Home Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
Article Open Access

Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1

  • Jin Shu , Jue Shi , Yiwen Gu , Lei Deng , Chen Zhao , Chun Wu , Jiachen Zhao , Haiya Wang EMAIL logo and Li Jin EMAIL logo
Published/Copyright: February 9, 2023
Download Article (PDF)
Open Life Sciences
From the journal Open Life Sciences Volume 18 Issue 1

Abstract

This study aimed to explore the effects of tissue inhibitor of metalloproteinases‐1 (TIMP‐1) on levocarnitine (LC)-mediated regulation of angiotensin II (AngII)-induced myocardial fibrosis (MF) and its underlying mechanisms. H9C2 cells were treated with AngII for 24 h to induce fibrosis. The cells were then treated with LC or transfected with TIMP‐1-OE plasmid/si‑TIMP‐1. Cell apoptosis, viability, migration, and related gene expression were analyzed. AngII treatment significantly upregulated Axl, α-SMA, and MMP3 expression (P < 0.05) and downregulated STAT4 and TIMP1 expression (P < 0.05) relative to the control levels. After transfection, cells with TIMP-1 overexpression/knockdown were successfully established. Compared with that of the control, AngII significantly inhibited cell viability and cell migration while promoting cell apoptosis (P < 0.05). LC and TIMP-1-OE transfection further suppressed cell viability and migration induced by Ang II and upregulated apoptosis, whereas si-TIMP-1 had the opposite effect. Furthermore, LC and TIMP-1-OE transfection downregulated Axl, AT1R, α-SMA, collagen III, Bcl-2, and MMP3 expression caused by AngII and upregulated caspase 3, p53, and STAT4 expression, whereas si-TIMP-1 had the opposite effect. TIMP-1 is therefore a potential therapeutic target for delaying MF progression.

Keywords: tissue inhibitor of metalloproteinases-1; myocardial fibrosis; levocarnitine; angiotensin II

1 Introduction

Heart failure (HF) is a global threat affecting 23 million people worldwide, and its prevalence continues to increase over time [1]. At a certain stage, myocardial fibrosis (MF) may be the leading cause of vasomotor dysfunction and myocardial disarray in various cardiovascular diseases, characterized by myocardial structural destruction, excessive cardiac interstitial fibroblast proliferation, and deposition [2,3]. Among patients with coronary artery disease, MF is strongly associated with sudden cardiac death [4] and long-term mortality in patients with HF [5]; thus, inhibiting MF progression is highly important. However, current therapeutics, including β-blockers, endothelin antagonists, ATI receptor antagonists, angiotensin-converting enzymes, and statins, usually display significant adverse effects [6,7]. Therefore, there is an urgent need to further explore the pathogenesis of MF and identify novel therapeutic targets to delay MF and improve HF outcomes.

Levocarnitine (LC) has good therapeutic potential for treating cardiovascular disease (HF and myocardial infarction), and a large body of experimental and clinical evidence supports the role of LC in suppressing fibrosis progression [8,9]. LC can improve angiotensin II (AngII)-induced reactive oxygen species (ROS) generation, AT1R expression, and collagen accumulation, thereby inhibiting cardiac fibrosis [10]. Zhao et al. showed that LC could inhibit the expression of proinflammatory and profibrotic cytokines and decrease intracellular production of ROS, followed by a significant reduction in renal tubulointerstitial inflammation and fibrosis [11]. Another study reported that LC protected against cardiac and renal damage by inhibiting oxidative stress and increasing antioxidant enzyme function by inhibiting TNF-α and IL-1β in isoprenaline-treated MI rat models [12]. These reports indicate that LC may affect fibrosis and protect cardiac function; however, the mechanisms of LC in MF progression remain unclear.

Tissue inhibitors of matrix metalloproteinases-1 (TIMP-1), a member of the TIMP family, are glycoproteins expressed in a variety of tissues and organs that can inhibit the activity of matrix metalloproteinase (MMP3) [13]. The role of TIMP-1 in the development of liver fibrosis has been widely reported [14]. Further evidence demonstrated that AngII could reduce TIMP-1 expression via AT1R and phosphokinase C, ultimately affecting collagen deposition [15]. TIMP family members are involved in MF regulation through the alteration of the intercellular matrix via inhibition of the activity of MMP family members [13]. MMP3 is significantly upregulated in AngII-induced MF cells, and its knockdown could delay MF progression by altering the activity of AngII‑induced MF by regulating genes related to oxidative stress and cell apoptosis [16]. These results indicated the importance of TIMP-1 in MF. However, the specific effects of TIMP-1 on the regulation of MF progression by LC remain unclear.

AngII is a cytokine with many biological functions, including growth factor-like effects. By mainly binding to its receptor AT1, AngII can promote the occurrence of MF because it can not only induce cardiomyocyte hypertrophy but also stimulate the proliferation of cardiac fibroblasts and collagen synthesis [17,18]. In the progression of MF, AngII acts as a critical signaling molecule associated with the renin-angiotensin system (RAS) [19]. Cellular changes within fibrosis induced by AngII are similar to those in humans [20]. A previous study by Chen et al. used 100 nM AngII to induce human cardiac fibroblasts to simulate fibrosis for 48 h, and the significant increase in fibrosis-related indicators after Ang II induction suggested the occurrence of fibrosis [21]. Another study applied 100 nM Ang II to stimulate cardiac fibroblasts for 24 h to induce cell fibrosis [22]. These reports demonstrated that AngII-induced MF in H9C2 cells can be used for experiments. Therefore, in this study, AngII was used to treat H9C2 cells for 24 h to induce cellular fibrosis. Next, the cells were treated with LC or transfected with TIMP‐1-OE/si‑TIMP‐1 plasmid to further investigate the roles of TIMP-1 in LC regulation of AngII-induced MF and their related mechanisms. These findings would help to improve our understanding of MF-based cardiovascular diseases and provide new therapeutic strategies for the prevention and delay of MF.

2 Materials and methods

2.1 Cell culture

H9C2 rat myocardial cells were purchased from the Chinese Academy of Sciences Cell Bank (Shanghai, China). The cells were cultured in Dulbecco’s modified Eagle’s medium (Wuhan Boster Biological Technology) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (Thermo Fisher Scientific) and then maintained at 37℃ with 5% CO2.

2.2 Cell transfection

H9C2 cells at a density of 5 × 105 cells per well were seeded into six-well plates and cultured overnight. Then, the complete culture medium was replaced with serum-free medium, and H9C2 cells were transfected with 100 nM si-NC/si-TIMP-1 (1/2/3) or NC/TIMP-1-OE plasmid using Lipofectamine® 3000 (Thermo Fisher Scientific, Inc.), according to the manufacturer’s protocols. NC and TIMP-1-OE plasmids and si-NC/si-TIMP-1 (1/2/3) were purchased from Yanzai Biotechnology (Shanghai) Co., Ltd (Shanghai, China). After 6 h of transfection, the serum-free medium was replaced with a complete culture medium. After culturing for another 24 h, total RNA was isolated from the cells with different treatments, and cell transfection efficiency was assessed by determining TIMP-1 expression using quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and western blotting.

2.3 Induction of cellular MF and cell grouping

H9C2 cells (5 × 105 cells per well) were seeded in 12‑well plates and cultured overnight. The next day, cells were treated with 10−8 M AngII for 24 h. After 24 h of AngII treatment, the cells were harvested to extract total RNA for the examination of MF- and fibroblast-related genes.

H9C2 cells were divided into five groups: control, MF, MF + LC, MF + LC + si-TIMP-1, and MF + LC + TIMP-1-OE. The cells in the MF and MF + LC groups were first treated with AngII for 24 h and then treated with equal amounts of PBS and 100 µM LC for another 24 h. The cells in the MF + LC + si-TIMP-1 and MF + LC + TIMP-1-OE groups were transfected with si-TIMP-1 and TIMP-1-OE plasmids, respectively. After transfection, TIMP-1 knockdown and overexpression cells were stimulated with 10−8 M AngII for 24 h and then treated with 100 µM LC. The cells in the control group were not treated. Cells subjected to different treatments were harvested for subsequent experiments.

