Home Life Sciences Stigmasterol alleviates endplate chondrocyte degeneration through inducing mitophagy by enhancing PINK1 mRNA acetylation via the ESR1/NAT10 axis
Article Open Access

Stigmasterol alleviates endplate chondrocyte degeneration through inducing mitophagy by enhancing PINK1 mRNA acetylation via the ESR1/NAT10 axis

  • Hao Li , Xiaofeng Chen , Baoci Huang , Junjie He , Junxian Xie , Weijun Guo , Jinjun Liang , Jiajian Ruan , Jincheng Liu , Zhen Xiang and Lixin Zhu EMAIL logo
Published/Copyright: April 8, 2025
Download Article (PDF)
Open Life Sciences
From the journal Open Life Sciences Volume 20 Issue 1

Abstract

Intervertebral disc degeneration (IVDD) is a core factor in spinal degeneration. To date, there is no effective treatment for IVDD. It is urgent to identify the pathogenesis of IVDD to develop effective strategies for IVDD treatment. Alleviating endplate chondrocyte degeneration is a promising strategy for IVDD treatment, while mitophagy prevents degeneration of endplate chondrocytes. Stigmasterol (STM) protects neurons from injuries by triggering mitophagy, yet the effect of STM on the mitophagy of endplate chondrocytes in IVDD has not been reported. In this study, endplate chondrocyte degeneration was induced by interleukin-1β, and the ribonucleic acid (RNA) acetylation level was identified by acetylated RNA immunoprecipitation. Herein, results indicated that STM alleviated endplate chondrocyte degeneration. Besides, STM induced PTEN-induced kinase 1 (PINK1)-mediated mitophagy in degenerated endplate chondrocytes. Moreover, N‐acetyltransferase 10 (NAT10) increased PINK1 expression by improving PINK1 mRNA acetylation in endplate chondrocytes. In addition, STM regulated NAT10 expression by estrogen receptor 1 (ESR1) in degenerated endplate chondrocytes. In summary, the present study revealed that STM attenuated endplate chondrocyte degeneration through inducing mitophagy by enhancing PINK1 mRNA acetylation via the ESR1/NAT10 axis. These findings would provide novel strategies for the treatment of IVDD.

Keywords: intervertebral disc degeneration; endplate chondrocyte degeneration; stigmasterol; mitophagy; RNA acetylation

1 Introduction

Intervertebral disc degeneration (IVDD) is a core factor in spinal degeneration, leading to intervertebral disc herniation, low back pain, and disability in severe cases [1,2]. Nearly 80% of adults worldwide are affected by IVDD, especially the elderly [3]. IVDD patients suffer from physical and mental health burdens, resulting in a serious decline in life quality [4]. To date, the standard treatments for IVDD include drug therapy, physical therapy, spinal fusion, or joint replacement surgery. However, the low success rate or high cost limits the effectiveness of the above treatments [5]. Therefore, it is urgent to identify the pathogenesis of IVDD to explore new therapeutic targets and develop more effective strategies for IVDD.

The intervertebral disc is mainly composed of nucleus pulposus, annulus fibrosus, and cartilage endplate [6]. As the main source of extracellular matrix, endplate chondrocytes play an important role in the physical buffering capacity and nutritional maintenance of the intervertebral disc [6,7]. Besides, endplate degeneration caused by degeneration of endplate chondrocytes is an important cause of IVDD [8,9]. Thus, alleviating the degeneration of endplate chondrocytes is a promising strategy for IVDD treatment.

Mitochondrial dysfunction contributes to IVDD [10,11], while mitophagy, a specific form of autophagy, could attenuate IVDD by suppressing the degeneration of endplate chondrocytes via preventing mitochondrial dysfunction. For instance, icariin ameliorates IVDD by suppressing the degeneration of endplate chondrocytes and by inducing mitophagy [12]. By contrast, intermittent cyclic mechanical compression promotes IVDD by enhancing endplate chondrocyte degeneration via hindering PTEN-induced kinase 1 (PINK1)-mediated mitophagy [13]. Therefore, therapeutic inducement of mitophagy could prevent the degeneration of endplate chondrocytes to alleviate IVDD.

Stigmasterol (STM), one of the major active ingredients of Achyranthes bidentata, has been shown to protect against hypoxia/reoxygenation-induced injuries by triggering mitophagy in hippocampal neurons [14]. Similarly, STM ameliorates glutamate-induced neurotoxicity by promoting mitophagy of HT-22 cells [15]. However, the effect of STM on mitophagy of endplate chondrocytes in IVDD has not been reported.

N‐acetyltransferase 10 (NAT10)-mediated N4‐acetylcytidine (ac4C) acetylation is a highly conserved modification of ribonucleic acid (RNA) by improving RNA stability [16]. Therefore, mRNA acetylation plays a critical role in development, cancer, premature disease, and viral infection [17]. Nevertheless, the effect of RNA acetylation on IVDD or degeneration of endplate chondrocytes is largely unknown.

Therefore, the primary aim of this study was to investigate whether STM could prevent the degeneration of endplate chondrocytes by restoring mitophagy via modifying RNA acetylation in IVDD.

2 Materials and methods

2.1 Cell culture

Primary mouse endplate chondrocytes were purchased from Hechuang Biotech (Guangzhou, Guangdong, China). Then, cells were cultured with Chondrocyte Medium (#4651, ScienCell, Carlsbad, CA, USA) containing 10% fetal bovine serum (#SH30087.01, HyClone, Logan, UT, USA) and 100 U/mL penicillin–streptomycin (#SH30010, HyClone) in a humidified atmosphere of 5% CO2 at 37°C.

2.2 Cell treatment

To induce degeneration, mouse endplate chondrocytes were treated with 10 ng/mL interleukin-1β (IL-1β) (#bs-41073P, Bioss, Beijing, China) for 24 h. Besides, mouse endplate chondrocytes were treated with 5, 10, and 15 μg/mL STM diluted in DMSO (#IS0760, Solarbio, Beijing, China) for 48 h after IL-1β treatment to determine the effect of STM on endplate chondrocyte degeneration. Moreover, small interfering RNA (siRNA) targeting PINK1, NAT10, and estrogen receptor 1 (ESR1) were transfected into endplate chondrocytes using Lipofectamine 2000 (#11668019, Invitrogen, Carlsbad, CA, USA). The siRNA sequences are listed in Table 1.

Table 1

Sequences of siRNAs

Genes Sequences (5′−3′)
PINK1 siRNA Sense UUUUCUGUGUAAAAAUUGCCU
Antisense GCAAUUUUUACACAGAAAACC
NAT10 siRNA Sense AGUACAAGCGGGAAAUGGCUG
Antisense GCCAUUUCCCGCUUGUACUUC
ESR1 siRNA Sense AUUUCAUGUUGUAGAGAUGCU
Antisense CAUCUCUACAACAUGAAAUGC
siRNA NC Sense UUCUCCGAACGUGUCACGU
Antisense ACGUGACACGUUCGGAGAA

2.3 Bioinformatics analysis

A network was constructed by Cytoscape based on the HERB database (herb.ac.cn/) to analyze the correlation between STM and genes involved in mitophagy. Besides, ac4C sites in PINK1 mRNA were predicted using PACES (www.rnanut.net/paces/). Moreover, the binding sites of ESR1 in the NAT10 gene promoter were analyzed by the JASPAR database (jaspar.genereg.net/).

2.4 Real-time reverse transcription-PCR (qRT-PCR)

Total RNA from mouse endplate chondrocytes was extracted using TRIZOL reagent (#15596026, Invitrogen) followed by the synthesis of cDNA via reverse transcription by PrimeScript II 1st Strand cDNA Synthesis Kit (#6210A, Takara, Dalian, Liaoning, China). Then, qRT-PCR was performed by TB Green® Premix Ex Taq™ (Tli RNaseH Plus) (#RR420A, Takara), and the amount of target RNA was normalized to that of β-actin (internal control). Subsequently, data of qRT-PCR were given by 2−△△Ct compared to that of the control group. The primers used for qRT-PCR are listed in Table 2.

Table 2

Sequences of primers

Genes Sequences (5′−3′) Amplicon length (bp)
MMP3 Forward TGGCATTCAGTCCCTCTATGG 198
Reverse AGGACAAAGCAGGATCACAGTT
MMP13 Forward CTTTTCCTCCTGGACCAAACT 105
Reverse TCATGGGCAGCAACAATAAA
PINK1 Forward TCGCACACTGTTCCTCGTTA 204
Reverse CAGGGACAGCCATCTGAGTC
NAT10 Forward AGATGAAGCTGCCGCTATTC 193
Reverse TGTCGTTGTGGTCTTGTTCTC
ESR1 Forward GCCTAGCTCAGCTCCTTCTCA 109
Reverse AGGTCATAGAGGGGCACAACG
β-actin Forward TGTGTCCGTCGTGGATCTGA 150
Reverse TTGCTGTTGAAGTCGCAGGAG

2.5 Immunofluorescence (IF)

First, mouse endplate chondrocytes plated on the slide were incubated with 100 nM MitoTracker Red (MTR, #M7512, Invitrogen) for 30 min at 37°C. Then, endplate chondrocytes were fixed by 4% paraformaldehyde and permeabilized by phosphate-buffered saline with Tween 20 (PBST) (0.2% Triton X-100) for 30 min at room temperature (RT). After rinsing thrice for 5 min in phosphate-buffered saline (PBS), endplate chondrocytes were incubated in a blocking solution containing 1% bovine serum albumin, 5% goat serum, and 0.1% Triton X-100 in PBS for 2 h prior to the incubation with light chain 3 II (LC3II) antibody (1: 500, #ab222776, Abcam, Cambridge, UK) at 4°C overnight. Following washing six times for 10 min with PBST (0.1% Triton X-100), endplate chondrocytes were incubated with fluorescein isothiocyanate conjugated goat anti-rabbit IgG (H + L) (1: 200, # GB22303, Servicebio, Wuhan, Hubei, China) for 1 h at RT. Next, endplate chondrocytes were washed six times for 15 min in PBST and then photographed using a fluorescence microscope (DMI6000B, Leica, Wetzlar, Germany).

