPK3 signalling pathway mediates the effect of lanthanum on necroptosis of nerve cells
- Longitudinal monitoring of autoantibody dynamics in patients with early-stage non-small-cell lung cancer undergoing surgery
- The potential role of rutin, a flavonoid, in the management of cancer through modulation of cell signaling pathways
- Construction of pectinase gene engineering microbe and its application in tobacco sheets
- Construction of a microbial abundance prognostic scoring model based on intratumoral microbial data for predicting the prognosis of lung squamous cell carcinoma
- Sepsis complicated by haemophagocytic lymphohistiocytosis triggered by methicillin-resistant Staphylococcus aureus and human herpesvirus 8 in an immunocompromised elderly patient: A case report
- Sarcopenia in liver transplantation: A comprehensive bibliometric study of current research trends and future directions
- Advances in cancer immunotherapy and future directions in personalized medicine
- Can coronavirus disease 2019 affect male fertility or cause spontaneous abortion? A two-sample Mendelian randomization analysis
- Heat stroke associated with novel leukaemia inhibitory factor receptor gene variant in a Chinese infant
- PSME2 exacerbates ulcerative colitis by disrupting intestinal barrier function and promoting autophagy-dependent inflammation
- Hyperosmolar hyperglycemic state with severe hypernatremia coexisting with central diabetes insipidus: A case report and literature review
- Efficacy and mechanism of escin in improving the tissue microenvironment of blood vessel walls via anti-inflammatory and anticoagulant effects: Implications for clinical practice
- Merkel cell carcinoma: Clinicopathological analysis of three patients and literature review
- Genetic variants in VWF exon 26 and their implications for type 1 Von Willebrand disease in a Saudi Arabian population
- Lipoxin A4 improves myocardial ischemia/reperfusion injury through the Notch1-Nrf2 signaling pathway
- High levels of EPHB2 expression predict a poor prognosis and promote tumor progression in endometrial cancer
- Knockdown of SHP-2 delays renal tubular epithelial cell injury in diabetic nephropathy by inhibiting NLRP3 inflammasome-mediated pyroptosis
- Exploring the toxicity mechanisms and detoxification methods of Rhizoma Paridis
- Concomitant gastric carcinoma and primary hepatic angiosarcoma in a patient: A case report
- YAP1 inhibition protects retinal vascular endothelial cells under high glucose by inhibiting autophagy
- Identification of secretory protein related biomarkers for primary biliary cholangitis based on machine learning and experimental validation
- Integrated genomic and clinical modeling for prognostic assessment of radiotherapy response in rectal neoplasms
- Stem cell-based approaches for glaucoma treatment: a mini review
- Bacteriophage titering by optical density means: KOTE assays
- Neutrophil-related signature characterizes immune landscape and predicts prognosis of esophageal squamous cell carcinoma
- Integrated bioinformatic analysis and machine learning strategies to identify new potential immune biomarkers for Alzheimer’s disease and their targeting prediction with geniposide
- TRIM21 accelerates ferroptosis in intervertebral disc degeneration by promoting SLC7A11 ubiquitination and degradation
- TRIM21 accelerates ferroptosis in intervertebral disc degeneration by promoting SLC7A11 ubiquitination and degradation
- Histone modification and non-coding RNAs in skin aging: emerging therapeutic avenues
- A multiplicative behavioral model of DNA replication initiation in cells
- Biogenic gold nanoparticles synthesized from Pergularia daemia leaves: a novel approach for nasopharyngeal carcinoma therapy
- Creutzfeldt-Jakob disease mimicking Hashimoto’s encephalopathy: steroid response followed by decline
- Impact of semaphorin, Sema3F, on the gene transcription and protein expression of CREB and its binding protein CREBBP in primary hippocampal neurons of rats
- Iron overloaded M0 macrophages regulate hematopoietic stem cell proliferation and senescence via the Nrf2/Keap1/HO-1 pathway
- Revisiting the link between NADPH oxidase p22phox C242T polymorphism and ischemic stroke risk: an updated meta-analysis
- Exercise training preferentially modulates α1D-adrenergic receptor expression in peripheral arteries of hypertensive rats
- Overexpression of HE4/WFDC2 gene in mice leads to keratitis and corneal opacity
- Tumoral calcinosis complicating CKD-MBD in hemodialysis: a case report
- Mechanism of KLF4 Inhibition of epithelial-mesenchymal transition in gastric cancer cells
- Dissecting the molecular mechanisms of T cell infiltration in psoriatic lesions via cell-cell communication and regulatory network analysis
- Circadian rhythm-based prognostic features predict immune infiltration and tumor microenvironment in molecular subtypes of hepatocellular carcinoma
- Ecology and Environmental Science
- Optimization and comparative study of Bacillus consortia for cellulolytic potential and cellulase enzyme activity
- The complete mitochondrial genome analysis of Haemaphysalis hystricis Supino, 1897 (Ixodida: Ixodidae) and its phylogenetic implications
- Epidemiological characteristics and risk factors analysis of multidrug-resistant tuberculosis among tuberculosis population in Huzhou City, Eastern China
- Indices of human impacts on landscapes: How do they reflect the proportions of natural habitats?
