Startseite Inhibiting CXCR6 promotes senescence of activated hepatic stellate cells with limited proinflammatory SASP to attenuate hepatic fibrosis
Artikel Open Access

Inhibiting CXCR6 promotes senescence of activated hepatic stellate cells with limited proinflammatory SASP to attenuate hepatic fibrosis

  • Liqin Sheng , Yiming Wu , Fei Shen EMAIL logo und Chenzhou Xu EMAIL logo
Veröffentlicht/Copyright: 8. August 2025
Artikel downloaden (PDF)
Open Life Sciences
Aus der Zeitschrift Open Life Sciences Band 20 Heft 1

Abstract

This study investigates the previously unexplored role of CXC chemokine receptor 6 (CXCR6) in hepatic fibrosis, where excessive extracellular matrix deposition by activated hepatic stellate cells (aHSCs) drives disease progression. Through analysis of gene expression omnibus datasets and human fibrotic liver samples, we identified significant CXCR6 upregulation, subsequently validated in murine fibrosis models. Using quantitative real-time polymerase chain reaction, western blotting, and immunohistochemistry, we demonstrated that CXCR6 silencing in vitro promoted aHSC senescence – as confirmed by senescence-associated β-galactosidase staining and Cell Counting Kit-8 assays – while simultaneously restricting the pro-inflammatory senescence-associated secretory phenotype (SASP). Mechanistically, the enzyme-linked immunosorbent assay revealed this process involves modulation of the interleukin-1 alpha/nuclear factor-kappa beta feedback loop. Our findings position CXCR6 inhibition as a promising therapeutic strategy that uniquely targets both fibrogenesis (through hepatic stellate cell senescence induction) and inflammation (via SASP regulation) in hepatic fibrosis.

Keywords: hepatic stellate cells; senescence; SASP; CXCR6; hepatic fibrosis

1 Introduction

Hepatic fibrosis, a pathological response to chronic liver injury characterized by excessive deposition of the extracellular matrix (ECM), disrupts the normal liver architecture and serves as a precursor to cirrhosis [1]. This condition results from prolonged liver damage induced by factors such as hepatitis virus infection, alcohol abuse, or nonalcoholic steatohepatitis [2]. Hepatic cirrhosis, a consequence of advanced hepatic fibrosis, is the 11th leading cause of death worldwide, underscoring the urgent need for effective therapies to alleviate the health burden associated with cirrhosis. The overproduction of ECM in hepatic fibrosis is primarily driven by fibrogenic myofibroblasts [3,4]. Hepatic stellate cells (HSCs), the main progenitors of these myofibroblasts, play a pivotal role in the fibrogenic process. Under normal physiological conditions, HSCs exist in a quiescent state and store lipid droplets rich in vitamin A. When exposed to profibrotic stimuli, quiescent HSCs become activated and transdifferentiate into myofibroblast-like cells, termed activated HSCs (aHSCs). These aHSCs acquire various properties, including enhanced ECM synthesis, increased proliferation, and activation of inflammatory signaling pathways [5]. Furthermore, inhibiting aHSCs through phenotypic reversion, induction of apoptosis, or inhibition of glycolytic and contractile functions has been demonstrated to mitigate hepatic fibrosis [6,7,8,9]. Recent studies have also emphasized HSC senescence as a promising therapeutic target for hepatic fibrosis [10].

Cellular senescence is a physiological process in which proliferating cells enter a permanent state of cell cycle arrest, preventing re-entry into the cell cycle [11]. This process is characterized by a reduction in genes involved in proliferation and ECM synthesis, alongside an increase in inflammatory cytokine production and other mediators that influence the microenvironment and immune responses [12]. In aHSCs, senescence leads to decreased ECM synthesis, increased ECM-degrading enzyme activity, and enhanced immune surveillance [13]. Consequently, inducing senescence in aHSCs may serve as a potential therapeutic strategy for hepatic fibrosis. Moreover, cellular senescence is frequently associated with a senescence-associated secretory phenotype (SASP), which involves the secretion of chemokines, growth factors, and other proteins [14]. However, the precise molecular mechanisms regulating SASP in hepatic fibrosis remain poorly understood. Identifying and targeting key regulators of SASP may provide valuable insights into therapeutic strategies that exploit the beneficial effects of senescence in treating hepatic fibrosis.

CXC chemokine receptor 6 (CXCR6), a G-protein-coupled receptor with seven transmembrane domains, belongs to the CXC chemokine receptor family [15]. CXCL16, the sole ligand eliciting cytokine secretion via the nuclear factor-κB (NF-κB) and extracellular signal-regulated kinase/mitogen-activated protein kinase pathways thereby influences the immune microenvironment [16,17,18]. In hepatocellular carcinoma, CXCR6 plays a crucial role in regulating hepatocyte senescence through immune surveillance, ultimately suppressing hepatocarcinogenesis [19]. Similarly, HSC activation, along with the associated alterations in inflammatory signaling and the immune microenvironment, is closely associated with CXCR6 activation [20]. Consequently, CXCR6 may emerge as a promising therapeutic target for modulating HSC behavior.

In this study, CXCR6 was found to be upregulated in hepatic fibrosis. Inhibition of CXCR6 promoted cellular senescence in aHSCs, unveiling a novel mechanism underlying the anti-fibrotic effects of CXCR6 modulation.

2 Materials and methods

2.1 Patient specimens

Paraffin-embedded liver sections from human tissues were obtained from the Affiliated Hospital of Jiaxing University between 2020 and 2023. The fibrotic liver specimens used in our study were indeed obtained from patients with confirmed hepatic fibrosis, while the normal liver tissues were collected from the non-tumor regions of hepatic hemangioma patients. These control tissues showed no signs of fibrosis or other liver injuries.

  1. Informed consent: Informed consent was obtained from all individuals included in this study.

  2. Ethical approval: The research related to human use complied with all the relevant national regulations, institutional policies, and in accordance with the tenets of the Helsinki Declaration, and was approved by the Ethics Committee of The First Hospital of Jiaxing (Jiaxing, China) (study/trial no.: 2013-017).

2.2 Public data collection

Datasets GSE171294, GSE84044, GSE14323, GSE25097, and GSE6764 were retrieved from the gene expression omnibus (http://www.ncbi.nlm.nih.gov/) and used to analyze the differences in CXCR6 expression between normal controls and patients with liver fibrosis.

2.3 Animal model and experimental protocols

Twenty male ICR mice (18–20 g; 6–8 weeks old) were purchased from the Animal Center of Jiaxing University and housed in a pathogen-free environment.

Hepatic fibrosis was induced using two methods: common bile duct ligation (BDL) and intraperitoneal injections of carbon tetrachloride (CCl4). For BDL, mice were anesthetized with a 40 mg/kg intraperitoneal injection of 3% sodium pentobarbital under sterile conditions. A midline abdominal incision was made, and the common bile duct was exposed near the duodenum’s junction. Two ligatures were placed below the bile duct, and a midsection cut was made. The control group underwent identical procedures without ligation. Hepatic fibrosis was induced for 14 days post-surgery, followed by intraperitoneal injections of 0.6 mL/kg body weight CCl4 twice a week for 40 days. Liver tissues were harvested at specified time points for further analysis.

  1. Ethical approval: The research related to animal use complied with all the relevant national regulations and institutional policies for the care and use of animals (JUMC2021-027).

2.4 Cell culture

The human HSC line LX-2 (Cat. BNCC337957) was obtained from Bena Culture Collection (Beijing, China). Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum and 1% penicillin–streptomycin antibiotic and maintained in an incubator at 37°C with 5% CO2. For HSC activation, transforming growth factor beta1 (TGF-β1) was added to the LX-2 cells at a concentration of 10 ng/mL for 24 h.

2.5 Reagents and antibodies

Etoposide (HY-13629) was sourced from MedChemExpress (Shanghai, China) and used at a concentration of 5 mmol/L in vitro. Pyrrolidine dithiocarbamate (PDTC) (HY-18738), also from MedChemExpress, was used at 100 mmol/L. Recombinant human interleukin-1 alpha (rIL-1α) (PHC0011) from Thermo Fisher Scientific (Shanghai, China) was applied at 20 ng/mL in vitro. Antibodies against CXCR6 (ab8023), alpha-1 subunit of type I collagen (COL1A1) (ab34710), tumor protein 53 (p53) (ab26), p21 (ab109520), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (ab8245) were purchased from Abcam (Shanghai, China). The LaminB1 antibody (12987-1-AP) was obtained from Proteintech (Wuhan, China), while the α-smooth muscle actin (α-SMA) antibody (mAb #19245) was from Cell Signaling Technology (Shanghai, China). Secondary antibodies, including Goat anti-rabbit IgG (H + L), horseradish peroxidase (HRP)-linked (Cat. #7074) and Goat anti-mouse IgG (H + L), HRP-linked (Cat. #7076), were from Cell Signaling Technology (Shanghai, China).

2.6 Quantitative real-time polymerase chain reaction (qPCR)

Total RNA from liver tissues and cells was extracted using TRIzol reagent (Thermo Fisher Scientific, Shanghai, China), followed by cDNA synthesis with a first-strand cDNA synthesis kit (Vazyme, Nanjing, China). qPCR was performed using SYBR-Green fluorescence-based assays for signal detection, with GAPDH serving as the internal reference for data normalization. Primer sequences are provided in Table 1.

Table 1

Sequence of primers for qPCR

Species Name Forward primer (5′–3′) Reverse primer (5′–3′)
Mouse Timp-1 GCAACTCGGACCTGGTCATAA CGGCCCGTGATGAGAAACT
Mouse Col1a1 TTCTCCTGGCAAAGACGGAC CCATCGGTCATGCTCTCTCC
Mouse Tgfb CTCCCGTGGCTTCTAGTGC GCCTTAGTTTGGACAGGATCTG
Mouse Cxcr6 GAGTCAGCTCTGTACGATGGG TCCTTGAACTTTAGGAAGCGTTT
Mouse Gapdh GGAGAGTGTTTCCTCGTCCC ACTGTGCCGTTGAATTTGCC
Human CXCR6 GACTATGGGTTCAGCAGTTTCA GGCTCTGCAACTTATGGTAGAAG
Human ACTA2 AAAAGACAGCTACGTGGGTGA GCCATGTTCTATCGGGTACTTC
Human IL1A TGGTAGTAGCAACCAACGGGA ACTTTGATTGAGGGCGTCATTC
Human IL1B ATGATGGCTTATTACAGTGGCAA GTCGGAGATTCGTAGCTGGA
Human IL6 ACTCACCTCTTCAGAACGAATTG CCATCTTTGGAAGGTTCAGGTTG
Human IL8 AGGACAACAGAGAGGTGTGC CAGCGGTGCATCAGAATTGAG
Human GAPDH CTGGGCTACACTGAGCACC AAGTGGTCGTTGAGGGCAATG

2.7 Immunohistochemistry (IHC)

Liver sections were fixed in 4% paraformaldehyde and subsequently washed three times with phosphate buffered saline (PBS). After a 5 min incubation in citrate buffer at 108°C, the slides were exposed to 0.3% hydrogen peroxide. Following that, the sections were incubated with 10% goat serum for 30 min, and the CXCR6 antibody was applied for overnight incubation at 4°C. A secondary antibody was then used for detection.

2.8 Histological hematoxylin–eosin (H&E), sirius red, and Masson staining

Liver sections underwent a series of graded alcohol dehydrations, followed by paraffin embedding and sectioning at 5 μm. The sections were stained with Masson’s trichrome, sirius red, and H&E for histological analysis. Ten random fields per slide were captured for Masson and sirius red staining, and the percentage of positively stained areas was quantified using ImageJ software.