2.6 Western blot (WB)

Total proteins were extracted from mouse endplate chondrocytes by radioimmunoprecipitation assay buffer (#9806, Cell Signaling Technology, Danvers, MA, USA). Then, proteins were separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto a polyvinylidene fluoride membrane. Subsequently, membranes were blocked with 5% nonfat milk for 1 h at RT followed by the incubation with the indicated primary antibody overnight at 4°C. The next day membranes were washed with Tris-buffered saline containing 0.1% Tween 20 and incubated with the corresponding secondary antibody at RT for 1 h. Finally, signals of target proteins were identified by a chemiluminescence detection kit (#P0018F, Beyotime Biotechnology). The primary antibodies used for WB were matrix metallopeptidase (MMP) 3 antibody (1:1,000, #17873-1-AP, Proteintech, Wuhan, Hubei, China), MMP13 antibody (1:1,000, #18165-1-AP, Proteintech), LC3II antibody (1:1,000, #ab222776, Abcam, Cambridge, UK), Parkin antibody (1:1,000, #bs-23687R, Bioss), NAT10 antibody (1:2,000, #ab194297, Abcam), ESR1 antibody (1:1,000, #21244-1-AP, Proteintech), and β-actin (1:10,000, #bs-0061R, Bioss).

2.7 Acetylated RNA immunoprecipitation (acRIP)

Mouse endplate chondrocytes were first lysed to collect nucleic acid fragments which were then interrupted by ultrasound. Subsequently, cell lysate was incubated with ac4C antibody (1:500, #ab252215, Abcam) at 4°C overnight to enrich acetylated RNA fragments. Next, ac4C antibody combined with acetylated RNA fragments were captured using avidin magnetic beads, and the level of acetylated PINK1 mRNA was detected by qRT-PCR.

2.8 Dual-luciferase reporter gene assay

First, the wildtype (WT) NAT10 gene promoter was cloned into a luciferase reporter gene vector (pGL3). Then, we mutated the ESR1 binding sites in the WT NAT10 gene promoter to construct the luciferase reporter gene vector containing the mutated NAT10 gene promoter (MUT). Next, mouse endplate chondrocytes were co-transfected with the WT or MUT NAT10 gene promoter-luciferase reporter gene vector and siRNA against ESR1. Subsequently, endplate chondrocytes were collected at 48 h post-transfection to measure the luciferase activity using Dual-Luciferase Reporter Assay System (#E1910, Promega, Madison, WI, USA).

2.9 Statistical analyses

In the present study, quantitative data were presented as mean ± standard error of the mean (SEM), and statistical analyses were performed using SPSS (version 21.0, IBM Corp., Armonk, NY, USA). Comparisons of continuous variables between two groups were analyzed using the Student’s t test, while statistical differences among three or more groups were performed by the Kruskal–Wallis test. Besides, all statistical tests were two-sided, and P values <0.05 were considered statistically significant.

3 Results

3.1 STM attenuates endplate chondrocyte degeneration

To induce degeneration in vitro, mouse endplate chondrocytes were treated with IL-1β. Results indicated that IL-1β treatment increased protein and mRNA levels of degeneration markers, including MMP3 and MMP13, in endplate chondrocytes (Figure 1a and b). However, STM treatment declined IL-1β-induced protein and mRNA levels of MMP3 and MMP13 in a dose-dependent manner in endplate chondrocytes (Figure 1a and b). Besides, DMSO had no effect on MMP3 and MMP13 levels in endplate chondrocytes (Figure 1a and b). These data suggested that STM could alleviate endplate chondrocyte degeneration.

Figure 1 STM alleviates the degeneration of endplate chondrocytes. (a) Protein levels of MMP3 and MMP13 in mouse endplate chondrocytes treated with or without IL-1β or IL-1β plus STM. (b) mRNA levels of MMP3 and MMP13 in mouse endplate chondrocytes treated with or without IL-1β or IL-1β plus STM. STM: stigmasterol. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
Figure 1

STM alleviates the degeneration of endplate chondrocytes. (a) Protein levels of MMP3 and MMP13 in mouse endplate chondrocytes treated with or without IL-1β or IL-1β plus STM. (b) mRNA levels of MMP3 and MMP13 in mouse endplate chondrocytes treated with or without IL-1β or IL-1β plus STM. STM: stigmasterol. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

3.2 STM induces PINK1-mediated mitophagy in degenerated endplate chondrocytes

As mitophagy could attenuate IVDD through hindering the degeneration of endplate chondrocytes by preventing mitochondrial dysfunction [12,13], the effect of STM on mitophagy in degenerated endplate chondrocytes was identified. Then, a network was constructed based on the HERB database to analyze the correlation between STM and genes involved in mitophagy. It was indicated that STM should be related to PINK1, a critical factor for mitophagy [18,19] (Figure 2a). Further qRT-PCR analysis showed that IL-1β treatment decreased PINK1 expression, whereas STM treatment abolished the inhibitory effect of IL-1β treatment on PINK1 expression in endplate chondrocytes (Figure 2b). Besides, STM also increased PINK1 expression in control endplate chondrocytes (Figure 2b).

Figure 2 STM triggers PINK1-mediated mitophagy in degenerated endplate chondrocytes. (a) A network constructed based on the HERB database to analyze the correlation between STM and genes involved in mitophagy. (b) The mRNA level of PINK1 in mouse endplate chondrocytes treated with or without IL-1β or IL-1β plus STM. (c) The co-location of MTR and LC3II in mouse endplate chondrocytes treated with or without IL-1β or IL-1β plus STM. (d) Protein levels of LC3II and Parkin in mouse endplate chondrocytes treated with or without IL-1β or IL-1β plus STM. STM: stigmasterol; MTR: MitoTracker Red. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.
Figure 2

STM triggers PINK1-mediated mitophagy in degenerated endplate chondrocytes. (a) A network constructed based on the HERB database to analyze the correlation between STM and genes involved in mitophagy. (b) The mRNA level of PINK1 in mouse endplate chondrocytes treated with or without IL-1β or IL-1β plus STM. (c) The co-location of MTR and LC3II in mouse endplate chondrocytes treated with or without IL-1β or IL-1β plus STM. (d) Protein levels of LC3II and Parkin in mouse endplate chondrocytes treated with or without IL-1β or IL-1β plus STM. STM: stigmasterol; MTR: MitoTracker Red. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Next, endplate chondrocytes were stained by mitochondrial marker MTR and autophagy marker LC3II via IF. Results of IF revealed that IL-1β treatment decreased the co-location of MTR and LC3II, while STM treatment enhanced the co-location of MTR and LC3II in endplate chondrocytes treated with IL-1β (Figure 2c). However, the silence of PINK1 by siRNA (Figure S1a) diminished the effect of STM treatment on the co-location of MTR and LC3II in endplate chondrocytes treated with IL-1β (Figure 2c). Similarly, WB results demonstrated that IL-1β treatment reduced the levels of mitophagy marker Parkin and LC3II, while STM treatment increased the levels of Parkin and LC3II in endplate chondrocytes treated with IL-1β (Figure 2d). Moreover, PINK1 silence neutralized the effect of STM treatment on the levels of Parkin and LC3II in endplate chondrocytes treated with IL-1β (Figure 2d). The above results suggested that STM could induce PINK1-mediated mitophagy in degenerated endplate chondrocytes.

3.3 NAT10 increases PINK1 expression by RNA acetylation in endplate chondrocytes

In addition, the mechanism of how STM increased PINK1 expression in endplate chondrocytes was explored. Bioinformatics analysis found a potential ac4C site in PINK1 mRNA (Figure 3a). Besides, the silence of NAT10 by siRNA (Figure S1b) declined the PINK1 mRNA level, while siRNA NC had no effect on the PINK1 mRNA level in endplate chondrocytes (Figure 3b). Moreover, acRIP results indicated that NAT10 silence reduced the PINK1 mRNA acetylation level (Figure 3c). All these results suggested that NAT10 increased PINK1 expression by improving PINK1 mRNA acetylation in endplate chondrocytes.

Figure 3 NAT10 elevates PINK1 expression by regulating RNA acetylation in endplate chondrocytes. (a) The potential ac4C site in PINK1 mRNA. (b) The mRNA level of PINK1 in mouse endplate chondrocytes treated with or without NAT10 siRNA. (c) The ac4C level of PINK1 mRNA detected by acRIP in mouse endplate chondrocytes treated with or without NAT10 siRNA. NC: negative control. *P < 0.05, ****P < 0.0001.
Figure 3

NAT10 elevates PINK1 expression by regulating RNA acetylation in endplate chondrocytes. (a) The potential ac4C site in PINK1 mRNA. (b) The mRNA level of PINK1 in mouse endplate chondrocytes treated with or without NAT10 siRNA. (c) The ac4C level of PINK1 mRNA detected by acRIP in mouse endplate chondrocytes treated with or without NAT10 siRNA. NC: negative control. *P < 0.05, ****P < 0.0001.

3.4 STM regulates NAT10 expression by ESR1 in degenerated endplate chondrocytes

Next, the mechanism modifying NAT10 expression in degenerated endplate chondrocytes was further determined. Bioinformatics analysis using the JASPAR database found potential ESR1 binding sites in the NAT10 gene promoter (Figure 4a). Besides, qRT-PCR results showed that silence of ESR1 by siRNA (Figure S1c) decreased NAT10 mRNA and protein levels, but siRNA NC had no effect on NAT10 mRNA and protein levels in endplate chondrocytes (Figure 4b and c). Moreover, a dual-luciferase reporter gene assay revealed that ESR1 silence reduced WT NAT10 gene promoter activity, whereas it had no effect on that of the MUT NAT10 gene promoter containing mutated ESR1 binding sites (Figure 4d). These results suggested that ESR1 could enhance the transcription of the NAT10 gene in endplate chondrocytes.