- Genetic analysis of the Siberian flying squirrel population in the northern Changbai Mountains, Northeast China: Insights into population status and conservation
- Diversity and environmental drivers of Suillus communities in Pinus sylvestris var. mongolica forests of Inner Mongolia
- Global assessment of the fate of nitrogen deposition in forest ecosystems: Insights from 15N tracer studies
- Fungal and bacterial pathogenic co-infections mainly lead to the assembly of microbial community in tobacco stems
- Influencing of coal industry related airborne particulate matter on ocular surface tear film injury and inflammatory factor expression in Sprague-Dawley rats
- Temperature-dependent development, predation, and life table of Sphaerophoria macrogaster (Thomson) (Diptera: Syrphidae) feeding on Myzus persicae (Sulzer) (Homoptera: Aphididae)
- Eleonora’s falcon trophic interactions with insects within its breeding range: A systematic review
- Agriculture
- Integrated analysis of transcriptome, sRNAome, and degradome involved in the drought-response of maize Zhengdan958
- Variation in flower frost tolerance among seven apple cultivars and transcriptome response patterns in two contrastingly frost-tolerant selected cultivars
- Heritability of durable resistance to stripe rust in bread wheat (Triticum aestivum L.)
- Molecular mechanism of follicular development in laying hens based on the regulation of water metabolism
- Molecular identification and control studies on Coridius sp. (Hemiptera: Dinidoridae) in Al-Khamra, south of Jeddah, Saudi Arabia
- 10.1515/biol-2025-1218
- Animal Science
- Effect of sex ratio on the life history traits of an important invasive species, Spodoptera frugiperda
- Plant Sciences
- Hairpin in a haystack: In silico identification and characterization of plant-conserved microRNA in Rafflesiaceae
- Widely targeted metabolomics of different tissues in Rubus corchorifolius
- The complete chloroplast genome of Gerbera piloselloides (L.) Cass., 1820 (Carduoideae, Asteraceae) and its phylogenetic analysis
- Field trial to correlate mineral solubilization activity of Pseudomonas aeruginosa and biochemical content of groundnut plants
- Correlation analysis between semen routine parameters and sperm DNA fragmentation index in patients with semen non-liquefaction: A retrospective study
- Plasticity of the anatomical traits of Rhododendron L. (Ericaceae) leaves and its implications in adaptation to the plateau environment
- Effects of Piriformospora indica and arbuscular mycorrhizal fungus on growth and physiology of Moringa oleifera under low-temperature stress
- Effects of different sources of potassium fertiliser on yield, fruit quality and nutrient absorption in “Harward” kiwifruit (Actinidia deliciosa)
- Comparative efficiency and residue levels of spraying programs against powdery mildew in grape varieties
- The DREB7 transcription factor enhances salt tolerance in soybean plants under salt stress
- Using plant electrical signals of water hyacinth (Eichhornia crassipes) for water pollution monitoring
- Response of hybrid grapes (Vitis spp.) to two biotic stress factors and their seedlessness status
- Metabolomic profiling reveals systemic metabolic reprogramming in Alternaria alternata under salt stress
- Effects of mixed salinity and alkali stress on photosynthetic characteristics and PEPC gene expression of vegetable soybean seedlings
- Food Science
- Phytochemical analysis of Stachys iva: Discovering the optimal extract conditions and its bioactive compounds
- Review on role of honey in disease prevention and treatment through modulation of biological activities
- Computational analysis of polymorphic residues in maltose and maltotriose transporters of a wild Saccharomyces cerevisiae strain
- Optimization of phenolic compound extraction from Tunisian squash by-products: A sustainable approach for antioxidant and antibacterial applications
- Liupao tea aqueous extract alleviates dextran sulfate sodium-induced ulcerative colitis in rats by modulating the gut microbiota
- Toxicological qualities and detoxification trends of fruit by-products for valorization: A review
- Polyphenolic spectrum of cornelian cherry fruits and their health-promoting effect
- Optimizing the encapsulation of the refined extract of squash peels for functional food applications: A sustainable approach to reduce food waste
- Advancements in curcuminoid formulations: An update on bioavailability enhancement strategies curcuminoid bioavailability and formulations
- Impact of saline sprouting on antioxidant properties and bioactive compounds in chia seeds
- The dilemma of food genetics and improvement
- Causal effects of trace elements on congenital foot deformities and their subtypes: a Mendelian randomization study with gut microbiota mediation
- Honey meets acidity: a novel biopreservative approach against foodborne pathogens