2.9 Western blotting (WB)

Liver tissues or cells were lysed with RIPA buffer, and protein samples were separated by polyacrylamide gel electrophoresis before being transferred onto polyvinylidene fluoride membranes. After blocking, the membranes were probed with specific antibodies, and protein bands were visualized using the ChemiDoc XRS+ system.

2.10 Cell transfection

CXCR6 siRNA (AM16708) was obtained from Thermo Fisher Scientific (Shanghai, China). Transfection was performed using Lipofectamine RNAiMAX Transfection Reagent (Cat. 13778100, Thermo Fisher Scientific) following the manufacturer’s instructions.

2.11 Immunohistofluorescence

LX-2 cells were fixed with 4% paraformaldehyde following three washes with PBS. After fixation, the cells were treated with 10% NGS for 1 h and then exposed to 0.5% Triton X-100/PBS for 10 min. The cells were incubated overnight at 4°C with an anti-α-SMA antibody. Subsequently, the cells were incubated with goat anti-rabbit IgG (Alexa Fluor 647-labeled, Cat. 4414S, CST) for 1 h in darkness. The nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) solution, and images were captured using fluorescence microscopy.

2.12 Colony formation assay

Activated LX-2 cells, treated with or without CXCR6 siRNA, were seeded into a 6-well plate at 500 cells per well. The medium was replaced every 3 days. Colonies were allowed to grow for 2 weeks, followed by fixation with carbinol and staining with 0.1% crystal violet for 20 min.

2.13 Cell Counting Kit-8 (CCK-8) assay

Cell proliferation was assessed using the CCK-8 (Cat. HY-K0301, MedChemExpress, Shanghai, China) assay. LX-2 cells pre-treated with TGF-β were seeded into 96-well plates at a density of 1 × 103 cells per 100 μL. Cells were treated with or without CXCR6 siRNA, and after 12, 24, 48, and 72 h of incubation, the medium was replaced with a mixture of 10 μL CCK-8 solution and 90 μL DMEM per well. After 4 h of incubation, absorbance was measured at 450 nm using a microplate reader.

2.14 Senescence-associated β-galactosidase (SA-β-Gal) staining

SA-β-Gal staining was performed using the SA-β-Gal staining kit (Cat. C0602, Beyotime, Shanghai, China). Activated LX-2 cells, treated with or without CXCR6 siRNA, were seeded into 24-well plates and allowed to attach overnight. The cells were fixed for 15 min and washed three times with PBS. A total of 250 μL of β-Gal solution was added to each well, and cells were incubated overnight at 37°C as per the protocol. The cells were fixed with 2% formaldehyde/0.2% glutaraldehyde and incubated with X-Gal solution (1 mg/mL, pH 6.0) at 37°C for 16 h (non-hypoxic conditions). Imaging was performed using a Nikon Eclipse Ti microscope (40×). SA-β-Gal+ cells were defined as those showing intense perinuclear blue staining. Three independent researchers counted ≥500 cells/group across five random fields (blinded to treatment).

2.15 Enzyme-linked immunosorbent assay (ELISA)

Intracellular IL-1α secretion was measured using the Human IL-1α ELISA Kit (Cat. PI565, Beyotime, Shanghai, China). ELISA was conducted according to the manufacturer’s instructions.

2.16 Statistical analysis

Data are presented as mean ± SEM. Statistical analysis was performed using SPSS 20.0 software, and comparisons between two groups were made using a Student’s t-test. A p-value of less than 0.05 was considered statistically significant.

3 Results

3.1 CXCR6 is overexpressed in human hepatic fibrosis

CXCR6 expression was initially analyzed across five publicly available datasets, revealing elevated levels in hepatic fibrosis compared to normal liver tissues (Figure 1a). WB analysis confirmed the enhanced protein expression of both CXCR6 and α-SMA in advanced stages of hepatic fibrosis (Figure 1b). Additionally, qPCR analysis of human liver samples further corroborated the increased mRNA levels of α-SMA and CXCR6 in hepatic fibrosis (Figure 1c and d). IHC analysis also demonstrated a significant upregulation of CXCR6 in fibrotic liver tissues (Figure 1e). These results collectively suggest that CXCR6 is overexpressed in human hepatic fibrosis, highlighting its potential as a therapeutic target.

Figure 1 CXCR6 is overexpressed in human hepatic fibrosis. (a) Box plot depicting CXCR6 expression in normal and fibrotic liver tissues across the datasets GSE171294, GSE84044, GSE14323, GSE25097, and GSE6764. (b) WB analysis of CXCR6 and α-SMA proteins in liver fibrosis tissues at different fibrosis stages. (c) and (d) qPCR analysis of α-SMA and CXCR6 mRNA levels in liver fibrosis and normal tissues from human samples. (e) IHC staining showing high CXCR6 expression in liver fibrosis. *p < 0.05, **p < 0.01.
Figure 1

CXCR6 is overexpressed in human hepatic fibrosis. (a) Box plot depicting CXCR6 expression in normal and fibrotic liver tissues across the datasets GSE171294, GSE84044, GSE14323, GSE25097, and GSE6764. (b) WB analysis of CXCR6 and α-SMA proteins in liver fibrosis tissues at different fibrosis stages. (c) and (d) qPCR analysis of α-SMA and CXCR6 mRNA levels in liver fibrosis and normal tissues from human samples. (e) IHC staining showing high CXCR6 expression in liver fibrosis. *p < 0.05, **p < 0.01.

3.2 Enhanced CXCR6 derived from hepatic fibrosis in mouse models

To investigate the role of CXCR6 in hepatic fibrosis, two experimental models were established using intraperitoneal CCl4 injections and BDL. As shown in Figure 2a–c, Masson, H&E, and sirius red staining revealed characteristic fibrotic changes in the livers of mice, indicative of ECM accumulation. qPCR analysis revealed an upregulation of tissue inhibitor of metalloproteinase-1 (TIMP-1), a known matrix metalloproteinase inhibitor [21], in the liver fibrosis tissues (Figure 2d). Additionally, mRNA levels of fibrosis markers, COL1A1 and TGFB1, were elevated during hepatic fibrosis (Figure 2e and f), alongside an increase in CXCR6 expression (Figure 2g). WB analysis consistently showed higher protein levels of α-SMA and CXCR6 in the hepatic fibrosis models (Figure 2h and i). These results collectively demonstrate the upregulated expression of CXCR6 in hepatic fibrosis in mouse models.

Figure 2 Enhanced CXCR6 expression in hepatic fibrosis mouse models. (a) H&E, Masson, and sirius red staining of liver sections from mice with liver fibrosis. Scale bar: 50 mm; n = 6 per group. (b) and (c) Quantification of positive staining for Masson and sirius red (n = 6). (d)–(g) mRNA levels (normalized to GAPDH) of TIMP-1, COL1A1, TGFB1, and CXCR6 in liver fibrosis models (n = 6 per group). (h) WB analysis of CXCR6 and α-SMA proteins in liver fibrosis models. (i) Quantification of CXCR6 protein expression in liver fibrosis models. **p < 0.01, ***p < 0.001.
Figure 2

Enhanced CXCR6 expression in hepatic fibrosis mouse models. (a) H&E, Masson, and sirius red staining of liver sections from mice with liver fibrosis. Scale bar: 50 mm; n = 6 per group. (b) and (c) Quantification of positive staining for Masson and sirius red (n = 6). (d)–(g) mRNA levels (normalized to GAPDH) of TIMP-1, COL1A1, TGFB1, and CXCR6 in liver fibrosis models (n = 6 per group). (h) WB analysis of CXCR6 and α-SMA proteins in liver fibrosis models. (i) Quantification of CXCR6 protein expression in liver fibrosis models. **p < 0.01, ***p < 0.001.

3.3 CXCR6 inhibition promotes cellular senescence of aHSCs

Cellular senescence results in an irreversible cessation of cell growth, characterized by increased SA-β-gal activity and suppressed cell proliferation [22]. Senescent aHSCs exhibit reduced ECM secretion, and inducing HSC senescence has been proposed as a potential strategy to alleviate hepatic fibrosis [23]. To further investigate the role of CXCR6 in HSC senescence, LX-2 cells were activated with TGF-β1 and subsequently treated with CXCR6 siRNA. Collagen secretion and α-SMA expression are markers of HSC activation [24]. As presented in Figure 3a, CXCR6 knockdown inhibited α-SMA expression, as evidenced by decreased immunofluorescence. In contrast, TGF-β1-treated LX-2 cells exhibited increased protein levels of α-SMA and COL1α1, while CXCR6 inhibition led to downregulation of these markers (Figure 3b, Figure S1b). SA-β-gal staining revealed an elevated number of positive cells in the CXCR6 siRNA-treated group, suggesting that CXCR6 knockdown significantly enhanced SA-β-gal activity (Figure S1c). To explore the mechanisms underlying CXCR6 inhibition-induced HSC senescence, WB analysis was performed to assess the expression of senescent markers p53 and p21. The results demonstrated that CXCR6 knockdown upregulated the expression of p53 and p21, accompanied by a downregulation of lamin-B1 (Figure 3d). Colony formation and CCK-8 assays consistently showed decreased cell proliferation following CXCR6 siRNA treatment (Figure 3e and f, Figure S1a). Together, these results indicate that CXCR6 inhibition promotes senescence in aHSCs.

Figure 3 CXCR6 inhibition induces cellular senescence in aHSCs. (a) Representative images of immunofluorescence co-staining for α-SMA (red) and DAPI (blue) in aHSCs treated with or without CXCR6 siRNA. (b) WB analysis showing reduced protein levels of CXCR6, COL1α1, and α-SMA in aHSCs treated with CXCR6 siRNA. (c) SA-β-Gal staining in aHSCs treated with or without CXCR6 siRNA. (d) WB analysis of senescence-related proteins in aHSCs treated with or without CXCR6 siRNA. (e) Colony formation assays in aHSCs treated with or without CXCR6 siRNA. (f) Cell viability assessment using the CCK-8 assay in aHSCs treated with or without CXCR6 siRNA. **p < 0.01.
Figure 3

CXCR6 inhibition induces cellular senescence in aHSCs. (a) Representative images of immunofluorescence co-staining for α-SMA (red) and DAPI (blue) in aHSCs treated with or without CXCR6 siRNA. (b) WB analysis showing reduced protein levels of CXCR6, COL1α1, and α-SMA in aHSCs treated with CXCR6 siRNA. (c) SA-β-Gal staining in aHSCs treated with or without CXCR6 siRNA. (d) WB analysis of senescence-related proteins in aHSCs treated with or without CXCR6 siRNA. (e) Colony formation assays in aHSCs treated with or without CXCR6 siRNA. (f) Cell viability assessment using the CCK-8 assay in aHSCs treated with or without CXCR6 siRNA. **p < 0.01.

