BAP1 complexes with YY1 and RBBP7 and its downstream targets in ccRCC cells

Ying Wu; Xue-Ying Li; Jin-Dong Chen; You-Fu Pan

doi:10.1515/biol-2025-1140

Article Open Access

BAP1 complexes with YY1 and RBBP7 and its downstream targets in ccRCC cells

Ying Wu , Xue-Ying Li , Jin-Dong Chen and You-Fu Pan

Published/Copyright: July 18, 2025

Published by

Become an author with De Gruyter Brill

Submit Manuscript Author Information Explore this Subject

From the journal Open Life Sciences Volume 20 Issue 1

Abstract

Clear cell renal cell carcinoma (ccRCC) is the most common type of kidney cancer. A few genes, such as BAP1, are associated with the tumorigenesis of ccRCC. Mutations in BAP1 are related to a proportion of ccRCCs. In this study, to explore the functional role of BAP1 in ccRCC, the potential interacting proteins with BAP1 in ccRCC cells are to be identified, and the gene expression profiles of BAP1 knockdown 786-O cells are to be analyzed.

Keywords: BAP1 ; YY1 ; RBBP7 ; ccRCC; kidney cancer; renal cell carcinoma

1 Introduction

Renal cell carcinoma (RCC) is a heterogeneous group of cancers derived from renal tubular epithelial cells, accounting for 5% of all malignant tumors in males [1]. Major RCC subtypes include clear cell renal cell carcinoma (ccRCC), papillary RCC, and chromophobe RCC [2]. There are approximately 209,000 new cases per year, and about 102,000 people die from this disease [3]. About 2–3% of cases are familial, and several RCC-related genes have been described, including VHL, PBRM1, TSC1/TSC2, FLCN, BAP1, FH, STED2, JARID1c/KDM5C, and MTOR [4,5,6,7,8]. Of them, VHL, PBRM1, SETD2, and BAP1 are located on chromosome 3p, and mutations in these genes lead to ccRCC. ccRCC caused by VHL mutation accounts for >50% [9], while PBRM1 mutation accounts for 40%, SETD2 for 16%, and BAP1 for 15% [4]. The BAP1 gene, encoding a protein of 729 amino acids called BRCA1-associated protein 1 [10], is a nuclear ubiquitin carboxy-terminal hydrolase. BAP1 regulates a number of biological processes, including DNA damage repair, cell cycle control, chromatin modification, programmed cell death, and the immune response [10,11,12]. Mutations in the BAP1 gene lead to several aggressive cancers, including RCC, malignant mesothelioma, uveal melanoma, and cutaneous melanoma. Several studies have reported that BAP1 is associated with the occurrence and progression of clear cell RCC [4,13,14]. While a single knockout of Vhl and Pbrm1 failed to develop kidney cancer in mice, both Bap1-Vhl and Bap1-Pbrm1 double-knockout mice developed ccRCC [15,16,17]. Although numerous studies have revealed that BAP1 is involved in the occurrence of ccRCC [4,13,14], the mechanism leading to BAP1-mutated tumorigenesis of ccRCC is unclear. This study aimed to determine the role of BAP1 in ccRCC by exploring the BAP1 interactive proteins and investigate the pathogenesis of ccRCC with BAP1 mutations.

2 Materials and methods

2.1 Cell line

The human kidney cell line, 786-O, was purchased from Cell Bank of Chinese Science Academy and was cultured in RPMI-1640 medium (cat. no. 61870044; Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (cat. no. 11011-6125; Zhejiang Tianhang Biotechnology Co., Ltd.), 2 g/l NaHCO₃, 100 µg/ml streptomycin, and 100 U/ml penicillin (BBI Life Sciences) at 37°C in a humidified incubator with 5% CO₂.

2.2 Co-immunoprecipitation

786-O cells (3 × 10⁵) were seeded in six-well-plate and incubated at 37°C for 24 h. Cells were lysed with 500 μl of immunoprecipitation (IP) buffer (0.303 g Tris, 0.8775 g NaCl, 0.029 g ethylenediamine-tetraacetic acid, 1 g NP-40, and 5 ml glycerin in 100 mL ddH₂O, pH 7.4) and followed by ultrasonic treatment for 1 min with a sonicator (SCIENTZ-IID, Ningbo, Zhejiang). Then, the cell lysate was centrifuged at 13,000g for 10 min (iCEN-24R, Allsheng, Hangzhou, China). Subsequently, the supernatant was collected and transferred into a new 1.5 ml Eppendorf tube. Approximately 100 μl supernatant was used for input control, and the left was evenly divided into two parts for IgG and BAP1 treatment, respectively. Then, pre-treated Rec-protein A-Sepharose^® 4B (Invitrogen) was added into the lysate of IgG and BAP1 groups and mixed with a rotary shaker at 4℃ for 3 h, followed by centrifuging at 4℃, and supernatants were transferred into new 1.5 ml Eppendorf tubes. Then, 2 μg normal mouse IgG and 20 μl Rec-protein A-Sepharose^® 4B were added into the IgG tube, followed by 2 μg mouse-anti-human BAP1cross-linked-agarose monoclonal antibody (25% agarose) (Santa CruzBiotechnology), then incubated at a rotary shaker at 4℃ overnight [4]. The mixtures were centrifuged shortly and washed three times with TBS buffer (0.6057 g Tris-HCl and 0.8775 g NaCl in 100 mL ddH₂O, pH 7.4) at 4℃ for 10 min each time. Loading buffer was added to the pellets and boiled. The mixtures were shortly spin, and the supernatants were subjected to Western blot analysis.