- Bioengineering and Biotechnology
- Impact of hyaluronic acid-modified hafnium metalorganic frameworks containing rhynchophylline on Alzheimer’s disease
- Emerging patterns in nanoparticle-based therapeutic approaches for rheumatoid arthritis: A comprehensive bibliometric and visual analysis spanning two decades
- Application of CRISPR/Cas gene editing for infectious disease control in poultry
- Preparation of hafnium nitride-coated titanium implants by magnetron sputtering technology and evaluation of their antibacterial properties and biocompatibility
- Preparation and characterization of lemongrass oil nanoemulsion: Antimicrobial, antibiofilm, antioxidant, and anticancer activities
- Fluorescent detection of sialic acid–binding lectins using functionalized quantum dots in ELISA format
- Smart tectorigenin-loaded ZnO hydrogel nanocomposites for targeted wound healing: synthesis, characterization, and biological evaluation
- Corrigendum
- Corrigendum to “Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells”
- Corrigendum to “Effects of Ire1 gene on virulence and pathogenicity of Candida albicans”
- Retraction
- Retraction of “Down-regulation of miR-539 indicates poor prognosis in patients with pancreatic cancer”
Articles in the same Issue
- Safety assessment and modulation of hepatic CYP3A4 and UGT enzymes by Glycyrrhiza glabra aqueous extract in female Sprague–Dawley rats
- Adult-onset Still’s disease with hemophagocytic lymphohistiocytosis and minimal change disease
- Role of DZ2002 in reducing corneal graft rejection in rats by influencing Th17 activation via inhibition of the PI3K/AKT pathway and downregulation of TRAF1
- Biomedical Sciences
- Mechanism of triptolide regulating proliferation and apoptosis of hepatoma cells by inhibiting JAK/STAT pathway
- Maslinic acid improves mitochondrial function and inhibits oxidative stress and autophagy in human gastric smooth muscle cells
- Comparative analysis of inflammatory biomarkers for the diagnosis of neonatal sepsis: IL-6, IL-8, SAA, CRP, and PCT
- Post-pandemic insights on COVID-19 and premature ovarian insufficiency
- Proteome differences of dental stem cells between permanent and deciduous teeth by data-independent acquisition proteomics
- Optimizing a modified cetyltrimethylammonium bromide protocol for fungal DNA extraction: Insights from multilocus gene amplification
- Preliminary analysis of the role of small hepatitis B surface proteins mutations in the pathogenesis of occult hepatitis B infection via the endoplasmic reticulum stress-induced UPR-ERAD pathway
- Efficacy of alginate-coated gold nanoparticles against antibiotics-resistant Staphylococcus and Streptococcus pathogens of acne origins
- Battling COVID-19 leveraging nanobiotechnology: Gold and silver nanoparticle–B-escin conjugates as SARS-CoV-2 inhibitors
- Neurodegenerative diseases and neuroinflammation-induced apoptosis
- Impact of fracture fixation surgery on cognitive function and the gut microbiota in mice with a history of stroke
- COLEC10: A potential tumor suppressor and prognostic biomarker in hepatocellular carcinoma through modulation of EMT and PI3K-AKT pathways
- High-temperature requirement serine protease A2 inhibitor UCF-101 ameliorates damaged neurons in traumatic brain-injured rats by the AMPK/NF-κB pathway
- SIK1 inhibits IL-1β-stimulated cartilage apoptosis and inflammation in vitro through the CRTC2/CREB1 signaling
- Rutin–chitooligosaccharide complex: Comprehensive evaluation of its anti-inflammatory and analgesic properties in vitro and in vivo
- Knockdown of Aurora kinase B alleviates high glucose-triggered trophoblast cells damage and inflammation during gestational diabetes
- Calcium-sensing receptors promoted Homer1 expression and osteogenic differentiation in bone marrow mesenchymal stem cells
- ABI3BP can inhibit the proliferation, invasion, and epithelial–mesenchymal transition of non-small-cell lung cancer cells
- Changes in blood glucose and metabolism in hyperuricemia mice
- Rapid detection of the GJB2 c.235delC mutation based on CRISPR-Cas13a combined with lateral flow dipstick
- IL-11 promotes Ang II-induced autophagy inhibition and mitochondrial dysfunction in atrial fibroblasts
- Short-chain fatty acid attenuates intestinal inflammation by regulation of gut microbial composition in antibiotic-associated diarrhea
- Application of metagenomic next-generation sequencing in the diagnosis of pathogens in patients with diabetes complicated by community-acquired pneumonia
- NAT10 promotes radiotherapy resistance in non-small cell lung cancer by regulating KPNB1-mediated PD-L1 nuclear translocation
- Phytol-mixed micelles alleviate dexamethasone-induced osteoporosis in zebrafish: Activation of the MMP3–OPN–MAPK pathway-mediating bone remodeling
- Association between TGF-β1 and β-catenin expression in the vaginal wall of patients with pelvic organ prolapse