2.4 Cell viability and apoptosis assays

The Cell Counting Kit-8 (CCK-8) was used to evaluate the effects of TIMP-1 on the viability of fibrotic H9C2 cells. Briefly, cells in the different groups were collected and seeded into a 96-well plate (1 × 104 cells per well). After culturing for 24, 48, 72, and 96 h, 10 µL of CCK-8 reagent was added, and the cells were further incubated for 2.5 h at 37℃. Finally, the absorbance at 450 nm was measured using a microplate reader.

The Annexin V-FITC Apoptosis Detection kit (Beyotime Institute of Biotechnology) was used to assess cell apoptosis, following the manufacturer’s recommendations. Briefly, H9C2 cells with different treatments for 48 h were harvested by centrifugation for 5 min at 1,000×g and resuspended in 195 µL of Annexin V-FITC. Then, 10 µL of PI and 5 µL of Annexin V-FITC were added to the cells, and the cells were incubated in the dark for 20 min at 20℃. Finally, a FACSCalibur flow cytometer (Becton-Dickinson) was used to acquire images of cells, and CellQuest software (version 4, Becton, Dickinson and Company) was used to calculate the apoptosis rate (early plus late apoptosis) in the different groups.

2.5 Cell migration evaluation

The effects of TIMP-1 on cell migration were investigated using transwell chambers (TCS003024, Guangzhou Jet Bio-Filtration Co., Ltd). Briefly, H9C2 cells with different treatments at a density of 6 × 104 cells per well were seeded into the upper chamber of the transwell chambers. In the lower chamber, the complete medium containing 10% FBS was added. After incubation at 37°C for 24 h, the cells were treated with 4% paraformaldehyde for 10 min and stained with 0.5% crystal violet for 10 min. Finally, a microscope was used to observe cell migration, and the cell numbers were analyzed.

2.6 qRT-PCR

Total RNA was isolated from the cells with different treatments using TRIzol® reagent (Thermo Fisher Scientific, Inc.), and the concentration and quality of the isolated RNA were measured using a UV spectrophotometer. Then, using the PrimeScript™ II 1st Strand cDNA Synthesis kit (Takara Bio, Inc.), RNA was reverse-transcribed into cDNA according to the manufacturer’s instructions. Next, SYBR Premix EX Taq (Thermo Fisher Scientific, Inc.) was used to perform qPCR using the ViiA7 real-time PCR system (ABI). The amplification procedure was as follows: 95°C for 3 min and 40 cycles of 95°C for 10 s, 60°C for 30 s, and 60°C for 30 s. mRNA expression levels were calculated using the 2–ΔΔCt method. The primer sequences are listed in Table 1. GAPDH was used as the housekeeping gene.

Table 1

Sequences of all primers

Primer Sequence (5′–3′)
GAPDH F: AGACAGCCGCATCTTCTTGT
R: CTTGCCGTGGGTAGAGTCAT
MMP3 F: CAGGCATTGGCACAAAGGTG
R: GTGGGTCACTTTCCCTGCAT
Axl F: GCCCAGTGAGTGAACCCC
R: TCTCCTTCAGCTCTTCGCTG
Bcl-2 F: GACTGAGTACCTGAACCGGCATC
R: CTGAGCAGCGTCTTCAGAGACA
Caspase 3 F: GAATCCACGAGCAGAGTC
R: TCAACAAGCCAACCAAGT
p53 F: ACAGTTAGGGGGTACCTGGC
R: GCTGTGGTGGGCAGAATATCAT
α-SMA- F: GGAGATGGCGTGACTCACAA
R: CGCTCAGCAGTAGTCACGAA
TIMP-1 F: TAAAGCCTGTAGCTGTGCCC
R: AGCGTCGAATCCTTTGAGCA
Collagen III (COL3A1) F: CGGAGGAATGGGTGGCTATC
R: ACCAGCTGGGCCTTTGATAC
AT1R F: GGAAACAGCTTGGTGGTGAT
R: CACACTGGCGTAGAGGTTGA
STAT4 F: ACCTGAGTAAGGCTGTCC
R: TCAGTTCCTACCCACTCTAT
COL1A1 F: ACTTAACATCCAAGGCCGCT
R: ACAATATTTGCCTCAGTTTGTGC
FSP1 F: TGTAATAGTGTCCACCTTCC
R: TTCATTGTCCCTGTTGCT
TGF-β1 F: ATGGTGGACCGCAACAAC
R: TGAGCACTGAAGCGAAAGC

2.7 Western blotting

The total protein of the cells with different treatments was extracted using RIPA lysis buffer, and a BCA protein assay kit was used to measure the total protein concentrations. After that, the protein samples (20 μg) were separated by 10% SDS-PAGE and transferred onto polyvinylidene difluoride membranes. After blocking with 5% skim milk at 37°C for 2 h, the membranes were incubated with anti-Axl antibody (1:1,000; Protein Tech Group, Inc.), anti-α-SMA antibody (1:1,000; Protein Tech Group, Inc.), anti-MMP3 antibody (1:1,000; Protein Tech Group, Inc.), anti-STAT4 antibody (1:1,000; Protein Tech Group, Inc.), anti-TIMP1 antibody (1:200; Santa Cruz, Inc.), anti-p53 antibody (1:2,000; Protein Tech Group, Inc.), anti- Caspase3 antibody (1:1,000; Protein Tech Group, Inc.), and anti-GAPDH antibody (1:10,000; Protein Tech Group, Inc.) at 4°C overnight. On the next day, the secondary antibody (goat anti-mouse IgG (H + L)-HRP [1:10,000; Jackson ImmunoResearch Laboratories, Inc.]) was added, and cells were incubated at 37°C for 2 h. Finally, the membrane was visualized using an ECL assay kit (Beyotime Institute of Biotechnology), and the protein expression levels of the related proteins were quantified using Image-Pro Plus software.

2.8 Statistical analysis

Data are shown as mean ± standard deviation (SD). GraphPad Prism software was used for statistical analysis. The homogeneity of variance test was first performed to analyze the homogeneity of the variance of the data. According to the P-value of the homogeneity of variance test, one-way ANOVA followed by Tukey’s post hoc test was performed if P > 0.05; otherwise, Brown-Forsythe and Welch ANOVA tests followed by Dunnett’s T3 post hoc test were performed. Differences were considered statistically significant at P < 0.05.

3 Results

3.1 Expression of MF markers in AngII-induced cells and cell transfection efficiency

As shown in Figure 1a, after Ang II treatment for 24 h, the mRNA expression of Axl, α-SMA, and MMP3 was significantly upregulated (P < 0.05), while that of STAT4 and TIMP1 was downregulated (P < 0.05) compared with the control cells. Western blotting also showed that the trends of Axl, α-SMA, MMP3, STAT4, and TIMP-1 protein expression in the control and MF groups were similar to that of their mRNA expression (Figure 1b). Additionally, the expression of fibroblast-related markers, such as FSP1, COL1A1, COL3A1, and TGF-β1, was determined using qRT-PCR. The mRNA expression levels of FSP1, COL1A1, COL3A1, and TGF-β1 were significantly higher in the MF group than in the control group (P < 0.05, Figure 2a). These results indicate that AngII successfully induced the formation of fibrotic H9C2 cells.

Figure 1 Expression of MF-related markers in AngII-induced cells using qRT-PCR and western blotting. (a) mRNA expression of Axl, α-SMA, MMP3, STAT4, and TIMP-1 after AngII treatment for 24 h determined using qRT-PCR. (b) Protein expression of Axl, α-SMA, MMP3, STAT4, and TIMP-1 after AngII treatment for 24 h determined using western blotting. *P < 0.05 vs control. MF, myocardial fibrosis.
Figure 1

Expression of MF-related markers in AngII-induced cells using qRT-PCR and western blotting. (a) mRNA expression of Axl, α-SMA, MMP3, STAT4, and TIMP-1 after AngII treatment for 24 h determined using qRT-PCR. (b) Protein expression of Axl, α-SMA, MMP3, STAT4, and TIMP-1 after AngII treatment for 24 h determined using western blotting. *P < 0.05 vs control. MF, myocardial fibrosis.

