Home Life Sciences Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
Article Open Access

Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses

  • Zhe Li and Da-Wei Li EMAIL logo
Published/Copyright: July 7, 2023
Download Article (PDF)
Open Life Sciences
From the journal Open Life Sciences Volume 18 Issue 1

Abstract

Prosthetic valve endocarditis is a serious complication after heart valve replacement, accounting for about 20–30% of infective endocarditis (IE). Aspergillosis infection accounts for 25–30% of fungal endocarditis, and the mortality rate is 42–68%. Aspergillus IE often has negative blood cultures and lacks fever, which makes diagnosis difficult and delays antifungal therapy. Our study reported a case of IE in a patient with Aspergillus infection after aortic valve replacement. Ultra-multiplex polymerase chain reaction was used to identify Aspergillus infection and guide treatment. The purpose of this study was to enhance the understanding of the management of patients with endocarditis infected by fungi after valve replacement regarding the early detection, timely intervention, and treatment of the fungal infection to reduce the risk of death and improve the long-term survival of patients.

Keywords: ultra-multiplex polymer chain reaction; Aspergillus infection; aortic valve prostheses; infective endocarditis

1 Introduction

Infective endocarditis (IE) is a serious complication that increases the risk of early death for patients after heart valve replacement. Clinically, prosthetic valve infections account for about 20–30% of IE. The incidence after aortic valve replacement is approximately 0.57% per person per year, with the highest risk being within 1 year after surgery [1]. Fungal endocarditis is rare but often fatal. Traditional fungal culture of low sensitivity (63%) and lengthy culture process lead to a delay in obtaining clinical evidence of pathogenic microorganisms and consequently delays antifungal therapy [2,3]. The 2020 European Confederation of Medical Mycology consensus states that polymerase chain reaction (PCR) methods on blood and bronchoalveolar fluid provides a robust diagnostic test for screening and confirming the diagnosis of Aspergillus infection [4]. Our study reported a case of IE in a patient with Aspergillus infection after aortic valve replacement. Ultra-multiplex PCR was used to identify Aspergillus infection and guide treatment. The purpose of this study was to enhance the understanding of the management of patients with endocarditis infected by fungi after valve replacement, regarding the early detection, timely intervention, and treatment of the fungal infection to reduce the risk of death and improve the long-term survival of patients.

2 Background

2.1 General information

The case concerns a 58-year-old male patient who underwent aortic valve replacement on December 17, 2021 for severe aortic valve insufficiency and received warfarin anticoagulation postoperatively. On January 7, 2022, the patient developed mobility impairment of the right limb. A cranial computed tomography (CT) scan showed cerebral infarction, so antiplatelet and anticoagulant therapy was administered. On January 12, the patient developed a fever with a maximum body temperature of 39.8°C. Transthoracic echocardiography (TTE) showed normal mechanical aortic valve function after mechanical aortic valve replacement. The patient presented an aortic root lesion (abscess ulceration with multiple superfluous formations and localized aortic root entrapment combined with an aneurysm) and segmental ventricular wall motion abnormalities. Intravenous daptomycin 500 mg was administered daily for anti-infection. The patient had recurrent fever with temperature fluctuations between 38–39°C. On February 20, the patient developed confusion, and a cranial CT scan showed a hematoma in the right frontal lobe, a subarachnoid hemorrhage in the right occipital lobe, and multiple lacunar infarctions in the bilateral basal ganglia and left paraventricular area. Pulmonary CT showed bronchitis, and 1 g of Tienam was given every 8 h in combination with 500 mg of daptomycin daily for anti-infection. On February 23, the patient developed chills and another high fever, with a maximum body temperature of 39°C, rapid breathing of 30–40 breaths per minute, and declining consciousness. For further treatment, he was transferred to our department on February 23. The patient had previous diabetes mellitus and pre-excitation syndrome and had undergone radiofrequency ablation. He entered our department with the test results as shown in Table 1. We were also provided with an electrocardiogram (Figure 1) and a transesophageal echocardiogram (TEE; Figure 2a, b). The patient had been diagnosed with cerebral infarction, cerebral hemorrhage, myocardial infarction, pulmonary infection, aortic insufficiency, IE after heart valve replacement, multiple organ dysfunction syndromes, renal insufficiency, cardiac insufficiency, abnormal coagulation function, abnormal liver function, type 2 diabetes, and anemia.