2.3 Knockdown of BAP1 in 786-O cell line

786-O cells at 75–80% confluence were transfected with BAP1-short hairpin RNA (shRNA) or control shRNA (Santa Cruz Biotechnology), and polybrene was used to improve the transfecting rate. Puromycin was used to select and stabilize the BAP1-shRNA transfected cells after 12 h of transfection. After 48 h, cells were washed three times with PBS and lysed with IP buffer on ice. The cell lysate was then collected in a 1.5 ml Eppendorf tube and centrifuged at 12,000g at 4°C for 10 min. The resultant supernatants were transferred into new 1.5 ml Eppendorf tubes, and protein concentration was determined using bicinchoninic acid assay (cat. no. PC0020; Beijing Solarbio Science & Technology Co., Ltd.) in accordance with the manufacturer’s protocol. The protein was stored at −80˚C for following Western blot analysis.

2.4 Western blot

Protein (∼20 μg) was mixed with 4X loading buffer and denatured by boiling for 5 min, after which samples were separated using 11% sodium dodecyl sulfate polyacrylamide gel electrophoresis. Proteins were subsequently transferred to polyvinylidene fluoride membranes (0.22 μm) and blocked with 5% non-fat milk in tris - buffered saline Tween (TBST) (with 0.1% Tween) for 2.5 h at room temperature. Samples were then incubated with primary antibodies BAP1 (28383, Santa Cruz Biotechnology) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (ProteinTech Group) at 4°C overnight. The membrane was washed three times with TBST buffer. Goat anti-mouse secondary antibodies (1:1,000, ProteinTech Group) were then added and incubated at 37°C for 2 h. Protein was exposed with enhanced chemilucinescent substrate reagents (cat. no. WBKLS0050; Merck Millipore) following the manufacturer’s protocol. Gel imaging was performed with the Gel Doc XR + System (Gel Doc XR, Bio-Rad), and IPP software (version number. 6.0; Media Cybernetics Inc.) was adopted to measure the gray level of each resultant band.

2.5 Quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR)

786-O cells were transfected with BAP1-shRNA or control shRNA, as aforementioned. Total RNA was extracted by using TRIzol reagent following the manufacturer’s protocol. Approximately 1 μg total RNA was transcribed into cDNA using PrimeScript™ RT reagent kit (Perfect Real Time) in accordance with the manufacturer’s protocol. For qRT-PCR, 1 μl diluted (1:10 dilution in ddH₂O) cDNA was mixed with BAP1 primers (20 pM each), and GAPDH was used as an internal control in 10 μl total reaction volume. qRT-PCR was performed using the SYBR^® Premix Ex TaqTMII (Tli RNaseH Plus) kit (TaKaRa Biotechnology) according to the manufacturer’s instructions. BAP1 primers: BAP1-FW, CCACCAGCTGATACCCAACTC; BAP1-RV, CCACGCTGCTGCAGTTCA. GAPDH primers: GAPDH-FW, AAGCTAGTTACAAAAAGGCCATCATT; GAPDH-RV, AGGGTTCGGACTCCTGGAA.

For differential gene expression analysis, the primers used for qRT-PCR are as follows: BAP1-FW, CCACCAGCTGATACCCAACTC; BAP1-RV, CCACGCTGCTGCAGTTCA; GAPDH-FW, AAGCTAGTTACAAAAAGGCCATCATT; GAPDH-RV, AGGGTTCGGACTCCTGGAA; E2F8-FW, TGGTCAGATCAGGCTTCGTT; E2F8-RV, CTTGCTTTGTACCGGCTGTT; FGF21-FW, GGTCGGATGGAGGAGAAACT; FGF21-RV, CAAAGTGGAGCTAGGGGACA; HIST1H1B-FW, CTTCACTGCCTTTTTCGCCC; HIST1H1B-RV, TTAAGCTGGGCCTCAAGAGC; KLF15-FW, GCAGCCATTTGAAACCCTGA; KLF15-RV, TCCCAGTTGGCCCATTATGT; HSPA6-FW, TTGAACTCAGTGGCATCCCT; HSPA6-RV, CCTTACCTGTGCTCCTGTCA; IL1B-FW, TCCAGCTACGAATCTCCGAC; IL1B-RV, AGGTGCTCAGGTCATTCTCC. All the primers were purchased from Sangon Biotech (Shanghai, China).