Figure 4 ESR1 promotes NAT10 gene transcription in endplate chondrocytes. (a) The potential ESR1 binding sites in NAT10 gene promoter. (b) The mRNA level of NAT10 in mouse endplate chondrocytes treated with or without ESR1 siRNA. (c) The protein level of NAT10 in mouse endplate chondrocytes treated with or without ESR1 siRNA. (d) The transcription activity of WT or MUT NAT10 gene promoter was analyzed by relative luciferase reporter activity assay in mouse endplate chondrocytes treated with or without ESR1 siRNA. NC: negative control. **P < 0.01, ****P < 0.0001.
Figure 4

ESR1 promotes NAT10 gene transcription in endplate chondrocytes. (a) The potential ESR1 binding sites in NAT10 gene promoter. (b) The mRNA level of NAT10 in mouse endplate chondrocytes treated with or without ESR1 siRNA. (c) The protein level of NAT10 in mouse endplate chondrocytes treated with or without ESR1 siRNA. (d) The transcription activity of WT or MUT NAT10 gene promoter was analyzed by relative luciferase reporter activity assay in mouse endplate chondrocytes treated with or without ESR1 siRNA. NC: negative control. **P < 0.01, ****P < 0.0001.

The network constructed to analyze the correlation between STM and genes involved in mitophagy indicated that ESR1 should be associated with STM (Figure 2a). Therefore, the effect of STM on ESR1 was investigated. Results of qRT-PCR indicated that IL-1β treatment decreased the ESR1 mRNA level, while STM treatment restored the IL-1β-reduced ESR1 mRNA level in endplate chondrocytes (Figure 5a). Besides, STM also increased the ESR1 mRNA level in control endplate chondrocytes (Figure 5a). Similarly, WB results found that IL-1β treatment reduced the ESR1 protein level, whereas STM treatment increased the ESR1 protein level in endplate chondrocytes treated with IL-1β (Figure 5b). Moreover, STM treatment neutralized the effect of IL-1β treatment on the ESR1 protein level in endplate chondrocytes (Figure 5b). In addition, STM also increased the ESR1 protein level in control endplate chondrocytes (Figure 5b). All these data together suggested that STM regulated NAT10 expression by ESR1 in degenerated endplate chondrocytes.

Figure 5 STM increases NAT10 expression by ESR1 in degenerated endplate chondrocytes. (a) The mRNA level of ESR1 in mouse endplate chondrocytes treated with or without IL-1β or IL-1β plus STM. (b) ESR1 protein level in mouse endplate chondrocytes treated with or without IL-1β or IL-1β plus STM. STM: stigmasterol. *P < 0.05, **P < 0.01.
Figure 5

STM increases NAT10 expression by ESR1 in degenerated endplate chondrocytes. (a) The mRNA level of ESR1 in mouse endplate chondrocytes treated with or without IL-1β or IL-1β plus STM. (b) ESR1 protein level in mouse endplate chondrocytes treated with or without IL-1β or IL-1β plus STM. STM: stigmasterol. *P < 0.05, **P < 0.01.

4 Discussion

This study revealed that STM alleviated endplate chondrocyte degeneration. Besides, STM induced PINK1-mediated mitophagy in degenerated endplate chondrocytes. Moreover, NAT10 increased PINK1 expression by improving PINK1 mRNA acetylation in endplate chondrocytes. In addition, STM regulated NAT10 expression by ESR1 in degenerated endplate chondrocytes (Figure 6).

Figure 6 Schematic diagram of regulatory mechanisms for this study. This study revealed that STM alleviated endplate chondrocyte degeneration. Besides, STM induced PINK1-mediated mitophagy in degenerated endplate chondrocytes. Moreover, NAT10 increased PINK1 expression by improving PINK1 mRNA acetylation in endplate chondrocytes. In addition, STM regulated NAT10 expression by ESR1 in degenerated endplate chondrocytes.
Figure 6

Schematic diagram of regulatory mechanisms for this study. This study revealed that STM alleviated endplate chondrocyte degeneration. Besides, STM induced PINK1-mediated mitophagy in degenerated endplate chondrocytes. Moreover, NAT10 increased PINK1 expression by improving PINK1 mRNA acetylation in endplate chondrocytes. In addition, STM regulated NAT10 expression by ESR1 in degenerated endplate chondrocytes.

Several studies have revealed the protective role of STM in chondrocytes. For instance, STM attenuates IL-1β-induced injuries by suppressing ferroptosis in mouse chondrocytes ATDC5 cells [20]. Besides, STM alleviates injuries of rat articular chondrocytes in osteoarthritis by negating IL-1β-induced inflammation [21]. However, the effect of STM on endplate chondrocytes in IVDD has not been reported. Thus, the current study uncovered the effect of STM on endplate chondrocytes in IVDD for the first time.

To date, only two studies have indicated the effect of STM on mitophagy [14,15]. Nevertheless, previous studies have not investigated the mechanism of STM regulating mitophagy. This study revealed that STM induced mitophagy by increasing PINK1 expression via improving PINK1 mRNA acetylation in endplate chondrocytes. Growing evidence has uncovered that ac4C RNA acetylation regulates RNA expression [17,22]. However, the role of ac4C RNA acetylation in PINK1 mRNA expression has not been reported. Therefore, our findings indicated that STM induced mitophagy by enhancing PINK1 mRNA acetylation in endplate chondrocytes for the first time.

This study found that NAT10 elevated the PINK1 mRNA level by enhancing PINK1 mRNA acetylation in endplate chondrocytes. NAT10-mediated acetylation could increase RNA levels by improving its stability. For example, NAT10 increases the notch receptor 3 (NOTCH3) mRNA level by improving mRNA stability via acetylation in cancers [23]. Besides, NAT10 stabilizes AHNAK nucleoprotein (AHNAK) mRNA to increase the AHNAK mRNA level by protecting it against exonucleases [24]. Therefore, NAT10 should increase the PINK1 mRNA level by improving its stability via acetylation in endplate chondrocytes. In addition, the role of NAT10-mediated RNA acetylation in mitophagy has not been investigated, which was explored for the first time in the present study.

A previous study has demonstrated that ESR1 could induce mitophagy by suppressing DNA damage inducible transcript 3 (DDIT3/CHOP) and OMA1 zinc metallopeptidase (OMA1) transcription as a transcription factor in pancreatic β-cells [25]. By contrast, ESR1 might induce mitophagy in mouse muscle [26]. Our findings also indicated that ESR1 should enhance NAT10 transcription to trigger mitophagy in degenerated endplate chondrocytes, the first to uncover the regulatory role of ESR1 in NAT10. All these studies together suggest that ESR1 should exert opposite effects on mitophagy in different cells.

However, there were still several limitations of this study. For example, the current study could be strengthened by determining the functional relevance of RNA acetylation and NAT10 to mitophagy and degeneration of endplate chondrocytes. Besides, the findings of this study should be further confirmed by in vivo experiments.

5 Conclusion

In summary, the current study indicated that STM attenuated endplate chondrocyte degeneration through inducing mitophagy by enhancing PINK1 mRNA acetylation via the ESR1/NAT10 axis. These findings would provide novel strategies for the treatment of IVDD.

# These authors contributed equally to this work.

  1. Funding information: This work was supported by Key medical disciplines in Panyu District (2022-2024) and Panyu District Science and Technology Programme General medical and health project (2020-Z04-011).

  2. Author contributions: H.L., X.F.C., and L.X.Z. conceived and designed the experiments; H.L., X.F.C., B.C.H., J.J.H., J.X.X., W.J.G., J.J.L., J.J.R., J.C.L., and Z.X. performed the experiments, analyzed the data, prepared figures, and tables; H.L., X.F.C., and L.X.Z. wrote and approved the final draft.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Roh EJ, Darai A, Kyung JW, Choi H, Kwon SY, Bhujel B, et al. Genetic therapy for intervertebral disc degeneration. Int J Mol Sci. 2021;22(4):1579.10.3390/ijms22041579Search in Google Scholar PubMed PubMed Central

[2] Francisco V, Pino J, González-Gay M, Lago F, Karppinen J, Tervonen O, et al. A new immunometabolic perspective of intervertebral disc degeneration. Nat Rev Rheumatol. 2022;18(1):47–60.10.1038/s41584-021-00713-zSearch in Google Scholar PubMed

[3] Li L, He J, Zhang G, Chen H, Luo Z, Deng B, et al. Role of caspase family in intervertebral disc degeneration and its therapeutic prospects. Biomolecules. 2022;12(8):1074.10.3390/biom12081074Search in Google Scholar PubMed PubMed Central

[4] Kang L, Zhang H, Jia C, Zhang R, Shen C. Epigenetic modifications of inflammation in intervertebral disc degeneration. Ageing Res Rev. 2023;87:101902.10.1016/j.arr.2023.101902Search in Google Scholar PubMed

[5] Clouet J, Fusellier M, Camus A, Le Visage C, Guicheux J. Intervertebral disc regeneration: From cell therapy to the development of novel bioinspired endogenous repair strategies. Adv Drug Delivery Rev. 2019;146:306–24.10.1016/j.addr.2018.04.017Search in Google Scholar PubMed

[6] Xin J, Wang Y, Zheng Z, Wang S, Na S, Zhang S. Treatment of intervertebral disc degeneration. Orthop Surg. 2022;14(7):1271–80.10.1111/os.13254Search in Google Scholar PubMed PubMed Central

[7] Sun K, Jing X, Guo J, Yao X, Guo F. Mitophagy in degenerative joint diseases. Autophagy. 2021;17(9):2082–92.10.1080/15548627.2020.1822097Search in Google Scholar PubMed PubMed Central

[8] Kang L, Liu S, Li J, Tian Y, Xue Y, Liu X. Parkin and Nrf2 prevent oxidative stress-induced apoptosis in intervertebral endplate chondrocytes via inducing mitophagy and anti-oxidant defenses. Life Sci. 2020;243:117244.10.1016/j.lfs.2019.117244Search in Google Scholar PubMed

[9] Wang G, Huang K, Dong Y, Chen S, Zhang J, Wang J, et al. Lycorine suppresses endplate-chondrocyte degeneration and prevents intervertebral disc degeneration by inhibiting NF-kappaB signalling pathway. Cell Physiol Biochem. 2018;45(3):1252–69.10.1159/000487457Search in Google Scholar PubMed

[10] Wang DK, Zheng HL, Zhou WS, Duan ZW, Jiang SD, Li B, et al. Mitochondrial dysfunction in oxidative stress-mediated intervertebral disc degeneration. Orthop Surg. 2022;14(8):1569–82.10.1111/os.13302Search in Google Scholar PubMed PubMed Central