3.4 Inhibition of CXCR6 limits proinflammatory SASP in senescent HSCs

To investigate the relationship between CXCR6 inhibition and the SASP, LX-2 cells were pre-treated with TGF-β1 for activation, followed by exposure to the chemotherapeutic agent etoposide to induce growth arrest and enhance SASP production [25]. PCR analysis revealed that CXCR6-depleted senescent HSCs exhibited a reduction in inflammation-related SASP components, including IL1A, IL1B, IL6, and IL8, compared to the etoposide-treated group (Figure 4a). To explore the mechanisms underlying this effect, IL-1α secretion, a known upstream regulator of SASP and a modulator of IL-6/IL-8 secretion during senescence [26], was measured. ELISA showed that CXCR6 silencing led to a decrease in intracellular IL-1α secretion compared to etoposide treatment (Figure 4b). IL-1α is known to activate the nuclear factor-kappa beta (NF-κB) signaling pathway by binding to its receptor IL1R1, initiating a cascade of signals that culminate in the nuclear translocation of NF-κB [27]. Analysis of IL-1α/NF-κB signaling revealed that CXCR6 inhibition resulted in reduced IL-1α/NF-κB signaling, as evidenced by increased IRAK1 expression and decreased levels of phosphorylated IKBα and phosphorylated NF-κB (Figure 4c). Supplementation with rIL-1α reversed the inhibitory effect of CXCR6 silencing on NF-κB activation, suggesting that CXCR6 depletion hinders the NF-κB signaling pathway by reducing IL-1α levels (Figure 4c). Furthermore, rIL-1α supplementation restored the proinflammatory SASP after CXCR6 siRNA treatment (Figure 4d). Additionally, NF-κB activation is known to upregulate proinflammatory SASP genes such as IL-1α, forming a positive feedback loop involving IL-1α and NF-κB [28]. To validate this, the NF-κB inhibitor PDTC was used in combination with rIL-1α, showing that PDTC attenuated the increase in mRNA levels of IL1A, IL1B, IL6, and IL8 induced by rIL-1α supplementation (Figure 4d). In summary, these results suggest that CXCR6 inhibition limits proinflammatory SASP in senescent HSCs through an IL-1α/NF-κB feedback loop.

Figure 4 Inhibition of CXCR6 limits proinflammatory SASP in senescent HSCs. (a) qPCR analysis of proinflammatory SASP mRNA levels (IL1A, IL1B, IL6, and IL8) in CXCR6-depleted LX-2 cells (n = 3 per group). (b) ELISA of IL-1α secretion (n = 3 per group). (c) WB analysis of NF-κB signaling proteins. (d) qPCR analysis of IL1A, IL1B, IL6, and IL8 in CXCR6-inhibited LX-2 cells treated with rIL-1α and the NF-κB inhibitor PDTC (n = 3 per group). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001; ns, no significance.
Figure 4

Inhibition of CXCR6 limits proinflammatory SASP in senescent HSCs. (a) qPCR analysis of proinflammatory SASP mRNA levels (IL1A, IL1B, IL6, and IL8) in CXCR6-depleted LX-2 cells (n = 3 per group). (b) ELISA of IL-1α secretion (n = 3 per group). (c) WB analysis of NF-κB signaling proteins. (d) qPCR analysis of IL1A, IL1B, IL6, and IL8 in CXCR6-inhibited LX-2 cells treated with rIL-1α and the NF-κB inhibitor PDTC (n = 3 per group). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001; ns, no significance.

4 Discussion

Hepatic fibrosis is marked by accumulation of the ECM, which is predominantly synthesized by aHSCs [24]. Targeting senescent aHSCs, in addition to eliminating aHSCs through the inhibition of HSC proliferation and induction of apoptosis, represents a novel therapeutic approach for reversing hepatic fibrosis [29]. The SASP is contingent on the specific senescence trigger and comprises a diverse array of cytokines, growth factors, and proteases secreted by senescent cells [30]. In this study, CXCR6 inhibition promoted senescence in aHSCs, leading to a reduction in the secretion of pro-inflammatory SASP factors. Thus, targeting CXCR6 may offer a potential therapeutic strategy for hepatic fibrosis.

CXCR6, a member of the CXC chemokine receptor family, functions as the receptor for CXCL16 and is involved in cytokine secretion, cell proliferation, and immune regulation [31]. Elevated CXCR6 expression has been observed in various cancer tissues, including prostate cancer [32], pancreatic ductal adenocarcinoma [33], and schwannoma [34], indicating that CXCR6 could be a promising therapeutic target. Our research confirmed that CXCR6 is substantially expressed in patients with advanced hepatic fibrosis, as evidenced by the analysis of public datasets and human fibrotic liver samples. Similar findings were observed in experimental mouse models. Moreover, CXCR6 knockdown alleviated hepatic fibrosis, as indicated by the reduced expression of α-SMA and collagen type I α1 (COL1α1) in vitro.

Cellular senescence is characterized by irreversible growth arrest and plays a critical role in various pathological processes, including aging, tumor suppression, and wound healing [35]. Senescent aHSCs exhibit a flattened morphology, along with DNA damage responses such as cell cycle inhibition, high SA-β-gal activity, and SASP production [36]. The mechanisms driving HSC senescence involve various cell stressors, including reactive oxygen species and lysosomal stress [37], as well as the modulation of signaling pathways such as the cyclic GMP-AMP synthase-stimulator of interferon genes (cGAS-STING) pathway and NF-κB signaling. Additionally, metabolic processes associated with deoxycholic acid, produced by gut microbiota, contribute to the progression of HSC senescence [37]. Senescent aHSCs may also express surface ligands that facilitate their clearance by immune cells [38]. In the present study, CXCR6 downregulation induced senescence in aHSCs, as evidenced by increased SA-β-gal activity, decreased α-SMA and COL1α1 expression, and inhibited cell proliferation. Furthermore, studies have demonstrated that p53 overexpression is associated with elevated SA-β-gal activity, increased levels of p21 and p16, and cell cycle arrest [39]. Inhibition of p53 reduces HSC senescence and promotes hepatic fibrosis [40]. Consistent with this, the present study showed that CXCR6 small interfering RNA (siRNA) treatment induced a senescent phenotype in aHSCs, characterized by elevated p53 and p21 expression. Moreover, SASP is a hallmark of cellular senescence. Chronic release of SASP factors can lead to immune cell infiltration, exacerbating local inflammation by inducing paracrine signaling and disrupting tissue homeostasis [41]. Compared to the extensive secretion of SASP factors triggered by etoposide treatment in HSCs, CXCR6 inhibition resulted in reduced pro-inflammatory SASP expression, as evidenced by lower levels of IL-1A, IL-1B, IL-6, and IL-8.

The regulatory mechanisms underlying SASP are complex and involve various cytokines and factors, such as IL-1B, growth-regulated oncogene-α, and neutrophil-activating protein-2, which have been shown to be regulated by the CCAAT/enhancer-binding protein (C/EBP), with C/EBP-β particularly upregulated during oncogene-induced senescence [42]. The SASP can either promote or suppress tumorigenicity depending on the p53 status [43]. A key signaling pathway involved in SASP development is NF-κB, which is primarily activated in response to DNA damage [44,45,46]. Activation of ataxia telangiectasia mutated, a kinase triggered by DNA damage, leads to NF-κB activation through multiple signaling pathways, including p38 mitogen-activated protein kinase (p38MAPK) and retinoic acid-inducible gene I [47]. Additionally, epigenetic changes, such as alterations in sirtuin 6 and high-mobility group box 1 function, can amplify the transcription of inflammation-related genes dependent on NF-κB. Cyclin-dependent kinase inhibitors, such as p14ARF and p16INK4a, act as potent blockers of NF-κB [47]. In the present study, CXCR6-mediated pro-inflammatory SASP via the IL-1α/NF-κB feedback loop.

While aHSCs are unequivocally the primary source of pathological ECM deposition in hepatic fibrosis, the potential contribution of other cell types within the complex hepatic microenvironment, such as liver-derived mesenchymal stem cells (L-MSCs), warrants acknowledgment [48]. L-MSCs exhibit a biphasic role: displaying anti-fibrotic and pro-reparative functions under regenerative conditions and potentially undergoing fibroblastic mesenchymal transition into ECM-producing myofibroblasts under chronic liver injury and sustained profibrotic signaling, notably persistent TGF-β1 stimulation – a key fibrotic driver elevated in our study. Consequently, the profibrotic milieu with high TGF-β1 levels observed here could theoretically facilitate L-MSC pro-fibrotic conversion, positioning them as potential secondary contributors to matrix deposition [49,50]. Nevertheless, aHSCs remain the dominant effector cells responsible for the bulk of pathological scarring. Our findings, demonstrating CXCR6 inhibition effectively targets aHSC senescence and reduces fibrosis, underscore the central importance of modulating aHSC function therapeutically. Further studies are warranted to elucidate the specific contributions and interplay between aHSCs, L-MSCs, and other stromal cells across fibrosis stages and in response to therapies like CXCR6 inhibition.

The strengths of this study are that these in vivo data provide strong evidence for the therapeutic potential of CXCR6 inhibition in hepatic fibrosis. Our study has a limitation: the mouse model used in our study may not fully replicate the complex pathophysiology of human hepatic fibrosis. Future research studies would be developed, including the use of more clinically relevant animal models and the exploration of the long-term effects and safety of CXCR6 inhibition.

In conclusion, this study revealed that CXCR6 is upregulated in both human and mouse hepatic fibrosis. Inhibition of CXCR6 promoted HSC senescence and resulted in a reduction of pro-inflammatory SASP through modulation of the IL-1α/NF-κB feedback loop. These findings suggest that CXCR6 inhibition may serve as a potential therapeutic strategy for alleviating hepatic fibrosis.

# Liqin Sheng and Yiming Wu contributed equally to this work.

Acknowledgments

We thank Bullet Edits Limited for the linguistic editing and proofreading of the manuscript.

  1. Funding information: This study was supported by the Jiaxing Public Welfare Project (No. 2022AD30046) and the 2023 Jiaxing Key Discipline of Medicine in Gastroenterology (Supporting Subject) (2023-zc-10).

  2. Author contributions: FS conceived this research, CZX was responsible for the research design, and YMW conducted data analysis. LQS wrote the manuscript, and all authors contributed to the manuscript review.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Iredale JP. Models of liver fibrosis: exploring the dynamic nature of inflammation and repair in a solid organ. J Clin Invest. 2007;117:539–48. 10.1172/JCI30542.Suche in Google Scholar PubMed PubMed Central

[2] Roehlen N, Crouchet E, Baumert TF. Liver fibrosis: mechanistic concepts and therapeutic perspectives. Cells. 2020;9(4):875. 10.3390/cells9040875.Suche in Google Scholar PubMed PubMed Central

[3] Mederacke I, Hsu CC, Troeger JS, Huebener P, Mu X, Dapito DH, et al. Fate tracing reveals hepatic stellate cells as dominant contributors to liver fibrosis independent of its aetiology. Nat Commun. 2013;4:2823. 10.1038/ncomms3823.Suche in Google Scholar PubMed PubMed Central

[4] Asrani SK, Devarbhavi H, Eaton J, Kamath PS. Burden of liver diseases in the world. J Hepatol. 2019;70:151–71. 10.1016/j.jhep.2018.09.014.Suche in Google Scholar PubMed

[5] Venkatachalam G, Surana U, Clement MV. Replication stress-induced endogenous DNA damage drives cellular senescence induced by a sub-lethal oxidative stress. Nucleic Acids Res. 2017;45:10564–82. 10.1093/nar/gkx684.Suche in Google Scholar PubMed PubMed Central

[6] Troeger JS, Mederacke I, Gwak GY, Dapito DH, Mu X, Hsu CC, et al. Deactivation of hepatic stellate cells during liver fibrosis resolution in mice. Gastroenterology. 2012;143:1073–83. 10.1053/j.gastro.2012.06.036.Suche in Google Scholar PubMed PubMed Central

