Home RUNX1 promotes denervation-induced muscle atrophy by activating the JUNB/NF-κB pathway and driving M1 macrophage polarization
Article Open Access

RUNX1 promotes denervation-induced muscle atrophy by activating the JUNB/NF-κB pathway and driving M1 macrophage polarization

  • Wei Hu , Yang Huang , Wei Yin EMAIL logo , Yao Huang EMAIL logo and Jian Wu
Published/Copyright: August 18, 2025
Download Article (PDF)
Open Life Sciences
From the journal Open Life Sciences Volume 20 Issue 1

Abstract

Peripheral nerve injury-induced muscle atrophy is characterized by chronic inflammation and dysregulated macrophage polarization. RUNX1, a transcription factor upregulated in denervated muscle, has been implicated in linking muscle degeneration to inflammatory processes, but its downstream targets and mechanisms remain unclear. The aim of this study is to delineate the RUNX1-JUNB-NF-κB axis in driving inflammation-mediated muscle atrophy. The GSE183802 single-nucleus RNA sequencing dataset was analyzed to identify RUNX1-associated pathways. A sciatic nerve transection model in mice was established to validate RUNX1 expression dynamics. Chromatin immunoprecipitation, dual-luciferase reporter assays, and siRNA-mediated knockdown were used to confirm RUNX1’s transcriptional regulation of JUNB. In vitro models (C2C12 myotubes, RAW 264.7 macrophages) assessed RUNX1-driven inflammatory responses, NF-κB activation, and extracellular matrix remodeling. RUNX1 was significantly upregulated in denervated muscle, particularly in myonuclei and macrophage subclusters, correlating with elevated atrophy markers (MuRF1, Atrogin-1). RUNX1 overexpression directly activated JUNB transcription via promoter binding, leading to NF-κB pathway activation (increased p65 phosphorylation) and M1 macrophage polarization (enhanced IL-1β/TNF-α secretion). JUNB knockdown reversed RUNX1-induced pro-inflammatory cytokine release, NF-κB signaling, and muscle atrophy markers. This study identifies the RUNX1-JUNB-NF-κB axis as a central regulator of inflammation-driven muscle atrophy following denervation. Targeting this pathway may offer therapeutic potential to mitigate neurogenic muscle degeneration and immune-mediated damage in conditions such as peripheral nerve injuries or motor neuron diseases.

Graphical abstract

Keywords: RUNX1; JUNB; NF-κB signaling; muscle atrophy; macrophage

1 Introduction

Skeletal muscle atrophy, characterized by a reduction in muscle mass and function, is a debilitating condition associated with chronic diseases, including neuromuscular disorders, cancer, and cachexia [1]. This condition severely impacts patients’ quality of life and contributes to increased healthcare costs [2]. Peripheral nerve injuries (PNIs), a leading cause of muscle atrophy, result in neuromuscular junction (NMJ) denervation and impaired muscle function. Macrophages are critically involved in NMJ reinnervation through debris clearance, modulation of inflammation, and support for axonal regeneration. Dysregulated macrophage activity may hinder NMJ recovery and worsen muscle atrophy. For instance, in Schwann cell-specific Gpr126 mutants, reduced macrophage infiltration and imbalanced chemokine expression (e.g., elevated Ccl2 and reduced Tnfα) delay NMJ reinnervation, highlighting the importance of coordinated macrophage responses for effective muscle recovery [3].

Recent research has identified RUNX1 as a key transcription factor in skeletal muscle denervation and atrophy, serving as an early marker of NMJ dysfunction and muscle stress [4]. In aging mouse models, RUNX1 upregulation correlates with NMJ instability preceding sarcopenia and regulates denervation-related genes, including acetylcholine receptor subunits and atrophy markers such as MuRF1 and Atrogin-1 [5,6]. While RUNX1 initially supports adaptive responses, its sustained expression exacerbates delayed recovery and muscle susceptibility to atrophy. Notably, RUNX1 also modulates macrophage polarization and immune signaling, particularly in denervation-prone muscles like the tibialis anterior, with expression patterns influenced by sex and exercise [7].

The JUNB-NF-κB axis, a well-characterized inflammatory pathway, plays a pivotal role in muscle pathology. JUNB, an AP-1 family transcription factor, regulates pro-inflammatory cytokine production (e.g., IL-1β, TNF-α) and interacts with NF-κB to amplify inflammatory responses [8]. NF-κB, a master regulator of inflammation, drives muscle atrophy by inducing proteolytic systems (e.g., ubiquitin-proteasome) and suppressing anabolic pathways [9]. While previous studies have investigated RUNX1 in contexts such as fibrosis and inflammation [7,8,9], and JUNB-NF-κB crosstalk has been implicated in chronic inflammatory diseases, the direct regulatory relationship between RUNX1, JUNB, and NF-κB in denervation-induced muscle atrophy remains underexplored. This study provides the first evidence that RUNX1 binds directly to the JUNB promoter, activating the JUNB-NF-κB pathway to mediate macrophage polarization and subsequent muscle degeneration following denervation.

Building on this foundation, we hypothesized that RUNX1 exacerbates denervation-induced atrophy by activating the JUNB-NF-κB axis, thereby amplifying inflammation and extracellular matrix (ECM) dysregulation. Leveraging the GSE183802 single-nucleus RNA sequencing (snRNA-seq) dataset, we identified RUNX1 upregulation in myonuclei and macrophage subclusters post-denervation. Using a sciatic nerve transection model, we demonstrated that RUNX1 drives macrophage M1 polarization and muscle atrophy markers. Mechanistically, RUNX1 directly binds to the JUNB promoter, activating NF-κB signaling (via p65 phosphorylation) and perpetuating a pro-inflammatory cascade. These findings establish the RUNX1-JUNB-NF-κB axis as a central driver of neurogenic muscle degeneration, offering novel therapeutic targets for mitigating atrophy in PNIs and related disorders.

2 Methods

2.1 snRNA-seq analysis

To explore gene expression changes associated with denervation-induced muscle atrophy, the GSE183802 snRNA-seq dataset of gastrocnemius (GAS) muscles from normal and denervated mice was obtained, and after quality control, 29,539 nuclei were retained (15,739 normal; 13,800 denervated). Using Seurat’s FindClusters (tested resolutions 0.2–1.0; final resolution = 0.5), we partitioned cells into 12 populations including different myofiber subtypes (Type I, Type IIa, IIx, IIb), fibro-adipogenic progenitors (FAPs), muscle stem cells (MuSCs), macrophages, and other supporting cell types.

2.2 Sciatic nerve transection model

A total of six female Sprague-Dawley rats (180–220 g) were randomly divided into two groups: Group A (Sham surgery, n = 3) and Group B (Denervation model, n = 3). Group A underwent a sham operation, where an incision was made to expose the left tibial nerve without transection, followed by wound closure with 3-0 silk sutures. In Group B, the left tibial nerve was completely transected, and the proximal stump was ligated with 5-0 nylon sutures to prevent reinnervation. All surgical procedures were performed under sterile conditions by two experienced microsurgeons. Anesthesia was induced with 3% sodium pentobarbital (50 mg/kg, intraperitoneally). A longitudinal incision was made over the left hindlimb, and the tibial nerve was carefully isolated under a surgical microscope. The nerve was completely transected at mid-thigh level, and the proximal stump was tightly ligated to ensure no reconnection. Postoperatively, all rats were placed in clean cages with fresh bedding and monitored for signs of distress or infection. Four weeks after surgery, rats were euthanized, and the GAS muscle from both groups was carefully dissected. The collected muscle tissues were divided into two parts: one was fixed in 4% paraformaldehyde for hematoxylin and eosin (HE) staining to assess muscle morphology and atrophy, while the other was stored at −80°C for subsequent RNA extraction and quantitative real-time PCR (qRT-PCR) analysis to evaluate the expression of atrophy-related genes.

  1. Ethical approval: The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals, and has been approved by the Animal Research Ethics Committee of Xianning Central Hospital (The First Affiliated Hospital of Hubei University of Science and Technology) (Approval No. 2023-97).

2.3 Histology and morphometric analysis

The GAS muscles were harvested from both the experimental and control groups. The muscles were dissected, weighed, and immediately frozen in liquid nitrogen-cooled isopentane. Next 10 μm thick transverse cryosections were prepared using a cryostat and stained with HE dye (Thermo Fisher Scientific, Rockford, IL, USA) following standard protocols. The stained sections were examined and imaged using an Eclipse TE 2000-U microscope equipped with a Digital Sight DS-Fi1 camera (Nikon, Tokyo, Japan). Muscle fiber morphometry was analyzed in a blinded manner using ImageJ software (NIH, Bethesda, MD, USA). Approximately 500 myofibers were measured in each of five non-adjacent transverse sections per muscle (totaling ∼2,500 fibers per rat) to determine cross-sectional area (CSA) and minimal Feret’s diameter. These parameters were used to quantitatively assess muscle atrophy and morphological changes following sciatic nerve transection.

2.4 C2C12 myotube and macrophage co-culture model

RAW 264.7 (CL-0190) and C2C12 (CL-0044) were obtained from ATCC. The cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco, United States) supplemented with 10% fetal bovine serum (Gibco, United States) under a humidified atmosphere with 5% CO2 at 37°C. The cell lines were authenticated using short tandem repeat analysis performed in June 2024 at the Laboratory Animal Center of Wuhan University. All experiments were conducted with mycoplasma-free cells, confirmed by the absence of detectable mycoplasma signals in Hoechst 33342-stained cells (Supplementary file). A 6-well and 24-well transwell co-culture system (Corning, United States) was used for the non-contact co-culture of RAW264.7 macrophages and C2C12 myoblasts. For C2C12 overexpression, C2C12 myoblasts were transfected with either an empty vector (NC) or a RUNX1 overexpression plasmid (oe-RUNX1) using Lipofectamine 3000 (Thermo Fisher Scientific, United States) according to the manufacturer’s instructions. Cells were incubated with the transfection mixture for 6 h, after which the medium was replaced with fresh DMEM supplemented with 10% fetal bovine serum. 24 h post-transfection, successful overexpression was confirmed via qRT-PCR and Western blot analysis.

For co-culture, 2 × 106 and 4 × 105 RAW264.7 macrophages were plated in the upper chamber of 6-well and 24-well transwell plates, respectively. Meanwhile, 6.6 × 106 and 13.3 × 105 C2C12 myoblasts (NC or oe-RUNX1-transfected) were plated in the lower chamber of the respective transwell plates. The macrophage-to-myoblast ratio was maintained at approximately 30%, reflecting physiological conditions in skeletal muscle. Cells were allowed to adhere for 24 h before initiating co-culture. To induce M1 polarization, RAW264.7 macrophages were treated with lipopolysaccharide (LPS) (100 ng/mL) and interferon-gamma (IFN-γ) (50 ng/mL) for 24 h before co-culture. The co-culture was maintained for 5 days in DMEM supplemented with 2% horse serum (Gibco, United States) to promote C2C12 myogenic differentiation. After co-culture, macrophages and myotubes were separately collected for further biochemical and molecular analyses, and culture supernatants were collected for cytokine assays.