- Primary pleomorphic liposarcoma involving bilateral ovaries: Case report and literature review
- Effects of de novo donor-specific Class I and II antibodies on graft outcomes after liver transplantation: A pilot cohort study
- Sleep architecture in Alzheimer’s disease continuum: The deep sleep question
- Ephedra fragilis plant extract: A groundbreaking corrosion inhibitor for mild steel in acidic environments – electrochemical, EDX, DFT, and Monte Carlo studies
- Langerhans cell histiocytosis in an adult patient with upper jaw and pulmonary involvement: A case report
- Inhibition of mast cell activation by Jaranol-targeted Pirin ameliorates allergic responses in mouse allergic rhinitis
- Aeromonas veronii-induced septic arthritis of the hip in a child with acute lymphoblastic leukemia
- Clusterin activates the heat shock response via the PI3K/Akt pathway to protect cardiomyocytes from high-temperature-induced apoptosis
- Research progress on fecal microbiota transplantation in tumor prevention and treatment
- Low-pressure exposure influences the development of HAPE
- Stigmasterol alleviates endplate chondrocyte degeneration through inducing mitophagy by enhancing PINK1 mRNA acetylation via the ESR1/NAT10 axis
- AKAP12, mediated by transcription factor 21, inhibits cell proliferation, metastasis, and glycolysis in lung squamous cell carcinoma
- Association between PAX9 or MSX1 gene polymorphism and tooth agenesis risk: A meta-analysis
- A case of bloodstream infection caused by Neisseria gonorrhoeae
- Case of nasopharyngeal tuberculosis complicated with cervical lymph node and pulmonary tuberculosis
- p-Cymene inhibits pro-fibrotic and inflammatory mediators to prevent hepatic dysfunction
- GFPT2 promotes paclitaxel resistance in epithelial ovarian cancer cells via activating NF-κB signaling pathway
- Transfer RNA-derived fragment tRF-36 modulates varicose vein progression via human vascular smooth muscle cell Notch signaling
- RTA-408 attenuates the hepatic ischemia reperfusion injury in mice possibly by activating the Nrf2/HO-1 signaling pathway
- Decreased serum TIMP4 levels in patients with rheumatoid arthritis
- Sirt1 protects lupus nephritis by inhibiting the NLRP3 signaling pathway in human glomerular mesangial cells
- Sodium butyrate aids brain injury repair in neonatal rats
- Interaction of MTHFR polymorphism with PAX1 methylation in cervical cancer
- Convallatoxin inhibits proliferation and angiogenesis of glioma cells via regulating JAK/STAT3 pathway
- The effect of the PKR inhibitor, 2-aminopurine, on the replication of influenza A virus, and segment 8 mRNA splicing
- Effects of Ire1 gene on virulence and pathogenicity of Candida albicans
- Small cell lung cancer with small intestinal metastasis: Case report and literature review
- GRB14: A prognostic biomarker driving tumor progression in gastric cancer through the PI3K/AKT signaling pathway by interacting with COBLL1
- 15-Lipoxygenase-2 deficiency induces foam cell formation that can be restored by salidroside through the inhibition of arachidonic acid effects
- FTO alleviated the diabetic nephropathy progression by regulating the N6-methyladenosine levels of DACT1
- Clinical relevance of inflammatory markers in the evaluation of severity of ulcerative colitis: A retrospective study
- Zinc valproic acid complex promotes osteoblast differentiation and exhibits anti-osteoporotic potential
- Primary pulmonary synovial sarcoma in the bronchial cavity: A case report
- Metagenomic next-generation sequencing of alveolar lavage fluid improves the detection of pulmonary infection
- Uterine tumor resembling ovarian sex cord tumor with extensive rhabdoid differentiation: A case report
- Genomic analysis of a novel ST11(PR34365) Clostridioides difficile strain isolated from the human fecal of a CDI patient in Guizhou, China
- Effects of tiered cardiac rehabilitation on CRP, TNF-α, and physical endurance in older adults with coronary heart disease
- Changes in T-lymphocyte subpopulations in patients with colorectal cancer before and after acupoint catgut embedding acupuncture observation
- Modulating the tumor microenvironment: The role of traditional Chinese medicine in improving lung cancer treatment
- Alterations of metabolites related to microbiota–gut–brain axis in plasma of colon cancer, esophageal cancer, stomach cancer, and lung cancer patients
- Research on individualized drug sensitivity detection technology based on bio-3D printing technology for precision treatment of gastrointestinal stromal tumors
- CEBPB promotes ulcerative colitis-associated colorectal cancer by stimulating tumor growth and activating the NF-κB/STAT3 signaling pathway
- Oncolytic bacteria: A revolutionary approach to cancer therapy
- A de novo meningioma with rapid growth: A possible malignancy imposter?