Figure 2 Expression of fibroblast-related markers in AngII-induced cells and cell transfection efficiency. (a) mRNA expression of FSP1, COL1A1, COL3A1, and TGF-β1 after AngII treatment for 24 h determined using qRT-PCR. *P < 0.05 vs control. (b) mRNA expression of TIMP-1 after transfection with si-TIMP-1. (c) Protein expression of TIMP-1 after transfection with si-TIMP-1. (d) mRNA expression of TIMP-1 after transfection with TIMP-1-OE plasmid. (e) Protein expression of TIMP-1 after transfection with TIMP-1-OE plasmid. *P < 0.05 vs blank, # P < 0.05 vs si-TIMP-1(1). TIMP‐1, tissue inhibitor of metalloproteinases‐1; MF, myocardial fibrosis; si, small interfering RNA; OE, over-expression.
Figure 2

Expression of fibroblast-related markers in AngII-induced cells and cell transfection efficiency. (a) mRNA expression of FSP1, COL1A1, COL3A1, and TGF-β1 after AngII treatment for 24 h determined using qRT-PCR. *P < 0.05 vs control. (b) mRNA expression of TIMP-1 after transfection with si-TIMP-1. (c) Protein expression of TIMP-1 after transfection with si-TIMP-1. (d) mRNA expression of TIMP-1 after transfection with TIMP-1-OE plasmid. (e) Protein expression of TIMP-1 after transfection with TIMP-1-OE plasmid. *P < 0.05 vs blank, # P < 0.05 vs si-TIMP-1(1). TIMP‐1, tissue inhibitor of metalloproteinases‐1; MF, myocardial fibrosis; si, small interfering RNA; OE, over-expression.

To investigate the roles of TIMP-1 in LC regulation of MF, H9C2 cells were transfected with TIMP-1-OE plasmid and si-TIMP-1, and cell transfection efficiency was evaluated by measuring TIMP-1 expression using qRT-PCR and western blotting. There was no significant difference in TIMP-1 mRNA and protein expression between the blank and si-NC groups (P > 0.05, Figure 2b and c) or between the blank and NC groups (P > 0.05, Figure 2d and e). Compared with that in the blank group cells, the mRNA and protein expression of TIMP-1 in the cells transfected with si-TIMP-1(1), si-TIMP-1(2), and si-TIMP-1(3) was significantly decreased (P < 0.05). si-TIMP-1(1) had the most significant effect (Figure 2b and c); hence, H9C2 cells with TIMP-1 knockdown were constructed using si-TIMP-1(1). Additionally, the mRNA expression of TIMP-1 in the blank cells and cells transfected with TIMP-1-OE plasmid was 1.01 ± 0.12 and 905.98 ± 24.17, respectively, implying that TIMP-1 expression in the TIMP-1-OE group was approximately 900 times higher than that in the blank group (Figure 1d). TIMP-1 protein and mRNA expression in the blank cells and cells transfected with TIMP-1-OE plasmid was similar (Figure 2e). All the results showed that cells with TIMP-1 overexpression and knockdown were successfully established and could be used for subsequent experiments.

3.2 Effects of LC and TIMP-1 on viability of AngII-induced H9C2 cells

The viability of H9C2 cells with different treatments for 24, 48, 72, and 96 h was measured using CCK-8. There were no significant differences in cell viability among the MF + LC, MF + LC + si-NC, and MF + LC + NC-OE groups (P > 0.05, Figure A1) after culturing for 24, 48, 72, and 96 h, implying that empty plasmids and transfection reagents did not influence cell growth. In addition, AngII treatment for 24, 48, 72, and 96 h significantly inhibited the cell viability relative to the control cells (P < 0.05, Figure 3). After treatment for 24 h, no significant difference in cell viability was observed among the MF, MF + LC, MF + LC + TIMP-1-OE, and MF + LC + si-TIMP-1 groups (P > 0.05, Figure 3a). After 48, 72, and 96 h of treatment, cell viability was further significantly suppressed by LC compared with that of the MF group (P < 0.05) and further decreased after TIMP-1 overexpression compared with that of the MF + LC group (Figure 3b–d). However, compared with that of the MF + LC group, TIMP-1 knockdown increased the viability of AngII-treated cells treated with LC (P < 0.05) and restored it to a level similar to that of the MF group (P > 0.05, Figure 3b–d). The results suggested that TIMP-1 overexpression could further inhibit the viability of MF cells treated with LC, whereas TIMP-1 knockdown had the opposite effect. Cells cultured for 48 h were used for further experiments.

Figure 3 Cell viability of H9C2 cells after si-TIMP-1 and TIMP-1-OE transfection for 24 h (a), 48 h (b), 72 h (c), and 96 h (d). *P < 0.05 vs control, # P < 0.05 vs MF, $ P < 0.05 vs MF + LC. TIMP‐1, tissue inhibitor of metalloproteinases‐1; MF, myocardial fibrosis; siRNA, small interfering RNA; OE, over-expression; LC, levocarnitine.
Figure 3

Cell viability of H9C2 cells after si-TIMP-1 and TIMP-1-OE transfection for 24 h (a), 48 h (b), 72 h (c), and 96 h (d). *P < 0.05 vs control, # P < 0.05 vs MF, $ P < 0.05 vs MF + LC. TIMP‐1, tissue inhibitor of metalloproteinases‐1; MF, myocardial fibrosis; siRNA, small interfering RNA; OE, over-expression; LC, levocarnitine.

3.3 Effects of LC and TIMP-1 on apoptosis and migration of AngII-induced H9C2 cells

The effects of LC and TIMP-1 on the apoptosis of Ang II-induced H9C2 cells were analyzed using flow cytometry. Compared with that in the control group, a significantly increased rate of cell apoptosis was observed in the MF group (P < 0.05, Figure 4a). LC significantly enhanced the apoptosis rate of AngII-induced H9C2 cells compared with the MF group (P < 0.05, Figure 4a). Compared with that of the MF + LC group, TIMP-1 overexpression also markedly increased the cell apoptosis rate (P < 0.05), whereas TIMP-1 knockdown reduced the apoptosis rate of AngII-induced cells treated with LC (P < 0.05, Figure 4a). These results indicated that TIMP-1 overexpression could further promote the apoptosis of MF cells treated with LC, while TIMP-1 knockdown had the opposite effect.

Figure 4 Effects of TIMP-1 on cell apoptosis and migration of H9C2 cells induced by AngII. (a) Cell apoptosis in the different groups determined using flow cytometry. (b) Cell migration in the different groups assessed using tanswell assay. *P < 0.05 vs control, # P < 0.05 vs MF, $ P < 0.05 vs MF + LC. TIMP‐1, tissue inhibitor of metalloproteinases‐1; MF, myocardial fibrosis; siRNA, small interfering RNA; OE, over-expression; LC, levocarnitine.
Figure 4

Effects of TIMP-1 on cell apoptosis and migration of H9C2 cells induced by AngII. (a) Cell apoptosis in the different groups determined using flow cytometry. (b) Cell migration in the different groups assessed using tanswell assay. *P < 0.05 vs control, # P < 0.05 vs MF, $ P < 0.05 vs MF + LC. TIMP‐1, tissue inhibitor of metalloproteinases‐1; MF, myocardial fibrosis; siRNA, small interfering RNA; OE, over-expression; LC, levocarnitine.

The migration of H9C2 cells with different treatments was examined using the transwell assay. The cell numbers in the control, MF, MF + LC, MF + LC + TIMP-1-OE, and MF + LC + si-TIMP-1 groups were 324.67 ± 18.77, 256.67 ± 32.13, 161.00 ± 3.61, 136.67 ± 7.57, and 217.67 ± 23.44, respectively (Figure 4b). AngII treatment significantly decreased cell numbers compared to that of the control cells (P < 0.05), and LC administration and TIMP-1 overexpression further reduced the number of AngII-induced cells (P < 0.05, Figure 4b). However, the number of cells in the MF + LC + si-TIMP-1 group was significantly higher than that in the MF + LC group (P < 0.05) and reversed to a similar level in the MF group (P > 0.05, Figure 4b). These results implied that TIMP-1 overexpression could further suppress the migration of MF cells with LC treatment, whereas TIMP-1 knockdown had the opposite effect.