Table 1

Comparison of laboratory tests before and after treatment

Test Prior treatment After treatment
Leukocyte count (×109/L) 18.31 11.63
Neutrophils (%) 87.5 79.9
Hemoglobin (g/L) 75 76
Platelets (×109/L) 263 202
Alanine aminotransferase (U/L) 58.7 24.9
Serum creatinine (µmol/L) 327.6 254.8
Creatine kinase-MB isoenzyme (ng/mL) 4.0 <2
Troponin I (ng/mL) 11 7.8
Myoglobin (ng/mL) 44 352
NT-proBNP (ng/L) 35,000 17,100
D-dimer (ng/mL) 17,000 47,000
Procalcitonin (ng/mL) 3.86 1.29
β-d-glucan (pg/mL) 343.84 270.87
Galactomannan 0.83 1.04
C-reactive protein (mg/mL) 240.2 165.45
Interleukin-6 (pg/mL) 137.8 85.12
Figure 1 Electrocardiogram. Electrocardiogram showed low T wave, no ST-elevation or depression, and no dynamic development.
Figure 1

Electrocardiogram. Electrocardiogram showed low T wave, no ST-elevation or depression, and no dynamic development.

Figure 2 TEE. The picture shows the prosthetic aortic valve incompetence. Multiple vegetations are present in the valve frame ascending aortic wall, the largest vegetation is 28 mm × 11 mm with an obvious range of motion. There is an obvious dilation of the ascending aorta whose internal diameter is approximately 64 mm, accompanied by a thickening of the wall whose thickness is approximately 6.6 mm. There is mild regurgitation of the mitral and tricuspid valves. (a) TEE-long axis of the aorta, (b) TEE-short axis of the aorta.
Figure 2

TEE. The picture shows the prosthetic aortic valve incompetence. Multiple vegetations are present in the valve frame ascending aortic wall, the largest vegetation is 28 mm × 11 mm with an obvious range of motion. There is an obvious dilation of the ascending aorta whose internal diameter is approximately 64 mm, accompanied by a thickening of the wall whose thickness is approximately 6.6 mm. There is mild regurgitation of the mitral and tricuspid valves. (a) TEE-long axis of the aorta, (b) TEE-short axis of the aorta.

  1. Informed consent: Informed consent has been obtained from all individuals included in this study.

  2. Ethical approval: The research related to human use has been complied with all the relevant national regulations, institutional policies and in accordance with the tenets of the Helsinki Declaration, and has been approved by Ethics Committee of Sixth Medical Center of Chinese People’s Liberation Army General Hospital.

2.2 Treatment situation

The patient was admitted with respiratory distress, a Glasgow Coma Scale of less than 8, and intermittent convulsions. A ventilator with tracheal intubation was used to assist respiration, and sedatives and sodium valproate were pumped to control epilepsy. Bronchoscopy showed normal mucosa of both bronchi, and a small amount of thin yellow-white sputum was visible at the left and right bronchial openings. Daptomycin and Tienam continued to be given to fight infection. On March 24, blood was simultaneously collected for culture and testing and sent to the hospital for inspection by ultra-multiplex PCR. The multiplex PCR results received on February 25 were as follows (Figure 3): Aspergillus flavus <1 × 102/L, Aspergillus oryzae <1 × 102/L, cytomegalovirus 2 × 102/L, G test 343.84 pg/mL, and GM 0.83. Test results indicated that the patient had endocarditis infected with Aspergillus, and the first dose of voriconazole was added at 6 mg/kg twice per day and was administered by 2 mg/day intravenous infusions maintained at 4 mg/kg. On February 28, the patient’s body temperature dropped to 37.8°C, and the test results were as shown in Table 1: Blood culture results reported negative on March 2.

Figure 3 The result of ultra-multiplex PCR using blood.
Figure 3

The result of ultra-multiplex PCR using blood.

Aspergillus flavus and Aspergillus oryzae were detected by pathogen-targeted metagenomics next-generation sequencing (ptNGS) of the blood (87 and 25 Copies/mL), Table 2 and Figure 4a, b. The primer sequences are as shown in Table 3.

Table 2

Microbes detected by ptNGS

Parameters Microbe Copies/mL
Pathogenic microorganisms Aspergillus flavus 87
Aspergillus oryzae 25
Background microorganisms Human herpesvirus 5 317

ptNGS: pathogen-targeted next-generation sequencing.