- Diagnosis of secondary tuberculosis infection in an asymptomatic elderly with cancer using next-generation sequencing: Case report
- Hesperidin and its zinc(ii) complex enhance osteoblast differentiation and bone formation: In vitro and in vivo evaluations
- Research progress on the regulation of autophagy in cardiovascular diseases by chemokines
- Anti-arthritic, immunomodulatory, and inflammatory regulation by the benzimidazole derivative BMZ-AD: Insights from an FCA-induced rat model
- Immunoassay for pyruvate kinase M1/2 as an Alzheimer’s biomarker in CSF
- The role of HDAC11 in age-related hearing loss: Mechanisms and therapeutic implications
- Evaluation and application analysis of animal models of PIPNP based on data mining
- Therapeutic approaches for liver fibrosis/cirrhosis by targeting pyroptosis
- Fabrication of zinc oxide nanoparticles using Ruellia tuberosa leaf extract induces apoptosis through P53 and STAT3 signalling pathways in prostate cancer cells
- Haplo-hematopoietic stem cell transplantation and immunoradiotherapy for severe aplastic anemia complicated with nasopharyngeal carcinoma: A case report
- Modulation of the KEAP1-NRF2 pathway by Erianin: A novel approach to reduce psoriasiform inflammation and inflammatory signaling
- The expression of epidermal growth factor receptor 2 and its relationship with tumor-infiltrating lymphocytes and clinical pathological features in breast cancer patients
- Innovations in MALDI-TOF Mass Spectrometry: Bridging modern diagnostics and historical insights
- BAP1 complexes with YY1 and RBBP7 and its downstream targets in ccRCC cells
- Hypereosinophilic syndrome with elevated IgG4 and T-cell clonality: A report of two cases
- Electroacupuncture alleviates sciatic nerve injury in sciatica rats by regulating BDNF and NGF levels, myelin sheath degradation, and autophagy
- Polydatin prevents cholesterol gallstone formation by regulating cholesterol metabolism via PPAR-γ signaling
- RNF144A and RNF144B: Important molecules for health
- Analysis of the detection rate and related factors of thyroid nodules in the healthy population
- Artesunate inhibits hepatocellular carcinoma cell migration and invasion through OGA-mediated O-GlcNAcylation of ZEB1
- Endovascular management of post-pancreatectomy hemorrhage caused by a hepatic artery pseudoaneurysm: Case report and review of the literature
- Efficacy and safety of anti-PD-1/PD-L1 antibodies in patients with relapsed refractory diffuse large B-cell lymphoma: A meta-analysis
- SATB2 promotes humeral fracture healing in rats by activating the PI3K/AKT pathway
- Overexpression of the ferroptosis-related gene, NFS1, corresponds to gastric cancer growth and tumor immune infiltration
- Understanding risk factors and prognosis in diabetic foot ulcers
- Atractylenolide I alleviates the experimental allergic response in mice by suppressing TLR4/NF-kB/NLRP3 signalling
- FBXO31 inhibits the stemness characteristics of CD147 (+) melanoma stem cells
- Immune molecule diagnostics in colorectal cancer: CCL2 and CXCL11
- Inhibiting CXCR6 promotes senescence of activated hepatic stellate cells with limited proinflammatory SASP to attenuate hepatic fibrosis
- Cadmium toxicity, health risk and its remediation using low-cost biochar adsorbents
- Pulmonary cryptococcosis with headache as the first presentation: A case report
- Solitary pulmonary metastasis with cystic airspaces in colon cancer: A rare case report
- RUNX1 promotes denervation-induced muscle atrophy by activating the JUNB/NF-κB pathway and driving M1 macrophage polarization
- Morphometric analysis and immunobiological investigation of Indigofera oblongifolia on the infected lung with Plasmodium chabaudi
- The NuA4/TIP60 histone-modifying complex and Hr78 modulate the Lobe2 mutant eye phenotype
- Experimental study on salmon demineralized bone matrix loaded with recombinant human bone morphogenetic protein-2: In vitro and in vivo study
- A case of IgA nephropathy treated with a combination of telitacicept and half-dose glucocorticoids
- Analgesic and toxicological evaluation of cannabidiol-rich Moroccan Cannabis sativa L. (Khardala variety) extract: Evidence from an in vivo and in silico study
- Wound healing and signaling pathways
- Combination of immunotherapy and whole-brain radiotherapy on prognosis of patients with multiple brain metastases: A retrospective cohort study