2.5 Total RNA isolation and qRT-PCR

RNA was extracted from cells and GAS using Trizol reagent (Qiagen, Germany). Complementary DNA (cDNA) was synthesized according to the manufacturer’s instructions of the SensiFAST™ cDNA Synthesis Kit (Bioline, OH, USA). Real-time PCR was performed with Power SYBR™ Green PCR Master Mix (Applied Biosystems, MA, USA). The cycling protocol was: initial denaturation at 95°C for 2 min; 40 cycles of 95°C for 15 s and 60°C for 30 s; followed by melt-curve analysis from 60 to 95°C. GAPDH served as the endogenous control, and relative expression was calculated by the 2–ΔΔCt method. All reactions were run in technical triplicate and biological triplicates. The primers used for real-time PCR are listed in Table 1.

Table 1

Primer sequences

Genes Primers
Forward (5′−3′) Reverse (5′−3′)
RUNX1 (Rattus norvegicus) TACCTGGGGTCCATCACCTC GGTCCGGGGCTGTTGAGA
RUNX1 (Mus musculus) CCTTCAGGAGAGGTGCGTTT CTCGTGCTGGCATCTCTCAT
JUNB (Mus musculus) ATCAGACACAGGCGCATCTC TGACAAAACCGTCCGCAAAG
MuRF1 (Mus musculus) CAGAGGGTAAAGAAGAACACCA TGCTAGTCCCTGCTCTCTGA
Atrogin-1 (Mus musculus) TGAGCGACCTCAGCAGTTAC GCGCTCCTTCGTACTTCCTT
GAPDH (Rattus norvegicus) CTCAGTTGCTGAGGAGTCCC ATTCGAGAGAAGGGAGGGCT
GAPDH (Mus musculus) TGGAGCCAAAAGGGTCATCA ATGAGCCCTTCCACAATGCC

2.6 Western blot analysis

Total protein was extracted from cells and GAS tissues, and protein concentrations were determined using the BCA protein assay kit. The proteins were separated by SDS-PAGE and transferred onto polyvinylidene fluoride membranes. The membranes were blocked with 5% nonfat milk for 1 h at room temperature to prevent non-specific binding. After blocking, the membranes were incubated overnight at 4°C with primary antibodies against RUNX1 (ab240639, 1:500, Abcam), JUNB (ab168356, 1:500, Abcam), CD86 (ab239075, 1:500, Abcam), NF-kB p65 (ab32536, 1:500, Abcam), and β-actin (ab5694, 1:1,000). The following day, the membranes were washed with tris-buffered saline with Tween 20 and incubated with horseradish peroxidase-conjugated secondary antibodies for 1 h at room temperature. The protein bands were visualized using enhanced chemiluminescence reagent (Amersham Biosciences, UK) and detected with a ChemiDoc MP system (Bio-Rad, USA). Band intensity was quantified using ImageJ software, and the protein expression was normalized to β-actin.

2.7 Enzyme-linked immunosorbent assay (ELISA)

ELISA was used to measure the levels of inducible nitric oxide synthase (iNOS), tumor necrosis factor-alpha (TNF-α), and interleukin-1 beta (IL-1β*) in the supernatants of RAW264.7 macrophages. Cytokine concentrations were determined using commercial ELISA kits (Absin Bioscience, China) according to the manufacturer’s instructions. All samples were analyzed in duplicates.

2.8 Chromatin immunoprecipitation (ChIP) assay

ChIP assay was performed to analyze the binding of RUNX1 to the promoter regions of JUNB in C2C12 myoblasts. Briefly, cells were cross-linked with 1% formaldehyde for 10 min at room temperature and quenched with 0.125 M glycine. The chromatin was then sheared using sonication to obtain fragments of 200–500 bp. Immunoprecipitation was carried out using specific antibodies against RUNX1, with IgG as a negative control. The immunoprecipitated DNA was eluted, purified, and analyzed by qRT-PCR to quantify the binding of RUNX1 to the promoter regions of interest.

2.9 Luciferase reporter assay

The luciferase reporter assay was performed using the Dual-Luciferase Reporter Assay Kit (Promega). HEK293T cells were cotransfected with wild-type (WT) or mutant (MUT) JUNB promoter plasmids and the RUNX1 overexpression plasmid. Mutations were introduced in the predicted binding sites 2 and 3 of the JUNB promoter. Negative control plasmids were included. After 48 h, luciferase activities were measured, with Firefly luciferase used to assess RUNX1 binding to the JUNB promoter and Renilla luciferase for normalization. Data were quantified using a luminometer (Promega).

2.10 Statistical analysis

All data are presented as mean value ± standard deviation. Statistical analyses were performed using GraphPad Prism (version 9.0). Differences between two groups were assessed using the unpaired Student’s t-test. Multiple-group comparisons were conducted using one-way ANOVA followed by Tukey’s post-hoc test. A P-value <0.05 was considered statistically significant.

3 Results

3.1 snRNA-seq reveals RUNX1 upregulation in denervation-induced muscle atrophy

A comprehensive review of previous studies revealed that the GSE183802 dataset provides snRNA-seq data from the GAS muscles of normal mice and mice subjected to denervation-induced muscle atrophy. This dataset retained 29,539 nuclei following quality control, comprising 15,739 nuclei from the normal group and 13,800 nuclei from the denervated group. Utilizing the Seurat package, the analysis identified 12 distinct cell populations, including type I myofibers, type II myofibers (IIa, IIx, and IIb), FAPs, MuSCs, NMJ cells, muscle-tendon junction cells, macrophages, endothelial cells, pericytes, adipocytes, and a group of unclassified nuclei (Figure 1a). To understand the molecular changes associated with denervation-induced muscle atrophy, differential gene expression analysis was conducted on type I myonuclei, comparing denervated and normal samples. This analysis revealed the significant upregulation of Dlg2, Col25a1, Igfn1, JUNB, Gadd45a, Runx1, and Kcng5, while genes such as Mylk4, Myh4, Rnf150, Rp1, Lrrfip1, Hs3st5, and Oxct1 were significantly downregulated (Figure 1b). Given its strong association with skeletal muscle atrophy, RUNX1 was selected for further investigation to determine its expression patterns across different cell populations. The findings demonstrated that RUNX1 expression was upregulated in type I, type IIa, and macrophage subclusters (Figure 1c), underscoring its potential role in mediating denervation-induced muscle atrophy.

Figure 1 snRNA-seq. (a) Identification of 12 distinct cell populations from GSE183802 database via snRNA-seq. (b) Differential gene analysis reveals RUNX1 upregulation in denervated type I myonuclei. (c) RUNX1 expression significantly elevated in type I and type IIa myofibers clusters post-denervation.
Figure 1

snRNA-seq. (a) Identification of 12 distinct cell populations from GSE183802 database via snRNA-seq. (b) Differential gene analysis reveals RUNX1 upregulation in denervated type I myonuclei. (c) RUNX1 expression significantly elevated in type I and type IIa myofibers clusters post-denervation.

3.2 Establishment of the sciatic nerve transection model for skeletal muscle atrophy

Sciatic nerve transection is a widely used experimental method for inducing skeletal muscle atrophy, providing a reliable model for investigating the mechanisms of muscle degeneration [1,10,11]. To assess the validity and consistency of this model, its effects were evaluated 14 days post-transection [12,13]. Figure 2a highlights the apparent atrophy of lower extremity muscles on the denervated side compared to the contralateral control side. Histological analysis of skeletal muscle atrophy is shown in Figure 2b, where HE staining of cross-sections demonstrates a significant reduction in GAS muscle fiber diameters in the injury group relative to the control group. This observation is further corroborated by a substantial decrease in the wet weight of GAS muscles, as illustrated in Figure 2c. Moreover, both the average (CSA, Figure 2d) and the minimal Feret’s diameter (Figure 2e) of GAS muscles were significantly reduced in the denervated group. Subsequent qRT-PCR analysis revealed that RUNX1 expression was significantly increased in the injury group compared to the control group, as evidenced by both mRNA levels (Figure 2f) and protein expression (Figure 2g and h).

Figure 2 Sciatic nerve transection model. (a) Gross GAS morphology in sham vs denervation groups, 14 days post‐surgery. (b) HE‐stained GAS cross‐sections in sham vs denervation groups. (c) GAS wet weight in sham vs denervation groups. (d) Muscle fiber CSA in sham vs denervation groups. (e) Minimal Feret’s diameter in sham vs denervation groups. (f) RUNX1 mRNA levels in GAS by qRT-PCR in sham vs denervation groups. (g) RUNX1 protein levels in GAS by Western blot in sham vs denervation groups. (h) Densitometric quantification of RUNX1 protein levels normalized to GAPDH.
Figure 2

Sciatic nerve transection model. (a) Gross GAS morphology in sham vs denervation groups, 14 days post‐surgery. (b) HE‐stained GAS cross‐sections in sham vs denervation groups. (c) GAS wet weight in sham vs denervation groups. (d) Muscle fiber CSA in sham vs denervation groups. (e) Minimal Feret’s diameter in sham vs denervation groups. (f) RUNX1 mRNA levels in GAS by qRT-PCR in sham vs denervation groups. (g) RUNX1 protein levels in GAS by Western blot in sham vs denervation groups. (h) Densitometric quantification of RUNX1 protein levels normalized to GAPDH.

3.3 RUNX1 overexpression in C2C12 cells enhances M1 polarization and muscle atrophy-related gene expression in macrophages

To confirm the efficiency of RUNX1 overexpression, C2C12 cells were transfected with either an empty vector (oe-NC) or a RUNX1 overexpression plasmid (oe-RUNX1) and cultured for 24 h. qRT-PCR and Western blot analyses confirmed a significant increase in RUNX1 mRNA and protein expression levels in the oe-RUNX1 group compared to the oe-NC group (Figure 3a–c). Supernatants from the transfected C2C12 cells were then collected and added to RAW 264.7 macrophages treated with LPS and IFN-γ to induce M1 polarization. Western blot analysis further demonstrated an upregulation of CD86 protein expression in the LPS + IFN-γ group (Figure 3d and e). ELISA results showed that the secretion levels of iNOS, IL-1β, and TNF-α were significantly elevated in the LPS + IFN-γ group compared to the untreated control group (Figure 3f). Additionally, qRT-PCR revealed a significant increase in MuRF1 and Atrogin-1 mRNA levels in macrophages treated with LPS and IFN-γ (Figure 3g), suggesting an association between M1 polarization and the expression of muscle atrophy-related genes. The addition of C2C12 supernatants from the oe-NC group did not significantly alter the expression of iNOS, IL-1β, TNF-α, CD86, MuRF1, or Atrogin-1 compared to the LPS + IFN-γ group. However, the presence of C2C12 supernatants from the oe-RUNX1 group further enhanced iNOS, IL-1β, and TNF-α levels (Figure 3f), CD86 protein expression (Figure 3e), and MuRF1 and Atrogin-1 mRNA levels (Figure 3g) in LPS + IFN-γ-treated macrophages compared to the LPS + IFN-γ + oe-NC group.