[11] Zhang F, Wang S, Gao M, Li B, He Z, Tang T, et al. Hyaluronic acid ameliorates intervertebral disc degeneration via promoting mitophagy activation. Front Bioeng Biotechnol. 2022;10:1057429.10.3389/fbioe.2022.1057429Search in Google Scholar PubMed PubMed Central

[12] Shao Y, Sun L, Yang G, Wang W, Liu X, Du T, et al. Icariin protects vertebral endplate chondrocytes against apoptosis and degeneration via activating Nrf-2/HO-1 pathway. Front Pharmacology. 2022;13:937502.10.3389/fphar.2022.937502Search in Google Scholar PubMed PubMed Central

[13] Zheng Q, Wang CD, Shao S, Wu MF, Dou QB, Wang QW, et al. Intermittent cyclic mechanical compression promotes endplate chondrocytes degeneration by disturbing Nrf2/PINK1 signaling pathway-dependent mitophagy. Hum Cell. 2023;36(6):1978–90.10.1007/s13577-023-00959-7Search in Google Scholar PubMed

[14] Haque MN, Hannan MA, Dash R, Choi SM, Moon IS. The potential LXRβ agonist stigmasterol protects against hypoxia/reoxygenation injury by modulating mitophagy in primary hippocampal neurons. Phytomedicine. 2021;81:153415.10.1016/j.phymed.2020.153415Search in Google Scholar PubMed

[15] Mongkolpobsin K, Sillapachaiyaporn C, Nilkhet S, Tencomnao T, Baek SJ. Stigmasterol isolated from Azadirachta indica flowers attenuated glutamate-induced neurotoxicity via downregulation of the Cdk5/p35/p25 signaling pathway in the HT-22 cells. Phytomedicine. 2023;113:154728.10.1016/j.phymed.2023.154728Search in Google Scholar PubMed

[16] Yang W, Li HY, Wu YF, Mi RJ, Liu WZ, Shen X, et al. ac4C acetylation of RUNX2 catalyzed by NAT10 spurs osteogenesis of BMSCs and prevents ovariectomy-induced bone loss. Mol Ther Nucleic Acids. 2021;26:135–47.10.1016/j.omtn.2021.06.022Search in Google Scholar PubMed PubMed Central

[17] Luo J, Cao J, Chen C, Xie H. Emerging role of RNA acetylation modification ac4C in diseases: Current advances and future challenges. Biochem Pharmacol. 2023;213:115628.10.1016/j.bcp.2023.115628Search in Google Scholar PubMed

[18] Gong Y, Tang N, Liu P, Sun Y, Lu S, Liu W, et al. Newcastle disease virus degrades SIRT3 via PINK1-PRKN-dependent mitophagy to reprogram energy metabolism in infected cells. Autophagy. 2022;18(7):1503–21.10.1080/15548627.2021.1990515Search in Google Scholar PubMed PubMed Central

[19] Lazarou M, Sliter DA, Kane LA, Sarraf SA, Wang C, Burman JL, et al. The ubiquitin kinase PINK1 recruits autophagy receptors to induce mitophagy. Nature. 2015;524(7565):309–14.10.1038/nature14893Search in Google Scholar PubMed PubMed Central

[20] Mo Z, Xu P, Li H. Stigmasterol alleviates interleukin-1beta-induced chondrocyte injury by down-regulating sterol regulatory element binding transcription factor 2 to regulate ferroptosis. Bioengineered. 2021;12(2):9332–40.10.1080/21655979.2021.2000742Search in Google Scholar PubMed PubMed Central

[21] Sampath SJP, Rath SN, Kotikalapudi N, Venkatesan V. Beneficial effects of secretome derived from mesenchymal stem cells with stigmasterol to negate IL-1β-induced inflammation in-vitro using rat chondrocytes-OA management. Inflammopharmacology. 2021;29(6):1701–17.10.1007/s10787-021-00874-zSearch in Google Scholar PubMed

[22] Shi J, Yang C, Zhang J, Zhao K, Li P, Kong C, et al. NAT10 is involved in cardiac remodeling through ac4C-mediated transcriptomic regulation. Circ Res. 2023;133(12):989–1002.10.1161/CIRCRESAHA.122.322244Search in Google Scholar PubMed

[23] Liao L, He Y, Li SJ, Yu XM, Liu ZC, Liang YY, et al. Lysine 2-hydroxyisobutyrylation of NAT10 promotes cancer metastasis in an ac4C-dependent manner. Cell Res. 2023;33(5):355–71.10.1038/s41422-023-00793-4Search in Google Scholar PubMed PubMed Central

[24] Xie R, Cheng L, Huang M, Huang L, Chen Z, Zhang Q, et al. NAT10 drives cisplatin chemoresistance by enhancing ac4C-associated DNA repair in bladder cancer. Cancer Res. 2023;83(10):1666–83.10.1158/0008-5472.CAN-22-2233Search in Google Scholar PubMed

[25] Zhou Z, Ribas V, Rajbhandari P, Drew BG, Moore TM, Fluitt AH, et al. Estrogen receptor α protects pancreatic β-cells from apoptosis by preserving mitochondrial function and suppressing endoplasmic reticulum stress. J Biol Chem. 2018;293(13):4735–51.10.1074/jbc.M117.805069Search in Google Scholar PubMed PubMed Central

[26] Ahuja P, Ng CF, Pang BPS, Chan WS, Tse MCL, Bi X, et al. Muscle-generated BDNF (brain derived neurotrophic factor) maintains mitochondrial quality control in female mice. Autophagy. 2022;18(6):1367–84.10.1080/15548627.2021.1985257Search in Google Scholar PubMed PubMed Central

Received: 2024-04-26
Revised: 2024-06-07
Accepted: 2024-06-10
Published Online: 2025-04-08