- To explore the relationship between endometrial hyperemia and polycystic ovary syndrome
- Research progress on the impact of curcumin on immune responses in breast cancer
- Biogenic Cu/Ni nanotherapeutics from Descurainia sophia (L.) Webb ex Prantl seeds for the treatment of lung cancer
- Dapagliflozin attenuates atrial fibrosis via the HMGB1/RAGE pathway in atrial fibrillation rats
- Glycitein alleviates inflammation and apoptosis in keratinocytes via ROS-associated PI3K–Akt signalling pathway
- ADH5 inhibits proliferation but promotes EMT in non-small cell lung cancer cell through activating Smad2/Smad3
- Apoptotic efficacies of AgNPs formulated by Syzygium aromaticum leaf extract on 32D-FLT3-ITD human leukemia cell line with PI3K/AKT/mTOR signaling pathway
- Novel cuproptosis-related genes C1QBP and PFKP identified as prognostic and therapeutic targets in lung adenocarcinoma
- Bee venom promotes exosome secretion and alters miRNA cargo in T cells
- Treatment of pure red cell aplasia in a chronic kidney disease patient with roxadustat: A case report
- Comparative bioinformatics analysis of the Wnt pathway in breast cancer: Selection of novel biomarker panels associated with ER status
- Kynurenine facilitates renal cell carcinoma progression by suppressing M2 macrophage pyroptosis through inhibition of CASP1 cleavage
- RFX5 promotes the growth, motility, and inhibits apoptosis of gastric adenocarcinoma cells through the SIRT1/AMPK axis
- ALKBH5 exacerbates early cardiac damage after radiotherapy for breast cancer via m6A demethylation of TLR4
- Phytochemicals of Roman chamomile: Antioxidant, anti-aging, and whitening activities of distillation residues
- Circadian gene Cry1 inhibits the tumorigenicity of hepatocellular carcinoma by the BAX/BCL2-mediated apoptosis pathway
- The TNFR-RIPK1/RIPK3 signalling pathway mediates the effect of lanthanum on necroptosis of nerve cells
- Longitudinal monitoring of autoantibody dynamics in patients with early-stage non-small-cell lung cancer undergoing surgery
- The potential role of rutin, a flavonoid, in the management of cancer through modulation of cell signaling pathways
- Construction of pectinase gene engineering microbe and its application in tobacco sheets
- Construction of a microbial abundance prognostic scoring model based on intratumoral microbial data for predicting the prognosis of lung squamous cell carcinoma
- Sepsis complicated by haemophagocytic lymphohistiocytosis triggered by methicillin-resistant Staphylococcus aureus and human herpesvirus 8 in an immunocompromised elderly patient: A case report
- Sarcopenia in liver transplantation: A comprehensive bibliometric study of current research trends and future directions
- Advances in cancer immunotherapy and future directions in personalized medicine
- Can coronavirus disease 2019 affect male fertility or cause spontaneous abortion? A two-sample Mendelian randomization analysis
- Heat stroke associated with novel leukaemia inhibitory factor receptor gene variant in a Chinese infant
- PSME2 exacerbates ulcerative colitis by disrupting intestinal barrier function and promoting autophagy-dependent inflammation
- Hyperosmolar hyperglycemic state with severe hypernatremia coexisting with central diabetes insipidus: A case report and literature review
- Efficacy and mechanism of escin in improving the tissue microenvironment of blood vessel walls via anti-inflammatory and anticoagulant effects: Implications for clinical practice
- Merkel cell carcinoma: Clinicopathological analysis of three patients and literature review
- Genetic variants in VWF exon 26 and their implications for type 1 Von Willebrand disease in a Saudi Arabian population
- Lipoxin A4 improves myocardial ischemia/reperfusion injury through the Notch1-Nrf2 signaling pathway
- High levels of EPHB2 expression predict a poor prognosis and promote tumor progression in endometrial cancer
- Knockdown of SHP-2 delays renal tubular epithelial cell injury in diabetic nephropathy by inhibiting NLRP3 inflammasome-mediated pyroptosis
- Exploring the toxicity mechanisms and detoxification methods of Rhizoma Paridis
- Concomitant gastric carcinoma and primary hepatic angiosarcoma in a patient: A case report