Figure 4 The results of ptNGS. (a) 185,992 is the total series of measurements. After eliminating the number of short sequences with low quality, unmatched sequences and matched sequences with low quality, the remaining number of valid sequences is 91,975, (b) In this 91,975, the number of effective sequences filtered was 91,492, the number of Aflatus sequences was 87, the number of Aspergillus sequences was 25, and the number of human herpesvirus type 5 sequences was 371.
Figure 4

The results of ptNGS. (a) 185,992 is the total series of measurements. After eliminating the number of short sequences with low quality, unmatched sequences and matched sequences with low quality, the remaining number of valid sequences is 91,975, (b) In this 91,975, the number of effective sequences filtered was 91,492, the number of Aflatus sequences was 87, the number of Aspergillus sequences was 25, and the number of human herpesvirus type 5 sequences was 371.

Table 3

Primer sequences of Aspergillus flavus/Aspergillus oryzae

Aspergillus flavus primer sequences
Primer F R
GTCTTCCGATCGGAATCGTG CTGGTTGCGTTATAAATACTGGCC
TGGCCCTTCTCAACCTCACT CGTCGCAAGTGAAACTCCAA
GTTCCGTTGGAGCTGTCGATATA CGTATCTACTTCCTCAAGCGCTACT
CTACCTTCTCCGAAATGGCTTG CTAGAGGGCAATAGTGGAGTTCAAG
Aspergillus oryzae primer sequences
Primer F R
TACTTTCTTTGGGGGTTTGTCTGGT ACTCCAAGCCAGTTATTTCACATCAC

Our treatment adjustment for this patient was to report the ultra-multiplex PCR results before obtaining a negative blood culture result for 5 days and to adjust the antibiotic time schedule, which led to effective infection control, successful ventilator withdrawal, and a clear state of consciousness. The patient was subsequently transferred out of the intensive care unit. Unfortunately, in the later stage, a massive cerebral hemorrhage combined with a new cerebral infarction led to the death of the patient.

3 Discussion

With the increase in patients undergoing valve replacement, prosthetic valve endocarditis (PVE) has become an infectious disease of serious concern. Endocarditis is contracted by 1–6% of patients who have received a prosthetic valve replacement, accounting for 20–30% of all IE [5]. The annual incidence of IE for valve replacement patients is 0.3–1.2% [6,7], with aortic and mitral valves having approximately the same probability of PVE [8,9]. Without early recognition and treatment, the expected mortality rate is high. Even with timely diagnosis, antibiotic treatment, and valve replacement, the mortality rate ranges from 26 to 75% in medically treated patients vs 23–43% in surgically treated patients [10].

The onset of IE after valve replacement may occur early or later but is usually within 12 months. The timing of infection reflects different pathogenic mechanisms. Generally, PVE infection (less than 12 months postoperation) is mostly caused by microorganisms reaching the prosthetic valve either through direct intraoperative contamination or hematogenous spread in the first few days or weeks after surgery. In the early stage after valve implantation, microorganisms can enter the paravalvular tissue along the suture route and become encapsulated by host proteins such as fibrin, thereby, causing infection of the valve and surrounding tissue. This is why early paravalvular abscesses are particularly common. Twelve-month postoperative valve infection is caused by the formation of microthrombi (composed of platelets and fibrin) due to structural changes in the heart that facilitate the attachment of microorganisms, leading to infection [11]. With the passage of postoperation time, the endothelialization of paravalvular tissue can protect paravalvular tissue from infection. Therefore, paravalvular tissue is less likely to affect advanced PVE unless the pathogen causing the infection is Staphylococcus aureus or another highly virulent or invasive pathogen [12]. Therefore, late-onset infections are rarely complicated by paravalvular abscesses or valve dehiscence and are usually limited to the suture ring or prosthetic valve. The risk of PVE is greatest in the first year after implantation, in the first 6 months postoperatively at 1.4–3.1%, and lower thereafter, but consistently at 0.2–0.35% per patient per year. The risk of infection is higher for mechanical valves than for biological valves in the first 3 months and is the same for both valves after 5 years [1].

The pathogenic microorganisms of early PVE infection are different from that of natural valve endocarditis. PVE is mostly related to perioperative infection or central venous catheter infection and is likely to be nosocomial. The most common pathogens causing PVE are Staphylococcus aureus and coagulase-negative staphylococci, followed by gram-negative bacilli and Candida. Fungal endocarditis is rare, accounting for 1–2% of all IE. Candida is the most common fungal pathogen causing PVE, accounting for 49.6% (Candida albicans 37% and Candida parapsilosis 31.5%) [13]. Aspergillus fungi account for 30% (Aspergillus fumigatus 66.7% and Aspergillus flavus 22.8%), Scedosporium apiospermum account for 3.2% [14].