© 2025 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Mechanism of triptolide regulating proliferation and apoptosis of hepatoma cells by inhibiting JAK/STAT pathway
  3. Maslinic acid improves mitochondrial function and inhibits oxidative stress and autophagy in human gastric smooth muscle cells
  4. Comparative analysis of inflammatory biomarkers for the diagnosis of neonatal sepsis: IL-6, IL-8, SAA, CRP, and PCT
  5. Post-pandemic insights on COVID-19 and premature ovarian insufficiency
  6. Proteome differences of dental stem cells between permanent and deciduous teeth by data-independent acquisition proteomics
  7. Optimizing a modified cetyltrimethylammonium bromide protocol for fungal DNA extraction: Insights from multilocus gene amplification
  8. Preliminary analysis of the role of small hepatitis B surface proteins mutations in the pathogenesis of occult hepatitis B infection via the endoplasmic reticulum stress-induced UPR-ERAD pathway
  9. Efficacy of alginate-coated gold nanoparticles against antibiotics-resistant Staphylococcus and Streptococcus pathogens of acne origins
  10. Battling COVID-19 leveraging nanobiotechnology: Gold and silver nanoparticle–B-escin conjugates as SARS-CoV-2 inhibitors
  11. Neurodegenerative diseases and neuroinflammation-induced apoptosis
  12. Impact of fracture fixation surgery on cognitive function and the gut microbiota in mice with a history of stroke
  13. COLEC10: A potential tumor suppressor and prognostic biomarker in hepatocellular carcinoma through modulation of EMT and PI3K-AKT pathways
  14. High-temperature requirement serine protease A2 inhibitor UCF-101 ameliorates damaged neurons in traumatic brain-injured rats by the AMPK/NF-κB pathway
  15. SIK1 inhibits IL-1β-stimulated cartilage apoptosis and inflammation in vitro through the CRTC2/CREB1 signaling
  16. Rutin–chitooligosaccharide complex: Comprehensive evaluation of its anti-inflammatory and analgesic properties in vitro and in vivo
  17. Knockdown of Aurora kinase B alleviates high glucose-triggered trophoblast cells damage and inflammation during gestational diabetes
  18. Calcium-sensing receptors promoted Homer1 expression and osteogenic differentiation in bone marrow mesenchymal stem cells
  19. ABI3BP can inhibit the proliferation, invasion, and epithelial–mesenchymal transition of non-small-cell lung cancer cells
  20. Changes in blood glucose and metabolism in hyperuricemia mice
  21. Rapid detection of the GJB2 c.235delC mutation based on CRISPR-Cas13a combined with lateral flow dipstick
  22. IL-11 promotes Ang II-induced autophagy inhibition and mitochondrial dysfunction in atrial fibroblasts
  23. Short-chain fatty acid attenuates intestinal inflammation by regulation of gut microbial composition in antibiotic-associated diarrhea
  24. Application of metagenomic next-generation sequencing in the diagnosis of pathogens in patients with diabetes complicated by community-acquired pneumonia
  25. NAT10 promotes radiotherapy resistance in non-small cell lung cancer by regulating KPNB1-mediated PD-L1 nuclear translocation
  26. Phytol-mixed micelles alleviate dexamethasone-induced osteoporosis in zebrafish: Activation of the MMP3–OPN–MAPK pathway-mediating bone remodeling
  27. Association between TGF-β1 and β-catenin expression in the vaginal wall of patients with pelvic organ prolapse
  28. Primary pleomorphic liposarcoma involving bilateral ovaries: Case report and literature review
  29. Effects of de novo donor-specific Class I and II antibodies on graft outcomes after liver transplantation: A pilot cohort study
  30. Sleep architecture in Alzheimer’s disease continuum: The deep sleep question
  31. Ephedra fragilis plant extract: A groundbreaking corrosion inhibitor for mild steel in acidic environments – electrochemical, EDX, DFT, and Monte Carlo studies
  32. Langerhans cell histiocytosis in an adult patient with upper jaw and pulmonary involvement: A case report
  33. Inhibition of mast cell activation by Jaranol-targeted Pirin ameliorates allergic responses in mouse allergic rhinitis
  34. Aeromonas veronii-induced septic arthritis of the hip in a child with acute lymphoblastic leukemia
  35. Clusterin activates the heat shock response via the PI3K/Akt pathway to protect cardiomyocytes from high-temperature-induced apoptosis
  36. Research progress on fecal microbiota transplantation in tumor prevention and treatment
  37. Low-pressure exposure influences the development of HAPE
  38. Stigmasterol alleviates endplate chondrocyte degeneration through inducing mitophagy by enhancing PINK1 mRNA acetylation via the ESR1/NAT10 axis
  39. AKAP12, mediated by transcription factor 21, inhibits cell proliferation, metastasis, and glycolysis in lung squamous cell carcinoma
  40. Association between PAX9 or MSX1 gene polymorphism and tooth agenesis risk: A meta-analysis
  41. A case of bloodstream infection caused by Neisseria gonorrhoeae
  42. Case of nasopharyngeal tuberculosis complicated with cervical lymph node and pulmonary tuberculosis
  43. p-Cymene inhibits pro-fibrotic and inflammatory mediators to prevent hepatic dysfunction
  44. GFPT2 promotes paclitaxel resistance in epithelial ovarian cancer cells via activating NF-κB signaling pathway
  45. Transfer RNA-derived fragment tRF-36 modulates varicose vein progression via human vascular smooth muscle cell Notch signaling
  46. RTA-408 attenuates the hepatic ischemia reperfusion injury in mice possibly by activating the Nrf2/HO-1 signaling pathway
  47. Decreased serum TIMP4 levels in patients with rheumatoid arthritis
  48. Sirt1 protects lupus nephritis by inhibiting the NLRP3 signaling pathway in human glomerular mesangial cells
  49. Sodium butyrate aids brain injury repair in neonatal rats
  50. Interaction of MTHFR polymorphism with PAX1 methylation in cervical cancer
  51. Convallatoxin inhibits proliferation and angiogenesis of glioma cells via regulating JAK/STAT3 pathway
  52. The effect of the PKR inhibitor, 2-aminopurine, on the replication of influenza A virus, and segment 8 mRNA splicing
  53. Effects of Ire1 gene on virulence and pathogenicity of Candida albicans
  54. Small cell lung cancer with small intestinal metastasis: Case report and literature review
  55. GRB14: A prognostic biomarker driving tumor progression in gastric cancer through the PI3K/AKT signaling pathway by interacting with COBLL1
  56. 15-Lipoxygenase-2 deficiency induces foam cell formation that can be restored by salidroside through the inhibition of arachidonic acid effects
  57. FTO alleviated the diabetic nephropathy progression by regulating the N6-methyladenosine levels of DACT1
  58. Clinical relevance of inflammatory markers in the evaluation of severity of ulcerative colitis: A retrospective study
  59. Zinc valproic acid complex promotes osteoblast differentiation and exhibits anti-osteoporotic potential
  60. Primary pulmonary synovial sarcoma in the bronchial cavity: A case report
  61. Metagenomic next-generation sequencing of alveolar lavage fluid improves the detection of pulmonary infection
  62. Uterine tumor resembling ovarian sex cord tumor with extensive rhabdoid differentiation: A case report
  63. Genomic analysis of a novel ST11(PR34365) Clostridioides difficile strain isolated from the human fecal of a CDI patient in Guizhou, China
  64. Effects of tiered cardiac rehabilitation on CRP, TNF-α, and physical endurance in older adults with coronary heart disease
  65. Changes in T-lymphocyte subpopulations in patients with colorectal cancer before and after acupoint catgut embedding acupuncture observation
  66. Modulating the tumor microenvironment: The role of traditional Chinese medicine in improving lung cancer treatment
  67. Alterations of metabolites related to microbiota–gut–brain axis in plasma of colon cancer, esophageal cancer, stomach cancer, and lung cancer patients
  68. Research on individualized drug sensitivity detection technology based on bio-3D printing technology for precision treatment of gastrointestinal stromal tumors
  69. CEBPB promotes ulcerative colitis-associated colorectal cancer by stimulating tumor growth and activating the NF-κB/STAT3 signaling pathway
  70. Oncolytic bacteria: A revolutionary approach to cancer therapy
  71. A de novo meningioma with rapid growth: A possible malignancy imposter?
  72. Diagnosis of secondary tuberculosis infection in an asymptomatic elderly with cancer using next-generation sequencing: Case report
  73. Hesperidin and its zinc(ii) complex enhance osteoblast differentiation and bone formation: In vitro and in vivo evaluations
  74. Research progress on the regulation of autophagy in cardiovascular diseases by chemokines
  75. Anti-arthritic, immunomodulatory, and inflammatory regulation by the benzimidazole derivative BMZ-AD: Insights from an FCA-induced rat model
  76. Immunoassay for pyruvate kinase M1/2 as an Alzheimer’s biomarker in CSF
  77. The role of HDAC11 in age-related hearing loss: Mechanisms and therapeutic implications
  78. Evaluation and application analysis of animal models of PIPNP based on data mining
  79. Therapeutic approaches for liver fibrosis/cirrhosis by targeting pyroptosis
  80. Fabrication of zinc oxide nanoparticles using Ruellia tuberosa leaf extract induces apoptosis through P53 and STAT3 signalling pathways in prostate cancer cells
  81. Haplo-hematopoietic stem cell transplantation and immunoradiotherapy for severe aplastic anemia complicated with nasopharyngeal carcinoma: A case report
  82. Modulation of the KEAP1-NRF2 pathway by Erianin: A novel approach to reduce psoriasiform inflammation and inflammatory signaling
  83. The expression of epidermal growth factor receptor 2 and its relationship with tumor-infiltrating lymphocytes and clinical pathological features in breast cancer patients
  84. Innovations in MALDI-TOF Mass Spectrometry: Bridging modern diagnostics and historical insights
  85. BAP1 complexes with YY1 and RBBP7 and its downstream targets in ccRCC cells
  86. Hypereosinophilic syndrome with elevated IgG4 and T-cell clonality: A report of two cases
  87. Electroacupuncture alleviates sciatic nerve injury in sciatica rats by regulating BDNF and NGF levels, myelin sheath degradation, and autophagy
  88. Polydatin prevents cholesterol gallstone formation by regulating cholesterol metabolism via PPAR-γ signaling
  89. RNF144A and RNF144B: Important molecules for health
  90. Analysis of the detection rate and related factors of thyroid nodules in the healthy population
  91. Artesunate inhibits hepatocellular carcinoma cell migration and invasion through OGA-mediated O-GlcNAcylation of ZEB1
  92. Endovascular management of post-pancreatectomy hemorrhage caused by a hepatic artery pseudoaneurysm: Case report and review of the literature
  93. Efficacy and safety of anti-PD-1/PD-L1 antibodies in patients with relapsed refractory diffuse large B-cell lymphoma: A meta-analysis
  94. SATB2 promotes humeral fracture healing in rats by activating the PI3K/AKT pathway
  95. Overexpression of the ferroptosis-related gene, NFS1, corresponds to gastric cancer growth and tumor immune infiltration
  96. Understanding risk factors and prognosis in diabetic foot ulcers
  97. Atractylenolide I alleviates the experimental allergic response in mice by suppressing TLR4/NF-kB/NLRP3 signalling
  98. FBXO31 inhibits the stemness characteristics of CD147 (+) melanoma stem cells
  99. Immune molecule diagnostics in colorectal cancer: CCL2 and CXCL11
  100. Inhibiting CXCR6 promotes senescence of activated hepatic stellate cells with limited proinflammatory SASP to attenuate hepatic fibrosis
  101. Cadmium toxicity, health risk and its remediation using low-cost biochar adsorbents