2.6 Cytometry

786-O cells (∼3 × 10⁵) were seeded in each well of a six-well-plate and incubated at 37°C for 24 h. Cells were then treated with BAP1-shRNA lentivirus and control shRNA lentivirus. Cells were counted between 0 and 4 days by cytometry. Growth curves were then generated to assess the effect of BAP1 knockdown on cell growth.

2.7 Gene expression profiling

786-O cells transfected with BAP1-shRNA lentivirus and control shRNA lentivirus, as aforementioned, were collected for gene expression profiling. Gene expression profiling was carried out by BGI Genomics (Shenzhen, China) through the BGISEQ-500 platform. Experiments with BAP1 shRNA and control shRNA were performed in triplicate.

2.8 Statistics

All data were shown as X̅ ± s. GraphPad Prism was adopted to analyze the data. Independent samples t-test was used to detect sample differences. P < 0.05, P < 0.01, and P < 0.001 mean statistically significant, very significant, and extremely significant, respectively.

3 Results

3.1 Identification of BAP1-interactive proteins through co-immunoprecipitation

Previous studies have revealed that BAP1 is able to interact with YY1 and RBBP7 [18,19]. To further determine whether YY1 and RBBP7 are BAP1-binding proteins in ccRCC, we have performed co-immunoprecipitation with YY1 and RBBP7 antibodies (Figure 1). Our results indicated that YY1 and RBBP7 were detected in the BAP1 group. The co-immunoprecipitation was repeated three times, and similar results were obtained (Figure 1). These results demonstrated that BAP1 could bind YY1 and RBBP7.

Figure 1

Identification of BAP1 interactive proteins in 786-O cells by co-immunoprecipitation. With anti-GAPDH antibody, only the input lane showed a GAPDH band. With anti-YY1 and anti-RBBP7 antibodies, lanes input and BAP1 presented YY1 and RBBP7 bands. The co-immunoprecipitation experiment was repeated three times.

3.2 Knockdown of BAP1 inhibits cell proliferation

Puromycin (2 μg/ml) was used to select the shBAP1-transfected cells for 96 h after transfection (Figures 2 and 3).

Figure 2

Killing effect of different concentrations of puromycin on 786-O cells. Note: *P < 0.05; ***P < 0.001.

Figure 3

Selection of BAP1-shRNA knockdown 786-O cell clones. (a) BAP1-shRNA transfected cells were selected with 2 μg/ml of puromycin. Five clones (1–5) were taken for BAP1 expression analysis. (b) Representative images for five BAP1-shRNA knockdowns and control; (c) quantitative BAP1 expression of five BAP1-shRNA clones and control shRNA cells. Clone 1 showed the best knockdown result. Scale bar: 100 μm, ***P < 0.001.

Compared to the control group, BAP1-shRNA knockdown cells presented low BAP1 expression at RNA and protein levels. Five shBAP1 knockdown 786-O cell clones were selected for analysis. Of them, Clone A presented the best knockdown effect (0.036 ± 0.108, P < 0.001) compared to control and was used for the following experiments (Figure 3).

In addition, BAP1 shRNA clone 1 grows much slower compared to the control shRNA clone. This result indicated that knockdown of BAP1 led to the growth inhibition of 786-O cells.

4 Knockdown of BAP1 leads to down-regulation of E2F8, FGF21, HIST1H1B in 786-O cells

4.1 Differential expressed genes

We tested 17,202 genes by comparing the BAP1 shRNA group and the control shRNA group and identified 3,422 genes with differential expression. Of them, 1,061 genes were up-regulated and 2,362 down-regulated (Figure 4).

Figure 4

Analysis of differential gene expression. (a) Heatmap of differential expression cluster. X-axis, log2 (FPKM+) of the sample, Y-axis, differential genes. Red, high expressional genes; Blue, low expressional genes. (b) MA-plot distribution map of DEG from BAP1-shRNA cells. X-axis, A value (mean of expression log2); Y-axis, M value (differential folds of expression log2). Red, DEG up-regulated; blue, DEG down-regulated; gray, non-DEG.

4.2 Enrichment of differential expressed genes

Further analysis indicated that gene cluster/enrichment is associated with 336 pathways in BAP1 shRNA 786-O cells. Of them, the first enriched genes are presented in Figure 5. Sixty-seven gene enrichments are related to the cell cycle, which is associated with Epstein–Barr virus infection, cellular senescence, and spliceosome (Table 1).