After valve replacement, it is necessary to be alert for PVE in patients if they have nonspecific unexplained symptoms such as fever, chills, anorexia, weight loss, or repeated bacteremia. The diagnosis of PVE relies on clinical manifestations, blood cultures (or other microbiological evidence), and echocardiography. The diagnosis of fungal endocarditis is far more difficult than it is for bacterial endocarditis, mainly because of lack of symptoms such as fever, splenomegaly, digital clubbing, or typical immune response symptoms such as Roth spots or Osler nodules. Fungal vegetations tend to be large and brittle and slough off, causing a greater risk of embolism than bacterial endocarditis. Many patients with endocarditis infected by Aspergillus fumigatus are admitted to other departments because of the tendency to shed large vegetations that predispose them to cerebrovascular and lower extremity vascular embolism [15]. Meena et al. [14] conducted a systematic review of 250 cases of fungal endocarditis reported between January 2000 and December 2020. The median time for symptom onset was 14 days postoperation. On general examination, fever was the most common symptom (62.1%), followed by dyspnea/chest pain (37.1%), new heart murmurs (32.8%), and splenomegaly (10.3%). At the same time, complications were the first manifestation of fungal endocarditis, the most common being peripheral vascular embolism (34.5%) followed by stroke, congestive heart failure, and pulmonary embolism, 27.9, 17, and 12.5%, respectively.

All patients with suspected PVE should undergo cardiac ultrasonography. TTE reveals valve involvement and redundancy in the majority of patients and abnormalities in nearly 13.6% of patients without TTE [10]. Paravalvular abscesses and fissures are difficult to evaluate by TTE. In addition, prosthetic valves can produce humming and shadowing that can obscure key patient presentations [16]. TEE is recommended for every patient suspected of having prosthetic fungal endocarditis to improve diagnostic accuracy and detection time. If the initial TEE is negative or indeterminate and PVE is clinically suspected, TEE should be repeated 5–7 days later if not contraindicated.

In addition to echocardiography and other examinations, the diagnosis of fungal endocarditis likely requires blood or tissue culture and histopathological analysis. However, the culture time of fungi is long, with a median time of 7 days, and the positive rate of blood culture of fungi, especially Aspergillus, is low [17], which leads to delayed diagnosis and treatment and significantly reduces the survival rate of patients with fungi, especially with Aspergillus endocarditis. Meena and others have shown [12] that 33.9% of IE with negative blood culture is a fungal infection. However, the positive of blood cultures for Aspergillus-infected endocarditis is only 28%, compared with 88% for Candida-infected endocarditis. The rates of positive tissue cultures and histopathological examinations are higher at 91.1% but are limited by the inconvenience to physicians in obtaining clinical materials. There are many new methods for fungal diagnoses, such as the G Test, GM Test, PCR technology, and gene detection of second-generation sequencing. The positive rate of G is 88.9%, the sensitivity of galactomannan detection and mannan/anti-mannan antibody is 83%, and PCR primer has been used for molecular diagnosis with good sensitivity and specificity in previous studies [18,19].

The patient in our case, who suffered complications of thrombosis, fever, and cerebral hemorrhage after aortic valve replacement, was admitted to our hospital. Although neurologic complications are the most frequent extracardiac complications of left-sided IE occurring in 20–55% of patients, including acute ischemic stroke, cerebral microbleeds, cerebral abscess, mycotic aneurysms, and meningoencephalitis. And cryptogenic stroke can be the first sign of IE in about 35% of patients and is associated with increased morbidity and mortality [20]. However, due to the lacking data of other hospitals and surgical procedures, we do not have enough evidence to prove whether the patient’s cerebral infarction is related to vegetations. But fever of unknown origin after antibacterial treatment makes us confused, whether there is infection by other pathogens? Considering the low detection rate and long progress of pathogens associated with Aspergillus infection, ultra-multiplex PCR (ptNGS) was conducted.