[7] Shaker ME, Ghani A, Shiha GE, Ibrahim TM, Mehal WZ. Nilotinib induces apoptosis and autophagic cell death of activated hepatic stellate cells via inhibition of histone deacetylases. Biochim Biophys Acta. 2013;1833:1992–2003. 10.1016/j.bbamcr.2013.02.033.Suche in Google Scholar PubMed PubMed Central

[8] Wang F, Jia Y, Li M, Wang L, Shao J, Guo Q, et al. Blockade of glycolysis-dependent contraction by oroxylin a via inhibition of lactate dehydrogenase-a in hepatic stellate cells. Cell Commun Signal. 2019;17:11. 10.1186/s12964-019-0324-8.Suche in Google Scholar PubMed PubMed Central

[9] Zhang F, Wang F, He J, Lian N, Wang Z, Shao J, et al. Regulation of hepatic stellate cell contraction and cirrhotic portal hypertension by Wnt/beta-catenin signalling via interaction with Gli1. Br J Pharmacol. 2021;178:2246–65. 10.1111/bph.15289.Suche in Google Scholar PubMed

[10] Wang F, Li Z, Chen L, Yang T, Liang B, Zhang Z, et al. Inhibition of ASCT2 induces hepatic stellate cell senescence with modified proinflammatory secretome through an IL-1alpha/NF-kappaB feedback pathway to inhibit liver fibrosis. Acta Pharm Sin B. 2022;12:3618–38. 10.1016/j.apsb.2022.03.014.Suche in Google Scholar PubMed PubMed Central

[11] Calcinotto A, Kohli J, Zagato E, Pellegrini L, Demaria M, Alimonti A. Cellular senescence: aging, cancer, and injury. Physiol Rev. 2019;99:1047–78. 10.1152/physrev.00020.2018.Suche in Google Scholar PubMed

[12] Wang B, Han J, Elisseeff JH, Demaria M. The senescence-associated secretory phenotype and its physiological and pathological implications. Nat Rev Mol Cell Biol. 2024;25:958–78. 10.1038/s41580-024-00727-x.Suche in Google Scholar PubMed

[13] Krizhanovsky V, Yon M, Dickins RA, Hearn S, Simon J, Miething C, et al. Senescence of activated stellate cells limits liver fibrosis. Cell. 2008;134:657–67. 10.1016/j.cell.2008.06.049.Suche in Google Scholar PubMed PubMed Central

[14] Zhu Y, Armstrong JL, Tchkonia T, Kirkland JL. Cellular senescence and the senescent secretory phenotype in age-related chronic diseases. Curr Opin Clin Nutr Metab Care. 2014;17:324–8. 10.1097/MCO.0000000000000065.Suche in Google Scholar PubMed

[15] Han X. Constitutively active chemokine CXC receptors. Adv Pharmacol. 2014;70:265–301. 10.1016/B978-0-12-417197-8.00009-2.Suche in Google Scholar PubMed

[16] Matloubian M, David A, Engel S, Ryan JE, Cyster JG. A transmembrane CXC chemokine is a ligand for HIV-coreceptor Bonzo. Nat Immunol. 2000;1:298–304. 10.1038/79738.Suche in Google Scholar PubMed

[17] Korbecki J, Bajdak-Rusinek K, Kupnicka P, Kapczuk P, Siminska D, Chlubek D, et al. The role of CXCL16 in the pathogenesis of cancer and other diseases. Int J Mol Sci. 2021;22(7):3490. 10.3390/ijms22073490.Suche in Google Scholar PubMed PubMed Central

[18] Bao N, Fu B, Zhong X, Jia S, Ren Z, Wang H, et al. Role of the CXCR6/CXCL16 axis in autoimmune diseases. Int Immunopharmacol. 2023;121:110530. 10.1016/j.intimp.2023.110530.Suche in Google Scholar PubMed

[19] Mossanen JC, Kohlhepp M, Wehr A, Krenkel O, Liepelt A, Roeth AA, et al. CXCR6 inhibits hepatocarcinogenesis by promoting natural killer T- and CD4( +) T-cell-dependent control of senescence. Gastroenterology. 2019;156:1877–89. 10.1053/j.gastro.2019.01.247.Suche in Google Scholar PubMed

[20] Wehr A, Baeck C, Ulmer F, Gassler N, Hittatiya K, Luedde T, et al. Pharmacological inhibition of the chemokine CXCL16 diminishes liver macrophage infiltration and steatohepatitis in chronic hepatic injury. PLoS One. 2014;9:e112327. 10.1371/journal.pone.0112327.Suche in Google Scholar PubMed PubMed Central

[21] Wang X, Zheng W, Zhu Z, Xing B, Yan W, Zhu K, et al. Timp1 deletion induces anxiety-like behavior in mice. Neurosci Bull. 2024;40:732–42. 10.1007/s12264-023-01163-1.Suche in Google Scholar PubMed PubMed Central

[22] Kuilman T, Michaloglou C, Mooi WJ, Peeper DS. The essence of senescence. Genes Dev. 2010;24:2463–79. 10.1101/gad.1971610.Suche in Google Scholar PubMed PubMed Central

[23] Zhao D, Gao Y, Su Y, Zhou Y, Yang T, Li Y, et al. Oroxylin A regulates cGAS DNA hypermethylation induced by methionine metabolism to promote HSC senescence. Pharmacol Res. 2023;187:106590. 10.1016/j.phrs.2022.106590.Suche in Google Scholar PubMed

[24] Tsuchida T, Friedman SL. Mechanisms of hepatic stellate cell activation. Nat Rev Gastroenterol Hepatol. 2017;14:397–411. 10.1038/nrgastro.2017.38.Suche in Google Scholar PubMed

[25] Gu L, Kitamura M. Sensitive detection and monitoring of senescence-associated secretory phenotype by SASP-RAP assay. PLoS One. 2012;7:e52305. 10.1371/journal.pone.0052305.Suche in Google Scholar PubMed PubMed Central

[26] Orjalo AV, Bhaumik D, Gengler BK, Scott GK, Campisi J. Cell surface-bound IL-1alpha is an upstream regulator of the senescence-associated IL-6/IL-8 cytokine network. Proc Natl Acad Sci U S A. 2009;106:17031–6. 10.1073/pnas.0905299106.Suche in Google Scholar PubMed PubMed Central

[27] Chiu JW, Binte Hanafi Z, Chew LCY, Mei Y, Liu H. IL-1α processing, signaling and its role in cancer progression. Cells. 2021;10(1):92. 10.3390/cells10010092.Suche in Google Scholar PubMed PubMed Central

[28] Freund A, Orjalo AV, Desprez PY, Campisi J. Inflammatory networks during cellular senescence: causes and consequences. Trends Mol Med. 2010;16:238–46. 10.1016/j.molmed.2010.03.003.Suche in Google Scholar PubMed PubMed Central

[29] Huang Y, Deng X, Liang J. Modulation of hepatic stellate cells and reversibility of hepatic fibrosis. Exp Cell Res. 2017;352:420–6. 10.1016/j.yexcr.2017.02.038.Suche in Google Scholar PubMed

[30] Birch J, Gil J. Senescence and the SASP: many therapeutic avenues. Genes Dev. 2020;34:1565–76. 10.1101/gad.343129.120.Suche in Google Scholar PubMed PubMed Central

[31] Mabrouk N, Tran T, Sam I, Pourmir I, Gruel N, Granier C, et al. CXCR6 expressing T cells: Functions and role in the control of tumors. Front Immunol. 2022;13:1022136. 10.3389/fimmu.2022.1022136.Suche in Google Scholar PubMed PubMed Central

[32] Lu Y, Wang J, Xu Y, Koch AE, Cai Z, Chen X, et al. CXCL16 functions as a novel chemotactic factor for prostate cancer cells in vitro. Mol Cancer Res. 2008;6:546–54. 10.1158/1541-7786.MCR-07-0277.Suche in Google Scholar PubMed

[33] Gaida MM, Gunther F, Wagner C, Friess H, Giese NA, Schmidt J, et al. Expression of the CXCR6 on polymorphonuclear neutrophils in pancreatic carcinoma and in acute, localized bacterial infections. Clin Exp Immunol. 2008;154:216–23. 10.1111/j.1365-2249.2008.03745.x.Suche in Google Scholar PubMed PubMed Central

[34] Held-Feindt J, Rehmke B, Mentlein R, Hattermann K, Knerlich F, Hugo HH, et al. Overexpression of CXCL16 and its receptor CXCR6/Bonzo promotes growth of human schwannomas. Glia. 2008;56:764–74. 10.1002/glia.20651.Suche in Google Scholar PubMed

[35] Yang M, Liu Y, Luo SL, Liu CB, Jiang N, Li CR, et al. DsbA-L ameliorates renal aging and renal fibrosis by maintaining mitochondrial homeostasis. Acta Pharmacol Sin. 2024;45:777–89. 10.1038/s41401-023-01216-1.Suche in Google Scholar PubMed PubMed Central

[36] Du K, Maeso-Diaz R, Oh SH, Wang E, Chen T, Pan C, et al. Targeting YAP-mediated HSC death susceptibility and senescence for treatment of liver fibrosis. Hepatology. 2023;77:1998–2015. 10.1097/HEP.0000000000000326.Suche in Google Scholar PubMed PubMed Central

[37] Zhang M, Serna-Salas S, Damba T, Borghesan M, Demaria M, Moshage H. Hepatic stellate cell senescence in liver fibrosis: Characteristics, mechanisms and perspectives. Mech Ageing Dev. 2021;199:111572. 10.1016/j.mad.2021.111572.Suche in Google Scholar PubMed

[38] Jin H, Jia Y, Yao Z, Huang J, Hao M, Yao S, et al. Hepatic stellate cell interferes with NK cell regulation of fibrogenesis via curcumin induced senescence of hepatic stellate cell. Cell Signal. 2017;33:79–85. 10.1016/j.cellsig.2017.02.006.Suche in Google Scholar PubMed

[39] Yang J, Lu Y, Yang P, Chen Q, Wang Y, Ding Q, et al. MicroRNA-145 induces the senescence of activated hepatic stellate cells through the activation of p53 pathway by ZEB2. J Cell Physiol. 2019;234:7587–99. 10.1002/jcp.27521.Suche in Google Scholar PubMed

[40] Yu S, Ji G, Zhang L. The role of p53 in liver fibrosis. Front Pharmacol. 2022;13:1057829. 10.3389/fphar.2022.1057829.Suche in Google Scholar PubMed PubMed Central

[41] Aravinthan AD, Alexander GJM. Senescence in chronic liver disease: Is the future in aging? J Hepatol. 2016;65:825–34. 10.1016/j.jhep.2016.05.030.Suche in Google Scholar PubMed

[42] Kuilman T, Michaloglou C, Vredeveld LC, Douma S, van Doorn R, Desmet CJ, et al. Oncogene-induced senescence relayed by an interleukin-dependent inflammatory network. Cell. 2008;133:1019–31. 10.1016/j.cell.2008.03.039.Suche in Google Scholar PubMed

[43] Lujambio A, Akkari L, Simon J, Grace D, Tschaharganeh DF, Bolden JE, et al. Non-cell-autonomous tumor suppression by p53. Cell. 2013;153:449–60. 10.1016/j.cell.2013.03.020.Suche in Google Scholar PubMed PubMed Central

[44] Chien Y, Scuoppo C, Wang X, Fang X, Balgley B, Bolden JE, et al. Control of the senescence-associated secretory phenotype by NF-kappaB promotes senescence and enhances chemosensitivity. Genes Dev. 2011;25:2125–36. 10.1101/gad.17276711.Suche in Google Scholar PubMed PubMed Central