Figure 5

Cluster map of KEGG pathways of differential expression genes identified in 786-O cells with BAP1-shRNA knockdown. Y-axis, pathway; down X-axis, blue bar, Q value (−log10); up X-axis, orange line, number of differential genes.

Table 1

Number of differential genes and related pathways identified in BAP1-shRNA cells

Pathway	Number of genes	P-value	Confidence level
Cell cycle	67	7.69 × 10⁻¹⁵	<0.01
DNA replication	26	2.84 × 10⁻⁸	<0.01
Fanconi anemia pathway	28	1.50 × 10⁻⁶	<0.01
Mismatch repair	14	0.000180521	<0.01
Homologous recombination	20	0.000210901	<0.01
Cellular senescence	57	0.000344742	<0.01
Spliceosome	54	0.001329485	<0.01
Nucleotide excision repair	22	0.001543348	<0.01
Ribosome biogenesis in eukaryotes	37	0.001784738	<0.01
Non-homologous end-joining	9	0.001952161	<0.01
Hepatitis B	44	0.00230733	<0.01
MicroRNAs in cancer	53	0.002859731	<0.01
Pyrimidine metabolism	48	0.003637364	<0.01
Glycine, serine, and threonine metabolism	15	0.004692524	<0.01
Glycosphingolipid biosynthesis – globo and isoglobo series	8	0.005580328	<0.01
Aminoacyl-tRNA biosynthesis	19	0.005839234	<0.01
Oocyte meiosis	42	0.006998931	<0.01
FoxO signaling pathway	39	0.009724549	<0.01
Longevity regulating pathway – worm	28	0.009960035	<0.01
Epstein–Barr virus infection	66	0.01073498	<0.05

4.3 Validation of differential genes

Six differentially expressed genes, E2F8, FGF21, HIST1H1B, KLF15, HSPA6, and IL1B, were selected for further validation by qRT-PCR. Total RNAs were extracted from BAP1-shRNA knockdown 786-O cells and were subsequently used for qRT-PCR analysis.

E2F8, FGF21, and HIST1H1B were down-regulated when BAP1 was knocked down (Table 2, Figure 6), while HSPA6 was up-regulated. We failed to validate the expression change of KLF15 and IL1B by qRT-PCR at the RNA level, though up-regulation was observed in differential gene expression analysis (Figure 6, Table 3).

Table 2

Expressional levels of selected differential expression genes in BAP1-shRNA cells

Gene	mRNA expression (X ± s)
E2F8	0.4839 ± 0.1066 (P < 0.05)
FGF21	0.1004 ± 0.0693 (P < 0.01)
HIST1H1B	0.3761 ± 0.0106 (P < 0.001)
KLF15	1.1293 ± 0.2079
HSPA6	1.7543 ± 0.2316 (P < 0.001)
IL1B	0.8740 ± 0.1018

Figure 6

Validation of differential genes in BAP1-shRNA treated cells. At the mRNA level, E2F8, FGF21, and HIST1H1B were down-regulated. HSPA6 was up-regulated, while IL1B and KLF15 had no change. (a) E2F8; (b) FGF21; (c) HIST1H1B; (d) KLF15; (e) HSPA6; (f) IL1B.

Table 3

Expressional comparison of differential genes in differential gene expression analysis and qRT-PCR

Gene	Folds of differential expression	qRT-PCR
E2F8	−4.46194091289301	Down
FGF21	−4.80986421631332	Down
HIST1H1B	−5.00250929425571	Down
KLF15	6.1674157071866	—
HSPA6	5.59243729503806	Up
IL1B	4.63473659739819	—

5 Discussion

BAP1, a tumor suppressor [11,12], utilizes its deubiquitinating activity to modulate a number of processes, including DNA damage repair, cell cycle control, programmed cell death, cellular differentiation, cell proliferation, chromatin modification, and the immune response. BAP1 is commonly mutated in ccRCC [4,13,14]. However, its role in tumorigenesis of ccRCC is poorly understood. To date, the treatment options available for tumors with BAP1 mutations are limited to standard therapies. Thus, investigation of the role of BAP1 in ccRCC tumorigenesis is essential for the development of target therapy for BAP1-mutated ccRCC. In this study, we demonstrated that BAP1 may inhibit renal tumorigenesis by interacting with YY1, RBBP7, HCF-1, H2A, ASXL1/2, and FoxK1/K2, which is consistent with previous reports [18,19,20,21].