  102. Pulmonary cryptococcosis with headache as the first presentation: A case report
  103. Solitary pulmonary metastasis with cystic airspaces in colon cancer: A rare case report
  104. RUNX1 promotes denervation-induced muscle atrophy by activating the JUNB/NF-κB pathway and driving M1 macrophage polarization
  105. Morphometric analysis and immunobiological investigation of Indigofera oblongifolia on the infected lung with Plasmodium chabaudi
  106. The NuA4/TIP60 histone-modifying complex and Hr78 modulate the Lobe2 mutant eye phenotype
  107. Experimental study on salmon demineralized bone matrix loaded with recombinant human bone morphogenetic protein-2: In vitro and in vivo study
  108. A case of IgA nephropathy treated with a combination of telitacicept and half-dose glucocorticoids
  109. Analgesic and toxicological evaluation of cannabidiol-rich Moroccan Cannabis sativa L. (Khardala variety) extract: Evidence from an in vivo and in silico study
  110. Wound healing and signaling pathways
  111. Combination of immunotherapy and whole-brain radiotherapy on prognosis of patients with multiple brain metastases: A retrospective cohort study
  112. To explore the relationship between endometrial hyperemia and polycystic ovary syndrome
  113. Research progress on the impact of curcumin on immune responses in breast cancer
  114. Biogenic Cu/Ni nanotherapeutics from Descurainia sophia (L.) Webb ex Prantl seeds for the treatment of lung cancer
  115. Dapagliflozin attenuates atrial fibrosis via the HMGB1/RAGE pathway in atrial fibrillation rats
  116. Glycitein alleviates inflammation and apoptosis in keratinocytes via ROS-associated PI3K–Akt signalling pathway
  117. ADH5 inhibits proliferation but promotes EMT in non-small cell lung cancer cell through activating Smad2/Smad3
  118. Apoptotic efficacies of AgNPs formulated by Syzygium aromaticum leaf extract on 32D-FLT3-ITD human leukemia cell line with PI3K/AKT/mTOR signaling pathway
  119. Novel cuproptosis-related genes C1QBP and PFKP identified as prognostic and therapeutic targets in lung adenocarcinoma
  120. Bee venom promotes exosome secretion and alters miRNA cargo in T cells
  121. Treatment of pure red cell aplasia in a chronic kidney disease patient with roxadustat: A case report
  122. Comparative bioinformatics analysis of the Wnt pathway in breast cancer: Selection of novel biomarker panels associated with ER status
  123. Kynurenine facilitates renal cell carcinoma progression by suppressing M2 macrophage pyroptosis through inhibition of CASP1 cleavage
  124. RFX5 promotes the growth, motility, and inhibits apoptosis of gastric adenocarcinoma cells through the SIRT1/AMPK axis
  125. ALKBH5 exacerbates early cardiac damage after radiotherapy for breast cancer via m6A demethylation of TLR4
  126. Phytochemicals of Roman chamomile: Antioxidant, anti-aging, and whitening activities of distillation residues
  127. Circadian gene Cry1 inhibits the tumorigenicity of hepatocellular carcinoma by the BAX/BCL2-mediated apoptosis pathway
  128. The TNFR-RIPK1/RIPK3 signalling pathway mediates the effect of lanthanum on necroptosis of nerve cells
  129. Longitudinal monitoring of autoantibody dynamics in patients with early-stage non-small-cell lung cancer undergoing surgery
  130. The potential role of rutin, a flavonoid, in the management of cancer through modulation of cell signaling pathways
  131. Construction of pectinase gene engineering microbe and its application in tobacco sheets
  132. Construction of a microbial abundance prognostic scoring model based on intratumoral microbial data for predicting the prognosis of lung squamous cell carcinoma
  133. Sepsis complicated by haemophagocytic lymphohistiocytosis triggered by methicillin-resistant Staphylococcus aureus and human herpesvirus 8 in an immunocompromised elderly patient: A case report
  134. Sarcopenia in liver transplantation: A comprehensive bibliometric study of current research trends and future directions
  135. Advances in cancer immunotherapy and future directions in personalized medicine
  136. Can coronavirus disease 2019 affect male fertility or cause spontaneous abortion? A two-sample Mendelian randomization analysis
  137. Heat stroke associated with novel leukaemia inhibitory factor receptor gene variant in a Chinese infant
  138. PSME2 exacerbates ulcerative colitis by disrupting intestinal barrier function and promoting autophagy-dependent inflammation
  139. Hyperosmolar hyperglycemic state with severe hypernatremia coexisting with central diabetes insipidus: A case report and literature review
  140. Efficacy and mechanism of escin in improving the tissue microenvironment of blood vessel walls via anti-inflammatory and anticoagulant effects: Implications for clinical practice
  141. Merkel cell carcinoma: Clinicopathological analysis of three patients and literature review
  142. Genetic variants in VWF exon 26 and their implications for type 1 Von Willebrand disease in a Saudi Arabian population
  143. Lipoxin A4 improves myocardial ischemia/reperfusion injury through the Notch1-Nrf2 signaling pathway
  144. High levels of EPHB2 expression predict a poor prognosis and promote tumor progression in endometrial cancer
  145. Knockdown of SHP-2 delays renal tubular epithelial cell injury in diabetic nephropathy by inhibiting NLRP3 inflammasome-mediated pyroptosis
  146. Exploring the toxicity mechanisms and detoxification methods of Rhizoma Paridis
  147. Concomitant gastric carcinoma and primary hepatic angiosarcoma in a patient: A case report
  148. Ecology and Environmental Science
  149. Optimization and comparative study of Bacillus consortia for cellulolytic potential and cellulase enzyme activity
  150. The complete mitochondrial genome analysis of Haemaphysalis hystricis Supino, 1897 (Ixodida: Ixodidae) and its phylogenetic implications
  151. Epidemiological characteristics and risk factors analysis of multidrug-resistant tuberculosis among tuberculosis population in Huzhou City, Eastern China
  152. Indices of human impacts on landscapes: How do they reflect the proportions of natural habitats?
  153. Genetic analysis of the Siberian flying squirrel population in the northern Changbai Mountains, Northeast China: Insights into population status and conservation
  154. Diversity and environmental drivers of Suillus communities in Pinus sylvestris var. mongolica forests of Inner Mongolia
  155. Global assessment of the fate of nitrogen deposition in forest ecosystems: Insights from 15N tracer studies
  156. Fungal and bacterial pathogenic co-infections mainly lead to the assembly of microbial community in tobacco stems
  157. Influencing of coal industry related airborne particulate matter on ocular surface tear film injury and inflammatory factor expression in Sprague-Dawley rats
  158. Temperature-dependent development, predation, and life table of Sphaerophoria macrogaster (Thomson) (Diptera: Syrphidae) feeding on Myzus persicae (Sulzer) (Homoptera: Aphididae)
  159. Eleonora’s falcon trophic interactions with insects within its breeding range: A systematic review
  160. Agriculture
  161. Integrated analysis of transcriptome, sRNAome, and degradome involved in the drought-response of maize Zhengdan958
  162. Variation in flower frost tolerance among seven apple cultivars and transcriptome response patterns in two contrastingly frost-tolerant selected cultivars
  163. Heritability of durable resistance to stripe rust in bread wheat (Triticum aestivum L.)
  164. Molecular mechanism of follicular development in laying hens based on the regulation of water metabolism
  165. Animal Science
  166. Effect of sex ratio on the life history traits of an important invasive species, Spodoptera frugiperda
  167. Plant Sciences
  168. Hairpin in a haystack: In silico identification and characterization of plant-conserved microRNA in Rafflesiaceae
  169. Widely targeted metabolomics of different tissues in Rubus corchorifolius
  170. The complete chloroplast genome of Gerbera piloselloides (L.) Cass., 1820 (Carduoideae, Asteraceae) and its phylogenetic analysis
  171. Field trial to correlate mineral solubilization activity of Pseudomonas aeruginosa and biochemical content of groundnut plants
  172. Correlation analysis between semen routine parameters and sperm DNA fragmentation index in patients with semen non-liquefaction: A retrospective study
  173. Plasticity of the anatomical traits of Rhododendron L. (Ericaceae) leaves and its implications in adaptation to the plateau environment
  174. Effects of Piriformospora indica and arbuscular mycorrhizal fungus on growth and physiology of Moringa oleifera under low-temperature stress
  175. Effects of different sources of potassium fertiliser on yield, fruit quality and nutrient absorption in “Harward” kiwifruit (Actinidia deliciosa)
  176. Comparative efficiency and residue levels of spraying programs against powdery mildew in grape varieties
  177. The DREB7 transcription factor enhances salt tolerance in soybean plants under salt stress
  178. Using plant electrical signals of water hyacinth (Eichhornia crassipes) for water pollution monitoring
  179. Food Science
  180. Phytochemical analysis of Stachys iva: Discovering the optimal extract conditions and its bioactive compounds
  181. Review on role of honey in disease prevention and treatment through modulation of biological activities
  182. Computational analysis of polymorphic residues in maltose and maltotriose transporters of a wild Saccharomyces cerevisiae strain
  183. Optimization of phenolic compound extraction from Tunisian squash by-products: A sustainable approach for antioxidant and antibacterial applications
  184. Liupao tea aqueous extract alleviates dextran sulfate sodium-induced ulcerative colitis in rats by modulating the gut microbiota
  185. Toxicological qualities and detoxification trends of fruit by-products for valorization: A review
  186. Polyphenolic spectrum of cornelian cherry fruits and their health-promoting effect
  187. Optimizing the encapsulation of the refined extract of squash peels for functional food applications: A sustainable approach to reduce food waste
  188. Advancements in curcuminoid formulations: An update on bioavailability enhancement strategies curcuminoid bioavailability and formulations
  189. Impact of saline sprouting on antioxidant properties and bioactive compounds in chia seeds
  190. The dilemma of food genetics and improvement
  191. Bioengineering and Biotechnology
  192. Impact of hyaluronic acid-modified hafnium metalorganic frameworks containing rhynchophylline on Alzheimer’s disease
  193. Emerging patterns in nanoparticle-based therapeutic approaches for rheumatoid arthritis: A comprehensive bibliometric and visual analysis spanning two decades
  194. Application of CRISPR/Cas gene editing for infectious disease control in poultry
  195. Preparation of hafnium nitride-coated titanium implants by magnetron sputtering technology and evaluation of their antibacterial properties and biocompatibility
  196. Preparation and characterization of lemongrass oil nanoemulsion: Antimicrobial, antibiofilm, antioxidant, and anticancer activities
  197. Corrigendum
  198. Corrigendum to “Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells”
  199. Corrigendum to “Effects of Ire1 gene on virulence and pathogenicity of Candida albicans”
  200. Retraction
  201. Retraction of “Down-regulation of miR-539 indicates poor prognosis in patients with pancreatic cancer”
https://doi.org/10.1515/biol-2022-0913
Keywords for this article
intervertebral disc degeneration; endplate chondrocyte degeneration; stigmasterol; mitophagy; RNA acetylation
Creative Commons
BY 4.0