Multiplex PCR was first introduced in 1988 when it was used to amplify the Duchenne muscular dystrophy gene to enable mutation detection. When the number of primer pairs in a single PCR exceeds 100, it is often referred to as ultra-multiplex PCR sequencing. By pre-designing thousands of targeted primers, ptNGS performs highly uniform ultra-multiplex PCR amplification and signal amplification for target-specific fragments in the sample of the same reaction system. And then, a large number of targets are enriched, amplification products are synchronously deep sequenced, non-target fragments are eliminated, and quantitative analysis is carried out by high-throughput sequencing. Therefore, this high-throughput ptNGS technology can quickly and economically exploit the dual advantages of the high sensitivity of targeted amplification and high specificity. Because the primer is pre-designed for the target, it is unaffected by the human genome and that of the background bacteria in the sample during the gene capture stage. Not only can the target gene of the pathogen in the sample be captured without interference, but there is an efficient collection of the pathogen’s nucleic acid, such as Mycobacterium tuberculosis, Legionella, Brucella, and others. At present, ultra-multiplex PCR technology has been widely used in various fields of molecular diagnosis, including the detection of monogenic hereditary diseases, the detection of tumor drug genes, polymorphic loci, and forensic medicine. Recently, ultra-multiplex PCR technology has also begun to emerge in the field of pathogenic microorganism detection. Shanghai Pulmonary Hospital can screen about 30 common tuberculosis Mycobacterium and non-tuberculous Mycobacterium species in a single test using multiplex PCR technology [21]. The Second Hospital of Hebei Medical University can use ultra-multiplex PCR technology to detect more than 300 common clinical pathogens in one reaction [22]. Compared with traditional single-tube PCR assays, these assays have the characteristics of high throughput, high efficiency, and cost-effectiveness. Compared with 7 days for fungal culture, the detection time of ultra-multiplex PCR is 1 day, a great benefit for the anti-infective treatment of critically ill patients.

For endocarditis caused by a fungal infection of prosthetic valves, the main treatment is a systemic application of antifungal drugs combined with surgery, the latter being more important. The operation time varies depending on the clinical situation, anatomical manifestations, and complications. Cases of ischemic and hemorrhagic brain injury are mainly treated by neurologists and neurosurgeons. New massive cerebral infarction or cerebral hemorrhage should be considered a possibility at least 4 weeks prior to valve replacement in cases of hemodynamic stability and low risk of embolic recurrence [1].

This patient was not suitable for surgical treatment because of serious complications, so we used voriconazole. Voriconazole is the first-line treatment for aspergillosis. With the treatment of voriconazole, the patient’s body temperature was normal, and the endotracheal tube was removed. However, the patient suffered more serious cerebral hemorrhage. Regardless of etiology, delays in diagnosis are common and associated with worse outcomes, for patients with diagnostic difficulties, early ultra-multiplex PCR (using biological samples with only a few pathogens) are helpful for early diagnosis and treatment, potentially allowing patients to achieve favorable outcomes.

4 Conclusion

PVE, especially from fungal infection, in valve replacement is a serious potential complication with high mortality. Slow diagnosis of fungal infection, especially in Aspergillus-infected PVE, leads to delayed antifungal treatment that increases the risk of serious complications and even death in patients. Therefore, it is necessary to be alert to any recurrent fever or unexplained embolism in patients after prosthetic valve replacement and alert to the possibility of prosthetic valve infection. Echocardiography remains the first step toward determining the cause of any symptoms, and TEE is recommended. In addition to improving the screening of routine infection indicators such as routine blood tests, procalcitonin tests, G tests, and GM tests, multiplex PCR combined with next-generation targeted sequencing technology can quickly obtain pathogenic evidence and increase the culture positivity rate, enabling the application of anti-infective drugs early to control infection and create better conditions for subsequent surgical treatment.

tel: +86 10 66951326

Acknowledgements

We would like to acknowledge the hard and dedicated work of all the staff that implemented the intervention and evaluation components of the study.