Figure 3 RUNX1 overexpression in C2C12 cells promotes M1 macrophage polarization. (a) qRT-PCR validation of RUNX1 mRNA overexpression in C2C12 cells (oe-NC vs oe-RUNX1). (b) Western blot of RUNX1 protein levels in C2C12 cells following transfection. (c) Densitometric quantification of RUNX1 protein normalized to GAPDH. (d) Western blot of CD86 in RAW264.7 macrophages treated with supernatant from oe-NC or oe-RUNX1 C2C12 cells. (e) Densitometric quantification of CD86 protein normalized to GAPDH. (f) ELISA measurement of iNOS, IL-1β, and TNF-α in macrophage culture supernatants. (g) qRT-PCR analysis of MuRF1 and Atrogin-1 mRNA levels in treated macrophages.
Figure 3

RUNX1 overexpression in C2C12 cells promotes M1 macrophage polarization. (a) qRT-PCR validation of RUNX1 mRNA overexpression in C2C12 cells (oe-NC vs oe-RUNX1). (b) Western blot of RUNX1 protein levels in C2C12 cells following transfection. (c) Densitometric quantification of RUNX1 protein normalized to GAPDH. (d) Western blot of CD86 in RAW264.7 macrophages treated with supernatant from oe-NC or oe-RUNX1 C2C12 cells. (e) Densitometric quantification of CD86 protein normalized to GAPDH. (f) ELISA measurement of iNOS, IL-1β, and TNF-α in macrophage culture supernatants. (g) qRT-PCR analysis of MuRF1 and Atrogin-1 mRNA levels in treated macrophages.

3.4 RUNX1 directly targets JUNB

To explore the regulatory mechanism of RUNX1, the KnockTF 2.0 database was utilized to identify its downstream target genes. This analysis revealed 1,425 negatively regulated genes and 756 positively regulated genes (Figure 4a). Complementing this, the ChIP-Atlas database predicted 14,910 potential downstream targets of RUNX1. By intersecting these predictions with genes upregulated in type I myonuclei identified from the GSE102255 dataset (Figure 4b), JUNB was identified as a shared target (Figure 4c). To validate that RUNX1 transcriptionally regulates JUNB, the JASPAR database was used to predict RUNX1 binding sites within the JUNB promoter region (Figure 4d). The analysis identified three putative binding sites. ChIP assays were then conducted to verify these predictions, demonstrating that RUNX1 specifically binds to Binding Sites 1 and 3, but not to Binding Site 2, on the JUNB promoter (Figure 4e and f). To further assess the functional importance of these binding sites, a dual-luciferase reporter assay was performed. The results revealed a significant reduction in luciferase activity in the JUNB-MUT group compared to the JUNB-WT group (Figure 4g and h), corroborating the regulatory influence of RUNX1 on JUNB transcription.

Figure 4 RUNX1 directly targets JUNB. (a) Identification of RUNX1 downstream targets using the KnockTF 2.0 database. (b) JUNB expression significantly upregulated in GSE102255 dataset. (c) Intersection analysis identified JUNB as a shared target gene of RUNX1. (d) Potential binding sites were predicted by JASPAR. (e) Schematic of the JUNB promoter region with three predicted RUNX1 binding motifs. (f) ChIP assays confirmed direct binding of RUNX1 to JUNB promoter regions (Sites 1 and 3). (g) Sequences of WT and MUT RUNX1 binding motifs in the JUNB promoter used for reporter constructs. (h) Dual-luciferase reporter assay comparing relative luciferase activity between the two groups.
Figure 4

RUNX1 directly targets JUNB. (a) Identification of RUNX1 downstream targets using the KnockTF 2.0 database. (b) JUNB expression significantly upregulated in GSE102255 dataset. (c) Intersection analysis identified JUNB as a shared target gene of RUNX1. (d) Potential binding sites were predicted by JASPAR. (e) Schematic of the JUNB promoter region with three predicted RUNX1 binding motifs. (f) ChIP assays confirmed direct binding of RUNX1 to JUNB promoter regions (Sites 1 and 3). (g) Sequences of WT and MUT RUNX1 binding motifs in the JUNB promoter used for reporter constructs. (h) Dual-luciferase reporter assay comparing relative luciferase activity between the two groups.

3.5 JUNB reverses RUNX1-induced M1 polarization

C2C12 cells were transfected with either an empty vector (NC), a RUNX1 overexpression plasmid (oe-RUNX1), or a RUNX1 overexpression plasmid combined with JUNB siRNA (oe-RUNX1 + si-JUNB). qRT-PCR and Western blot confirmed successful transfection, with JUNB expression significantly reduced in the oe-RUNX1 + si-JUNB group compared with the oe-RUNX1 group (Figure 5a–c). Supernatants from the transfected C2C12 cells were subsequently added to RAW264.7 macrophages treated with LPS and IFN-γ to induce M1 polarization. RUNX1 overexpression resulted in significant increases in the levels of CD86 (Figure 5d and e), iNOS, IL-1β, TNF-α (Figure 5f), MuRF1, and Atrogin-1 (Figure 5g) compared with the NC group, whereas JUNB knockdown effectively reversed these effects. Moreover, analysis of the NF-κB pathway revealed that overexpression of RUNX1 significantly increased phosphorylated p65 levels, whereas knockdown of JUNB markedly reduced p-p65 expression (Figure 5h and i).

Figure 5 JUNB knockdown reverses RUNX1-induced M1 macrophage polarization via NF-κB. (a) qRT-PCR validation of JUNB knockdown efficiency in C2C12 cells transfected with si-JUNB vs control siRNA. (b) Western blot of JUNB protein levels in C2C12 cells after siRNA transfection. (c) Densitometric quantification of JUNB protein normalized to GAPDH. (d) Western blot of CD86 expression in RAW264.7 macrophages treated with conditioned medium from C2C12 cells (NC, oe-RUNX1, oe-RUNX1 + si-JUNB). (e) Densitometric quantification of CD86 normalized to GAPDH. (f) ELISA measurement of iNOS, IL-1β, and TNF-α in macrophage supernatants. (g) qRT-PCR analysis of MuRF1 and Atrogin-1 mRNA levels in treated macrophages. (h) Western blot of phosphorylated NF-κB p65 in macrophages exposed to conditioned media. (i) Densitometric quantification of p-p65 normalized to total p65.
Figure 5

JUNB knockdown reverses RUNX1-induced M1 macrophage polarization via NF-κB. (a) qRT-PCR validation of JUNB knockdown efficiency in C2C12 cells transfected with si-JUNB vs control siRNA. (b) Western blot of JUNB protein levels in C2C12 cells after siRNA transfection. (c) Densitometric quantification of JUNB protein normalized to GAPDH. (d) Western blot of CD86 expression in RAW264.7 macrophages treated with conditioned medium from C2C12 cells (NC, oe-RUNX1, oe-RUNX1 + si-JUNB). (e) Densitometric quantification of CD86 normalized to GAPDH. (f) ELISA measurement of iNOS, IL-1β, and TNF-α in macrophage supernatants. (g) qRT-PCR analysis of MuRF1 and Atrogin-1 mRNA levels in treated macrophages. (h) Western blot of phosphorylated NF-κB p65 in macrophages exposed to conditioned media. (i) Densitometric quantification of p-p65 normalized to total p65.

4 Discussion

RUNX1 has been widely studied in the context of denervation-induced muscle atrophy and NMJ remodeling, particularly in aging and stress-induced muscle dysfunction [14]. Previous research established RUNX1 as a critical transcription factor in the early stress response to denervation, with its upregulation linked to atrophy-related gene activation, including Fbxo32 (Atrogin-1) and Gadd45a [8,9]. In mild denervation models, such as nSod1KO mice, RUNX1 expression increases in response to NMJ instability, suggesting an adaptive role in maintaining NMJ integrity [14]. However, chronic denervation, aging, or sustained stress leads to persistent RUNX1 upregulation, which correlates with progressive NMJ dysfunction and sarcopenia. This dual role – protective in acute stress but deleterious in chronic settings – is further underscored by sex-specific differences and exercise interventions that reduce RUNX1 expression, ameliorating age-related muscle decline [7]. Despite these advances, RUNX1’s role in immune-mediated muscle atrophy, particularly through macrophage interactions, remained poorly defined. Macrophages are pivotal in muscle repair, balancing pro-inflammatory (M1) and anti-inflammatory (M2) polarization during injury and regeneration [9]. Persistent M1 polarization, marked by elevated IL-1β, TNF-α, and CD86, drives chronic inflammation and atrophy. Our findings align with this paradigm: RUNX1 overexpression in C2C12 myotubes promoted M1 polarization, amplifying pro-inflammatory cytokine secretion (e.g., IL-1β, TNF-α) and upregulating atrophy markers (MuRF1, Atrogin-1). This mirrors prior studies showing that M1 macrophages exacerbate proteolysis and inhibit regeneration [9]. Notably, RUNX1’s broader role in tissue remodeling is evident in fibrotic diseases like systemic sclerosis (SSc), where hypomethylation-driven RUNX1 overexpression accelerates ECM dysregulation [15]. These parallels reinforce RUNX1 as a molecular switch between adaptive stress responses and chronic degenerative pathways, positioning it as a therapeutic target to modulate inflammation and ECM dynamics in atrophy. The upstream mechanisms regulating RUNX1 expression following denervation remain unclear. Potential triggers may include oxidative stress reactive oxygen species (ROS), ischemia-reperfusion injury, or neurotrophic factors such as nerve growth factor and brain-derived neurotrophic factor. Future research will explore these possibilities using ROS inhibitors or receptor antagonists in both in vitro and in vivo models.