Articles in the same Issue

  1. Biomedical Sciences
  2. Mechanism of triptolide regulating proliferation and apoptosis of hepatoma cells by inhibiting JAK/STAT pathway
  3. Maslinic acid improves mitochondrial function and inhibits oxidative stress and autophagy in human gastric smooth muscle cells
  4. Comparative analysis of inflammatory biomarkers for the diagnosis of neonatal sepsis: IL-6, IL-8, SAA, CRP, and PCT
  5. Post-pandemic insights on COVID-19 and premature ovarian insufficiency
  6. Proteome differences of dental stem cells between permanent and deciduous teeth by data-independent acquisition proteomics
  7. Optimizing a modified cetyltrimethylammonium bromide protocol for fungal DNA extraction: Insights from multilocus gene amplification
  8. Preliminary analysis of the role of small hepatitis B surface proteins mutations in the pathogenesis of occult hepatitis B infection via the endoplasmic reticulum stress-induced UPR-ERAD pathway
  9. Efficacy of alginate-coated gold nanoparticles against antibiotics-resistant Staphylococcus and Streptococcus pathogens of acne origins
  10. Battling COVID-19 leveraging nanobiotechnology: Gold and silver nanoparticle–B-escin conjugates as SARS-CoV-2 inhibitors
  11. Neurodegenerative diseases and neuroinflammation-induced apoptosis
  12. Impact of fracture fixation surgery on cognitive function and the gut microbiota in mice with a history of stroke
  13. COLEC10: A potential tumor suppressor and prognostic biomarker in hepatocellular carcinoma through modulation of EMT and PI3K-AKT pathways
  14. High-temperature requirement serine protease A2 inhibitor UCF-101 ameliorates damaged neurons in traumatic brain-injured rats by the AMPK/NF-κB pathway
  15. SIK1 inhibits IL-1β-stimulated cartilage apoptosis and inflammation in vitro through the CRTC2/CREB1 signaling
  16. Rutin–chitooligosaccharide complex: Comprehensive evaluation of its anti-inflammatory and analgesic properties in vitro and in vivo
  17. Knockdown of Aurora kinase B alleviates high glucose-triggered trophoblast cells damage and inflammation during gestational diabetes
  18. Calcium-sensing receptors promoted Homer1 expression and osteogenic differentiation in bone marrow mesenchymal stem cells
  19. ABI3BP can inhibit the proliferation, invasion, and epithelial–mesenchymal transition of non-small-cell lung cancer cells
  20. Changes in blood glucose and metabolism in hyperuricemia mice
  21. Rapid detection of the GJB2 c.235delC mutation based on CRISPR-Cas13a combined with lateral flow dipstick
  22. IL-11 promotes Ang II-induced autophagy inhibition and mitochondrial dysfunction in atrial fibroblasts
  23. Short-chain fatty acid attenuates intestinal inflammation by regulation of gut microbial composition in antibiotic-associated diarrhea
  24. Application of metagenomic next-generation sequencing in the diagnosis of pathogens in patients with diabetes complicated by community-acquired pneumonia
  25. NAT10 promotes radiotherapy resistance in non-small cell lung cancer by regulating KPNB1-mediated PD-L1 nuclear translocation
  26. Phytol-mixed micelles alleviate dexamethasone-induced osteoporosis in zebrafish: Activation of the MMP3–OPN–MAPK pathway-mediating bone remodeling
  27. Association between TGF-β1 and β-catenin expression in the vaginal wall of patients with pelvic organ prolapse
  28. Primary pleomorphic liposarcoma involving bilateral ovaries: Case report and literature review
  29. Effects of de novo donor-specific Class I and II antibodies on graft outcomes after liver transplantation: A pilot cohort study
  30. Sleep architecture in Alzheimer’s disease continuum: The deep sleep question
  31. Ephedra fragilis plant extract: A groundbreaking corrosion inhibitor for mild steel in acidic environments – electrochemical, EDX, DFT, and Monte Carlo studies
  32. Langerhans cell histiocytosis in an adult patient with upper jaw and pulmonary involvement: A case report
  33. Inhibition of mast cell activation by Jaranol-targeted Pirin ameliorates allergic responses in mouse allergic rhinitis
  34. Aeromonas veronii-induced septic arthritis of the hip in a child with acute lymphoblastic leukemia
  35. Clusterin activates the heat shock response via the PI3K/Akt pathway to protect cardiomyocytes from high-temperature-induced apoptosis
  36. Research progress on fecal microbiota transplantation in tumor prevention and treatment
  37. Low-pressure exposure influences the development of HAPE
  38. Stigmasterol alleviates endplate chondrocyte degeneration through inducing mitophagy by enhancing PINK1 mRNA acetylation via the ESR1/NAT10 axis
  39. AKAP12, mediated by transcription factor 21, inhibits cell proliferation, metastasis, and glycolysis in lung squamous cell carcinoma
  40. Association between PAX9 or MSX1 gene polymorphism and tooth agenesis risk: A meta-analysis
  41. A case of bloodstream infection caused by Neisseria gonorrhoeae
  42. Case of nasopharyngeal tuberculosis complicated with cervical lymph node and pulmonary tuberculosis
  43. p-Cymene inhibits pro-fibrotic and inflammatory mediators to prevent hepatic dysfunction
  44. GFPT2 promotes paclitaxel resistance in epithelial ovarian cancer cells via activating NF-κB signaling pathway
  45. Transfer RNA-derived fragment tRF-36 modulates varicose vein progression via human vascular smooth muscle cell Notch signaling
  46. RTA-408 attenuates the hepatic ischemia reperfusion injury in mice possibly by activating the Nrf2/HO-1 signaling pathway
  47. Decreased serum TIMP4 levels in patients with rheumatoid arthritis
  48. Sirt1 protects lupus nephritis by inhibiting the NLRP3 signaling pathway in human glomerular mesangial cells
  49. Sodium butyrate aids brain injury repair in neonatal rats
  50. Interaction of MTHFR polymorphism with PAX1 methylation in cervical cancer
  51. Convallatoxin inhibits proliferation and angiogenesis of glioma cells via regulating JAK/STAT3 pathway
  52. The effect of the PKR inhibitor, 2-aminopurine, on the replication of influenza A virus, and segment 8 mRNA splicing
  53. Effects of Ire1 gene on virulence and pathogenicity of Candida albicans
  54. Small cell lung cancer with small intestinal metastasis: Case report and literature review
  55. GRB14: A prognostic biomarker driving tumor progression in gastric cancer through the PI3K/AKT signaling pathway by interacting with COBLL1
  56. 15-Lipoxygenase-2 deficiency induces foam cell formation that can be restored by salidroside through the inhibition of arachidonic acid effects
  57. FTO alleviated the diabetic nephropathy progression by regulating the N6-methyladenosine levels of DACT1
  58. Clinical relevance of inflammatory markers in the evaluation of severity of ulcerative colitis: A retrospective study
  59. Zinc valproic acid complex promotes osteoblast differentiation and exhibits anti-osteoporotic potential
  60. Primary pulmonary synovial sarcoma in the bronchial cavity: A case report
  61. Metagenomic next-generation sequencing of alveolar lavage fluid improves the detection of pulmonary infection
  62. Uterine tumor resembling ovarian sex cord tumor with extensive rhabdoid differentiation: A case report
  63. Genomic analysis of a novel ST11(PR34365) Clostridioides difficile strain isolated from the human fecal of a CDI patient in Guizhou, China
  64. Effects of tiered cardiac rehabilitation on CRP, TNF-α, and physical endurance in older adults with coronary heart disease
  65. Changes in T-lymphocyte subpopulations in patients with colorectal cancer before and after acupoint catgut embedding acupuncture observation
  66. Modulating the tumor microenvironment: The role of traditional Chinese medicine in improving lung cancer treatment
  67. Alterations of metabolites related to microbiota–gut–brain axis in plasma of colon cancer, esophageal cancer, stomach cancer, and lung cancer patients
  68. Research on individualized drug sensitivity detection technology based on bio-3D printing technology for precision treatment of gastrointestinal stromal tumors
  69. CEBPB promotes ulcerative colitis-associated colorectal cancer by stimulating tumor growth and activating the NF-κB/STAT3 signaling pathway
  70. Oncolytic bacteria: A revolutionary approach to cancer therapy
  71. A de novo meningioma with rapid growth: A possible malignancy imposter?
  72. Diagnosis of secondary tuberculosis infection in an asymptomatic elderly with cancer using next-generation sequencing: Case report
  73. Hesperidin and its zinc(ii) complex enhance osteoblast differentiation and bone formation: In vitro and in vivo evaluations
  74. Research progress on the regulation of autophagy in cardiovascular diseases by chemokines
  75. Anti-arthritic, immunomodulatory, and inflammatory regulation by the benzimidazole derivative BMZ-AD: Insights from an FCA-induced rat model
  76. Immunoassay for pyruvate kinase M1/2 as an Alzheimer’s biomarker in CSF
  77. The role of HDAC11 in age-related hearing loss: Mechanisms and therapeutic implications
  78. Evaluation and application analysis of animal models of PIPNP based on data mining
  79. Therapeutic approaches for liver fibrosis/cirrhosis by targeting pyroptosis
  80. Fabrication of zinc oxide nanoparticles using Ruellia tuberosa leaf extract induces apoptosis through P53 and STAT3 signalling pathways in prostate cancer cells
  81. Haplo-hematopoietic stem cell transplantation and immunoradiotherapy for severe aplastic anemia complicated with nasopharyngeal carcinoma: A case report
  82. Modulation of the KEAP1-NRF2 pathway by Erianin: A novel approach to reduce psoriasiform inflammation and inflammatory signaling
  83. The expression of epidermal growth factor receptor 2 and its relationship with tumor-infiltrating lymphocytes and clinical pathological features in breast cancer patients
  84. Innovations in MALDI-TOF Mass Spectrometry: Bridging modern diagnostics and historical insights
  85. BAP1 complexes with YY1 and RBBP7 and its downstream targets in ccRCC cells
  86. Hypereosinophilic syndrome with elevated IgG4 and T-cell clonality: A report of two cases
  87. Electroacupuncture alleviates sciatic nerve injury in sciatica rats by regulating BDNF and NGF levels, myelin sheath degradation, and autophagy
  88. Polydatin prevents cholesterol gallstone formation by regulating cholesterol metabolism via PPAR-γ signaling
  89. RNF144A and RNF144B: Important molecules for health
  90. Analysis of the detection rate and related factors of thyroid nodules in the healthy population
  91. Artesunate inhibits hepatocellular carcinoma cell migration and invasion through OGA-mediated O-GlcNAcylation of ZEB1
  92. Endovascular management of post-pancreatectomy hemorrhage caused by a hepatic artery pseudoaneurysm: Case report and review of the literature
  93. Efficacy and safety of anti-PD-1/PD-L1 antibodies in patients with relapsed refractory diffuse large B-cell lymphoma: A meta-analysis
  94. SATB2 promotes humeral fracture healing in rats by activating the PI3K/AKT pathway
  95. Overexpression of the ferroptosis-related gene, NFS1, corresponds to gastric cancer growth and tumor immune infiltration
  96. Understanding risk factors and prognosis in diabetic foot ulcers
  97. Atractylenolide I alleviates the experimental allergic response in mice by suppressing TLR4/NF-kB/NLRP3 signalling
  98. FBXO31 inhibits the stemness characteristics of CD147 (+) melanoma stem cells
  99. Immune molecule diagnostics in colorectal cancer: CCL2 and CXCL11
  100. Inhibiting CXCR6 promotes senescence of activated hepatic stellate cells with limited proinflammatory SASP to attenuate hepatic fibrosis
  101. Cadmium toxicity, health risk and its remediation using low-cost biochar adsorbents