YY1 is a multifunctional transcription factor that plays a critical role in regulating the expression of the genes involved in various physiological processes, including development, cell proliferation, differentiation, DNA repair, and apoptosis. YY1 has emerged as a promising target for antitumor therapy in recent years due to its critical role in regulating various hallmarks of cancer, such as tumor cell proliferation, evading programmed cell death, deregulated metabolism, induction of angiogenesis, activation of invasion and metastasis, genome instability, and evading immune system [11,19,20,21], as well as in tumor cell drug resistance [22,23,24]. Overexpression of YY1 is frequently observed in various human cancers, including breast, bladder, cervical, colon, esophageal, liver, brain, and gastric cancers [23]. While YY1 promotes tumor growth by stabilizing HIF-1α levels in some types of tumors [24], aberrant expression of YY1 results in ccRCC by increasing the expression of HIF-2α and inhibiting VHL [25]. YY1 is able to regulate gene expression by binding BAP1-HCF1 and forming a triplex [26]. In this study, we demonstrated that YY1 is able to bind BAP1.

Retinoblastoma-binding protein 7 (RBBP7), a ubiquitously expressed nuclear protein and a component in many histone deacetylase (HDAC) complexes, plays a key role in chaperoning chromatin remodeling proteins to their nuclear histone substrates, including histone acetylases and HDACs [27,28]. RBBP7 modulates the epigenetic activity of these chromatin-remodeling proteins, thereby modulating the expression of target genes [28]. RBBP7 can specifically bind to the BRCT domain of BRCA1 and modulate its transcriptional activity to influence the regulation of cell proliferation and differentiation [29], and have been implicated in numerous cancers [30]. Mass spectrum analysis of human kidney cell line 786-O indicated that BAP1 can interact with RBBP7 [31]. Herein, our results indicate that RBBP7 can bind to BAP1.

Interaction between proteins plays a key role in cell regulation and signaling. Previous studies indicated that BAP1 might inhibit cancer cell growth by interacting with one or more partner proteins, including YY1, RBBP7, HCF-1, H2A, ASXL1/2, and FoxK1/K2 [19,21,25]. YY1 and RBBP7 are the two most important interactive partners of BAP1 [19,31]. By co-immunoprecipitating, we herein further demonstrated that both YY1 and RBBP7 can bind to BAP1 in ccRCC cell line 786-O.

To explore the downstream target proteins of BAP1 in ccRCC, we conducted differential gene expression analysis by knocking down BAP1 in 786-O cells. We identified 3,422 differential expression genes, and a gene cluster was related to 336 pathways. Among them, there is a significant enrichment of differentially expressed genes in pathways such as cycle, senescence, in cancer, Epstein–Barr virus infection (Figure 5, Table 1). Based on differential fold and function association, we selected six differential expression genes, including E2F8 (cell cycle), FGF21 (metabolism), HIST1H1B (nucleosome formation), KLF15 (gene transcription), HSPA46 (cell proliferation, stress response), and IL1B (cell proliferation, inflammation) for further validation. Our qRT-PCR indicated that E2F8, FGF21, and HIST1H1B were down-regulated while HSPA6 was up-regulated in BAP1-shRNA knockdown 786-o cells, which is consistent with our finding in differential gene expression analysis (Table 3). However, we failed to validate the expression change of KLF15 and IL1B. The reason is unclear. These results revealed that BAP1 regulates the expression of E2F8, FGF21, HIST1H1B, and HSPA6 in 786-O cells, which may be associated with tumorigenesis of ccRCC. E2F8 is a new member of the E2F gene family and plays a role in modulating the progression of the G1-S phase in the cell cycle. E2F8 is linked to carcinogenesis [32,33,34]. FGF21 (fibroblast growth factor 21), a member of the FGF family, is a non-mitosis-promoting gene [35,36,37]. Since ccRCC is a type of metabolic disease. FGF21 is mainly metabolized in the kidney. HIST1H1B (histone cluster 1 H1 family member b) encodes a histone that is involved in nucleosome formation [38]. HIST1H1B plays a crucial role in the progression of carcinogenesis [38]. HSPA6 (Heat Shock Protein Family A [Hsp70] Member 6) is associated with folding, stabilizing, and transportation of proteins and is a member of the stress response pathway. Aberrant expression of HSPA6 is involved in tumorigenesis [39,40]. Based on these results, BAP1 may inhibit carcinogenesis by modulating the cell cycle and metabolism and involving nucleosome formation in ccRCC.

In summary, BAP1 can exert its inhibitory effect on ccRCC by regulating multiple target genes and signaling pathways via interactions with the transcription factor YY1 and the histone-binding protein RBBP7. These findings may have future implications for therapy in BAP1-mutated cancers.

pyf2015@zmu.edu.cn

Acknowledgments

The completion of the thesis is attributed to many people’s encouragement. I want to extend my heartfelt gratitude to my supervisor, Professor Xue-Ying Li, and You-Fu Pan, whose patient guidance, valuable suggestions, and constant encouragement made me successfully complete this thesis. They gave me much help and advice during the whole process of my writing, which has made my accomplishments possible. Also, I would like to express my gratitude to Professor Jin-Dong Chen for helping to polish my manuscript. The authors are grateful for the reviewer’s valuable comments that improved the manuscript.