In this study, we identified JUNB as a novel downstream effector of RUNX1, mechanistically linking RUNX1 to NF-κB-driven inflammation and muscle degeneration. While JUNB-NF-κB interactions are well-documented in chronic inflammatory diseases [8], their role in denervation atrophy was unexplored. Our data reveal that RUNX1 directly binds the JUNB promoter, activating its transcriptional regulatory relationship conserved in fibrotic and muscular pathologies. For instance, in SSc, hypomethylation of both RUNX1 and JUNB drives ECM overproduction [15], paralleling our observation of JUNB upregulation in type I/IIa myonuclei post-denervation. This suggests that RUNX1-JUNB signaling is a shared axis in tissue remodeling across diverse conditions. Importantly, JUNB’s role in macrophage polarization extends beyond muscle atrophy. In endometriosis, JUNB collaborates with AP-1 members (e.g., FOS, FOSB) to drive early-stage M1 polarization and inflammation [16], mirroring our findings in denervated muscle. Conversely, late-stage endometriosis shifts toward M2 polarization, emphasizing JUNB’s context-dependent role in immune modulation. Our work extends these insights by demonstrating that RUNX1-induced JUNB amplifies NF-κB signaling (via p65 phosphorylation), creating a feedforward loop that sustains M1 polarization and cytokine release (e.g., IL-1β, TNF-α). This mechanism aligns with studies in inflammatory skin diseases, where JUNB deficiency enhances NF-κB activation by derepressing SQSTM1/p62, exacerbating inflammation [17]. Similarly, in ischemic stroke, JUNB/NF-κB modulation by Sparganin C promotes microglial M2 polarization, attenuating injury [17]. These parallels underscore JUNB’s universal role as a rheostat for NF-κB activity and macrophage phenotypes.

Critically, our study bridges RUNX1 to the JUNB-NF-κB axis, revealing its dual impact on immune and muscle cells. RUNX1 overexpression in myotubes not only upregulated JUNB but also induced a paracrine inflammatory cascade that polarized macrophages toward M1, further amplifying muscle atrophy markers. This crosstalk highlights the microenvironmental interplay between myocytes and macrophages in driving atrophy. The reversal of these effects by JUNB knockdown confirms its centrality in RUNX1-mediated pathology. Notably, myeloid-specific JUNB deletion in cerebral malaria models reduces IL-1β/TNF production and shifts macrophages toward a regulated phenotype, improving survival [18], a finding that dovetails with our observation that JUNB silencing suppresses M1 polarization and NF-κB activation. Collectively, these data position JUNB as a linchpin connecting transcriptional regulation (via RUNX1) to inflammatory signaling (via NF-κB) in muscle atrophy. A limitation of our study is the use of the immortalized RAW 264.7 macrophage cell line, which may amplify RUNX1-induced signaling and does not fully replicate the complex interactions between macrophages, satellite cells, and fibroblasts in muscle. Future studies should isolate primary macrophages from denervated muscles and employ co-culture systems to validate our findings and further elucidate the physiological relevance.

5 Conclusion

Our findings establish the RUNX1-JUNB-NF-κB axis as a central driver of denervation-induced muscle atrophy. RUNX1 activates JUNB transcription, which in turn amplifies NF-κB signaling to promote M1 macrophage polarization, pro-inflammatory cytokine release, and atrophy-related gene expression. JUNB knockdown reverses these effects, validating its role as a critical mediator. Given that our experiments were conducted in a mouse model, further studies using human muscle tissues or primary human myotubes will be necessary to assess clinical relevance. Future directions include (1) validating RUNX1–JUNB–NF-κB signaling in patient-derived cells, (2) exploring upstream triggers of RUNX1 activation post-denervation, and (3) investigating additional downstream targets of RUNX1 to map the broader regulatory network.

# These authors have contributed equally to this work and share first authorship.

  1. Funding information: This work was supported by the Xianning city level science and technology plan project (2023ZRKX089), Research project of Xianning Central Hospital (2021XYB030) and Natural Science Foundation Project of Hubei Province (2022CFB551).

  2. Author contributions: Yao Huang and Wei Hu wrote the proposal, designed the methodology, coordinated data curation, performed formal analysis, and drafted the original manuscript. Wei Yin, Yang Huang, and Jian Wu contributed to investigation, validation, visualization, resource provision, software support, supervision, and critically revising the manuscript. All authors reviewed and approved the final manuscript.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Yang X, Xue P, Chen H, Yuan M, Kang Y, Duscher D, et al. Denervation drives skeletal muscle atrophy and induces mitochondrial dysfunction, mitophagy and apoptosis via miR-142a-5p/MFN1 axis. Theranostics. 2020;10(3):1415–32.10.7150/thno.40857Search in Google Scholar PubMed PubMed Central

[2] He Z, Song Q, Yu Y, Liu F, Zhao J, Un W, et al. Protein therapy of skeletal muscle atrophy and mechanism by angiogenic factor AGGF1. J Cachexia Sarcopenia Muscle. 2023;14(2):978–91.10.1002/jcsm.13179Search in Google Scholar PubMed PubMed Central

[3] Jablonka-Shariff A, Lu CY, Campbell K, Monk KR, Snyder-Warwick AK. Gpr126/Adgrg6 contributes to the terminal Schwann cell response at the neuromuscular junction following peripheral nerve injury. Glia. 2020;68(6):1182–200.10.1002/glia.23769Search in Google Scholar PubMed PubMed Central

[4] Rossi M, Zuccarelli L, Brocca L, Sazzi C, Gissi C, Rossi P, et al. Dietary nitrate supplementation mitigates age-related changes at the neuromuscular junction in mice. J Physiol. 2025. 10.1113/JP287592.Search in Google Scholar PubMed

[5] Comfort N, Gade M, Strait M, Merwin SJ, Antoniou D, Parodi C, et al. Longitudinal transcriptomic analysis of mouse sciatic nerve reveals pathways associated with age-related muscle pathology. J Cachexia Sarcopenia Muscle. 2023;14(3):1322–36.10.1002/jcsm.13204Search in Google Scholar PubMed PubMed Central

[6] Baehr LM, West DW, Marcotte G, Marshall AG, De Sousa LG, Baar K, et al. Age-related deficits in skeletal muscle recovery following disuse are associated with neuromuscular junction instability and ER stress, not impaired protein synthesis. Aging (Albany NY). 2016;8(1):127–46.10.18632/aging.100879Search in Google Scholar PubMed PubMed Central

[7] White Z, Terrill J, White RB, McMahon C, Sheard P, Grounds MD, et al. Voluntary resistance wheel exercise from mid-life prevents sarcopenia and increases markers of mitochondrial function and autophagy in muscles of old male and female C57BL/6J mice. Skelet Muscle. 2016;6(1):45.10.1186/s13395-016-0117-3Search in Google Scholar PubMed PubMed Central

[8] Sataranatarajan K, Qaisar R, Davis C, Sakellariou GK, Vasilaki A, Zhang Y, et al. Neuron specific reduction in CuZnSOD is not sufficient to initiate a full sarcopenia phenotype. Redox Biol. 2015;5:140–8.10.1016/j.redox.2015.04.005Search in Google Scholar PubMed PubMed Central

[9] Lin H, Ma X, Sun Y, Peng H, Wang Y, Thomas SS, et al. Decoding the transcriptome of denervated muscle at single-nucleus resolution. J Cachexia Sarcopenia Muscle. 2022;13(4):2102–17.10.1002/jcsm.13023Search in Google Scholar PubMed PubMed Central

[10] Brown JL, Peelor 3rd FF, Georgescu C, Wren JD, Kinter M, Tyrrell VJ, et al. Lipid hydroperoxides and oxylipins are mediators of denervation induced muscle atrophy. Redox Biol. 2022;57:102518.10.1016/j.redox.2022.102518Search in Google Scholar PubMed PubMed Central

[11] Schilling BK, Baker JS, Komatsu C, Marra KG. Intramuscular injection of skeletal muscle derived extracellular matrix mitigates denervation atrophy after sciatic nerve transection. J Tissue Eng. 2021;12:20417314211032491.10.1177/20417314211032491Search in Google Scholar PubMed PubMed Central

[12] Yadav A, Dabur R. Skeletal muscle atrophy after sciatic nerve damage: Mechanistic insights. Eur J Pharmacol. 2024;970:176506.10.1016/j.ejphar.2024.176506Search in Google Scholar PubMed

[13] Grönholdt-Klein M, Altun M, Becklén M, Dickman Kahm E, Fahlström A, Rullman E, et al. Muscle atrophy and regeneration associated with behavioural loss and recovery of function after sciatic nerve crush. Acta Physiol (Oxf). 2019;227(3):e13335.10.1111/apha.13335Search in Google Scholar PubMed

[14] Hughes DC, Marcotte GR, Marshall AG, West DWD, Baehr LM, Wallace MA, et al. Age-related differences in dystrophin: impact on force transfer proteins, membrane integrity, and neuromuscular junction stability. J Gerontol A Biol Sci Med Sci. 2017;72(5):640–8.Search in Google Scholar

[15] Altorok N, Tsou PS, Coit P, Khanna D, Sawalha AH. Genome-wide DNA methylation analysis in dermal fibroblasts from patients with diffuse and limited systemic sclerosis reveals common and subset-specific DNA methylation aberrancies. Ann Rheum Dis. 2015;74(8):1612–20.10.1136/annrheumdis-2014-205303Search in Google Scholar PubMed PubMed Central

[16] Poli-Neto OB, Meola J, Rosa ESJC, Tiezzi D. Transcriptome meta-analysis reveals differences of immune profile between eutopic endometrium from stage I-II and III-IV endometriosis independently of hormonal milieu. Sci Rep. 2020;10(1):313.10.1038/s41598-019-57207-ySearch in Google Scholar PubMed PubMed Central

[17] Zhang X, Jin JY, Wu J, Qin X, Streilein R, Hall RP, et al. RNA-Seq and ChIP-Seq reveal SQSTM1/p62 as a key mediator of JunB suppression of NF-κB-dependent inflammation. J Invest Dermatol. 2015;135(4):1016–24.10.1038/jid.2014.519Search in Google Scholar PubMed PubMed Central

[18] Fontana MF, Baccarella A, Kellar D, Oniskey TK, Terinate P, Rosenberg SD, et al. Myeloid expression of the AP-1 transcription factor JUNB modulates outcomes of type 1 and type 2 parasitic infections. Parasite Immunol. 2015;37(9):470–8.10.1111/pim.12215Search in Google Scholar PubMed PubMed Central

Received: 2025-04-10
Revised: 2025-06-30
Accepted: 2025-07-11
Published Online: 2025-08-18