[45] Crescenzi E, Pacifico F, Lavorgna A, De Palma R, D’Aiuto E, Palumbo G, et al. NF-kappaB-dependent cytokine secretion controls Fas expression on chemotherapy-induced premature senescent tumor cells. Oncogene. 2011;30:2707–17. 10.1038/onc.2011.1.Suche in Google Scholar PubMed

[46] Rovillain E, Mansfield L, Caetano C, Alvarez-Fernandez M, Caballero OL, Medema RH, et al. Activation of nuclear factor-kappa B signalling promotes cellular senescence. Oncogene. 2011;30:2356–66. 10.1038/onc.2010.611.Suche in Google Scholar PubMed PubMed Central

[47] Salminen A, Kauppinen A, Kaarniranta K. Emerging role of NF-kappaB signaling in the induction of senescence-associated secretory phenotype (SASP). Cell Signal. 2012;24:835–45. 10.1016/j.cellsig.2011.12.006.Suche in Google Scholar PubMed

[48] Wang Y, Yu X, Chen E, Li L. Liver-derived human mesenchymal stem cells: a novel therapeutic source for liver diseases. Stem Cell Res Ther. 2016;7:71. 10.1186/s13287-016-0330-3.Suche in Google Scholar PubMed PubMed Central

[49] Bruno S, Herrera Sanchez MB, Pasquino C, Tapparo M, Cedrino M, Tetta C, et al. Human liver-derived stem cells improve fibrosis and inflammation associated with nonalcoholic steatohepatitis. Stem Cell Int. 2019;2019:6351091. 10.1155/2019/6351091.Suche in Google Scholar PubMed PubMed Central

[50] Bruno S, Herrera Sanchez MB, Chiabotto G, Fonsato V, Navarro-Tableros V, Pasquino C, et al. Human liver stem cells: a liver-derived mesenchymal stromal cell-like population with pro-regenerative properties. Front Cell Dev Biol. 2021;9:644088. 10.3389/fcell.2021.644088.Suche in Google Scholar PubMed PubMed Central

Received: 2025-04-16
Revised: 2025-06-03
Accepted: 2025-06-16
Published Online: 2025-08-08