Funding information: This work was supported by the National Natural Science Foundation of China (32360166; 31760321), Zunyi City Science and Technology Bureau HZ (2024) 328, and Zunyi Medical University 2021 Academic New Seedling Cultivation and Innovation Exploration Project [2021] 1350-063.
Author contributions: All authors have accepted responsibility for the entire content of this manuscript and consented to its submission to the journal, reviewed all the results, and approved the final version of the manuscript. You-Fu Pan and Xue-Ying Li designed the experiments, and Ying Wu carried them out. Ying Wu, Jin-Dong Chen, and You-Fu Pan prepared the manuscript.
Conflict of interest: Authors state no conflict of interest. The company Exploring Health LLC. had not influenced the results obtained within the studies.
Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Siegel RL, Kratzer TB, Giaquinto AN, Sung H, Jemal A. Cancer statistics, 2025. CA Cancer J Clin. 2025 Jan-Feb;75(1):10–45.10.3322/caac.21871Search in Google Scholar PubMed PubMed Central

[2] Msaouel P, Genovese G, Tannir NM. Renal cell carcinoma of variant histology: biology and therapies. Hematol Oncol Clin North Am. 2023 Oct;37(5):977–92.10.1016/j.hoc.2023.04.019Search in Google Scholar PubMed PubMed Central

[3] Sharma R, Kadife E, Myers M, Kannourakis G, Prithviraj P, Ahmed N. Determinants of resistance to VEGF-TKI and immune checkpoint inhibitors in metastatic renal cell carcinoma. J Exp Clin Cancer Res. 2021;40:186.10.1186/s13046-021-01961-3Search in Google Scholar PubMed PubMed Central

[4] Bihr S, Ohashi R, Moore AL, Ruschoff JH, Beisel C, Hermanns T, et al. Expression and mutation patterns of PBRM1, BAP1 and SETD2 mirror specific evolutionary subtypes in clear cell renal cell carcinoma. Neoplasia. 2019;21:247–56.10.1016/j.neo.2018.12.006Search in Google Scholar PubMed PubMed Central

[5] Glennon KI, Endo M, Usui Y, Iwasaki Y, Breau RH, Kapoor A, et al. Germline susceptibility to renal cell carcinoma and implications for genetic screening. JCO Precis Oncol. 2024 Jul;8:e2400094.10.1200/PO.24.00094Search in Google Scholar PubMed

[6] Rose TL, Kim WY. Renal cell carcinoma: a review. JAMA. 2024 Sep;332(12):1001–10.10.1001/jama.2024.12848Search in Google Scholar PubMed PubMed Central

[7] Machacek ME, Wu CL, Cornejo KM. Pathology of hereditary renal cell carcinoma syndromes: Tuberous sclerosis complex (TSC). Semin Diagn Pathol. 2024 Jan;41(1):8–19.10.1053/j.semdp.2023.09.001Search in Google Scholar PubMed

[8] Charbel C, Causa Andrieu PI, Soliman M, Woo S, Zheng J, Capanu M, et al. The prevalence and radiologic features of renal cancers associated with FLCN, BAP1, SDH, and MET germline mutations. Radiol Imaging Cancer. 2024 Mar;6(2):e230063.10.1148/rycan.230063Search in Google Scholar PubMed PubMed Central

[9] van de Pol JAA, van den Brandt PA, van Engeland M, Godschalk RWL, van Schooten FJ, Hogervorst JGF, et al. Germline polymorphisms in the Von Hippel-Lindau and Hypoxia-inducible factor 1-alpha genes, gene-environment and gene-gene interactions and renal cell cancer. Sci Rep. 2020;10:137.10.1038/s41598-019-56980-0Search in Google Scholar PubMed PubMed Central

[10] Szczepanski AP, Wang L. Emerging multifaceted roles of BAP1 complexes in biological processes. Cell Death Discov. 2021;7:20.10.1038/s41420-021-00406-2Search in Google Scholar PubMed PubMed Central

[11] Kwon J, Lee D, Lee SA. BAP1 as a guardian of genome stability: implications in human cancer. Exp Mol Med. 2023 Apr;55(4):745–54.10.1038/s12276-023-00979-1Search in Google Scholar PubMed PubMed Central

[12] Louie BH, Kurzrock R. BAP1: Not just a BRCA1-associated protein. Cancer Treat Rev. 2020;90:102091.10.1016/j.ctrv.2020.102091Search in Google Scholar PubMed PubMed Central