© 2025 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Mechanism of triptolide regulating proliferation and apoptosis of hepatoma cells by inhibiting JAK/STAT pathway
  3. Maslinic acid improves mitochondrial function and inhibits oxidative stress and autophagy in human gastric smooth muscle cells
  4. Comparative analysis of inflammatory biomarkers for the diagnosis of neonatal sepsis: IL-6, IL-8, SAA, CRP, and PCT
  5. Post-pandemic insights on COVID-19 and premature ovarian insufficiency
  6. Proteome differences of dental stem cells between permanent and deciduous teeth by data-independent acquisition proteomics
  7. Optimizing a modified cetyltrimethylammonium bromide protocol for fungal DNA extraction: Insights from multilocus gene amplification
  8. Preliminary analysis of the role of small hepatitis B surface proteins mutations in the pathogenesis of occult hepatitis B infection via the endoplasmic reticulum stress-induced UPR-ERAD pathway
  9. Efficacy of alginate-coated gold nanoparticles against antibiotics-resistant Staphylococcus and Streptococcus pathogens of acne origins
  10. Battling COVID-19 leveraging nanobiotechnology: Gold and silver nanoparticle–B-escin conjugates as SARS-CoV-2 inhibitors
  11. Neurodegenerative diseases and neuroinflammation-induced apoptosis
  12. Impact of fracture fixation surgery on cognitive function and the gut microbiota in mice with a history of stroke
  13. COLEC10: A potential tumor suppressor and prognostic biomarker in hepatocellular carcinoma through modulation of EMT and PI3K-AKT pathways
  14. High-temperature requirement serine protease A2 inhibitor UCF-101 ameliorates damaged neurons in traumatic brain-injured rats by the AMPK/NF-κB pathway
  15. SIK1 inhibits IL-1β-stimulated cartilage apoptosis and inflammation in vitro through the CRTC2/CREB1 signaling
  16. Rutin–chitooligosaccharide complex: Comprehensive evaluation of its anti-inflammatory and analgesic properties in vitro and in vivo
  17. Knockdown of Aurora kinase B alleviates high glucose-triggered trophoblast cells damage and inflammation during gestational diabetes
  18. Calcium-sensing receptors promoted Homer1 expression and osteogenic differentiation in bone marrow mesenchymal stem cells
  19. ABI3BP can inhibit the proliferation, invasion, and epithelial–mesenchymal transition of non-small-cell lung cancer cells
  20. Changes in blood glucose and metabolism in hyperuricemia mice
  21. Rapid detection of the GJB2 c.235delC mutation based on CRISPR-Cas13a combined with lateral flow dipstick
  22. IL-11 promotes Ang II-induced autophagy inhibition and mitochondrial dysfunction in atrial fibroblasts
  23. Short-chain fatty acid attenuates intestinal inflammation by regulation of gut microbial composition in antibiotic-associated diarrhea
  24. Application of metagenomic next-generation sequencing in the diagnosis of pathogens in patients with diabetes complicated by community-acquired pneumonia
  25. NAT10 promotes radiotherapy resistance in non-small cell lung cancer by regulating KPNB1-mediated PD-L1 nuclear translocation
  26. Phytol-mixed micelles alleviate dexamethasone-induced osteoporosis in zebrafish: Activation of the MMP3–OPN–MAPK pathway-mediating bone remodeling
  27. Association between TGF-β1 and β-catenin expression in the vaginal wall of patients with pelvic organ prolapse
  28. Primary pleomorphic liposarcoma involving bilateral ovaries: Case report and literature review
  29. Effects of de novo donor-specific Class I and II antibodies on graft outcomes after liver transplantation: A pilot cohort study
  30. Sleep architecture in Alzheimer’s disease continuum: The deep sleep question
  31. Ephedra fragilis plant extract: A groundbreaking corrosion inhibitor for mild steel in acidic environments – electrochemical, EDX, DFT, and Monte Carlo studies
  32. Langerhans cell histiocytosis in an adult patient with upper jaw and pulmonary involvement: A case report
  33. Inhibition of mast cell activation by Jaranol-targeted Pirin ameliorates allergic responses in mouse allergic rhinitis
  34. Aeromonas veronii-induced septic arthritis of the hip in a child with acute lymphoblastic leukemia
  35. Clusterin activates the heat shock response via the PI3K/Akt pathway to protect cardiomyocytes from high-temperature-induced apoptosis
  36. Research progress on fecal microbiota transplantation in tumor prevention and treatment
  37. Low-pressure exposure influences the development of HAPE
  38. Stigmasterol alleviates endplate chondrocyte degeneration through inducing mitophagy by enhancing PINK1 mRNA acetylation via the ESR1/NAT10 axis
  39. AKAP12, mediated by transcription factor 21, inhibits cell proliferation, metastasis, and glycolysis in lung squamous cell carcinoma
  40. Association between PAX9 or MSX1 gene polymorphism and tooth agenesis risk: A meta-analysis
  41. A case of bloodstream infection caused by Neisseria gonorrhoeae
  42. Case of nasopharyngeal tuberculosis complicated with cervical lymph node and pulmonary tuberculosis
  43. p-Cymene inhibits pro-fibrotic and inflammatory mediators to prevent hepatic dysfunction
  44. GFPT2 promotes paclitaxel resistance in epithelial ovarian cancer cells via activating NF-κB signaling pathway
  45. Transfer RNA-derived fragment tRF-36 modulates varicose vein progression via human vascular smooth muscle cell Notch signaling
  46. RTA-408 attenuates the hepatic ischemia reperfusion injury in mice possibly by activating the Nrf2/HO-1 signaling pathway
  47. Decreased serum TIMP4 levels in patients with rheumatoid arthritis
  48. Sirt1 protects lupus nephritis by inhibiting the NLRP3 signaling pathway in human glomerular mesangial cells
  49. Sodium butyrate aids brain injury repair in neonatal rats
  50. Interaction of MTHFR polymorphism with PAX1 methylation in cervical cancer
  51. Convallatoxin inhibits proliferation and angiogenesis of glioma cells via regulating JAK/STAT3 pathway
  52. The effect of the PKR inhibitor, 2-aminopurine, on the replication of influenza A virus, and segment 8 mRNA splicing
  53. Effects of Ire1 gene on virulence and pathogenicity of Candida albicans
  54. Small cell lung cancer with small intestinal metastasis: Case report and literature review
  55. GRB14: A prognostic biomarker driving tumor progression in gastric cancer through the PI3K/AKT signaling pathway by interacting with COBLL1
  56. 15-Lipoxygenase-2 deficiency induces foam cell formation that can be restored by salidroside through the inhibition of arachidonic acid effects
  57. FTO alleviated the diabetic nephropathy progression by regulating the N6-methyladenosine levels of DACT1
  58. Clinical relevance of inflammatory markers in the evaluation of severity of ulcerative colitis: A retrospective study
  59. Zinc valproic acid complex promotes osteoblast differentiation and exhibits anti-osteoporotic potential
  60. Primary pulmonary synovial sarcoma in the bronchial cavity: A case report
  61. Metagenomic next-generation sequencing of alveolar lavage fluid improves the detection of pulmonary infection
  62. Uterine tumor resembling ovarian sex cord tumor with extensive rhabdoid differentiation: A case report
  63. Genomic analysis of a novel ST11(PR34365) Clostridioides difficile strain isolated from the human fecal of a CDI patient in Guizhou, China
  64. Effects of tiered cardiac rehabilitation on CRP, TNF-α, and physical endurance in older adults with coronary heart disease
  65. Changes in T-lymphocyte subpopulations in patients with colorectal cancer before and after acupoint catgut embedding acupuncture observation
  66. Modulating the tumor microenvironment: The role of traditional Chinese medicine in improving lung cancer treatment
  67. Alterations of metabolites related to microbiota–gut–brain axis in plasma of colon cancer, esophageal cancer, stomach cancer, and lung cancer patients
  68. Research on individualized drug sensitivity detection technology based on bio-3D printing technology for precision treatment of gastrointestinal stromal tumors
  69. CEBPB promotes ulcerative colitis-associated colorectal cancer by stimulating tumor growth and activating the NF-κB/STAT3 signaling pathway
  70. Oncolytic bacteria: A revolutionary approach to cancer therapy
  71. A de novo meningioma with rapid growth: A possible malignancy imposter?
  72. Diagnosis of secondary tuberculosis infection in an asymptomatic elderly with cancer using next-generation sequencing: Case report
  73. Hesperidin and its zinc(ii) complex enhance osteoblast differentiation and bone formation: In vitro and in vivo evaluations
  74. Research progress on the regulation of autophagy in cardiovascular diseases by chemokines
  75. Anti-arthritic, immunomodulatory, and inflammatory regulation by the benzimidazole derivative BMZ-AD: Insights from an FCA-induced rat model
  76. Immunoassay for pyruvate kinase M1/2 as an Alzheimer’s biomarker in CSF
  77. The role of HDAC11 in age-related hearing loss: Mechanisms and therapeutic implications
  78. Evaluation and application analysis of animal models of PIPNP based on data mining
  79. Therapeutic approaches for liver fibrosis/cirrhosis by targeting pyroptosis
  80. Fabrication of zinc oxide nanoparticles using Ruellia tuberosa leaf extract induces apoptosis through P53 and STAT3 signalling pathways in prostate cancer cells
  81. Haplo-hematopoietic stem cell transplantation and immunoradiotherapy for severe aplastic anemia complicated with nasopharyngeal carcinoma: A case report
  82. Modulation of the KEAP1-NRF2 pathway by Erianin: A novel approach to reduce psoriasiform inflammation and inflammatory signaling
  83. The expression of epidermal growth factor receptor 2 and its relationship with tumor-infiltrating lymphocytes and clinical pathological features in breast cancer patients
  84. Innovations in MALDI-TOF Mass Spectrometry: Bridging modern diagnostics and historical insights
  85. BAP1 complexes with YY1 and RBBP7 and its downstream targets in ccRCC cells
  86. Hypereosinophilic syndrome with elevated IgG4 and T-cell clonality: A report of two cases
  87. Electroacupuncture alleviates sciatic nerve injury in sciatica rats by regulating BDNF and NGF levels, myelin sheath degradation, and autophagy
  88. Polydatin prevents cholesterol gallstone formation by regulating cholesterol metabolism via PPAR-γ signaling
  89. RNF144A and RNF144B: Important molecules for health
  90. Analysis of the detection rate and related factors of thyroid nodules in the healthy population
  91. Artesunate inhibits hepatocellular carcinoma cell migration and invasion through OGA-mediated O-GlcNAcylation of ZEB1
  92. Endovascular management of post-pancreatectomy hemorrhage caused by a hepatic artery pseudoaneurysm: Case report and review of the literature
  93. Efficacy and safety of anti-PD-1/PD-L1 antibodies in patients with relapsed refractory diffuse large B-cell lymphoma: A meta-analysis
  94. SATB2 promotes humeral fracture healing in rats by activating the PI3K/AKT pathway
  95. Overexpression of the ferroptosis-related gene, NFS1, corresponds to gastric cancer growth and tumor immune infiltration
  96. Understanding risk factors and prognosis in diabetic foot ulcers