3.4 Effects of TIMP-1 on the expression of oxidative stress-, MF-, and apoptosis-related markers

To further understand the molecular mechanisms by which TIMP-1 regulates the growth of MF cells, the expression of oxidative stress-related genes (MMP3 and STAT4), MF-related genes/proteins (TIMP-1, Axl, AT1R, α-SMA, and collagen III), and apoptosis-related genes (p53, caspase 3, and Bcl-2) was determined using qRT-PCR and western blotting. qRT-PCR showed that the mRNA expression levels of MF-related genes (Axl, AT1R, α-SMA, and collagen III) were significantly upregulated in the MF cells compared with that in the control cells (P < 0.05), whereas they were downregulated by LC treatment compared with that in the MF group (P < 0.05, Figure 5a–d). Compared with that in the MF + LC group, TIMP-1 overexpression significantly downregulated Axl, AT1R, α-SMA, and collagen III mRNA expression (P < 0.05), but TIMP-1 knockdown markedly upregulated their expression (P < 0.05, Figure 5a–d). For apoptosis-related genes (p53, caspase 3, and Bcl-2), it was found that AngII treatment significantly upregulated p53 and caspase 3 expression levels and downregulated that of Bcl-2 compared to that in the control cells (P < 0.05). LC and TIMP-1 overexpression significantly upregulated p53 and caspase 3 expression and downregulated that of Bcl-2 compared with that in the MF cells (P < 0.05, Figure 5e–g). However, the effects of TIMP-1 knockdown on p53, caspase 3, and Bcl-2 expression were opposite to those of TIMP-1 overexpression (Figure 5e–g). For oxidative stress-related genes (MMP3 and STAT4), MMP3 expression was significantly higher in the MF group than in the control cells (P < 0.05), whereas it was lower in the MF + LC group than in the MF group (P < 0.05, Figure 5h). Compared to that in the MF + LC group, TIMP-1 overexpression significantly downregulated MMP3 (P < 0.05), whereas TIMP-1 knockdown significantly upregulated its expression (P < 0.05, Figure 5h). The trend of STAT4 expression in the different groups was opposite to that of MMP3 expression (Figure 5i).

Figure 5 Effects of TIMP-1 on the expression of oxidative stress-related genes, MF-related genes, and apoptosis-related genes determined using qRT-PCR. Relative mRNA expression of Axl (a), AT1R (b), α-SMA (c), Collagen III (d), Caspase 3 (e), p53 (f), Bcl2 (g), MMP3 (h), and STAT4 (i). *P < 0.05 vs control, # P < 0.05 vs MF, $ P < 0.05 vs MF + LC. TIMP‐1, tissue inhibitor of metalloproteinases‐1; MMP, matrix metalloproteinase; Axl, AXL receptor tyrosine kinase; AT1R, angiotensin II receptor type 1; α-SMA, α-smooth muscle actin; MF, myocardial fibrosis; siRNA, small interfering RNA; OE, over-expression, LC, levocarnitine.
Figure 5

Effects of TIMP-1 on the expression of oxidative stress-related genes, MF-related genes, and apoptosis-related genes determined using qRT-PCR. Relative mRNA expression of Axl (a), AT1R (b), α-SMA (c), Collagen III (d), Caspase 3 (e), p53 (f), Bcl2 (g), MMP3 (h), and STAT4 (i). *P < 0.05 vs control, # P < 0.05 vs MF, $ P < 0.05 vs MF + LC. TIMP‐1, tissue inhibitor of metalloproteinases‐1; MMP, matrix metalloproteinase; Axl, AXL receptor tyrosine kinase; AT1R, angiotensin II receptor type 1; α-SMA, α-smooth muscle actin; MF, myocardial fibrosis; siRNA, small interfering RNA; OE, over-expression, LC, levocarnitine.

Finally, the protein expression levels of TIMP-1, caspase 3, and p53 were detected using western blotting. The protein expression of TIMP-1 was significantly downregulated after AngII treatment relative to the control cells (P < 0.05), while it was upregulated in the MF cells treated with LC (P < 0.05, Figure 6a and b). Compared with that in the MF + LC group, TIMP-1 was significantly upregulated by the transfection of TIMP-1 overexpression plasmid (P < 0.05), whereas it was downregulated by si-TIMP-1 transfection (P < 0.05, Figure 6a and b). Additionally, the amount of caspase 3 and p53 protein expression in the different groups detected using western blotting was similar to that of their mRNA expression examined using RT-qPCR (Figure 6a–d).

Figure 6 Effects of TIMP-1 on protein expression levels in H9C2 cells determined using western blotting. (a) Representative images of western blotting. The protein expression of TIMP-1 (b), Caspase‑3 (c), and p53 (d). *P < 0.05 vs control, # P < 0.05 vs MF, $ P < 0.05 vs MF + LC. TIMP‐1, tissue inhibitor of metalloproteinases‐1; MF, myocardial fibrosis; siRNA, small interfering RNA; OE, over-expression, LC, levocarnitine.
Figure 6

Effects of TIMP-1 on protein expression levels in H9C2 cells determined using western blotting. (a) Representative images of western blotting. The protein expression of TIMP-1 (b), Caspase‑3 (c), and p53 (d). *P < 0.05 vs control, # P < 0.05 vs MF, $ P < 0.05 vs MF + LC. TIMP‐1, tissue inhibitor of metalloproteinases‐1; MF, myocardial fibrosis; siRNA, small interfering RNA; OE, over-expression, LC, levocarnitine.

4 Discussion

In many patients with heart disease, MF is recognized as a common feature, which might ultimately result in organ failure [23]. Extracellular matrix (ECM) protein accumulation within the myocardium is the main characteristic of fibrosis. TIMP-1, upregulated in liver fibrosis development both in murine experimental models and human samples [14], is a significant contributor to greater morbidity and poor prognosis in HF [24]. Therefore, we investigated the role of TIMP-1 in the LC regulation of MF. Lijnen et al. suggested that in rat adult cardiac fibroblasts, a well-established model for fibrosis, Ang II increased collagen secretion and production [25]. In our study, we successfully established an MF cellular model using Ang II, and LC was used to treat Ang II-induced cells. TIMP-1 overexpression and knockdown cells were successfully constructed. AngII induction could inhibit the viability and migration of H9C2 myocardial cells while facilitating their apoptosis, and LC could further suppress the viability and migration of fibrotic myocardial cells and further induce cell apoptosis caused by AngII. qRT-PCR results showed that Ang II induction significantly upregulated the expression of MF-related genes (Axl, AT1R, α-SMA, and collagen III), MMP3, caspase 3, and p53 and downregulated that of STAT4 and Bcl-2. However, LC reversed the expression of MF-related genes MMP3 and STAT4 caused by AngII, further upregulating that of caspase 3 and p53 and downregulating that of Bcl-2. TIMP-1 overexpression promoted the effects of LC, whereas TIMP-1 knockdown reversed the effects of LC. In light of these findings, TIMP-1 may be a potential therapeutic target for delaying MF progression.

Ang II, a member of the RAS, has been implicated in the development of MF and other fibrotic diseases [26]. A previous study reported that the death of rat myocardial cells triggers an inflammatory response that eventually leads to fibroblast activation and the replacement of dead myocardial cells with fibrous tissue [27]. Wan et al. demonstrated that Ang II treatment induced apoptosis in H9C2 cells, and caspase 3 activity was significantly increased in AngII-induced cells [28]. Our study showed that in MF cells, the viability and migration of myocardial cells were suppressed, whereas their apoptosis was increased. LC is a naturally occurring co-factor involved in fatty acid metabolism, the major biogenesis process in the heart. Therefore, the key role of LC in the pathogenesis of various cardiovascular diseases has been demonstrated [29]. Furthermore, the protective effect of LC on mitochondrial dysfunction and apoptosis has been reported previously [30]. Our study showed that LC could further inhibit the viability and migration of AngII-induced cells while facilitating their apoptosis, in accordance with our previous report. TIMP-1 was upregulated during liver fibrosis and is thought to promote fibrosis in the damaged liver by inhibiting MMP and ECM degradation [31]. However, our study found that TIMP-1 was significantly downregulated in MF cells, which was different from the results reported by a previous study [31]. Therefore, we investigated the role of TIMP-1 in the regulation of MF by LC. Previous evidence also supports the role of TIMPs in various biological processes such as cell differentiation, growth, and apoptosis [32]. Based on the present study, TIMP-1 overexpression could promote the effects of LC, while silencing TIMP-1 could reverse the actions of LC in AngII-induced myocardial cells. Taken together, we speculate that LC combined with TIMP-1 overexpression may be involved in MF progression by further inhibiting the viability and migration of AngII-induced cells while promoting their apoptosis.