- YAP1 inhibition protects retinal vascular endothelial cells under high glucose by inhibiting autophagy
- Identification of secretory protein related biomarkers for primary biliary cholangitis based on machine learning and experimental validation
- Integrated genomic and clinical modeling for prognostic assessment of radiotherapy response in rectal neoplasms
- Stem cell-based approaches for glaucoma treatment: a mini review
- Bacteriophage titering by optical density means: KOTE assays
- Neutrophil-related signature characterizes immune landscape and predicts prognosis of esophageal squamous cell carcinoma
- Integrated bioinformatic analysis and machine learning strategies to identify new potential immune biomarkers for Alzheimer’s disease and their targeting prediction with geniposide
- TRIM21 accelerates ferroptosis in intervertebral disc degeneration by promoting SLC7A11 ubiquitination and degradation
- TRIM21 accelerates ferroptosis in intervertebral disc degeneration by promoting SLC7A11 ubiquitination and degradation
- Histone modification and non-coding RNAs in skin aging: emerging therapeutic avenues
- A multiplicative behavioral model of DNA replication initiation in cells
- Biogenic gold nanoparticles synthesized from Pergularia daemia leaves: a novel approach for nasopharyngeal carcinoma therapy
- Creutzfeldt-Jakob disease mimicking Hashimoto’s encephalopathy: steroid response followed by decline
- Impact of semaphorin, Sema3F, on the gene transcription and protein expression of CREB and its binding protein CREBBP in primary hippocampal neurons of rats
- Iron overloaded M0 macrophages regulate hematopoietic stem cell proliferation and senescence via the Nrf2/Keap1/HO-1 pathway
- Revisiting the link between NADPH oxidase p22phox C242T polymorphism and ischemic stroke risk: an updated meta-analysis
- Exercise training preferentially modulates α1D-adrenergic receptor expression in peripheral arteries of hypertensive rats
- Overexpression of HE4/WFDC2 gene in mice leads to keratitis and corneal opacity
- Tumoral calcinosis complicating CKD-MBD in hemodialysis: a case report
- Mechanism of KLF4 Inhibition of epithelial-mesenchymal transition in gastric cancer cells
- Dissecting the molecular mechanisms of T cell infiltration in psoriatic lesions via cell-cell communication and regulatory network analysis
- Circadian rhythm-based prognostic features predict immune infiltration and tumor microenvironment in molecular subtypes of hepatocellular carcinoma
- Ecology and Environmental Science
- Optimization and comparative study of Bacillus consortia for cellulolytic potential and cellulase enzyme activity
- The complete mitochondrial genome analysis of Haemaphysalis hystricis Supino, 1897 (Ixodida: Ixodidae) and its phylogenetic implications
- Epidemiological characteristics and risk factors analysis of multidrug-resistant tuberculosis among tuberculosis population in Huzhou City, Eastern China
- Indices of human impacts on landscapes: How do they reflect the proportions of natural habitats?
- Genetic analysis of the Siberian flying squirrel population in the northern Changbai Mountains, Northeast China: Insights into population status and conservation
- Diversity and environmental drivers of Suillus communities in Pinus sylvestris var. mongolica forests of Inner Mongolia
- Global assessment of the fate of nitrogen deposition in forest ecosystems: Insights from 15N tracer studies
- Fungal and bacterial pathogenic co-infections mainly lead to the assembly of microbial community in tobacco stems
- Influencing of coal industry related airborne particulate matter on ocular surface tear film injury and inflammatory factor expression in Sprague-Dawley rats
- Temperature-dependent development, predation, and life table of Sphaerophoria macrogaster (Thomson) (Diptera: Syrphidae) feeding on Myzus persicae (Sulzer) (Homoptera: Aphididae)
- Eleonora’s falcon trophic interactions with insects within its breeding range: A systematic review
- Agriculture
- Integrated analysis of transcriptome, sRNAome, and degradome involved in the drought-response of maize Zhengdan958
- Variation in flower frost tolerance among seven apple cultivars and transcriptome response patterns in two contrastingly frost-tolerant selected cultivars
- Heritability of durable resistance to stripe rust in bread wheat (Triticum aestivum L.)