  97. Atractylenolide I alleviates the experimental allergic response in mice by suppressing TLR4/NF-kB/NLRP3 signalling
  98. FBXO31 inhibits the stemness characteristics of CD147 (+) melanoma stem cells
  99. Immune molecule diagnostics in colorectal cancer: CCL2 and CXCL11
  100. Inhibiting CXCR6 promotes senescence of activated hepatic stellate cells with limited proinflammatory SASP to attenuate hepatic fibrosis
  101. Cadmium toxicity, health risk and its remediation using low-cost biochar adsorbents
  102. Pulmonary cryptococcosis with headache as the first presentation: A case report
  103. Solitary pulmonary metastasis with cystic airspaces in colon cancer: A rare case report
  104. RUNX1 promotes denervation-induced muscle atrophy by activating the JUNB/NF-κB pathway and driving M1 macrophage polarization
  105. Morphometric analysis and immunobiological investigation of Indigofera oblongifolia on the infected lung with Plasmodium chabaudi
  106. The NuA4/TIP60 histone-modifying complex and Hr78 modulate the Lobe2 mutant eye phenotype
  107. Experimental study on salmon demineralized bone matrix loaded with recombinant human bone morphogenetic protein-2: In vitro and in vivo study
  108. A case of IgA nephropathy treated with a combination of telitacicept and half-dose glucocorticoids
  109. Analgesic and toxicological evaluation of cannabidiol-rich Moroccan Cannabis sativa L. (Khardala variety) extract: Evidence from an in vivo and in silico study
  110. Wound healing and signaling pathways
  111. Combination of immunotherapy and whole-brain radiotherapy on prognosis of patients with multiple brain metastases: A retrospective cohort study
  112. To explore the relationship between endometrial hyperemia and polycystic ovary syndrome
  113. Research progress on the impact of curcumin on immune responses in breast cancer
  114. Biogenic Cu/Ni nanotherapeutics from Descurainia sophia (L.) Webb ex Prantl seeds for the treatment of lung cancer
  115. Dapagliflozin attenuates atrial fibrosis via the HMGB1/RAGE pathway in atrial fibrillation rats
  116. Glycitein alleviates inflammation and apoptosis in keratinocytes via ROS-associated PI3K–Akt signalling pathway
  117. ADH5 inhibits proliferation but promotes EMT in non-small cell lung cancer cell through activating Smad2/Smad3
  118. Apoptotic efficacies of AgNPs formulated by Syzygium aromaticum leaf extract on 32D-FLT3-ITD human leukemia cell line with PI3K/AKT/mTOR signaling pathway
  119. Novel cuproptosis-related genes C1QBP and PFKP identified as prognostic and therapeutic targets in lung adenocarcinoma
  120. Bee venom promotes exosome secretion and alters miRNA cargo in T cells
  121. Treatment of pure red cell aplasia in a chronic kidney disease patient with roxadustat: A case report
  122. Comparative bioinformatics analysis of the Wnt pathway in breast cancer: Selection of novel biomarker panels associated with ER status
  123. Kynurenine facilitates renal cell carcinoma progression by suppressing M2 macrophage pyroptosis through inhibition of CASP1 cleavage
  124. RFX5 promotes the growth, motility, and inhibits apoptosis of gastric adenocarcinoma cells through the SIRT1/AMPK axis
  125. ALKBH5 exacerbates early cardiac damage after radiotherapy for breast cancer via m6A demethylation of TLR4
  126. Phytochemicals of Roman chamomile: Antioxidant, anti-aging, and whitening activities of distillation residues
  127. Circadian gene Cry1 inhibits the tumorigenicity of hepatocellular carcinoma by the BAX/BCL2-mediated apoptosis pathway
  128. The TNFR-RIPK1/RIPK3 signalling pathway mediates the effect of lanthanum on necroptosis of nerve cells
  129. Longitudinal monitoring of autoantibody dynamics in patients with early-stage non-small-cell lung cancer undergoing surgery
  130. The potential role of rutin, a flavonoid, in the management of cancer through modulation of cell signaling pathways
  131. Construction of pectinase gene engineering microbe and its application in tobacco sheets
  132. Construction of a microbial abundance prognostic scoring model based on intratumoral microbial data for predicting the prognosis of lung squamous cell carcinoma
  133. Sepsis complicated by haemophagocytic lymphohistiocytosis triggered by methicillin-resistant Staphylococcus aureus and human herpesvirus 8 in an immunocompromised elderly patient: A case report
  134. Sarcopenia in liver transplantation: A comprehensive bibliometric study of current research trends and future directions
  135. Advances in cancer immunotherapy and future directions in personalized medicine
  136. Can coronavirus disease 2019 affect male fertility or cause spontaneous abortion? A two-sample Mendelian randomization analysis
  137. Heat stroke associated with novel leukaemia inhibitory factor receptor gene variant in a Chinese infant
  138. PSME2 exacerbates ulcerative colitis by disrupting intestinal barrier function and promoting autophagy-dependent inflammation
  139. Hyperosmolar hyperglycemic state with severe hypernatremia coexisting with central diabetes insipidus: A case report and literature review
  140. Efficacy and mechanism of escin in improving the tissue microenvironment of blood vessel walls via anti-inflammatory and anticoagulant effects: Implications for clinical practice
  141. 10.1515/biol-2025-1168
  142. Ecology and Environmental Science
  143. Optimization and comparative study of Bacillus consortia for cellulolytic potential and cellulase enzyme activity
  144. The complete mitochondrial genome analysis of Haemaphysalis hystricis Supino, 1897 (Ixodida: Ixodidae) and its phylogenetic implications
  145. Epidemiological characteristics and risk factors analysis of multidrug-resistant tuberculosis among tuberculosis population in Huzhou City, Eastern China
  146. Indices of human impacts on landscapes: How do they reflect the proportions of natural habitats?
  147. Genetic analysis of the Siberian flying squirrel population in the northern Changbai Mountains, Northeast China: Insights into population status and conservation
  148. Diversity and environmental drivers of Suillus communities in Pinus sylvestris var. mongolica forests of Inner Mongolia
  149. Global assessment of the fate of nitrogen deposition in forest ecosystems: Insights from 15N tracer studies
  150. Fungal and bacterial pathogenic co-infections mainly lead to the assembly of microbial community in tobacco stems
  151. Influencing of coal industry related airborne particulate matter on ocular surface tear film injury and inflammatory factor expression in Sprague-Dawley rats
  152. Temperature-dependent development, predation, and life table of Sphaerophoria macrogaster (Thomson) (Diptera: Syrphidae) feeding on Myzus persicae (Sulzer) (Homoptera: Aphididae)
  153. Eleonora’s falcon trophic interactions with insects within its breeding range: A systematic review
  154. Agriculture
  155. Integrated analysis of transcriptome, sRNAome, and degradome involved in the drought-response of maize Zhengdan958
  156. Variation in flower frost tolerance among seven apple cultivars and transcriptome response patterns in two contrastingly frost-tolerant selected cultivars
  157. Heritability of durable resistance to stripe rust in bread wheat (Triticum aestivum L.)
  158. Molecular mechanism of follicular development in laying hens based on the regulation of water metabolism
  159. Animal Science
  160. Effect of sex ratio on the life history traits of an important invasive species, Spodoptera frugiperda
  161. Plant Sciences
  162. Hairpin in a haystack: In silico identification and characterization of plant-conserved microRNA in Rafflesiaceae
  163. Widely targeted metabolomics of different tissues in Rubus corchorifolius
  164. The complete chloroplast genome of Gerbera piloselloides (L.) Cass., 1820 (Carduoideae, Asteraceae) and its phylogenetic analysis
  165. Field trial to correlate mineral solubilization activity of Pseudomonas aeruginosa and biochemical content of groundnut plants
  166. Correlation analysis between semen routine parameters and sperm DNA fragmentation index in patients with semen non-liquefaction: A retrospective study
  167. Plasticity of the anatomical traits of Rhododendron L. (Ericaceae) leaves and its implications in adaptation to the plateau environment
  168. Effects of Piriformospora indica and arbuscular mycorrhizal fungus on growth and physiology of Moringa oleifera under low-temperature stress
  169. Effects of different sources of potassium fertiliser on yield, fruit quality and nutrient absorption in “Harward” kiwifruit (Actinidia deliciosa)
  170. Comparative efficiency and residue levels of spraying programs against powdery mildew in grape varieties
  171. The DREB7 transcription factor enhances salt tolerance in soybean plants under salt stress
  172. Using plant electrical signals of water hyacinth (Eichhornia crassipes) for water pollution monitoring
  173. Food Science
  174. Phytochemical analysis of Stachys iva: Discovering the optimal extract conditions and its bioactive compounds
  175. Review on role of honey in disease prevention and treatment through modulation of biological activities
  176. Computational analysis of polymorphic residues in maltose and maltotriose transporters of a wild Saccharomyces cerevisiae strain
  177. Optimization of phenolic compound extraction from Tunisian squash by-products: A sustainable approach for antioxidant and antibacterial applications
  178. Liupao tea aqueous extract alleviates dextran sulfate sodium-induced ulcerative colitis in rats by modulating the gut microbiota
  179. Toxicological qualities and detoxification trends of fruit by-products for valorization: A review
  180. Polyphenolic spectrum of cornelian cherry fruits and their health-promoting effect
  181. Optimizing the encapsulation of the refined extract of squash peels for functional food applications: A sustainable approach to reduce food waste
  182. Advancements in curcuminoid formulations: An update on bioavailability enhancement strategies curcuminoid bioavailability and formulations
  183. Impact of saline sprouting on antioxidant properties and bioactive compounds in chia seeds
  184. The dilemma of food genetics and improvement
  185. Bioengineering and Biotechnology
  186. Impact of hyaluronic acid-modified hafnium metalorganic frameworks containing rhynchophylline on Alzheimer’s disease
  187. Emerging patterns in nanoparticle-based therapeutic approaches for rheumatoid arthritis: A comprehensive bibliometric and visual analysis spanning two decades
  188. Application of CRISPR/Cas gene editing for infectious disease control in poultry
  189. Preparation of hafnium nitride-coated titanium implants by magnetron sputtering technology and evaluation of their antibacterial properties and biocompatibility
  190. Preparation and characterization of lemongrass oil nanoemulsion: Antimicrobial, antibiofilm, antioxidant, and anticancer activities
  191. Corrigendum
  192. Corrigendum to “Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells”
  193. Corrigendum to “Effects of Ire1 gene on virulence and pathogenicity of Candida albicans”
https://doi.org/10.1515/biol-2025-1157
Keywords for this article
RUNX1; JUNB; NF-κB signaling; muscle atrophy; macrophage
Creative Commons
BY 4.0