[13] Carbone M, Harbour JW, Brugarolas J, Bononi A, Pagano I, Dey A, et al. Biological mechanisms and clinical significance of BAP1 mutations in human cancer. Cancer Discov. 2020;10:1103–20.10.1158/2159-8290.CD-19-1220Search in Google Scholar PubMed PubMed Central

[14] Lalloo F, Kulkarni A, Chau C, Nielsen M, Sheaff M, Steele J, et al. Clinical practice guidelines for the diagnosis and surveillance of BAP1 tumour predisposition syndrome. Eur J Hum Genet. 2023 Nov;31(11):1261–9.10.1038/s41431-023-01448-zSearch in Google Scholar PubMed PubMed Central

[15] Wang SS, Gu YF, Wolff N, Stefanius K, Christie A, Dey A, et al. Bap1 is essential for kidney function and cooperates with Vhl in renal tumorigenesis. Proc Natl Acad Sci U S A. 2014;111:16538–43.10.1073/pnas.1414789111Search in Google Scholar PubMed PubMed Central

[16] Gao W, Li W, Xiao T, Liu XS, Kaelin Jr WG. Inactivation of the PBRM1 tumor suppressor gene amplifies the HIF-response in VHL-/- clear cell renal carcinoma. Proc Natl Acad Sci U S A. 2017;114:1027–32.10.1073/pnas.1619726114Search in Google Scholar PubMed PubMed Central

[17] Gu YF, Cohn S, Christie A, McKenzie T, Wolff N, Do QN, et al. Modeling renal cell carcinoma in mice: Bap1 and pbrm1 inactivation drive tumor grade. Cancer Discov. 2017;7:900–17.10.1158/2159-8290.CD-17-0292Search in Google Scholar PubMed PubMed Central

[18] Baas R, van der Wa FJ, Bleijerveld OB, van Attikum H, Sixma TK. Proteomic analysis identifies novel binding partners of BAP1. PLoS One. 2021;16:e0257688.10.1371/journal.pone.0257688Search in Google Scholar PubMed PubMed Central

[19] Ishii Y, Kolluri KK, Pennycuick A, Zhang X, Nigro E, Alrifai D, et al. BAP1 and YY1 regulate expression of death receptors in malignant pleural mesothelioma. J Biol Chem. 2021;297:101223.10.1016/j.jbc.2021.101223Search in Google Scholar PubMed PubMed Central

[20] Xiao J, Zhang R, Peng J, Yang Z. BAP1 maintains chromosome stability by stabilizing DIDO1 in renal cell carcinoma. Am J Cancer Res. 2020;10:1455–66.Search in Google Scholar

[21] Xia YK, Zeng YR, Zhang ML, Liu P, Liu F, Zhang H, et al. Tumor-derived neomorphic mutations in ASXL1 impairs the BAP1-ASXL1-FOXK1/K2 transcription network. Protein Cell. 2021;12:557–77.10.1007/s13238-020-00754-2Search in Google Scholar PubMed PubMed Central

[22] Clark DJ, Dhanasekaran SM, Petralia F, Pan J, Song X, Hu Y, et al. Integrated proteogenomic characterization of clear cell renal cell carcinoma. Cell. 2020;180:207.10.1016/j.cell.2019.12.026Search in Google Scholar PubMed

[23] Hosea R, Hillary S, Wu S, Kasim V. Targeting transcription factor YY1 for cancer treatment: current strategies and future directions. Cancers. 2023 Jul;15(13):3506.10.3390/cancers15133506Search in Google Scholar PubMed PubMed Central

[24] Yang TT, Shao YT, Cheng Q, He YT, Qiu Z, Pan DD, et al. YY1/HIF-1α/mROS positive-feedback loop exacerbates glomerular mesangial cell proliferation in mouse early diabetic kidney disease. Acta Pharmacol Sin. 2025 Mar.10.1038/s41401-025-01498-7Search in Google Scholar PubMed PubMed Central

[25] Petrella BL, Brinckerhoff CE. PTEN suppression of YY1 induces HIF-2 activity in von-Hippel-Lindau-null renal-cell carcinoma. Cancer Biol Ther. 2009;8:1389–401.10.4161/cbt.8.14.8880Search in Google Scholar PubMed PubMed Central

[26] Yu H, Mashtalir N, Daou S, Hammond-Martel I, Ross J, Sui G, et al. The ubiquitin carboxyl hydrolase BAP1 forms a ternary complex with YY1 and HCF-1 and is a critical regulator of gene expression. Mol Cell Biol. 2010;30:5071–85.10.1128/MCB.00396-10Search in Google Scholar PubMed PubMed Central