- Molecular mechanism of follicular development in laying hens based on the regulation of water metabolism
- Molecular identification and control studies on Coridius sp. (Hemiptera: Dinidoridae) in Al-Khamra, south of Jeddah, Saudi Arabia
- 10.1515/biol-2025-1218
- Animal Science
- Effect of sex ratio on the life history traits of an important invasive species, Spodoptera frugiperda
- Plant Sciences
- Hairpin in a haystack: In silico identification and characterization of plant-conserved microRNA in Rafflesiaceae
- Widely targeted metabolomics of different tissues in Rubus corchorifolius
- The complete chloroplast genome of Gerbera piloselloides (L.) Cass., 1820 (Carduoideae, Asteraceae) and its phylogenetic analysis
- Field trial to correlate mineral solubilization activity of Pseudomonas aeruginosa and biochemical content of groundnut plants
- Correlation analysis between semen routine parameters and sperm DNA fragmentation index in patients with semen non-liquefaction: A retrospective study
- Plasticity of the anatomical traits of Rhododendron L. (Ericaceae) leaves and its implications in adaptation to the plateau environment
- Effects of Piriformospora indica and arbuscular mycorrhizal fungus on growth and physiology of Moringa oleifera under low-temperature stress
- Effects of different sources of potassium fertiliser on yield, fruit quality and nutrient absorption in “Harward” kiwifruit (Actinidia deliciosa)
- Comparative efficiency and residue levels of spraying programs against powdery mildew in grape varieties
- The DREB7 transcription factor enhances salt tolerance in soybean plants under salt stress
- Using plant electrical signals of water hyacinth (Eichhornia crassipes) for water pollution monitoring
- Response of hybrid grapes (Vitis spp.) to two biotic stress factors and their seedlessness status
- Metabolomic profiling reveals systemic metabolic reprogramming in Alternaria alternata under salt stress
- Effects of mixed salinity and alkali stress on photosynthetic characteristics and PEPC gene expression of vegetable soybean seedlings
- Food Science
- Phytochemical analysis of Stachys iva: Discovering the optimal extract conditions and its bioactive compounds
- Review on role of honey in disease prevention and treatment through modulation of biological activities
- Computational analysis of polymorphic residues in maltose and maltotriose transporters of a wild Saccharomyces cerevisiae strain
- Optimization of phenolic compound extraction from Tunisian squash by-products: A sustainable approach for antioxidant and antibacterial applications
- Liupao tea aqueous extract alleviates dextran sulfate sodium-induced ulcerative colitis in rats by modulating the gut microbiota
- Toxicological qualities and detoxification trends of fruit by-products for valorization: A review
- Polyphenolic spectrum of cornelian cherry fruits and their health-promoting effect
- Optimizing the encapsulation of the refined extract of squash peels for functional food applications: A sustainable approach to reduce food waste
- Advancements in curcuminoid formulations: An update on bioavailability enhancement strategies curcuminoid bioavailability and formulations
- Impact of saline sprouting on antioxidant properties and bioactive compounds in chia seeds
- The dilemma of food genetics and improvement
- Causal effects of trace elements on congenital foot deformities and their subtypes: a Mendelian randomization study with gut microbiota mediation
- Honey meets acidity: a novel biopreservative approach against foodborne pathogens
- Bioengineering and Biotechnology
- Impact of hyaluronic acid-modified hafnium metalorganic frameworks containing rhynchophylline on Alzheimer’s disease
- Emerging patterns in nanoparticle-based therapeutic approaches for rheumatoid arthritis: A comprehensive bibliometric and visual analysis spanning two decades
- Application of CRISPR/Cas gene editing for infectious disease control in poultry
- Preparation of hafnium nitride-coated titanium implants by magnetron sputtering technology and evaluation of their antibacterial properties and biocompatibility
- Preparation and characterization of lemongrass oil nanoemulsion: Antimicrobial, antibiofilm, antioxidant, and anticancer activities
- Fluorescent detection of sialic acid–binding lectins using functionalized quantum dots in ELISA format
- Smart tectorigenin-loaded ZnO hydrogel nanocomposites for targeted wound healing: synthesis, characterization, and biological evaluation
- Corrigendum
- Corrigendum to “Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells”
- Corrigendum to “Effects of Ire1 gene on virulence and pathogenicity of Candida albicans”
- Retraction
- Retraction of “Down-regulation of miR-539 indicates poor prognosis in patients with pancreatic cancer”