Articles in the same Issue

  1. Biomedical Sciences
  2. Mechanism of triptolide regulating proliferation and apoptosis of hepatoma cells by inhibiting JAK/STAT pathway
  3. Maslinic acid improves mitochondrial function and inhibits oxidative stress and autophagy in human gastric smooth muscle cells
  4. Comparative analysis of inflammatory biomarkers for the diagnosis of neonatal sepsis: IL-6, IL-8, SAA, CRP, and PCT
  5. Post-pandemic insights on COVID-19 and premature ovarian insufficiency
  6. Proteome differences of dental stem cells between permanent and deciduous teeth by data-independent acquisition proteomics
  7. Optimizing a modified cetyltrimethylammonium bromide protocol for fungal DNA extraction: Insights from multilocus gene amplification
  8. Preliminary analysis of the role of small hepatitis B surface proteins mutations in the pathogenesis of occult hepatitis B infection via the endoplasmic reticulum stress-induced UPR-ERAD pathway
  9. Efficacy of alginate-coated gold nanoparticles against antibiotics-resistant Staphylococcus and Streptococcus pathogens of acne origins
  10. Battling COVID-19 leveraging nanobiotechnology: Gold and silver nanoparticle–B-escin conjugates as SARS-CoV-2 inhibitors
  11. Neurodegenerative diseases and neuroinflammation-induced apoptosis
  12. Impact of fracture fixation surgery on cognitive function and the gut microbiota in mice with a history of stroke
  13. COLEC10: A potential tumor suppressor and prognostic biomarker in hepatocellular carcinoma through modulation of EMT and PI3K-AKT pathways
  14. High-temperature requirement serine protease A2 inhibitor UCF-101 ameliorates damaged neurons in traumatic brain-injured rats by the AMPK/NF-κB pathway
  15. SIK1 inhibits IL-1β-stimulated cartilage apoptosis and inflammation in vitro through the CRTC2/CREB1 signaling
  16. Rutin–chitooligosaccharide complex: Comprehensive evaluation of its anti-inflammatory and analgesic properties in vitro and in vivo
  17. Knockdown of Aurora kinase B alleviates high glucose-triggered trophoblast cells damage and inflammation during gestational diabetes
  18. Calcium-sensing receptors promoted Homer1 expression and osteogenic differentiation in bone marrow mesenchymal stem cells
  19. ABI3BP can inhibit the proliferation, invasion, and epithelial–mesenchymal transition of non-small-cell lung cancer cells
  20. Changes in blood glucose and metabolism in hyperuricemia mice
  21. Rapid detection of the GJB2 c.235delC mutation based on CRISPR-Cas13a combined with lateral flow dipstick
  22. IL-11 promotes Ang II-induced autophagy inhibition and mitochondrial dysfunction in atrial fibroblasts
  23. Short-chain fatty acid attenuates intestinal inflammation by regulation of gut microbial composition in antibiotic-associated diarrhea
  24. Application of metagenomic next-generation sequencing in the diagnosis of pathogens in patients with diabetes complicated by community-acquired pneumonia
  25. NAT10 promotes radiotherapy resistance in non-small cell lung cancer by regulating KPNB1-mediated PD-L1 nuclear translocation
  26. Phytol-mixed micelles alleviate dexamethasone-induced osteoporosis in zebrafish: Activation of the MMP3–OPN–MAPK pathway-mediating bone remodeling
  27. Association between TGF-β1 and β-catenin expression in the vaginal wall of patients with pelvic organ prolapse
  28. Primary pleomorphic liposarcoma involving bilateral ovaries: Case report and literature review
  29. Effects of de novo donor-specific Class I and II antibodies on graft outcomes after liver transplantation: A pilot cohort study
  30. Sleep architecture in Alzheimer’s disease continuum: The deep sleep question
  31. Ephedra fragilis plant extract: A groundbreaking corrosion inhibitor for mild steel in acidic environments – electrochemical, EDX, DFT, and Monte Carlo studies
  32. Langerhans cell histiocytosis in an adult patient with upper jaw and pulmonary involvement: A case report
  33. Inhibition of mast cell activation by Jaranol-targeted Pirin ameliorates allergic responses in mouse allergic rhinitis
  34. Aeromonas veronii-induced septic arthritis of the hip in a child with acute lymphoblastic leukemia
  35. Clusterin activates the heat shock response via the PI3K/Akt pathway to protect cardiomyocytes from high-temperature-induced apoptosis
  36. Research progress on fecal microbiota transplantation in tumor prevention and treatment
  37. Low-pressure exposure influences the development of HAPE
  38. Stigmasterol alleviates endplate chondrocyte degeneration through inducing mitophagy by enhancing PINK1 mRNA acetylation via the ESR1/NAT10 axis
  39. AKAP12, mediated by transcription factor 21, inhibits cell proliferation, metastasis, and glycolysis in lung squamous cell carcinoma
  40. Association between PAX9 or MSX1 gene polymorphism and tooth agenesis risk: A meta-analysis
  41. A case of bloodstream infection caused by Neisseria gonorrhoeae
  42. Case of nasopharyngeal tuberculosis complicated with cervical lymph node and pulmonary tuberculosis
  43. p-Cymene inhibits pro-fibrotic and inflammatory mediators to prevent hepatic dysfunction
  44. GFPT2 promotes paclitaxel resistance in epithelial ovarian cancer cells via activating NF-κB signaling pathway
  45. Transfer RNA-derived fragment tRF-36 modulates varicose vein progression via human vascular smooth muscle cell Notch signaling
  46. RTA-408 attenuates the hepatic ischemia reperfusion injury in mice possibly by activating the Nrf2/HO-1 signaling pathway
  47. Decreased serum TIMP4 levels in patients with rheumatoid arthritis
  48. Sirt1 protects lupus nephritis by inhibiting the NLRP3 signaling pathway in human glomerular mesangial cells
  49. Sodium butyrate aids brain injury repair in neonatal rats
  50. Interaction of MTHFR polymorphism with PAX1 methylation in cervical cancer
  51. Convallatoxin inhibits proliferation and angiogenesis of glioma cells via regulating JAK/STAT3 pathway
  52. The effect of the PKR inhibitor, 2-aminopurine, on the replication of influenza A virus, and segment 8 mRNA splicing
  53. Effects of Ire1 gene on virulence and pathogenicity of Candida albicans
  54. Small cell lung cancer with small intestinal metastasis: Case report and literature review
  55. GRB14: A prognostic biomarker driving tumor progression in gastric cancer through the PI3K/AKT signaling pathway by interacting with COBLL1
  56. 15-Lipoxygenase-2 deficiency induces foam cell formation that can be restored by salidroside through the inhibition of arachidonic acid effects
  57. FTO alleviated the diabetic nephropathy progression by regulating the N6-methyladenosine levels of DACT1
  58. Clinical relevance of inflammatory markers in the evaluation of severity of ulcerative colitis: A retrospective study
  59. Zinc valproic acid complex promotes osteoblast differentiation and exhibits anti-osteoporotic potential
  60. Primary pulmonary synovial sarcoma in the bronchial cavity: A case report
  61. Metagenomic next-generation sequencing of alveolar lavage fluid improves the detection of pulmonary infection
  62. Uterine tumor resembling ovarian sex cord tumor with extensive rhabdoid differentiation: A case report
  63. Genomic analysis of a novel ST11(PR34365) Clostridioides difficile strain isolated from the human fecal of a CDI patient in Guizhou, China
  64. Effects of tiered cardiac rehabilitation on CRP, TNF-α, and physical endurance in older adults with coronary heart disease
  65. Changes in T-lymphocyte subpopulations in patients with colorectal cancer before and after acupoint catgut embedding acupuncture observation
  66. Modulating the tumor microenvironment: The role of traditional Chinese medicine in improving lung cancer treatment
  67. Alterations of metabolites related to microbiota–gut–brain axis in plasma of colon cancer, esophageal cancer, stomach cancer, and lung cancer patients
  68. Research on individualized drug sensitivity detection technology based on bio-3D printing technology for precision treatment of gastrointestinal stromal tumors
  69. CEBPB promotes ulcerative colitis-associated colorectal cancer by stimulating tumor growth and activating the NF-κB/STAT3 signaling pathway
  70. Oncolytic bacteria: A revolutionary approach to cancer therapy
  71. A de novo meningioma with rapid growth: A possible malignancy imposter?
  72. Diagnosis of secondary tuberculosis infection in an asymptomatic elderly with cancer using next-generation sequencing: Case report
  73. Hesperidin and its zinc(ii) complex enhance osteoblast differentiation and bone formation: In vitro and in vivo evaluations
  74. Research progress on the regulation of autophagy in cardiovascular diseases by chemokines
  75. Anti-arthritic, immunomodulatory, and inflammatory regulation by the benzimidazole derivative BMZ-AD: Insights from an FCA-induced rat model
  76. Immunoassay for pyruvate kinase M1/2 as an Alzheimer’s biomarker in CSF
  77. The role of HDAC11 in age-related hearing loss: Mechanisms and therapeutic implications
  78. Evaluation and application analysis of animal models of PIPNP based on data mining
  79. Therapeutic approaches for liver fibrosis/cirrhosis by targeting pyroptosis
  80. Fabrication of zinc oxide nanoparticles using Ruellia tuberosa leaf extract induces apoptosis through P53 and STAT3 signalling pathways in prostate cancer cells
  81. Haplo-hematopoietic stem cell transplantation and immunoradiotherapy for severe aplastic anemia complicated with nasopharyngeal carcinoma: A case report
  82. Modulation of the KEAP1-NRF2 pathway by Erianin: A novel approach to reduce psoriasiform inflammation and inflammatory signaling
  83. The expression of epidermal growth factor receptor 2 and its relationship with tumor-infiltrating lymphocytes and clinical pathological features in breast cancer patients
  84. Innovations in MALDI-TOF Mass Spectrometry: Bridging modern diagnostics and historical insights
  85. BAP1 complexes with YY1 and RBBP7 and its downstream targets in ccRCC cells
  86. Hypereosinophilic syndrome with elevated IgG4 and T-cell clonality: A report of two cases
  87. Electroacupuncture alleviates sciatic nerve injury in sciatica rats by regulating BDNF and NGF levels, myelin sheath degradation, and autophagy
  88. Polydatin prevents cholesterol gallstone formation by regulating cholesterol metabolism via PPAR-γ signaling
  89. RNF144A and RNF144B: Important molecules for health
  90. Analysis of the detection rate and related factors of thyroid nodules in the healthy population
  91. Artesunate inhibits hepatocellular carcinoma cell migration and invasion through OGA-mediated O-GlcNAcylation of ZEB1
  92. Endovascular management of post-pancreatectomy hemorrhage caused by a hepatic artery pseudoaneurysm: Case report and review of the literature
  93. Efficacy and safety of anti-PD-1/PD-L1 antibodies in patients with relapsed refractory diffuse large B-cell lymphoma: A meta-analysis
  94. SATB2 promotes humeral fracture healing in rats by activating the PI3K/AKT pathway
  95. Overexpression of the ferroptosis-related gene, NFS1, corresponds to gastric cancer growth and tumor immune infiltration
  96. Understanding risk factors and prognosis in diabetic foot ulcers
  97. Atractylenolide I alleviates the experimental allergic response in mice by suppressing TLR4/NF-kB/NLRP3 signalling