To explore the molecular mechanisms of TIMP-1 in the regulation of MF, the expression levels of some molecules associated with oxidative stress (MMP3 and STAT4), apoptosis (Bcl-2, caspase-3, and p53), and MF (TIMP-1, Axl, AT1R, α-SMA, and collagen III) were measured. Our results showed that Ang II exposure significantly upregulated the expression of Axl, AT1R, α-SMA, collagen III, caspase 3, p53, and MMP3 and downregulated that of Bcl-2 and STAT4. LC treatment reversed the action of AngII on the expression of Axl, AT1R, α-SMA, collagen III, MMP3, and STAT4, whereas it further upregulated that of caspase 3 and p53 and downregulated that of Bcl-2. TIMP-1 overexpression promoted the effects of LC on these genes, whereas TIMP-1 knockdown had the opposite effect. Axl, a receptor tyrosine kinase associated with fibrotic pathways, is involved in myofibroblast activation [33]. AT1R can interact with AngII to promote tissue fibrosis and is upregulated in renal fibrosis [34]. α-SMA and collagen III are fibrosis-related markers that are both upregulated in the fibrosis process. Li et al. [35] illustrated that tetrahydrocurcumin treatment could alleviate diabetic cardiomyopathy by reducing the expression of α-SMA, collagen I, and collagen III, which are markers of cardiac fibrosis.

Oxidative stress is defined as an imbalance between the production of ROS and the endogenous antioxidant defense system. It has been reported to participate in fibrosis and has been identified as an important pathophysiological pathway for the development and progression of HF [36]. Excessive ROS may exacerbate inflammation and progression of HF [37]. ROS can contribute to ECM remodeling by mediating apoptosis and MMPs. MMP3, a member of the MMP family, can induce epithelial–mesenchymal transition associated with malignant transformation through a pathway dependent on ROS production [38]. Skacelova et al. [39] observed that MMP3 is highly expressed in patients with rheumatoid arthritis and could serve as a marker of disease activity in rheumatoid arthritis. STAT4 plays an important role in many diseases through the activation of different cytokines via the JAK-STAT signaling pathway [40]. STAT4 absence could reduce the development of atherosclerosis by affecting MΦ activation and CCL2-induced MΦ migration [41]. Additionally, apoptosis is closely associated with fibrosis [42]. Caspase‑3, a member of the caspase family, is a key regulator of extrinsic and intrinsic apoptotic pathways and cell apoptosis [43]. p53 is an essential cell cycle and DNA repair regulator that plays a role in apoptosis-related genes [44]. Bcl-2, an anti-apoptotic gene, is a key downstream effector of the PI3K-Akt signaling pathway that maintains myocardial cell survival and is involved in sudden cardiac death and HF [45]. Combined with our results, it can be inferred that LC together with TIMP-1 overexpression may delay MF by downregulating the expression of MF-related genes (Axl, AT1R, α-SMA, and collagen III), inhibiting oxidative stress (MMP3 and STAT4), and promoting cell apoptosis (Bcl2, caspase 3, and p53).

However, this study has some limitations. First, TIMP-1 levels should be further determined in clinical samples of patients with MF and paired adjacent benign tissues, and additional investigation into the roles of TIMP-1 in MF should be undertaken in vivo. Additionally, the relationship between MF and the growth of Ang II-induced myocardial cells needs to be explored in the future.

5 Conclusion

In conclusion, our findings support the hypothesis that LC combined with TIMP-1 overexpression may affect fibrotic cell apoptosis, viability, and migration by regulating the expression of MF-, oxidative stress-, and cell apoptosis-related genes, thereby delaying the progression of MF. Our study provides a theoretical foundation for the treatment of MF-based cardiovascular diseases, with TIMP1 as a potential therapeutic target for LC to promote cardiovascular health and prolong life expectancy in older individuals.

# Co-first authors.

  1. Funding information: This study was supported by the Medical research project of Jing’an District (General program 2020MS12) and Key medical discipline construction project of Jing’an District (Key Medical Disciplines 2021ZD03).

  2. Author contributions: Conceptualization: Xiangwei Wu and Xinyu Peng; data curation: Jian Yang; formal analysis: Jian Yang and Meiyan Wang; funding acquisition: Xiangwei Wu; investigation: Jian Yang, Jing Yang, Zhiqiang Chu, and Xueling Chen; methodology: Jian Yang and Xueling Chen; project administration: Jian Yang; resources: Xiangwei Wu and Xinyu Peng; software: Meiyan Wang; supervision: Xinyu Peng; validation: Jing Yang and Zhiqiang Chu; visualization: Jing Yang and Zhiqiang Chu; writing – original draft: Jian Yang; writing – review and editing: Xiangwei Wu and Xinyu Peng.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Appendix

Figure A1 Effects of empty plasmids and transfection reagents on the cell viability of H9C2 cells after culturing for 24, 48, 72, and 96 h using CCK-8.
Figure A1

Effects of empty plasmids and transfection reagents on the cell viability of H9C2 cells after culturing for 24, 48, 72, and 96 h using CCK-8.

References

[1] Savarese G, Becher PM, Lund LH, Seferovic P, Rosano GMC, Coats A. Global burden of heart failure: a comprehensive and updated review of epidemiology. Cardiovasc Res. 2023;118(17):3272–87.10.1093/cvr/cvac013Search in Google Scholar PubMed

[2] Gonzalez A, Lopez B, Ravassa S, San Jose G, Diez J. The complex dynamics of myocardial interstitial fibrosis in heart failure. Focus on collagen cross-linking. Biochim Biophys Acta, Mol Cell Res. 2019;1866(9):1421–32.10.1016/j.bbamcr.2019.06.001Search in Google Scholar PubMed

[3] Maruyama K, Imanaka-Yoshida K. The pathogenesis of cardiac fibrosis: a review of recent progress. Int J Mol Sci. 2022;23(5):2617.10.3390/ijms23052617Search in Google Scholar PubMed PubMed Central

[4] Zegard A, Okafor O, de Bono J, Kalla M, Lencioni M, Marshall H, et al. Myocardial fibrosis as a predictor of sudden death in patients with coronary artery disease. J Am Coll Cardiol. 2021;77(1):29–41.10.1016/j.jacc.2020.10.046Search in Google Scholar PubMed

[5] Gyongyosi M, Winkler J, Ramos I, Do QT, Firat H, McDonald K, et al. Myocardial fibrosis: biomedical research from bench to bedside. Eur J Heart Fail. 2017;19(2):177–91.10.1002/ejhf.696Search in Google Scholar PubMed PubMed Central

[6] Schupp T, Behnes M, Weiss C, Nienaber C, Reiser L, Bollow A, et al. Digitalis therapy and risk of recurrent ventricular tachyarrhythmias and ICD therapies in atrial fibrillation and heart failure. Cardiology. 2019;142(3):129–40.10.1159/000497271Search in Google Scholar PubMed

[7] Neefs J, van den Berg NW, Limpens J, Berger WR, Boekholdt SM, Sanders P, et al. Aldosterone pathway blockade to prevent atrial fibrillation: a systematic review and meta-analysis. Int J Cardiol. 2017;231:155–61.10.1016/j.ijcard.2016.12.029Search in Google Scholar PubMed

[8] Huang DD, Huang HF, Yang Q, Chen XQ. Liraglutide improves myocardial fibrosis after myocardial infarction through inhibition of CTGF by activating cAMP in mice. Eur Rev Med Pharmacol Sci. 2018;22(14):4648–56.Search in Google Scholar

[9] Gaspari T, Brdar M, Lee HW, Spizzo I, Hu Y, Widdop RE, et al. Molecular and cellular mechanisms of glucagon-like peptide-1 receptor agonist-mediated attenuation of cardiac fibrosis. Diab Vasc Dis Res. 2016;13(1):56–68.10.1177/1479164115605000Search in Google Scholar PubMed

[10] Chen P, Yang F, Wang W, Li X, Liu D, Zhang Y, et al. Liraglutide attenuates myocardial fibrosis via inhibition of AT1R-mediated ROS production in hypertensive mice. J Cardiovasc Pharmacol Ther. 2021;26(2):179–88.10.1177/1074248420942007Search in Google Scholar PubMed