© 2025 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Biomedical Sciences
  2. Mechanism of triptolide regulating proliferation and apoptosis of hepatoma cells by inhibiting JAK/STAT pathway
  3. Maslinic acid improves mitochondrial function and inhibits oxidative stress and autophagy in human gastric smooth muscle cells
  4. Comparative analysis of inflammatory biomarkers for the diagnosis of neonatal sepsis: IL-6, IL-8, SAA, CRP, and PCT
  5. Post-pandemic insights on COVID-19 and premature ovarian insufficiency
  6. Proteome differences of dental stem cells between permanent and deciduous teeth by data-independent acquisition proteomics
  7. Optimizing a modified cetyltrimethylammonium bromide protocol for fungal DNA extraction: Insights from multilocus gene amplification
  8. Preliminary analysis of the role of small hepatitis B surface proteins mutations in the pathogenesis of occult hepatitis B infection via the endoplasmic reticulum stress-induced UPR-ERAD pathway
  9. Efficacy of alginate-coated gold nanoparticles against antibiotics-resistant Staphylococcus and Streptococcus pathogens of acne origins
  10. Battling COVID-19 leveraging nanobiotechnology: Gold and silver nanoparticle–B-escin conjugates as SARS-CoV-2 inhibitors
  11. Neurodegenerative diseases and neuroinflammation-induced apoptosis
  12. Impact of fracture fixation surgery on cognitive function and the gut microbiota in mice with a history of stroke
  13. COLEC10: A potential tumor suppressor and prognostic biomarker in hepatocellular carcinoma through modulation of EMT and PI3K-AKT pathways
  14. High-temperature requirement serine protease A2 inhibitor UCF-101 ameliorates damaged neurons in traumatic brain-injured rats by the AMPK/NF-κB pathway
  15. SIK1 inhibits IL-1β-stimulated cartilage apoptosis and inflammation in vitro through the CRTC2/CREB1 signaling
  16. Rutin–chitooligosaccharide complex: Comprehensive evaluation of its anti-inflammatory and analgesic properties in vitro and in vivo
  17. Knockdown of Aurora kinase B alleviates high glucose-triggered trophoblast cells damage and inflammation during gestational diabetes
  18. Calcium-sensing receptors promoted Homer1 expression and osteogenic differentiation in bone marrow mesenchymal stem cells
  19. ABI3BP can inhibit the proliferation, invasion, and epithelial–mesenchymal transition of non-small-cell lung cancer cells
  20. Changes in blood glucose and metabolism in hyperuricemia mice
  21. Rapid detection of the GJB2 c.235delC mutation based on CRISPR-Cas13a combined with lateral flow dipstick
  22. IL-11 promotes Ang II-induced autophagy inhibition and mitochondrial dysfunction in atrial fibroblasts
  23. Short-chain fatty acid attenuates intestinal inflammation by regulation of gut microbial composition in antibiotic-associated diarrhea
  24. Application of metagenomic next-generation sequencing in the diagnosis of pathogens in patients with diabetes complicated by community-acquired pneumonia
  25. NAT10 promotes radiotherapy resistance in non-small cell lung cancer by regulating KPNB1-mediated PD-L1 nuclear translocation
  26. Phytol-mixed micelles alleviate dexamethasone-induced osteoporosis in zebrafish: Activation of the MMP3–OPN–MAPK pathway-mediating bone remodeling
  27. Association between TGF-β1 and β-catenin expression in the vaginal wall of patients with pelvic organ prolapse
  28. Primary pleomorphic liposarcoma involving bilateral ovaries: Case report and literature review
  29. Effects of de novo donor-specific Class I and II antibodies on graft outcomes after liver transplantation: A pilot cohort study
  30. Sleep architecture in Alzheimer’s disease continuum: The deep sleep question
  31. Ephedra fragilis plant extract: A groundbreaking corrosion inhibitor for mild steel in acidic environments – electrochemical, EDX, DFT, and Monte Carlo studies
  32. Langerhans cell histiocytosis in an adult patient with upper jaw and pulmonary involvement: A case report
  33. Inhibition of mast cell activation by Jaranol-targeted Pirin ameliorates allergic responses in mouse allergic rhinitis
  34. Aeromonas veronii-induced septic arthritis of the hip in a child with acute lymphoblastic leukemia
  35. Clusterin activates the heat shock response via the PI3K/Akt pathway to protect cardiomyocytes from high-temperature-induced apoptosis
  36. Research progress on fecal microbiota transplantation in tumor prevention and treatment
  37. Low-pressure exposure influences the development of HAPE
  38. Stigmasterol alleviates endplate chondrocyte degeneration through inducing mitophagy by enhancing PINK1 mRNA acetylation via the ESR1/NAT10 axis
  39. AKAP12, mediated by transcription factor 21, inhibits cell proliferation, metastasis, and glycolysis in lung squamous cell carcinoma
  40. Association between PAX9 or MSX1 gene polymorphism and tooth agenesis risk: A meta-analysis
  41. A case of bloodstream infection caused by Neisseria gonorrhoeae
  42. Case of nasopharyngeal tuberculosis complicated with cervical lymph node and pulmonary tuberculosis
  43. p-Cymene inhibits pro-fibrotic and inflammatory mediators to prevent hepatic dysfunction
  44. GFPT2 promotes paclitaxel resistance in epithelial ovarian cancer cells via activating NF-κB signaling pathway
  45. Transfer RNA-derived fragment tRF-36 modulates varicose vein progression via human vascular smooth muscle cell Notch signaling
  46. RTA-408 attenuates the hepatic ischemia reperfusion injury in mice possibly by activating the Nrf2/HO-1 signaling pathway
  47. Decreased serum TIMP4 levels in patients with rheumatoid arthritis
  48. Sirt1 protects lupus nephritis by inhibiting the NLRP3 signaling pathway in human glomerular mesangial cells
  49. Sodium butyrate aids brain injury repair in neonatal rats
  50. Interaction of MTHFR polymorphism with PAX1 methylation in cervical cancer
  51. Convallatoxin inhibits proliferation and angiogenesis of glioma cells via regulating JAK/STAT3 pathway
  52. The effect of the PKR inhibitor, 2-aminopurine, on the replication of influenza A virus, and segment 8 mRNA splicing
  53. Effects of Ire1 gene on virulence and pathogenicity of Candida albicans
  54. Small cell lung cancer with small intestinal metastasis: Case report and literature review
  55. GRB14: A prognostic biomarker driving tumor progression in gastric cancer through the PI3K/AKT signaling pathway by interacting with COBLL1
  56. 15-Lipoxygenase-2 deficiency induces foam cell formation that can be restored by salidroside through the inhibition of arachidonic acid effects
  57. FTO alleviated the diabetic nephropathy progression by regulating the N6-methyladenosine levels of DACT1
  58. Clinical relevance of inflammatory markers in the evaluation of severity of ulcerative colitis: A retrospective study
  59. Zinc valproic acid complex promotes osteoblast differentiation and exhibits anti-osteoporotic potential
  60. Primary pulmonary synovial sarcoma in the bronchial cavity: A case report
  61. Metagenomic next-generation sequencing of alveolar lavage fluid improves the detection of pulmonary infection
  62. Uterine tumor resembling ovarian sex cord tumor with extensive rhabdoid differentiation: A case report
  63. Genomic analysis of a novel ST11(PR34365) Clostridioides difficile strain isolated from the human fecal of a CDI patient in Guizhou, China
  64. Effects of tiered cardiac rehabilitation on CRP, TNF-α, and physical endurance in older adults with coronary heart disease
  65. Changes in T-lymphocyte subpopulations in patients with colorectal cancer before and after acupoint catgut embedding acupuncture observation
  66. Modulating the tumor microenvironment: The role of traditional Chinese medicine in improving lung cancer treatment
  67. Alterations of metabolites related to microbiota–gut–brain axis in plasma of colon cancer, esophageal cancer, stomach cancer, and lung cancer patients
  68. Research on individualized drug sensitivity detection technology based on bio-3D printing technology for precision treatment of gastrointestinal stromal tumors
  69. CEBPB promotes ulcerative colitis-associated colorectal cancer by stimulating tumor growth and activating the NF-κB/STAT3 signaling pathway
  70. Oncolytic bacteria: A revolutionary approach to cancer therapy
  71. A de novo meningioma with rapid growth: A possible malignancy imposter?
  72. Diagnosis of secondary tuberculosis infection in an asymptomatic elderly with cancer using next-generation sequencing: Case report
  73. Hesperidin and its zinc(ii) complex enhance osteoblast differentiation and bone formation: In vitro and in vivo evaluations
  74. Research progress on the regulation of autophagy in cardiovascular diseases by chemokines
  75. Anti-arthritic, immunomodulatory, and inflammatory regulation by the benzimidazole derivative BMZ-AD: Insights from an FCA-induced rat model
  76. Immunoassay for pyruvate kinase M1/2 as an Alzheimer’s biomarker in CSF
  77. The role of HDAC11 in age-related hearing loss: Mechanisms and therapeutic implications
  78. Evaluation and application analysis of animal models of PIPNP based on data mining
  79. Therapeutic approaches for liver fibrosis/cirrhosis by targeting pyroptosis
  80. Fabrication of zinc oxide nanoparticles using Ruellia tuberosa leaf extract induces apoptosis through P53 and STAT3 signalling pathways in prostate cancer cells
  81. Haplo-hematopoietic stem cell transplantation and immunoradiotherapy for severe aplastic anemia complicated with nasopharyngeal carcinoma: A case report
  82. Modulation of the KEAP1-NRF2 pathway by Erianin: A novel approach to reduce psoriasiform inflammation and inflammatory signaling
  83. The expression of epidermal growth factor receptor 2 and its relationship with tumor-infiltrating lymphocytes and clinical pathological features in breast cancer patients
  84. Innovations in MALDI-TOF Mass Spectrometry: Bridging modern diagnostics and historical insights
  85. BAP1 complexes with YY1 and RBBP7 and its downstream targets in ccRCC cells
  86. Hypereosinophilic syndrome with elevated IgG4 and T-cell clonality: A report of two cases
  87. Electroacupuncture alleviates sciatic nerve injury in sciatica rats by regulating BDNF and NGF levels, myelin sheath degradation, and autophagy
  88. Polydatin prevents cholesterol gallstone formation by regulating cholesterol metabolism via PPAR-γ signaling
  89. RNF144A and RNF144B: Important molecules for health
  90. Analysis of the detection rate and related factors of thyroid nodules in the healthy population
  91. Artesunate inhibits hepatocellular carcinoma cell migration and invasion through OGA-mediated O-GlcNAcylation of ZEB1
  92. Endovascular management of post-pancreatectomy hemorrhage caused by a hepatic artery pseudoaneurysm: Case report and review of the literature
  93. Efficacy and safety of anti-PD-1/PD-L1 antibodies in patients with relapsed refractory diffuse large B-cell lymphoma: A meta-analysis
  94. SATB2 promotes humeral fracture healing in rats by activating the PI3K/AKT pathway
  95. Overexpression of the ferroptosis-related gene, NFS1, corresponds to gastric cancer growth and tumor immune infiltration
  96. Understanding risk factors and prognosis in diabetic foot ulcers
  97. Atractylenolide I alleviates the experimental allergic response in mice by suppressing TLR4/NF-kB/NLRP3 signalling
  98. FBXO31 inhibits the stemness characteristics of CD147 (+) melanoma stem cells
  99. Immune molecule diagnostics in colorectal cancer: CCL2 and CXCL11
  100. Inhibiting CXCR6 promotes senescence of activated hepatic stellate cells with limited proinflammatory SASP to attenuate hepatic fibrosis
  101. Cadmium toxicity, health risk and its remediation using low-cost biochar adsorbents
  102. Pulmonary cryptococcosis with headache as the first presentation: A case report
  103. Solitary pulmonary metastasis with cystic airspaces in colon cancer: A rare case report
  104. RUNX1 promotes denervation-induced muscle atrophy by activating the JUNB/NF-κB pathway and driving M1 macrophage polarization
  105. Morphometric analysis and immunobiological investigation of Indigofera oblongifolia on the infected lung with Plasmodium chabaudi
  106. The NuA4/TIP60 histone-modifying complex and Hr78 modulate the Lobe2 mutant eye phenotype
  107. Experimental study on salmon demineralized bone matrix loaded with recombinant human bone morphogenetic protein-2: In vitro and in vivo study
  108. A case of IgA nephropathy treated with a combination of telitacicept and half-dose glucocorticoids
  109. Analgesic and toxicological evaluation of cannabidiol-rich Moroccan Cannabis sativa L. (Khardala variety) extract: Evidence from an in vivo and in silico study
  110. Wound healing and signaling pathways
  111. Combination of immunotherapy and whole-brain radiotherapy on prognosis of patients with multiple brain metastases: A retrospective cohort study
  112. To explore the relationship between endometrial hyperemia and polycystic ovary syndrome
  113. Research progress on the impact of curcumin on immune responses in breast cancer
  114. Biogenic Cu/Ni nanotherapeutics from Descurainia sophia (L.) Webb ex Prantl seeds for the treatment of lung cancer
  115. Dapagliflozin attenuates atrial fibrosis via the HMGB1/RAGE pathway in atrial fibrillation rats
  116. Glycitein alleviates inflammation and apoptosis in keratinocytes via ROS-associated PI3K–Akt signalling pathway
  117. ADH5 inhibits proliferation but promotes EMT in non-small cell lung cancer cell through activating Smad2/Smad3
  118. Apoptotic efficacies of AgNPs formulated by Syzygium aromaticum leaf extract on 32D-FLT3-ITD human leukemia cell line with PI3K/AKT/mTOR signaling pathway
  119. Novel cuproptosis-related genes C1QBP and PFKP identified as prognostic and therapeutic targets in lung adenocarcinoma
  120. Bee venom promotes exosome secretion and alters miRNA cargo in T cells
  121. Treatment of pure red cell aplasia in a chronic kidney disease patient with roxadustat: A case report
  122. Comparative bioinformatics analysis of the Wnt pathway in breast cancer: Selection of novel biomarker panels associated with ER status
  123. Kynurenine facilitates renal cell carcinoma progression by suppressing M2 macrophage pyroptosis through inhibition of CASP1 cleavage
  124. RFX5 promotes the growth, motility, and inhibits apoptosis of gastric adenocarcinoma cells through the SIRT1/AMPK axis
  125. ALKBH5 exacerbates early cardiac damage after radiotherapy for breast cancer via m6A demethylation of TLR4
  126. Phytochemicals of Roman chamomile: Antioxidant, anti-aging, and whitening activities of distillation residues
  127. Circadian gene Cry1 inhibits the tumorigenicity of hepatocellular carcinoma by the BAX/BCL2-mediated apoptosis pathway
  128. The TNFR-RIPK1/RIPK3 signalling pathway mediates the effect of lanthanum on necroptosis of nerve cells
  129. Longitudinal monitoring of autoantibody dynamics in patients with early-stage non-small-cell lung cancer undergoing surgery
  130. The potential role of rutin, a flavonoid, in the management of cancer through modulation of cell signaling pathways
  131. Construction of pectinase gene engineering microbe and its application in tobacco sheets
  132. Construction of a microbial abundance prognostic scoring model based on intratumoral microbial data for predicting the prognosis of lung squamous cell carcinoma
  133. Sepsis complicated by haemophagocytic lymphohistiocytosis triggered by methicillin-resistant Staphylococcus aureus and human herpesvirus 8 in an immunocompromised elderly patient: A case report
  134. Sarcopenia in liver transplantation: A comprehensive bibliometric study of current research trends and future directions
  135. Advances in cancer immunotherapy and future directions in personalized medicine
  136. Can coronavirus disease 2019 affect male fertility or cause spontaneous abortion? A two-sample Mendelian randomization analysis
  137. Heat stroke associated with novel leukaemia inhibitory factor receptor gene variant in a Chinese infant
  138. PSME2 exacerbates ulcerative colitis by disrupting intestinal barrier function and promoting autophagy-dependent inflammation
  139. Hyperosmolar hyperglycemic state with severe hypernatremia coexisting with central diabetes insipidus: A case report and literature review
  140. Efficacy and mechanism of escin in improving the tissue microenvironment of blood vessel walls via anti-inflammatory and anticoagulant effects: Implications for clinical practice
  141. Merkel cell carcinoma: Clinicopathological analysis of three patients and literature review
  142. Ecology and Environmental Science
  143. Optimization and comparative study of Bacillus consortia for cellulolytic potential and cellulase enzyme activity
  144. The complete mitochondrial genome analysis of Haemaphysalis hystricis Supino, 1897 (Ixodida: Ixodidae) and its phylogenetic implications
  145. Epidemiological characteristics and risk factors analysis of multidrug-resistant tuberculosis among tuberculosis population in Huzhou City, Eastern China
  146. Indices of human impacts on landscapes: How do they reflect the proportions of natural habitats?
  147. Genetic analysis of the Siberian flying squirrel population in the northern Changbai Mountains, Northeast China: Insights into population status and conservation
  148. Diversity and environmental drivers of Suillus communities in Pinus sylvestris var. mongolica forests of Inner Mongolia
  149. Global assessment of the fate of nitrogen deposition in forest ecosystems: Insights from 15N tracer studies
  150. Fungal and bacterial pathogenic co-infections mainly lead to the assembly of microbial community in tobacco stems
  151. Influencing of coal industry related airborne particulate matter on ocular surface tear film injury and inflammatory factor expression in Sprague-Dawley rats
  152. Temperature-dependent development, predation, and life table of Sphaerophoria macrogaster (Thomson) (Diptera: Syrphidae) feeding on Myzus persicae (Sulzer) (Homoptera: Aphididae)
  153. Eleonora’s falcon trophic interactions with insects within its breeding range: A systematic review
  154. Agriculture
  155. Integrated analysis of transcriptome, sRNAome, and degradome involved in the drought-response of maize Zhengdan958
  156. Variation in flower frost tolerance among seven apple cultivars and transcriptome response patterns in two contrastingly frost-tolerant selected cultivars
  157. Heritability of durable resistance to stripe rust in bread wheat (Triticum aestivum L.)
  158. Molecular mechanism of follicular development in laying hens based on the regulation of water metabolism
  159. Animal Science
  160. Effect of sex ratio on the life history traits of an important invasive species, Spodoptera frugiperda
  161. Plant Sciences
  162. Hairpin in a haystack: In silico identification and characterization of plant-conserved microRNA in Rafflesiaceae
  163. Widely targeted metabolomics of different tissues in Rubus corchorifolius
  164. The complete chloroplast genome of Gerbera piloselloides (L.) Cass., 1820 (Carduoideae, Asteraceae) and its phylogenetic analysis
  165. Field trial to correlate mineral solubilization activity of Pseudomonas aeruginosa and biochemical content of groundnut plants
  166. Correlation analysis between semen routine parameters and sperm DNA fragmentation index in patients with semen non-liquefaction: A retrospective study
  167. Plasticity of the anatomical traits of Rhododendron L. (Ericaceae) leaves and its implications in adaptation to the plateau environment
  168. Effects of Piriformospora indica and arbuscular mycorrhizal fungus on growth and physiology of Moringa oleifera under low-temperature stress
  169. Effects of different sources of potassium fertiliser on yield, fruit quality and nutrient absorption in “Harward” kiwifruit (Actinidia deliciosa)
  170. Comparative efficiency and residue levels of spraying programs against powdery mildew in grape varieties
  171. The DREB7 transcription factor enhances salt tolerance in soybean plants under salt stress
  172. Using plant electrical signals of water hyacinth (Eichhornia crassipes) for water pollution monitoring
  173. Food Science
  174. Phytochemical analysis of Stachys iva: Discovering the optimal extract conditions and its bioactive compounds
  175. Review on role of honey in disease prevention and treatment through modulation of biological activities
  176. Computational analysis of polymorphic residues in maltose and maltotriose transporters of a wild Saccharomyces cerevisiae strain
  177. Optimization of phenolic compound extraction from Tunisian squash by-products: A sustainable approach for antioxidant and antibacterial applications
  178. Liupao tea aqueous extract alleviates dextran sulfate sodium-induced ulcerative colitis in rats by modulating the gut microbiota
  179. Toxicological qualities and detoxification trends of fruit by-products for valorization: A review
  180. Polyphenolic spectrum of cornelian cherry fruits and their health-promoting effect
  181. Optimizing the encapsulation of the refined extract of squash peels for functional food applications: A sustainable approach to reduce food waste
  182. Advancements in curcuminoid formulations: An update on bioavailability enhancement strategies curcuminoid bioavailability and formulations
  183. Impact of saline sprouting on antioxidant properties and bioactive compounds in chia seeds
  184. The dilemma of food genetics and improvement
  185. Bioengineering and Biotechnology
  186. Impact of hyaluronic acid-modified hafnium metalorganic frameworks containing rhynchophylline on Alzheimer’s disease
  187. Emerging patterns in nanoparticle-based therapeutic approaches for rheumatoid arthritis: A comprehensive bibliometric and visual analysis spanning two decades
  188. Application of CRISPR/Cas gene editing for infectious disease control in poultry
  189. Preparation of hafnium nitride-coated titanium implants by magnetron sputtering technology and evaluation of their antibacterial properties and biocompatibility
  190. Preparation and characterization of lemongrass oil nanoemulsion: Antimicrobial, antibiofilm, antioxidant, and anticancer activities
  191. Corrigendum
  192. Corrigendum to “Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells”
  193. Corrigendum to “Effects of Ire1 gene on virulence and pathogenicity of Candida albicans”
https://doi.org/10.1515/biol-2025-1151
Schlagwörter für diesen Artikel
hepatic stellate cells; senescence; SASP; CXCR6; hepatic fibrosis
Creative Commons
BY 4.0