  1. Funding information: Authors state no funding involved.

  2. Author contributions: Writing of the manuscript: Zhe Li. Critical revision of the manuscript for intellectual content: Da-Wei Li. All authors read and approved the final draft.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Malvindi PG, Olevano C, Luthra S, Tsang G, Barlow C, Ohri S. Outcomes of patients with acute prosthetic aortic valve endocarditis. Asian Cardiovasc Thorac Ann. 2021;29:268–77.10.1177/0218492320974112Search in Google Scholar PubMed

[2] Chevalier K, Barde F, Benhamida S, Meur ML, Thyrault M, Bentoumi Y, et al. Invasive aspergillosis and endocarditis. Rev Med Interne. 2021;42:678–85.10.1016/j.revmed.2021.07.001Search in Google Scholar PubMed

[3] Lin LQ, Wu BX, Lin MY, Chen QX, Xu DP. Interim analysis report of kuanxiong aerosol in improving angina and quality of life after percutaneous coronary intervention. World J Tradit Chin Med. 2022;8:87–91.10.4103/wjtcm.wjtcm_26_21Search in Google Scholar

[4] Donnelly JP, Chen SC, Kauffman CA, Steinbach WJ, Baddley JW, Verweij PE, et al. Revision and update of the consensus definitions of invasive fungal disease from the European organization for research and treatment of cancer and the mycoses study group education and research consortium. Clin Infect Dis. 2020;71:1367–76.10.1093/cid/ciz1008Search in Google Scholar PubMed PubMed Central

[5] Nataloni M, Pergolini M, Rescigno G, Mocchegiani R. Prosthetic valve endocarditis. J Cardiovasc Med (Hagerstown). 2010;11:869–83.10.2459/JCM.0b013e328336ec9aSearch in Google Scholar PubMed

[6] Weber C, Petrov G, Luehr M, Aubin H, Tugtekin SM, Borger MA, et al. Surgical results for prosthetic versus native valve endocarditis: A multicenter analysis. J Thorac Cardiovasc Surg. 2021;161:609–19.10.1016/j.jtcvs.2019.09.186Search in Google Scholar PubMed

[7] Wang A, Athan E, Pappas PA, Fowler VG, Fowler L, Paré C, et al. Contemporary clinical profile and outcome of prosthetic valve endocarditis. JAMA. 2007;297:1354–61.10.1001/jama.297.12.1354Search in Google Scholar PubMed

[8] Hammermeister KE, Sethi GK, Henderson WG, Oprian C, Kim T, Rahimtoola S, et al. A comparison of outcomes in men 11 years after heart-valve replacement with a mechanical valve or bioprosthesis. Veterans Affairs Cooperative Study on Valvular Heart Disease. N Engl J Med. 1993;328:1289–96.10.1056/NEJM199305063281801Search in Google Scholar PubMed

[9] Grover FL, Cohen DJ, Oprian C, Henderson WJ, Sethi G, Hammermeister KE, et al. Determinants of the occurrence of and survival from prosthetic valve endocarditis. J Thorac Cardiovasc Surg. 1994;108:207–14.10.1016/S0022-5223(94)70002-8Search in Google Scholar

[10] Ivanovic B, Trifunovic D, Matic S, Petrovic J, Sacic D, Tadic M. Prosthetic valve endocarditis - A trouble or a challenge? J Cardiol. 2019;73:126–33.10.1016/j.jjcc.2018.08.007Search in Google Scholar PubMed

[11] Wiesemann S, Trauzeddel RF, Musa A, Hickstein R, Mayr T, Brenkenhoff FK, et al. Changes of aortic hemodynamics after aortic valve replacement-A four dimensional flow cardiovascular magnetic resonance follow up study. Front Cardiovasc Med. 2023;10:1071643.10.3389/fcvm.2023.1071643Search in Google Scholar PubMed PubMed Central

[12] Kamde SP, Anjankar A. Pathogenesis, diagnosis, antimicrobial therapy, and management of infective endocarditis, and its complications. Cureus. 2022;14:e29182.10.7759/cureus.29182Search in Google Scholar PubMed PubMed Central

[13] Cahill TJ, Prendergast BD. Infective endocarditis. Lancet. 2016;387:882–93.10.1016/S0140-6736(15)00067-7Search in Google Scholar PubMed

[14] Meena DS, Kumar D, Agarwal M, Bohra GK, Choudhary R, Samantaray S, et al. Clinical features, diagnosis and treatment outcome of fungal endocarditis: A systematic review of reported cases. Mycoses. 2022;65:294–302.10.1111/myc.13398Search in Google Scholar PubMed

[15] Lennard K, Bannan A, Grant P, Post J. Potential benefit of combination antifungal therapy in Aspergillus endocarditis. BMJ Case Rep. 2020;13:e234008.10.1136/bcr-2019-234008Search in Google Scholar PubMed PubMed Central