[11] Zhao HY, Li HY, Jin J, Jin JZ, Zhang LY, Xuan MY, et al. L-carnitine treatment attenuates renal tubulointerstitial fibrosis induced by unilateral ureteral obstruction. Korean J Intern Med. 2021;36(Suppl 1):S180–95.10.3904/kjim.2019.413Search in Google Scholar PubMed PubMed Central

[12] Emran T, Chowdhury NI, Sarker M, Bepari AK, Hossain M, Rahman GMS, et al. L-carnitine protects cardiac damage by reducing oxidative stress and inflammatory response via inhibition of tumor necrosis factor-alpha and interleukin-1beta against isoproterenol-induced myocardial infarction. Biomed Pharmacother. 2021;143:112139.10.1016/j.biopha.2021.112139Search in Google Scholar PubMed

[13] Cabral-Pacheco GA, Garza-Veloz I, Castruita-De la Rosa C, Ramirez-Acuña JM, Perez-Romero BA, Guerrero-Rodriguez JF, et al. The roles of matrix metalloproteinases and their inhibitors in human diseases. Int J Mol Sci. 2020;21(24):9739.10.3390/ijms21249739Search in Google Scholar PubMed PubMed Central

[14] Yoshiji H, Kuriyama S, Miyamoto Y, Thorgeirsson UP, Gomez DE, Kawata M, et al. Tissue inhibitor of metalloproteinases-1 promotes liver fibrosis development in a transgenic mouse model. Hepatology. 2000;32(6):1248–54.10.1053/jhep.2000.20521Search in Google Scholar PubMed

[15] Takeda K, Noguchi R, Kitade M, Namisaki T, Moriya K, Kawaratani H, et al. Periostin crossreacts with the reninangiotensin system during liver fibrosis development. Mol Med Rep. 2017;16(5):5752–8.10.3892/mmr.2017.7356Search in Google Scholar PubMed PubMed Central

[16] Shu J, Gu Y, Jin L, Wang H. Matrix metalloproteinase 3 regulates angiotensin II induced myocardial fibrosis cell viability, migration and apoptosis. Mol Med Rep. 2021;23(2):151.10.3892/mmr.2020.11790Search in Google Scholar PubMed PubMed Central

[17] Sun Y. Local angiotensin II and myocardial fibrosis. Adv Exp Med Biol. 1997;432:55–61.10.1007/978-1-4615-5385-4_6Search in Google Scholar PubMed

[18] Wang S, Gong H, Jiang G, Ye Y, Wu J, You J, et al. Src is required for mechanical stretch-induced cardiomyocyte hypertrophy through angiotensin II type 1 receptor-dependent β-arrestin2 pathways. PLoS One. 2014;9(4):e92926.10.1371/journal.pone.0092926Search in Google Scholar PubMed PubMed Central

[19] Weber KT, Brilla CG, Campbell SE, Guarda E, Zhou G, Sriram K. Myocardial fibrosis: role of angiotensin II and aldosterone. Basic Res Cardiol. 1993;88(Suppl 1):107–24.10.1007/978-3-642-72497-8_8Search in Google Scholar PubMed

[20] Billet S, Aguilar F, Baudry C, Clauser E. Role of angiotensin II AT1 receptor activation in cardiovascular diseases. Kidney Int. 2008;74(11):1379–84.10.1038/ki.2008.358Search in Google Scholar PubMed

[21] Chen Y, Huang M, Yan Y, He D. Tranilast inhibits angiotensin II-induced myocardial fibrosis through S100A11/transforming growth factor-β (TGF-β1)/Smad axis. Bioengineered. 2021;12(1):8447–56.10.1080/21655979.2021.1982322Search in Google Scholar PubMed PubMed Central

[22] Liu L, Gong W, Zhang S, Shen J, Wang Y, Chen Y, et al. Hydrogen sulfide attenuates angiotensin II-induced cardiac fibroblast proliferation and transverse aortic constriction-induced myocardial fibrosis through oxidative stress inhibition via sirtuin 3. Oxid Med Cell Longevity. 2021;2021:9925771.10.1155/2021/9925771Search in Google Scholar PubMed PubMed Central

[23] Kim S, Iwao H. Molecular and cellular mechanisms of angiotensin II-mediated cardiovascular and renal diseases. Pharmacol Rev. 2000;52(1):11–34.Search in Google Scholar

[24] Almehmadi F, Joncas SX, Nevis I, Zahrani M, Bokhari M, Stirrat J, et al. Prevalence of myocardial fibrosis patterns in patients with systolic dysfunction: prognostic significance for the prediction of sudden cardiac arrest or appropriate implantable cardiac defibrillator therapy. Circ Cardiovasc Imaging. 2014;7(4):593–600.10.1161/CIRCIMAGING.113.001768Search in Google Scholar PubMed

[25] Lijnen PJ, Petrov VV, Fagard RH. Induction of cardiac fibrosis by angiotensin II. Methods Find Exp Clin Pharmacol. 2000;22(10):709–23.10.1358/mf.2000.22.10.802287Search in Google Scholar PubMed

[26] Rosin NL, Falkenham A, Sopel MJ, Lee TD, Légaré JF. Regulation and role of connective tissue growth factor in AngII-induced myocardial fibrosis. Am J Pathol. 2013;182(3):714–26.10.1016/j.ajpath.2012.11.014Search in Google Scholar PubMed

[27] Kong P, Christia P, Frangogiannis NG. The pathogenesis of cardiac fibrosis. Cell Mol Life Sci. 2014;71(4):549–74.10.1007/s00018-013-1349-6Search in Google Scholar PubMed PubMed Central

[28] Wan M, Yin K, Yuan J, Ma S, Xu Q, Li D, et al. YQFM alleviated cardiac hypertrophy by apoptosis inhibition and autophagy regulation via PI(3)K/AKT/mTOR pathway. J ethnopharmacology. 2022;285:114835.10.1016/j.jep.2021.114835Search in Google Scholar PubMed

[29] Ren J, Pulakat L, Whaley-Connell A, Sowers JR. Mitochondrial biogenesis in the metabolic syndrome and cardiovascular disease. J Mol Med. 2010;88(10):993–1001.10.1007/s00109-010-0663-9Search in Google Scholar PubMed PubMed Central

[30] Mao CY, Lu HB, Kong N, Li JY, Liu M, Yang CY, et al. Levocarnitine protects H9c2 rat cardiomyocytes from H2O2-induced mitochondrial dysfunction and apoptosis. Int J Med Sci. 2014;11(11):1107–15.10.7150/ijms.9153Search in Google Scholar PubMed PubMed Central

[31] Thiele ND, Wirth JW, Steins D, Koop AC, Ittrich H, Lohse AW, et al. TIMP-1 is upregulated, but not essential in hepatic fibrogenesis and carcinogenesis in mice. Sci Rep. 2017;7(1):714.10.1038/s41598-017-00671-1Search in Google Scholar PubMed PubMed Central

[32] Ries C. Cytokine functions of TIMP-1. Cell Mol Life Sci. 2014;71(4):659–72.10.1007/s00018-013-1457-3Search in Google Scholar PubMed

[33] Steiner CA, Rodansky ES, Johnson LA, Berinstein JA, Cushing KC, Huang S, et al. AXL is a potential target for the treatment of intestinal fibrosis. Inflamm bowel Dis. 2021;27(3):303–16.10.1093/ibd/izaa169Search in Google Scholar PubMed PubMed Central

[34] Wu QY, Feng Y, Wang LL, Zhang XH. Levels of Apelin-12, AT1R, and AGT are correlated with degree of renal fibrosis in patients with immunoglobulin A nephropathy. Ann Palliat Med. 2021;10(5):5687–93.10.21037/apm-21-1059Search in Google Scholar PubMed

[35] Li K, Zhai M, Jiang L, Song F, Zhang B, Li J, et al. Tetrahydrocurcumin ameliorates diabetic cardiomyopathy by attenuating high glucose-induced oxidative stress and fibrosis via activating the SIRT1 pathway. Oxid Med Cell Longevity. 2019;2019:6746907.10.1155/2019/6746907Search in Google Scholar PubMed PubMed Central