Artikel in diesem Heft

  1. Biomedical Sciences
  2. Mechanism of triptolide regulating proliferation and apoptosis of hepatoma cells by inhibiting JAK/STAT pathway
  3. Maslinic acid improves mitochondrial function and inhibits oxidative stress and autophagy in human gastric smooth muscle cells
  4. Comparative analysis of inflammatory biomarkers for the diagnosis of neonatal sepsis: IL-6, IL-8, SAA, CRP, and PCT
  5. Post-pandemic insights on COVID-19 and premature ovarian insufficiency
  6. Proteome differences of dental stem cells between permanent and deciduous teeth by data-independent acquisition proteomics
  7. Optimizing a modified cetyltrimethylammonium bromide protocol for fungal DNA extraction: Insights from multilocus gene amplification
  8. Preliminary analysis of the role of small hepatitis B surface proteins mutations in the pathogenesis of occult hepatitis B infection via the endoplasmic reticulum stress-induced UPR-ERAD pathway
  9. Efficacy of alginate-coated gold nanoparticles against antibiotics-resistant Staphylococcus and Streptococcus pathogens of acne origins
  10. Battling COVID-19 leveraging nanobiotechnology: Gold and silver nanoparticle–B-escin conjugates as SARS-CoV-2 inhibitors
  11. Neurodegenerative diseases and neuroinflammation-induced apoptosis
  12. Impact of fracture fixation surgery on cognitive function and the gut microbiota in mice with a history of stroke
  13. COLEC10: A potential tumor suppressor and prognostic biomarker in hepatocellular carcinoma through modulation of EMT and PI3K-AKT pathways
  14. High-temperature requirement serine protease A2 inhibitor UCF-101 ameliorates damaged neurons in traumatic brain-injured rats by the AMPK/NF-κB pathway
  15. SIK1 inhibits IL-1β-stimulated cartilage apoptosis and inflammation in vitro through the CRTC2/CREB1 signaling
  16. Rutin–chitooligosaccharide complex: Comprehensive evaluation of its anti-inflammatory and analgesic properties in vitro and in vivo
  17. Knockdown of Aurora kinase B alleviates high glucose-triggered trophoblast cells damage and inflammation during gestational diabetes
  18. Calcium-sensing receptors promoted Homer1 expression and osteogenic differentiation in bone marrow mesenchymal stem cells
  19. ABI3BP can inhibit the proliferation, invasion, and epithelial–mesenchymal transition of non-small-cell lung cancer cells
  20. Changes in blood glucose and metabolism in hyperuricemia mice
  21. Rapid detection of the GJB2 c.235delC mutation based on CRISPR-Cas13a combined with lateral flow dipstick
  22. IL-11 promotes Ang II-induced autophagy inhibition and mitochondrial dysfunction in atrial fibroblasts
  23. Short-chain fatty acid attenuates intestinal inflammation by regulation of gut microbial composition in antibiotic-associated diarrhea
  24. Application of metagenomic next-generation sequencing in the diagnosis of pathogens in patients with diabetes complicated by community-acquired pneumonia
  25. NAT10 promotes radiotherapy resistance in non-small cell lung cancer by regulating KPNB1-mediated PD-L1 nuclear translocation
  26. Phytol-mixed micelles alleviate dexamethasone-induced osteoporosis in zebrafish: Activation of the MMP3–OPN–MAPK pathway-mediating bone remodeling
  27. Association between TGF-β1 and β-catenin expression in the vaginal wall of patients with pelvic organ prolapse
  28. Primary pleomorphic liposarcoma involving bilateral ovaries: Case report and literature review
  29. Effects of de novo donor-specific Class I and II antibodies on graft outcomes after liver transplantation: A pilot cohort study
  30. Sleep architecture in Alzheimer’s disease continuum: The deep sleep question
  31. Ephedra fragilis plant extract: A groundbreaking corrosion inhibitor for mild steel in acidic environments – electrochemical, EDX, DFT, and Monte Carlo studies
  32. Langerhans cell histiocytosis in an adult patient with upper jaw and pulmonary involvement: A case report
  33. Inhibition of mast cell activation by Jaranol-targeted Pirin ameliorates allergic responses in mouse allergic rhinitis
  34. Aeromonas veronii-induced septic arthritis of the hip in a child with acute lymphoblastic leukemia
  35. Clusterin activates the heat shock response via the PI3K/Akt pathway to protect cardiomyocytes from high-temperature-induced apoptosis
  36. Research progress on fecal microbiota transplantation in tumor prevention and treatment
  37. Low-pressure exposure influences the development of HAPE
  38. Stigmasterol alleviates endplate chondrocyte degeneration through inducing mitophagy by enhancing PINK1 mRNA acetylation via the ESR1/NAT10 axis
  39. AKAP12, mediated by transcription factor 21, inhibits cell proliferation, metastasis, and glycolysis in lung squamous cell carcinoma
  40. Association between PAX9 or MSX1 gene polymorphism and tooth agenesis risk: A meta-analysis
  41. A case of bloodstream infection caused by Neisseria gonorrhoeae
  42. Case of nasopharyngeal tuberculosis complicated with cervical lymph node and pulmonary tuberculosis
  43. p-Cymene inhibits pro-fibrotic and inflammatory mediators to prevent hepatic dysfunction
  44. GFPT2 promotes paclitaxel resistance in epithelial ovarian cancer cells via activating NF-κB signaling pathway
  45. Transfer RNA-derived fragment tRF-36 modulates varicose vein progression via human vascular smooth muscle cell Notch signaling
  46. RTA-408 attenuates the hepatic ischemia reperfusion injury in mice possibly by activating the Nrf2/HO-1 signaling pathway
  47. Decreased serum TIMP4 levels in patients with rheumatoid arthritis
  48. Sirt1 protects lupus nephritis by inhibiting the NLRP3 signaling pathway in human glomerular mesangial cells
  49. Sodium butyrate aids brain injury repair in neonatal rats
  50. Interaction of MTHFR polymorphism with PAX1 methylation in cervical cancer
  51. Convallatoxin inhibits proliferation and angiogenesis of glioma cells via regulating JAK/STAT3 pathway
  52. The effect of the PKR inhibitor, 2-aminopurine, on the replication of influenza A virus, and segment 8 mRNA splicing
  53. Effects of Ire1 gene on virulence and pathogenicity of Candida albicans
  54. Small cell lung cancer with small intestinal metastasis: Case report and literature review
  55. GRB14: A prognostic biomarker driving tumor progression in gastric cancer through the PI3K/AKT signaling pathway by interacting with COBLL1
  56. 15-Lipoxygenase-2 deficiency induces foam cell formation that can be restored by salidroside through the inhibition of arachidonic acid effects
  57. FTO alleviated the diabetic nephropathy progression by regulating the N6-methyladenosine levels of DACT1
  58. Clinical relevance of inflammatory markers in the evaluation of severity of ulcerative colitis: A retrospective study
  59. Zinc valproic acid complex promotes osteoblast differentiation and exhibits anti-osteoporotic potential
  60. Primary pulmonary synovial sarcoma in the bronchial cavity: A case report
  61. Metagenomic next-generation sequencing of alveolar lavage fluid improves the detection of pulmonary infection
  62. Uterine tumor resembling ovarian sex cord tumor with extensive rhabdoid differentiation: A case report
  63. Genomic analysis of a novel ST11(PR34365) Clostridioides difficile strain isolated from the human fecal of a CDI patient in Guizhou, China
  64. Effects of tiered cardiac rehabilitation on CRP, TNF-α, and physical endurance in older adults with coronary heart disease
  65. Changes in T-lymphocyte subpopulations in patients with colorectal cancer before and after acupoint catgut embedding acupuncture observation
  66. Modulating the tumor microenvironment: The role of traditional Chinese medicine in improving lung cancer treatment
  67. Alterations of metabolites related to microbiota–gut–brain axis in plasma of colon cancer, esophageal cancer, stomach cancer, and lung cancer patients
  68. Research on individualized drug sensitivity detection technology based on bio-3D printing technology for precision treatment of gastrointestinal stromal tumors
  69. CEBPB promotes ulcerative colitis-associated colorectal cancer by stimulating tumor growth and activating the NF-κB/STAT3 signaling pathway
  70. Oncolytic bacteria: A revolutionary approach to cancer therapy
  71. A de novo meningioma with rapid growth: A possible malignancy imposter?
  72. Diagnosis of secondary tuberculosis infection in an asymptomatic elderly with cancer using next-generation sequencing: Case report
  73. Hesperidin and its zinc(ii) complex enhance osteoblast differentiation and bone formation: In vitro and in vivo evaluations
  74. Research progress on the regulation of autophagy in cardiovascular diseases by chemokines
  75. Anti-arthritic, immunomodulatory, and inflammatory regulation by the benzimidazole derivative BMZ-AD: Insights from an FCA-induced rat model
  76. Immunoassay for pyruvate kinase M1/2 as an Alzheimer’s biomarker in CSF
  77. The role of HDAC11 in age-related hearing loss: Mechanisms and therapeutic implications
  78. Evaluation and application analysis of animal models of PIPNP based on data mining
  79. Therapeutic approaches for liver fibrosis/cirrhosis by targeting pyroptosis
  80. Fabrication of zinc oxide nanoparticles using Ruellia tuberosa leaf extract induces apoptosis through P53 and STAT3 signalling pathways in prostate cancer cells
  81. Haplo-hematopoietic stem cell transplantation and immunoradiotherapy for severe aplastic anemia complicated with nasopharyngeal carcinoma: A case report
  82. Modulation of the KEAP1-NRF2 pathway by Erianin: A novel approach to reduce psoriasiform inflammation and inflammatory signaling
  83. The expression of epidermal growth factor receptor 2 and its relationship with tumor-infiltrating lymphocytes and clinical pathological features in breast cancer patients
  84. Innovations in MALDI-TOF Mass Spectrometry: Bridging modern diagnostics and historical insights
  85. BAP1 complexes with YY1 and RBBP7 and its downstream targets in ccRCC cells
  86. Hypereosinophilic syndrome with elevated IgG4 and T-cell clonality: A report of two cases
  87. Electroacupuncture alleviates sciatic nerve injury in sciatica rats by regulating BDNF and NGF levels, myelin sheath degradation, and autophagy
  88. Polydatin prevents cholesterol gallstone formation by regulating cholesterol metabolism via PPAR-γ signaling
  89. RNF144A and RNF144B: Important molecules for health
  90. Analysis of the detection rate and related factors of thyroid nodules in the healthy population
  91. Artesunate inhibits hepatocellular carcinoma cell migration and invasion through OGA-mediated O-GlcNAcylation of ZEB1
  92. Endovascular management of post-pancreatectomy hemorrhage caused by a hepatic artery pseudoaneurysm: Case report and review of the literature
  93. Efficacy and safety of anti-PD-1/PD-L1 antibodies in patients with relapsed refractory diffuse large B-cell lymphoma: A meta-analysis
  94. SATB2 promotes humeral fracture healing in rats by activating the PI3K/AKT pathway
  95. Overexpression of the ferroptosis-related gene, NFS1, corresponds to gastric cancer growth and tumor immune infiltration
  96. Understanding risk factors and prognosis in diabetic foot ulcers
  97. Atractylenolide I alleviates the experimental allergic response in mice by suppressing TLR4/NF-kB/NLRP3 signalling
  98. FBXO31 inhibits the stemness characteristics of CD147 (+) melanoma stem cells