[27] Zhang Y, Ng HH, Erdjument-Bromage H, Tempst P, Bird A, Reinberg D. Analysis of the NuRD subunits reveals a histone deacetylase core complex and a connection with DNA methylation. Genes Dev. 1999;13:1924–35.10.1101/gad.13.15.1924Search in Google Scholar PubMed PubMed Central

[28] Brasen C, Dorosz J, Wiuf A, Boesen T, Mirza O. Gajhede M. Expression, purification and characterization of the human MTA2-RBBP7 complex. Biochim Biophys Acta Proteins Proteom. 2017;1865:531–8.10.1016/j.bbapap.2017.02.002Search in Google Scholar PubMed

[29] Yu N, Zhang P, Wang L, He X, Yang S, Lu H. RBBP7 is a prognostic biomarker in patients with esophageal squamous cell carcinoma. Oncol Lett. 2018;16:7204–11.10.3892/ol.2018.9543Search in Google Scholar PubMed PubMed Central

[30] Cai L, Liu B, Cao Y, Sun T, Li Y. Unveiling the molecular structure and role of RBBP4/7: implications for epigenetic regulation and cancer research. Front Mol Biosci. 2023 Nov;10:1276612.10.3389/fmolb.2023.1276612Search in Google Scholar PubMed PubMed Central

[31] Xiao J, Zhang R, Peng J, Yang Z. BAP1 maintains chromosome stability by stabilizing DIDO1 in renal cell carcinoma. Am J Cancer Res. 2020 May;10(5):1455–66.Search in Google Scholar

[32] Lee DY, Chun JN, Cho M, So I, Jeon JH. Emerging role of E2F8 in human cancer. Biochim Biophys Acta Mol Basis Dis. 2023 Aug;1869(6):166745.10.1016/j.bbadis.2023.166745Search in Google Scholar PubMed

[33] Hang M, Xu Y, Zhang Y, Lou G. E2F8 knockdown suppresses cell proliferation and induces cell cycle arrest via Wnt/β-Catenin pathway in ovarian cancer. Chin J Physiol. 2023 Jul–Aug;66(4):266–75.10.4103/cjop.CJOP-D-22-00142Search in Google Scholar PubMed

[34] Li XQ, Cao ZR, Deng M, Qing Y, Sun L, Wu ZJ. E2F8-TPX2 axis regulates glycolysis and angiogenesis to promote progression and reduce chemosensitivity of liver cancer. Cytotechnology. 2024 Dec;76(6):817–32.10.1007/s10616-024-00655-wSearch in Google Scholar PubMed PubMed Central

[35] Flippo KH, Potthoff MJ. Metabolic messengers: FGF21. Nat Metab. 2021;3:309–17.10.1038/s42255-021-00354-2Search in Google Scholar PubMed PubMed Central

[36] Lu W, Li X, Luo Y. FGF21 in obesity and cancer: New insights. Cancer Lett. 2021;499:5–13.10.1016/j.canlet.2020.11.026Search in Google Scholar PubMed PubMed Central

[37] Hu C, Qiao W, Li X, Ning ZK, Liu J, Dalangood S, et al. Tumor-secreted FGF21 acts as an immune suppressor by rewiring cholesterol metabolism of CD8 + T cells. Cell Metab. 2024 Mar;36(3):630–47.10.1016/j.cmet.2024.01.005Search in Google Scholar PubMed

[38] Liao R, Chen X, Cao Q, Wang Y, Miao Z, Lei X, et al. HIST1H1B promotes basal-like breast cancer progression by modulating CSF2 expression. Front Oncol. 2021;11:780094.10.3389/fonc.2021.780094Search in Google Scholar PubMed PubMed Central

[39] Zhang L, Zhuo HQ, Hong ZJ, Hou JJ, Cheng J, Cai J. HSPA6, a novel prognostic and therapeutic biomarker, associated with Ming classification in gastric cancer. J Clin Lab Anal. 2023 Jan;37(1):e24763.10.1002/jcla.24763Search in Google Scholar PubMed PubMed Central

[40] Zhu X, Chen X, Shen X, Liu Y, Fu W, Wang B, et al. PP4R1 accelerates the malignant progression of NSCLC via up-regulating HSPA6 expression and HSPA6-mediated ER stress. Biochim Biophys Acta Mol Cell Res. 2024 Jan;1871(1):119588.10.1016/j.bbamcr.2023.119588Search in Google Scholar PubMed

Received: 2025-03-27

Revised: 2025-05-12

Accepted: 2025-05-30

Published Online: 2025-07-18

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

https://doi.org/10.1515/biol-2025-1140

Keywords for this article

BAP1; YY1; RBBP7; ccRCC; kidney cancer; renal cell carcinoma

Creative Commons

BY 4.0