  102. Pulmonary cryptococcosis with headache as the first presentation: A case report
  103. Solitary pulmonary metastasis with cystic airspaces in colon cancer: A rare case report
  104. RUNX1 promotes denervation-induced muscle atrophy by activating the JUNB/NF-κB pathway and driving M1 macrophage polarization
  105. Morphometric analysis and immunobiological investigation of Indigofera oblongifolia on the infected lung with Plasmodium chabaudi
  106. The NuA4/TIP60 histone-modifying complex and Hr78 modulate the Lobe2 mutant eye phenotype
  107. Experimental study on salmon demineralized bone matrix loaded with recombinant human bone morphogenetic protein-2: In vitro and in vivo study
  108. A case of IgA nephropathy treated with a combination of telitacicept and half-dose glucocorticoids
  109. Analgesic and toxicological evaluation of cannabidiol-rich Moroccan Cannabis sativa L. (Khardala variety) extract: Evidence from an in vivo and in silico study
  110. Wound healing and signaling pathways
  111. Combination of immunotherapy and whole-brain radiotherapy on prognosis of patients with multiple brain metastases: A retrospective cohort study
  112. To explore the relationship between endometrial hyperemia and polycystic ovary syndrome
  113. Research progress on the impact of curcumin on immune responses in breast cancer
  114. Biogenic Cu/Ni nanotherapeutics from Descurainia sophia (L.) Webb ex Prantl seeds for the treatment of lung cancer
  115. Dapagliflozin attenuates atrial fibrosis via the HMGB1/RAGE pathway in atrial fibrillation rats
  116. Glycitein alleviates inflammation and apoptosis in keratinocytes via ROS-associated PI3K–Akt signalling pathway
  117. ADH5 inhibits proliferation but promotes EMT in non-small cell lung cancer cell through activating Smad2/Smad3
  118. Apoptotic efficacies of AgNPs formulated by Syzygium aromaticum leaf extract on 32D-FLT3-ITD human leukemia cell line with PI3K/AKT/mTOR signaling pathway
  119. Novel cuproptosis-related genes C1QBP and PFKP identified as prognostic and therapeutic targets in lung adenocarcinoma
  120. Bee venom promotes exosome secretion and alters miRNA cargo in T cells
  121. Treatment of pure red cell aplasia in a chronic kidney disease patient with roxadustat: A case report
  122. Comparative bioinformatics analysis of the Wnt pathway in breast cancer: Selection of novel biomarker panels associated with ER status
  123. Kynurenine facilitates renal cell carcinoma progression by suppressing M2 macrophage pyroptosis through inhibition of CASP1 cleavage
  124. RFX5 promotes the growth, motility, and inhibits apoptosis of gastric adenocarcinoma cells through the SIRT1/AMPK axis
  125. ALKBH5 exacerbates early cardiac damage after radiotherapy for breast cancer via m6A demethylation of TLR4
  126. Phytochemicals of Roman chamomile: Antioxidant, anti-aging, and whitening activities of distillation residues
  127. Circadian gene Cry1 inhibits the tumorigenicity of hepatocellular carcinoma by the BAX/BCL2-mediated apoptosis pathway
  128. The TNFR-RIPK1/RIPK3 signalling pathway mediates the effect of lanthanum on necroptosis of nerve cells
  129. Longitudinal monitoring of autoantibody dynamics in patients with early-stage non-small-cell lung cancer undergoing surgery
  130. The potential role of rutin, a flavonoid, in the management of cancer through modulation of cell signaling pathways
  131. Construction of pectinase gene engineering microbe and its application in tobacco sheets
  132. Construction of a microbial abundance prognostic scoring model based on intratumoral microbial data for predicting the prognosis of lung squamous cell carcinoma
  133. Sepsis complicated by haemophagocytic lymphohistiocytosis triggered by methicillin-resistant Staphylococcus aureus and human herpesvirus 8 in an immunocompromised elderly patient: A case report
  134. Sarcopenia in liver transplantation: A comprehensive bibliometric study of current research trends and future directions
  135. Advances in cancer immunotherapy and future directions in personalized medicine
  136. Can coronavirus disease 2019 affect male fertility or cause spontaneous abortion? A two-sample Mendelian randomization analysis
  137. Heat stroke associated with novel leukaemia inhibitory factor receptor gene variant in a Chinese infant
  138. PSME2 exacerbates ulcerative colitis by disrupting intestinal barrier function and promoting autophagy-dependent inflammation
  139. Hyperosmolar hyperglycemic state with severe hypernatremia coexisting with central diabetes insipidus: A case report and literature review
  140. Efficacy and mechanism of escin in improving the tissue microenvironment of blood vessel walls via anti-inflammatory and anticoagulant effects: Implications for clinical practice
  141. Merkel cell carcinoma: Clinicopathological analysis of three patients and literature review
  142. Genetic variants in VWF exon 26 and their implications for type 1 Von Willebrand disease in a Saudi Arabian population
  143. Lipoxin A4 improves myocardial ischemia/reperfusion injury through the Notch1-Nrf2 signaling pathway
  144. High levels of EPHB2 expression predict a poor prognosis and promote tumor progression in endometrial cancer
  145. Knockdown of SHP-2 delays renal tubular epithelial cell injury in diabetic nephropathy by inhibiting NLRP3 inflammasome-mediated pyroptosis
  146. Exploring the toxicity mechanisms and detoxification methods of Rhizoma Paridis
  147. Concomitant gastric carcinoma and primary hepatic angiosarcoma in a patient: A case report
  148. Ecology and Environmental Science
  149. Optimization and comparative study of Bacillus consortia for cellulolytic potential and cellulase enzyme activity
  150. The complete mitochondrial genome analysis of Haemaphysalis hystricis Supino, 1897 (Ixodida: Ixodidae) and its phylogenetic implications
  151. Epidemiological characteristics and risk factors analysis of multidrug-resistant tuberculosis among tuberculosis population in Huzhou City, Eastern China
  152. Indices of human impacts on landscapes: How do they reflect the proportions of natural habitats?
  153. Genetic analysis of the Siberian flying squirrel population in the northern Changbai Mountains, Northeast China: Insights into population status and conservation
  154. Diversity and environmental drivers of Suillus communities in Pinus sylvestris var. mongolica forests of Inner Mongolia
  155. Global assessment of the fate of nitrogen deposition in forest ecosystems: Insights from 15N tracer studies
  156. Fungal and bacterial pathogenic co-infections mainly lead to the assembly of microbial community in tobacco stems
  157. Influencing of coal industry related airborne particulate matter on ocular surface tear film injury and inflammatory factor expression in Sprague-Dawley rats
  158. Temperature-dependent development, predation, and life table of Sphaerophoria macrogaster (Thomson) (Diptera: Syrphidae) feeding on Myzus persicae (Sulzer) (Homoptera: Aphididae)
  159. Eleonora’s falcon trophic interactions with insects within its breeding range: A systematic review
  160. Agriculture
  161. Integrated analysis of transcriptome, sRNAome, and degradome involved in the drought-response of maize Zhengdan958
  162. Variation in flower frost tolerance among seven apple cultivars and transcriptome response patterns in two contrastingly frost-tolerant selected cultivars
  163. Heritability of durable resistance to stripe rust in bread wheat (Triticum aestivum L.)
  164. Molecular mechanism of follicular development in laying hens based on the regulation of water metabolism
  165. Animal Science
  166. Effect of sex ratio on the life history traits of an important invasive species, Spodoptera frugiperda
  167. Plant Sciences
  168. Hairpin in a haystack: In silico identification and characterization of plant-conserved microRNA in Rafflesiaceae
  169. Widely targeted metabolomics of different tissues in Rubus corchorifolius
  170. The complete chloroplast genome of Gerbera piloselloides (L.) Cass., 1820 (Carduoideae, Asteraceae) and its phylogenetic analysis
  171. Field trial to correlate mineral solubilization activity of Pseudomonas aeruginosa and biochemical content of groundnut plants
  172. Correlation analysis between semen routine parameters and sperm DNA fragmentation index in patients with semen non-liquefaction: A retrospective study
  173. Plasticity of the anatomical traits of Rhododendron L. (Ericaceae) leaves and its implications in adaptation to the plateau environment
  174. Effects of Piriformospora indica and arbuscular mycorrhizal fungus on growth and physiology of Moringa oleifera under low-temperature stress
  175. Effects of different sources of potassium fertiliser on yield, fruit quality and nutrient absorption in “Harward” kiwifruit (Actinidia deliciosa)
  176. Comparative efficiency and residue levels of spraying programs against powdery mildew in grape varieties
  177. The DREB7 transcription factor enhances salt tolerance in soybean plants under salt stress
  178. Using plant electrical signals of water hyacinth (Eichhornia crassipes) for water pollution monitoring
  179. Food Science
  180. Phytochemical analysis of Stachys iva: Discovering the optimal extract conditions and its bioactive compounds
  181. Review on role of honey in disease prevention and treatment through modulation of biological activities
  182. Computational analysis of polymorphic residues in maltose and maltotriose transporters of a wild Saccharomyces cerevisiae strain
  183. Optimization of phenolic compound extraction from Tunisian squash by-products: A sustainable approach for antioxidant and antibacterial applications
  184. Liupao tea aqueous extract alleviates dextran sulfate sodium-induced ulcerative colitis in rats by modulating the gut microbiota
  185. Toxicological qualities and detoxification trends of fruit by-products for valorization: A review
  186. Polyphenolic spectrum of cornelian cherry fruits and their health-promoting effect
  187. Optimizing the encapsulation of the refined extract of squash peels for functional food applications: A sustainable approach to reduce food waste
  188. Advancements in curcuminoid formulations: An update on bioavailability enhancement strategies curcuminoid bioavailability and formulations
  189. Impact of saline sprouting on antioxidant properties and bioactive compounds in chia seeds
  190. The dilemma of food genetics and improvement
  191. Bioengineering and Biotechnology
  192. Impact of hyaluronic acid-modified hafnium metalorganic frameworks containing rhynchophylline on Alzheimer’s disease
  193. Emerging patterns in nanoparticle-based therapeutic approaches for rheumatoid arthritis: A comprehensive bibliometric and visual analysis spanning two decades
  194. Application of CRISPR/Cas gene editing for infectious disease control in poultry
  195. Preparation of hafnium nitride-coated titanium implants by magnetron sputtering technology and evaluation of their antibacterial properties and biocompatibility
  196. Preparation and characterization of lemongrass oil nanoemulsion: Antimicrobial, antibiofilm, antioxidant, and anticancer activities
  197. Corrigendum
  198. Corrigendum to “Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells”
  199. Corrigendum to “Effects of Ire1 gene on virulence and pathogenicity of Candida albicans”
  200. Retraction
  201. Retraction of “Down-regulation of miR-539 indicates poor prognosis in patients with pancreatic cancer”
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 25.12.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0913/html
Scroll to top button