  99. Immune molecule diagnostics in colorectal cancer: CCL2 and CXCL11
  100. Inhibiting CXCR6 promotes senescence of activated hepatic stellate cells with limited proinflammatory SASP to attenuate hepatic fibrosis
  101. Cadmium toxicity, health risk and its remediation using low-cost biochar adsorbents
  102. Pulmonary cryptococcosis with headache as the first presentation: A case report
  103. Solitary pulmonary metastasis with cystic airspaces in colon cancer: A rare case report
  104. RUNX1 promotes denervation-induced muscle atrophy by activating the JUNB/NF-κB pathway and driving M1 macrophage polarization
  105. Morphometric analysis and immunobiological investigation of Indigofera oblongifolia on the infected lung with Plasmodium chabaudi
  106. The NuA4/TIP60 histone-modifying complex and Hr78 modulate the Lobe2 mutant eye phenotype
  107. Experimental study on salmon demineralized bone matrix loaded with recombinant human bone morphogenetic protein-2: In vitro and in vivo study
  108. A case of IgA nephropathy treated with a combination of telitacicept and half-dose glucocorticoids
  109. Analgesic and toxicological evaluation of cannabidiol-rich Moroccan Cannabis sativa L. (Khardala variety) extract: Evidence from an in vivo and in silico study
  110. Wound healing and signaling pathways
  111. Combination of immunotherapy and whole-brain radiotherapy on prognosis of patients with multiple brain metastases: A retrospective cohort study
  112. To explore the relationship between endometrial hyperemia and polycystic ovary syndrome
  113. Research progress on the impact of curcumin on immune responses in breast cancer
  114. Biogenic Cu/Ni nanotherapeutics from Descurainia sophia (L.) Webb ex Prantl seeds for the treatment of lung cancer
  115. Dapagliflozin attenuates atrial fibrosis via the HMGB1/RAGE pathway in atrial fibrillation rats
  116. Glycitein alleviates inflammation and apoptosis in keratinocytes via ROS-associated PI3K–Akt signalling pathway
  117. ADH5 inhibits proliferation but promotes EMT in non-small cell lung cancer cell through activating Smad2/Smad3
  118. Apoptotic efficacies of AgNPs formulated by Syzygium aromaticum leaf extract on 32D-FLT3-ITD human leukemia cell line with PI3K/AKT/mTOR signaling pathway
  119. Novel cuproptosis-related genes C1QBP and PFKP identified as prognostic and therapeutic targets in lung adenocarcinoma
  120. Bee venom promotes exosome secretion and alters miRNA cargo in T cells
  121. Treatment of pure red cell aplasia in a chronic kidney disease patient with roxadustat: A case report
  122. Comparative bioinformatics analysis of the Wnt pathway in breast cancer: Selection of novel biomarker panels associated with ER status
  123. Kynurenine facilitates renal cell carcinoma progression by suppressing M2 macrophage pyroptosis through inhibition of CASP1 cleavage
  124. RFX5 promotes the growth, motility, and inhibits apoptosis of gastric adenocarcinoma cells through the SIRT1/AMPK axis
  125. ALKBH5 exacerbates early cardiac damage after radiotherapy for breast cancer via m6A demethylation of TLR4
  126. Phytochemicals of Roman chamomile: Antioxidant, anti-aging, and whitening activities of distillation residues
  127. Circadian gene Cry1 inhibits the tumorigenicity of hepatocellular carcinoma by the BAX/BCL2-mediated apoptosis pathway
  128. The TNFR-RIPK1/RIPK3 signalling pathway mediates the effect of lanthanum on necroptosis of nerve cells
  129. Longitudinal monitoring of autoantibody dynamics in patients with early-stage non-small-cell lung cancer undergoing surgery
  130. The potential role of rutin, a flavonoid, in the management of cancer through modulation of cell signaling pathways
  131. Construction of pectinase gene engineering microbe and its application in tobacco sheets
  132. Construction of a microbial abundance prognostic scoring model based on intratumoral microbial data for predicting the prognosis of lung squamous cell carcinoma
  133. Sepsis complicated by haemophagocytic lymphohistiocytosis triggered by methicillin-resistant Staphylococcus aureus and human herpesvirus 8 in an immunocompromised elderly patient: A case report
  134. Sarcopenia in liver transplantation: A comprehensive bibliometric study of current research trends and future directions
  135. Advances in cancer immunotherapy and future directions in personalized medicine
  136. Can coronavirus disease 2019 affect male fertility or cause spontaneous abortion? A two-sample Mendelian randomization analysis
  137. Heat stroke associated with novel leukaemia inhibitory factor receptor gene variant in a Chinese infant
  138. PSME2 exacerbates ulcerative colitis by disrupting intestinal barrier function and promoting autophagy-dependent inflammation
  139. Hyperosmolar hyperglycemic state with severe hypernatremia coexisting with central diabetes insipidus: A case report and literature review
  140. Efficacy and mechanism of escin in improving the tissue microenvironment of blood vessel walls via anti-inflammatory and anticoagulant effects: Implications for clinical practice
  141. Merkel cell carcinoma: Clinicopathological analysis of three patients and literature review
  142. Ecology and Environmental Science
  143. Optimization and comparative study of Bacillus consortia for cellulolytic potential and cellulase enzyme activity
  144. The complete mitochondrial genome analysis of Haemaphysalis hystricis Supino, 1897 (Ixodida: Ixodidae) and its phylogenetic implications
  145. Epidemiological characteristics and risk factors analysis of multidrug-resistant tuberculosis among tuberculosis population in Huzhou City, Eastern China
  146. Indices of human impacts on landscapes: How do they reflect the proportions of natural habitats?
  147. Genetic analysis of the Siberian flying squirrel population in the northern Changbai Mountains, Northeast China: Insights into population status and conservation
  148. Diversity and environmental drivers of Suillus communities in Pinus sylvestris var. mongolica forests of Inner Mongolia
  149. Global assessment of the fate of nitrogen deposition in forest ecosystems: Insights from 15N tracer studies
  150. Fungal and bacterial pathogenic co-infections mainly lead to the assembly of microbial community in tobacco stems
  151. Influencing of coal industry related airborne particulate matter on ocular surface tear film injury and inflammatory factor expression in Sprague-Dawley rats
  152. Temperature-dependent development, predation, and life table of Sphaerophoria macrogaster (Thomson) (Diptera: Syrphidae) feeding on Myzus persicae (Sulzer) (Homoptera: Aphididae)
  153. Eleonora’s falcon trophic interactions with insects within its breeding range: A systematic review
  154. Agriculture
  155. Integrated analysis of transcriptome, sRNAome, and degradome involved in the drought-response of maize Zhengdan958
  156. Variation in flower frost tolerance among seven apple cultivars and transcriptome response patterns in two contrastingly frost-tolerant selected cultivars
  157. Heritability of durable resistance to stripe rust in bread wheat (Triticum aestivum L.)
  158. Molecular mechanism of follicular development in laying hens based on the regulation of water metabolism
  159. Animal Science
  160. Effect of sex ratio on the life history traits of an important invasive species, Spodoptera frugiperda
  161. Plant Sciences
  162. Hairpin in a haystack: In silico identification and characterization of plant-conserved microRNA in Rafflesiaceae
  163. Widely targeted metabolomics of different tissues in Rubus corchorifolius
  164. The complete chloroplast genome of Gerbera piloselloides (L.) Cass., 1820 (Carduoideae, Asteraceae) and its phylogenetic analysis
  165. Field trial to correlate mineral solubilization activity of Pseudomonas aeruginosa and biochemical content of groundnut plants
  166. Correlation analysis between semen routine parameters and sperm DNA fragmentation index in patients with semen non-liquefaction: A retrospective study
  167. Plasticity of the anatomical traits of Rhododendron L. (Ericaceae) leaves and its implications in adaptation to the plateau environment
  168. Effects of Piriformospora indica and arbuscular mycorrhizal fungus on growth and physiology of Moringa oleifera under low-temperature stress
  169. Effects of different sources of potassium fertiliser on yield, fruit quality and nutrient absorption in “Harward” kiwifruit (Actinidia deliciosa)
  170. Comparative efficiency and residue levels of spraying programs against powdery mildew in grape varieties
  171. The DREB7 transcription factor enhances salt tolerance in soybean plants under salt stress
  172. Using plant electrical signals of water hyacinth (Eichhornia crassipes) for water pollution monitoring
  173. Food Science
  174. Phytochemical analysis of Stachys iva: Discovering the optimal extract conditions and its bioactive compounds
  175. Review on role of honey in disease prevention and treatment through modulation of biological activities
  176. Computational analysis of polymorphic residues in maltose and maltotriose transporters of a wild Saccharomyces cerevisiae strain
  177. Optimization of phenolic compound extraction from Tunisian squash by-products: A sustainable approach for antioxidant and antibacterial applications
  178. Liupao tea aqueous extract alleviates dextran sulfate sodium-induced ulcerative colitis in rats by modulating the gut microbiota
  179. Toxicological qualities and detoxification trends of fruit by-products for valorization: A review
  180. Polyphenolic spectrum of cornelian cherry fruits and their health-promoting effect
  181. Optimizing the encapsulation of the refined extract of squash peels for functional food applications: A sustainable approach to reduce food waste
  182. Advancements in curcuminoid formulations: An update on bioavailability enhancement strategies curcuminoid bioavailability and formulations
  183. Impact of saline sprouting on antioxidant properties and bioactive compounds in chia seeds
  184. The dilemma of food genetics and improvement
  185. Bioengineering and Biotechnology
  186. Impact of hyaluronic acid-modified hafnium metalorganic frameworks containing rhynchophylline on Alzheimer’s disease
  187. Emerging patterns in nanoparticle-based therapeutic approaches for rheumatoid arthritis: A comprehensive bibliometric and visual analysis spanning two decades
  188. Application of CRISPR/Cas gene editing for infectious disease control in poultry
  189. Preparation of hafnium nitride-coated titanium implants by magnetron sputtering technology and evaluation of their antibacterial properties and biocompatibility
  190. Preparation and characterization of lemongrass oil nanoemulsion: Antimicrobial, antibiofilm, antioxidant, and anticancer activities
  191. Corrigendum
  192. Corrigendum to “Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells”
  193. Corrigendum to “Effects of Ire1 gene on virulence and pathogenicity of Candida albicans”
Jetzt anmelden und 20% sparen
Institutioneller Zugang
Wie funktioniert Authentifizierung?
Haben Sie eine Idee, wie wir unsere Website verbessern können?
Bitte schreiben Sie uns.
© 2025 De Gruyter Brill
Heruntergeladen am 16.11.2025 von https://www.degruyterbrill.com/document/doi/10.1515/biol-2025-1151/html
Button zum nach oben scrollen