[36] Purnomo Y, Piccart Y, Coenen T, Prihadi JS, Lijnen PJ. Oxidative stress and transforming growth factor-beta1-induced cardiac fibrosis. Cardiovasc Hematol Disord Drug Targets. 2013;13(2):165–72.10.2174/1871529X11313020010Search in Google Scholar PubMed

[37] Huo S, Shi W, Ma H, Yan D, Luo P, Guo J, et al. Alleviation of inflammation and oxidative stress in pressure overload-induced cardiac remodeling and heart failure via IL-6/STAT3 inhibition by raloxifene. Oxid Med Cell Longevity. 2021;2021:6699054.10.1155/2021/6699054Search in Google Scholar PubMed PubMed Central

[38] Cichon MA, Radisky DC. ROS-induced epithelial–mesenchymal transition in mammary epithelial cells is mediated by NF-kB-dependent activation of snail. Oncotarget. 2014;5(9):2827–38.10.18632/oncotarget.1940Search in Google Scholar PubMed PubMed Central

[39] Skacelova M, Hermanova Z, Horak P, Ahmed K, Langova K. Higher levels of matrix metalloproteinase-3 in patients with RA reflect disease activity and structural damage. Biomed Pap. 2017;161(3):296–302.10.5507/bp.2017.015Search in Google Scholar PubMed

[40] Yang C, Mai H, Peng J, Zhou B, Hou J, Jiang D. STAT4: an immunoregulator contributing to diverse human diseases. Int J Biol Sci. 2020;16(9):1575–85.10.7150/ijbs.41852Search in Google Scholar PubMed PubMed Central

[41] Taghavie-Moghadam PL, Gjurich BN, Jabeen R, Krishnamurthy P, Kaplan MH, Dobrian AD, et al. STAT4 deficiency reduces the development of atherosclerosis in mice. Atherosclerosis. 2015;243(1):169–78.10.1016/j.atherosclerosis.2015.08.045Search in Google Scholar PubMed PubMed Central

[42] Meng D, Li Z, Wang G, Ling L, Wu Y, Zhang C. Carvedilol attenuates liver fibrosis by suppressing autophagy and promoting apoptosis in hepatic stellate cells. Biomed Pharmacother. 2018;108:1617–27.10.1016/j.biopha.2018.10.005Search in Google Scholar PubMed

[43] Lossi L, Castagna C, Merighi A. Caspase-3 mediated cell death in the normal development of the mammalian cerebellum. Int J Mol Sci. 2018;19(12):3999.10.3390/ijms19123999Search in Google Scholar PubMed PubMed Central

[44] Wang X, Simpson ER, Brown KA. p53: protection against tumor growth beyond effects on cell cycle and apoptosis. Cancer Res. 2015;75(23):5001–7.10.1158/0008-5472.CAN-15-0563Search in Google Scholar PubMed

[45] Meng X, Cui J, He G. Bcl-2 is involved in cardiac hypertrophy through PI3K-Akt pathway. Biomed Res Int. 2021;2021:6615502.10.1155/2021/6615502Search in Google Scholar PubMed PubMed Central

Received: 2022-06-20
Revised: 2022-11-03
Accepted: 2022-11-30
Published Online: 2023-02-09

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
  3. Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
  4. Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
  5. Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
  6. A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
  7. Neutrophilia with subclinical Cushing’s disease: A case report and literature review
  8. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
  9. Immunoregulation of synovial macrophages for the treatment of osteoarthritis
  10. Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
  11. Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
  12. Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
  13. High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
  14. Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
  15. Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
  16. Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
  17. Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
  18. Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
  19. Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
  20. Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
  21. Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
  22. Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
  23. Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
  24. Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
  25. 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
  26. Experimental study on the optimization of ANM33 release in foam cells
  27. Primary retroperitoneal angiosarcoma: A case report
  28. Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
  29. Malignant pleural effusion diagnosis and therapy
  30. Effect of spaceflight on the phenotype and proteome of Escherichia coli
  31. Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
  32. Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
  33. Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
  34. The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
  35. Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
  36. mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
  37. The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
  38. Radiotherapy for primary thyroid adenoid cystic carcinoma
  39. Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
  40. Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
  41. Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
  42. Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
  43. PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
  44. The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
  45. Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
  46. Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
  47. NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
  48. Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
  49. Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
  50. Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
  51. Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
  52. Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
  53. Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
  54. Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
  55. Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
  56. Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
  57. Gemella morbillorum infective endocarditis: A case report and literature review
  58. An unusual ectopic thymoma clonal evolution analysis: A case report
  59. Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
  60. Detection of V. vulnificus septic shock with ARDS using mNGS
  61. Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
  62. The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
  63. Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
  64. ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
  65. Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
  66. Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
  67. Collagen changes in rabbit conjunctiva after conjunctival crosslinking
  68. Effects of NM23 transfection of human gastric carcinoma cells in mice
  69. Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
  70. Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
  71. Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
  72. Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
  73. Giant duplication of the transverse colon in an adult: A case report and literature review
  74. Ectopic thyroid tissue in the breast: A case report
  75. SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
  76. Vaginal metastasis from breast cancer: A case report
  77. Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
  78. Inhibition of TAZ impairs the migration ability of melanoma cells
  79. Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
  80. Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
  81. Identification of winter wheat pests and diseases based on improved convolutional neural network
  82. Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
  83. Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
  84. Immune checkpoint inhibitors in cancer patients with COVID-19
  85. Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
  86. Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
  87. Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
  88. DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
  89. Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
  90. Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
  91. Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
  92. Studying infant mortality: A demographic analysis based on data mining models
  93. Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
  94. Protein Z modulates the metastasis of lung adenocarcinoma cells
  95. Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
  96. TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
  97. Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
  98. Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
  99. Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
  100. Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
  101. Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
  102. HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
  103. Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
  104. Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
  105. Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
  106. Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
  107. Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
  108. Research progress on gas signal molecular therapy for Parkinson’s disease
  109. Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
  110. The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
  111. α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
  112. CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
  113. Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
  114. Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
  115. Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
  116. Research progress of AMP-activated protein kinase and cardiac aging
  117. TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
  118. Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
  119. Metastasis from small cell lung cancer to ovary: A case report
  120. The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
  121. The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
  122. Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
  123. Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
  124. Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
  125. Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
  126. Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
  127. Traumatic brain injury and rTMS-ERPs: Case report and literature review
  128. Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
  129. Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
  130. The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
  131. Inflammation-related signaling pathways in tendinopathy
  132. CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
  133. Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
  134. Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
  135. Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
  136. Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
  137. Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
  138. Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
  139. TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
  140. Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
  141. Ferroptosis: A potential target of macrophages in plaque vulnerability
  142. Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
  143. Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
  144. HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
  145. IL-17 in osteoarthritis: A narrative review
  146. Circadian cycle and neuroinflammation
  147. Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
  148. Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
  149. SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
  150. Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
  151. PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
  152. Pancreatic ectopic thyroid tissue: A case report and analysis of literature
  153. The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
  154. Report on a case of liver-originating malignant melanoma of unknown primary
  155. Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
  156. The fibroblast growth factor–Klotho axis at molecular level
  157. Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
  158. A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
  159. Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
  160. Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
  161. Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
  162. Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
  163. Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
  164. Case report of atypical undernutrition of hypoproteinemia type
  165. Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
  166. Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
  167. Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
  168. Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
  169. Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
  170. Precisional detection of lymph node metastasis using tFCM in colorectal cancer
  171. Advances in diagnosis and treatment of perimenopausal syndrome
  172. A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
  173. Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
  174. Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
  175. Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
  176. Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
  177. Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
  178. Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
  179. An online diagnosis method for cancer lesions based on intelligent imaging analysis
  180. Medical imaging in rheumatoid arthritis: A review on deep learning approach
  181. Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
  182. Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
  183. A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
  184. TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
  185. Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
  186. Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
  187. Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
  188. Hepatobiliary surgery based on intelligent image segmentation technology
  189. Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
  190. Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
  191. Early diagnosis for the onset of peri-implantitis based on artificial neural network
  192. Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
  193. Forecast of pain degree of lumbar disc herniation based on back propagation neural network
  194. SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
  195. Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
  196. Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
  197. A novel approach for minimising anti-aliasing effects in EEG data acquisition
  198. ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
  199. Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
  200. Lung nodule segmentation via semi-residual multi-resolution neural networks
  201. Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
  202. A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
  203. Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
  204. Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
  205. Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
  206. Monitoring and evaluation of anesthesia depth status data based on neuroscience
  207. Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
  208. Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
  209. Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
  210. Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
  211. Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
  212. From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
  213. Ecology and Environmental Science
  214. Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
  215. Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
  216. Effects of cadmium stress on fruits germination and growth of two herbage species
  217. Bamboo charcoal affects soil properties and bacterial community in tea plantations
  218. Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
  219. Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
  220. Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
  221. Food Science
  222. Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
  223. Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
  224. Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
  225. Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
  226. Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
  227. Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
  228. Microbiological transglutaminase: Biotechnological application in the food industry
  229. Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
  230. Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
  231. The potential for the use of leghemoglobin and plant ferritin as sources of iron
  232. Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
  233. Bioengineering and Biotechnology
  234. Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
  235. Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
  236. Agriculture
  237. Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
  238. On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
  239. Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
  240. A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
  241. Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
  242. Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
  243. Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
  244. Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
  245. Animal Sciences
  246. Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
  247. Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
  248. Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
  249. Tracking behavioral changes of confined sows from the first mating to the third parity
  250. The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
  251. Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
  252. Plant Sciences
  253. Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
  254. Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
  255. Tissue culture and rapid propagation technology for Gentiana rhodantha
  256. Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
  257. Cloning and expression analysis of VrNAC13 gene in mung bean
  258. Chlorate-induced molecular floral transition revealed by transcriptomes
  259. Effects of warming and drought on growth and development of soybean in Hailun region
  260. Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
  261. Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
  262. Distinguish Dianthus species or varieties based on chloroplast genomes
  263. Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
  264. Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
  265. An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
  266. Erratum
  267. Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
  268. Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
  269. Retraction
  270. Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
https://doi.org/10.1515/biol-2022-0554
Keywords for this article
tissue inhibitor of metalloproteinases-1; myocardial fibrosis; levocarnitine; angiotensin II
Creative Commons
BY 4.0