  98. FBXO31 inhibits the stemness characteristics of CD147 (+) melanoma stem cells
  99. Immune molecule diagnostics in colorectal cancer: CCL2 and CXCL11
  100. Inhibiting CXCR6 promotes senescence of activated hepatic stellate cells with limited proinflammatory SASP to attenuate hepatic fibrosis
  101. Cadmium toxicity, health risk and its remediation using low-cost biochar adsorbents
  102. Pulmonary cryptococcosis with headache as the first presentation: A case report
  103. Solitary pulmonary metastasis with cystic airspaces in colon cancer: A rare case report
  104. RUNX1 promotes denervation-induced muscle atrophy by activating the JUNB/NF-κB pathway and driving M1 macrophage polarization
  105. Morphometric analysis and immunobiological investigation of Indigofera oblongifolia on the infected lung with Plasmodium chabaudi
  106. The NuA4/TIP60 histone-modifying complex and Hr78 modulate the Lobe2 mutant eye phenotype
  107. Experimental study on salmon demineralized bone matrix loaded with recombinant human bone morphogenetic protein-2: In vitro and in vivo study
  108. A case of IgA nephropathy treated with a combination of telitacicept and half-dose glucocorticoids
  109. Analgesic and toxicological evaluation of cannabidiol-rich Moroccan Cannabis sativa L. (Khardala variety) extract: Evidence from an in vivo and in silico study
  110. Wound healing and signaling pathways
  111. Combination of immunotherapy and whole-brain radiotherapy on prognosis of patients with multiple brain metastases: A retrospective cohort study
  112. To explore the relationship between endometrial hyperemia and polycystic ovary syndrome
  113. Research progress on the impact of curcumin on immune responses in breast cancer
  114. Biogenic Cu/Ni nanotherapeutics from Descurainia sophia (L.) Webb ex Prantl seeds for the treatment of lung cancer
  115. Dapagliflozin attenuates atrial fibrosis via the HMGB1/RAGE pathway in atrial fibrillation rats
  116. Glycitein alleviates inflammation and apoptosis in keratinocytes via ROS-associated PI3K–Akt signalling pathway
  117. ADH5 inhibits proliferation but promotes EMT in non-small cell lung cancer cell through activating Smad2/Smad3
  118. Apoptotic efficacies of AgNPs formulated by Syzygium aromaticum leaf extract on 32D-FLT3-ITD human leukemia cell line with PI3K/AKT/mTOR signaling pathway
  119. Novel cuproptosis-related genes C1QBP and PFKP identified as prognostic and therapeutic targets in lung adenocarcinoma
  120. Bee venom promotes exosome secretion and alters miRNA cargo in T cells
  121. Treatment of pure red cell aplasia in a chronic kidney disease patient with roxadustat: A case report
  122. Comparative bioinformatics analysis of the Wnt pathway in breast cancer: Selection of novel biomarker panels associated with ER status
  123. Kynurenine facilitates renal cell carcinoma progression by suppressing M2 macrophage pyroptosis through inhibition of CASP1 cleavage
  124. RFX5 promotes the growth, motility, and inhibits apoptosis of gastric adenocarcinoma cells through the SIRT1/AMPK axis
  125. ALKBH5 exacerbates early cardiac damage after radiotherapy for breast cancer via m6A demethylation of TLR4
  126. Phytochemicals of Roman chamomile: Antioxidant, anti-aging, and whitening activities of distillation residues
  127. Circadian gene Cry1 inhibits the tumorigenicity of hepatocellular carcinoma by the BAX/BCL2-mediated apoptosis pathway
  128. The TNFR-RIPK1/RIPK3 signalling pathway mediates the effect of lanthanum on necroptosis of nerve cells
  129. Longitudinal monitoring of autoantibody dynamics in patients with early-stage non-small-cell lung cancer undergoing surgery
  130. The potential role of rutin, a flavonoid, in the management of cancer through modulation of cell signaling pathways
  131. Construction of pectinase gene engineering microbe and its application in tobacco sheets
  132. Construction of a microbial abundance prognostic scoring model based on intratumoral microbial data for predicting the prognosis of lung squamous cell carcinoma
  133. Sepsis complicated by haemophagocytic lymphohistiocytosis triggered by methicillin-resistant Staphylococcus aureus and human herpesvirus 8 in an immunocompromised elderly patient: A case report
  134. Sarcopenia in liver transplantation: A comprehensive bibliometric study of current research trends and future directions
  135. Advances in cancer immunotherapy and future directions in personalized medicine
  136. Can coronavirus disease 2019 affect male fertility or cause spontaneous abortion? A two-sample Mendelian randomization analysis
  137. Heat stroke associated with novel leukaemia inhibitory factor receptor gene variant in a Chinese infant
  138. PSME2 exacerbates ulcerative colitis by disrupting intestinal barrier function and promoting autophagy-dependent inflammation
  139. Hyperosmolar hyperglycemic state with severe hypernatremia coexisting with central diabetes insipidus: A case report and literature review
  140. Efficacy and mechanism of escin in improving the tissue microenvironment of blood vessel walls via anti-inflammatory and anticoagulant effects: Implications for clinical practice
  141. 10.1515/biol-2025-1168
  142. Ecology and Environmental Science
  143. Optimization and comparative study of Bacillus consortia for cellulolytic potential and cellulase enzyme activity
  144. The complete mitochondrial genome analysis of Haemaphysalis hystricis Supino, 1897 (Ixodida: Ixodidae) and its phylogenetic implications
  145. Epidemiological characteristics and risk factors analysis of multidrug-resistant tuberculosis among tuberculosis population in Huzhou City, Eastern China
  146. Indices of human impacts on landscapes: How do they reflect the proportions of natural habitats?
  147. Genetic analysis of the Siberian flying squirrel population in the northern Changbai Mountains, Northeast China: Insights into population status and conservation
  148. Diversity and environmental drivers of Suillus communities in Pinus sylvestris var. mongolica forests of Inner Mongolia
  149. Global assessment of the fate of nitrogen deposition in forest ecosystems: Insights from 15N tracer studies
  150. Fungal and bacterial pathogenic co-infections mainly lead to the assembly of microbial community in tobacco stems
  151. Influencing of coal industry related airborne particulate matter on ocular surface tear film injury and inflammatory factor expression in Sprague-Dawley rats
  152. Temperature-dependent development, predation, and life table of Sphaerophoria macrogaster (Thomson) (Diptera: Syrphidae) feeding on Myzus persicae (Sulzer) (Homoptera: Aphididae)
  153. Eleonora’s falcon trophic interactions with insects within its breeding range: A systematic review
  154. Agriculture
  155. Integrated analysis of transcriptome, sRNAome, and degradome involved in the drought-response of maize Zhengdan958
  156. Variation in flower frost tolerance among seven apple cultivars and transcriptome response patterns in two contrastingly frost-tolerant selected cultivars
  157. Heritability of durable resistance to stripe rust in bread wheat (Triticum aestivum L.)
  158. Molecular mechanism of follicular development in laying hens based on the regulation of water metabolism
  159. Animal Science
  160. Effect of sex ratio on the life history traits of an important invasive species, Spodoptera frugiperda
  161. Plant Sciences
  162. Hairpin in a haystack: In silico identification and characterization of plant-conserved microRNA in Rafflesiaceae
  163. Widely targeted metabolomics of different tissues in Rubus corchorifolius
  164. The complete chloroplast genome of Gerbera piloselloides (L.) Cass., 1820 (Carduoideae, Asteraceae) and its phylogenetic analysis
  165. Field trial to correlate mineral solubilization activity of Pseudomonas aeruginosa and biochemical content of groundnut plants
  166. Correlation analysis between semen routine parameters and sperm DNA fragmentation index in patients with semen non-liquefaction: A retrospective study
  167. Plasticity of the anatomical traits of Rhododendron L. (Ericaceae) leaves and its implications in adaptation to the plateau environment
  168. Effects of Piriformospora indica and arbuscular mycorrhizal fungus on growth and physiology of Moringa oleifera under low-temperature stress
  169. Effects of different sources of potassium fertiliser on yield, fruit quality and nutrient absorption in “Harward” kiwifruit (Actinidia deliciosa)
  170. Comparative efficiency and residue levels of spraying programs against powdery mildew in grape varieties
  171. The DREB7 transcription factor enhances salt tolerance in soybean plants under salt stress
  172. Using plant electrical signals of water hyacinth (Eichhornia crassipes) for water pollution monitoring
  173. Food Science
  174. Phytochemical analysis of Stachys iva: Discovering the optimal extract conditions and its bioactive compounds
  175. Review on role of honey in disease prevention and treatment through modulation of biological activities
  176. Computational analysis of polymorphic residues in maltose and maltotriose transporters of a wild Saccharomyces cerevisiae strain
  177. Optimization of phenolic compound extraction from Tunisian squash by-products: A sustainable approach for antioxidant and antibacterial applications
  178. Liupao tea aqueous extract alleviates dextran sulfate sodium-induced ulcerative colitis in rats by modulating the gut microbiota
  179. Toxicological qualities and detoxification trends of fruit by-products for valorization: A review
  180. Polyphenolic spectrum of cornelian cherry fruits and their health-promoting effect
  181. Optimizing the encapsulation of the refined extract of squash peels for functional food applications: A sustainable approach to reduce food waste
  182. Advancements in curcuminoid formulations: An update on bioavailability enhancement strategies curcuminoid bioavailability and formulations
  183. Impact of saline sprouting on antioxidant properties and bioactive compounds in chia seeds
  184. The dilemma of food genetics and improvement
  185. Bioengineering and Biotechnology
  186. Impact of hyaluronic acid-modified hafnium metalorganic frameworks containing rhynchophylline on Alzheimer’s disease
  187. Emerging patterns in nanoparticle-based therapeutic approaches for rheumatoid arthritis: A comprehensive bibliometric and visual analysis spanning two decades
  188. Application of CRISPR/Cas gene editing for infectious disease control in poultry
  189. Preparation of hafnium nitride-coated titanium implants by magnetron sputtering technology and evaluation of their antibacterial properties and biocompatibility
  190. Preparation and characterization of lemongrass oil nanoemulsion: Antimicrobial, antibiofilm, antioxidant, and anticancer activities
  191. Corrigendum
  192. Corrigendum to “Utilization of convolutional neural networks to analyze microscopic images for high-throughput screening of mesenchymal stem cells”
  193. Corrigendum to “Effects of Ire1 gene on virulence and pathogenicity of Candida albicans”
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 14.11.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2025-1157/html
Scroll to top button