[16] Sordelli C, Fele N, Mocerino R, Weisz SH, Ascione L, Caso P, et al. Infective endocarditis: echocardiographic imaging and new imaging modalities. J Cardiovasc Echogr. 2019;29:149–55.10.4103/jcecho.jcecho_53_19Search in Google Scholar PubMed PubMed Central

[17] Jalalian R, Shokohi T, Mirzakhani R, Ghasemian R, Hedayati MT, Ardalani S, et al. Fatal prosthetic valve endocarditis due to aspergillus flavus in a diabetic patient. Infect Drug Resist. 2020;13:2245–50.10.2147/IDR.S258637Search in Google Scholar PubMed PubMed Central

[18] Pasha AK, Lee JZ, Low SW, Desai H, Lee KS, Mohajer MA. Fungal endocarditis: Update on diagnosis and management. Am J Med. 2016;129:1037–43.10.1016/j.amjmed.2016.05.012Search in Google Scholar PubMed

[19] Grijalva M, Horvath R, Dendis M, Erný J, Benedik J. Molecular diagnosis of culture negative infective endocarditis: clinical validation in a group of surgically treated patients. Heart. 2003;89:263–8.10.1136/heart.89.3.263Search in Google Scholar PubMed PubMed Central

[20] Distefano M, Calandrelli R, Arena V, Pedicelli A, Marca GD, Pilato F. A puzzling case of cryptogenic stroke. J Stroke Cerebrovasc Dis. 2019;28:e33–5.10.1016/j.jstrokecerebrovasdis.2019.01.001Search in Google Scholar PubMed

[21] Li B, Xu LY, Guo Q, Chen JH, Zhang YN, Huang WP, et al. GenSeizer: a multiplex PCR-based targeted gene sequencing platform for rapid and accurate identification of major mycobacterium species. J Clin Microbiol. 2021;59:e00584-20.10.1128/JCM.00584-20Search in Google Scholar PubMed PubMed Central

[22] Chao LS, Li JH, Zhang YN, Pu H, Yan XX. Application of next generation sequencing-based rapid detection platform for microbiological diagnosis and drug resistance prediction in acute lower respiratory infection. Ann Transl Med. 2020;8:1644.10.21037/atm-20-7081Search in Google Scholar PubMed PubMed Central

Received: 2022-12-12
Revised: 2023-05-10
Accepted: 2023-05-15
Published Online: 2023-07-07