Articles in the same Issue

  1. Biomedical Sciences
  2. Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
  3. Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
  4. Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
  5. Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
  6. A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
  7. Neutrophilia with subclinical Cushing’s disease: A case report and literature review
  8. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
  9. Immunoregulation of synovial macrophages for the treatment of osteoarthritis
  10. Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
  11. Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
  12. Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
  13. High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
  14. Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
  15. Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
  16. Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
  17. Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
  18. Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
  19. Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
  20. Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
  21. Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
  22. Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
  23. Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
  24. Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
  25. 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
  26. Experimental study on the optimization of ANM33 release in foam cells
  27. Primary retroperitoneal angiosarcoma: A case report
  28. Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
  29. Malignant pleural effusion diagnosis and therapy
  30. Effect of spaceflight on the phenotype and proteome of Escherichia coli
  31. Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
  32. Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
  33. Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
  34. The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
  35. Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
  36. mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
  37. The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
  38. Radiotherapy for primary thyroid adenoid cystic carcinoma
  39. Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
  40. Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
  41. Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
  42. Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
  43. PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
  44. The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
  45. Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
  46. Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
  47. NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
  48. Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
  49. Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
  50. Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
  51. Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
  52. Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
  53. Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
  54. Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
  55. Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
  56. Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
  57. Gemella morbillorum infective endocarditis: A case report and literature review
  58. An unusual ectopic thymoma clonal evolution analysis: A case report
  59. Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
  60. Detection of V. vulnificus septic shock with ARDS using mNGS
  61. Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
  62. The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
  63. Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
  64. ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
  65. Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
  66. Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
  67. Collagen changes in rabbit conjunctiva after conjunctival crosslinking
  68. Effects of NM23 transfection of human gastric carcinoma cells in mice
  69. Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
  70. Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
  71. Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
  72. Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
  73. Giant duplication of the transverse colon in an adult: A case report and literature review
  74. Ectopic thyroid tissue in the breast: A case report
  75. SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
  76. Vaginal metastasis from breast cancer: A case report
  77. Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
  78. Inhibition of TAZ impairs the migration ability of melanoma cells
  79. Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
  80. Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
  81. Identification of winter wheat pests and diseases based on improved convolutional neural network
  82. Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
  83. Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
  84. Immune checkpoint inhibitors in cancer patients with COVID-19
  85. Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
  86. Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
  87. Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
  88. DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
  89. Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
  90. Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
  91. Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
  92. Studying infant mortality: A demographic analysis based on data mining models
  93. Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
  94. Protein Z modulates the metastasis of lung adenocarcinoma cells
  95. Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
  96. TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
  97. Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
  98. Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
  99. Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
  100. Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
  101. Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
  102. HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
  103. Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
  104. Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
  105. Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
  106. Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
  107. Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
  108. Research progress on gas signal molecular therapy for Parkinson’s disease
  109. Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
  110. The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
  111. α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
  112. CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
  113. Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
  114. Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
  115. Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
  116. Research progress of AMP-activated protein kinase and cardiac aging
  117. TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
  118. Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
  119. Metastasis from small cell lung cancer to ovary: A case report
  120. The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
  121. The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
  122. Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
  123. Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
  124. Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
  125. Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
  126. Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
  127. Traumatic brain injury and rTMS-ERPs: Case report and literature review
  128. Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
  129. Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
  130. The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
  131. Inflammation-related signaling pathways in tendinopathy
  132. CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
  133. Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
  134. Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
  135. Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
  136. Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
  137. Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
  138. Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
  139. TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
  140. Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
  141. Ferroptosis: A potential target of macrophages in plaque vulnerability
  142. Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
  143. Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
  144. HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
  145. IL-17 in osteoarthritis: A narrative review
  146. Circadian cycle and neuroinflammation
  147. Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
  148. Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
  149. SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
  150. Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
  151. PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
  152. Pancreatic ectopic thyroid tissue: A case report and analysis of literature
  153. The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
  154. Report on a case of liver-originating malignant melanoma of unknown primary
  155. Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
  156. The fibroblast growth factor–Klotho axis at molecular level
  157. Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
  158. A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
  159. Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
  160. Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
  161. Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
  162. Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
  163. Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
  164. Case report of atypical undernutrition of hypoproteinemia type
  165. Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
  166. Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
  167. Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
  168. Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
  169. Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
  170. Precisional detection of lymph node metastasis using tFCM in colorectal cancer
  171. Advances in diagnosis and treatment of perimenopausal syndrome
  172. A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
  173. Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
  174. Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
  175. Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
  176. Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
  177. Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
  178. Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
  179. An online diagnosis method for cancer lesions based on intelligent imaging analysis
  180. Medical imaging in rheumatoid arthritis: A review on deep learning approach
  181. Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
  182. Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
  183. A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
  184. TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
  185. Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
  186. Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
  187. Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
  188. Hepatobiliary surgery based on intelligent image segmentation technology
  189. Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
  190. Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
  191. Early diagnosis for the onset of peri-implantitis based on artificial neural network
  192. Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
  193. Forecast of pain degree of lumbar disc herniation based on back propagation neural network
  194. SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
  195. Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
  196. Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
  197. A novel approach for minimising anti-aliasing effects in EEG data acquisition
  198. ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
  199. Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
  200. Lung nodule segmentation via semi-residual multi-resolution neural networks
  201. Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
  202. A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
  203. Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
  204. Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
  205. Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
  206. Monitoring and evaluation of anesthesia depth status data based on neuroscience
  207. Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
  208. Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
  209. Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
  210. Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
  211. Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
  212. From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
  213. Ecology and Environmental Science
  214. Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
  215. Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
  216. Effects of cadmium stress on fruits germination and growth of two herbage species
  217. Bamboo charcoal affects soil properties and bacterial community in tea plantations
  218. Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
  219. Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
  220. Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
  221. Food Science
  222. Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
  223. Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
  224. Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
  225. Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
  226. Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
  227. Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
  228. Microbiological transglutaminase: Biotechnological application in the food industry
  229. Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
  230. Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
  231. The potential for the use of leghemoglobin and plant ferritin as sources of iron
  232. Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
  233. Bioengineering and Biotechnology
  234. Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
  235. Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
  236. Agriculture
  237. Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
  238. On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
  239. Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
  240. A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
  241. Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
  242. Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
  243. Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
  244. Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
  245. Animal Sciences
  246. Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
  247. Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
  248. Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
  249. Tracking behavioral changes of confined sows from the first mating to the third parity
  250. The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
  251. Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
  252. Plant Sciences
  253. Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
  254. Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
  255. Tissue culture and rapid propagation technology for Gentiana rhodantha
  256. Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
  257. Cloning and expression analysis of VrNAC13 gene in mung bean
  258. Chlorate-induced molecular floral transition revealed by transcriptomes
  259. Effects of warming and drought on growth and development of soybean in Hailun region
  260. Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
  261. Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
  262. Distinguish Dianthus species or varieties based on chloroplast genomes
  263. Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
  264. Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
  265. An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
  266. Erratum
  267. Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
  268. Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
  269. Retraction
  270. Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 5.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0554/html
Scroll to top button