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
  3. Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
  4. Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
  5. Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
  6. A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
  7. Neutrophilia with subclinical Cushing’s disease: A case report and literature review
  8. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
  9. Immunoregulation of synovial macrophages for the treatment of osteoarthritis
  10. Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
  11. Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
  12. Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
  13. High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
  14. Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
  15. Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
  16. Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
  17. Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
  18. Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
  19. Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
  20. Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
  21. Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
  22. Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
  23. Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
  24. Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
  25. 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
  26. Experimental study on the optimization of ANM33 release in foam cells
  27. Primary retroperitoneal angiosarcoma: A case report
  28. Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
  29. Malignant pleural effusion diagnosis and therapy
  30. Effect of spaceflight on the phenotype and proteome of Escherichia coli
  31. Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
  32. Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
  33. Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
  34. The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
  35. Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
  36. mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
  37. The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
  38. Radiotherapy for primary thyroid adenoid cystic carcinoma
  39. Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
  40. Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
  41. Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
  42. Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
  43. PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
  44. The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
  45. Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
  46. Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
  47. NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
  48. Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
  49. Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
  50. Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
  51. Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
  52. Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
  53. Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
  54. Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
  55. Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
  56. Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
  57. Gemella morbillorum infective endocarditis: A case report and literature review
  58. An unusual ectopic thymoma clonal evolution analysis: A case report
  59. Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
  60. Detection of V. vulnificus septic shock with ARDS using mNGS
  61. Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
  62. The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
  63. Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
  64. ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
  65. Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
  66. Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
  67. Collagen changes in rabbit conjunctiva after conjunctival crosslinking
  68. Effects of NM23 transfection of human gastric carcinoma cells in mice
  69. Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
  70. Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
  71. Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
  72. Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
  73. Giant duplication of the transverse colon in an adult: A case report and literature review
  74. Ectopic thyroid tissue in the breast: A case report
  75. SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
  76. Vaginal metastasis from breast cancer: A case report
  77. Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
  78. Inhibition of TAZ impairs the migration ability of melanoma cells
  79. Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
  80. Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
  81. Identification of winter wheat pests and diseases based on improved convolutional neural network
  82. Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
  83. Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
  84. Immune checkpoint inhibitors in cancer patients with COVID-19
  85. Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
  86. Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
  87. Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
  88. DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
  89. Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
  90. Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
  91. Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
  92. Studying infant mortality: A demographic analysis based on data mining models
  93. Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
  94. Protein Z modulates the metastasis of lung adenocarcinoma cells
  95. Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
  96. TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
  97. Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
  98. Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
  99. Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
  100. Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
  101. Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
  102. HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
  103. Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
  104. Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
  105. Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
  106. Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
  107. Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
  108. Research progress on gas signal molecular therapy for Parkinson’s disease
  109. Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
  110. The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
  111. α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
  112. CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
  113. Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
  114. Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
  115. Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
  116. Research progress of AMP-activated protein kinase and cardiac aging
  117. TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
  118. Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
  119. Metastasis from small cell lung cancer to ovary: A case report
  120. The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
  121. The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
  122. Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
  123. Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
  124. Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
  125. Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
  126. Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
  127. Traumatic brain injury and rTMS-ERPs: Case report and literature review
  128. Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
  129. Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
  130. The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
  131. Inflammation-related signaling pathways in tendinopathy
  132. CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
  133. Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
  134. Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
  135. Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
  136. Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
  137. Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
  138. Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
  139. TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
  140. Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
  141. Ferroptosis: A potential target of macrophages in plaque vulnerability
  142. Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
  143. Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
  144. HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
  145. IL-17 in osteoarthritis: A narrative review
  146. Circadian cycle and neuroinflammation
  147. Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
  148. Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
  149. SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
  150. Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
  151. PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
  152. Pancreatic ectopic thyroid tissue: A case report and analysis of literature
  153. The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
  154. Report on a case of liver-originating malignant melanoma of unknown primary
  155. Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
  156. The fibroblast growth factor–Klotho axis at molecular level
  157. Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
  158. A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
  159. Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
  160. Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
  161. Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
  162. Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
  163. Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
  164. Case report of atypical undernutrition of hypoproteinemia type
  165. Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
  166. Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
  167. Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
  168. Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
  169. Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
  170. Precisional detection of lymph node metastasis using tFCM in colorectal cancer
  171. Advances in diagnosis and treatment of perimenopausal syndrome
  172. A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
  173. Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
  174. Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
  175. Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
  176. Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
  177. Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
  178. Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
  179. An online diagnosis method for cancer lesions based on intelligent imaging analysis
  180. Medical imaging in rheumatoid arthritis: A review on deep learning approach
  181. Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
  182. Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
  183. A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
  184. TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
  185. Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
  186. Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
  187. Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
  188. Hepatobiliary surgery based on intelligent image segmentation technology
  189. Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
  190. Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
  191. Early diagnosis for the onset of peri-implantitis based on artificial neural network
  192. Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
  193. Forecast of pain degree of lumbar disc herniation based on back propagation neural network
  194. SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
  195. Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
  196. Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
  197. A novel approach for minimising anti-aliasing effects in EEG data acquisition
  198. ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
  199. Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
  200. Lung nodule segmentation via semi-residual multi-resolution neural networks
  201. Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
  202. A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
  203. Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
  204. Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
  205. Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
  206. Monitoring and evaluation of anesthesia depth status data based on neuroscience
  207. Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
  208. Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
  209. Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
  210. Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
  211. Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
  212. From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
  213. Ecology and Environmental Science
  214. Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
  215. Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
  216. Effects of cadmium stress on fruits germination and growth of two herbage species
  217. Bamboo charcoal affects soil properties and bacterial community in tea plantations
  218. Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
  219. Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
  220. Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
  221. Food Science
  222. Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
  223. Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
  224. Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
  225. Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
  226. Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
  227. Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
  228. Microbiological transglutaminase: Biotechnological application in the food industry
  229. Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
  230. Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
  231. The potential for the use of leghemoglobin and plant ferritin as sources of iron
  232. Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
  233. Bioengineering and Biotechnology
  234. Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
  235. Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
  236. Agriculture
  237. Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
  238. On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
  239. Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
  240. A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
  241. Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
  242. Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
  243. Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
  244. Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
  245. Animal Sciences
  246. Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
  247. Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
  248. Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
  249. Tracking behavioral changes of confined sows from the first mating to the third parity
  250. The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
  251. Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
  252. Plant Sciences
  253. Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
  254. Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
  255. Tissue culture and rapid propagation technology for Gentiana rhodantha
  256. Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
  257. Cloning and expression analysis of VrNAC13 gene in mung bean
  258. Chlorate-induced molecular floral transition revealed by transcriptomes
  259. Effects of warming and drought on growth and development of soybean in Hailun region
  260. Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
  261. Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
  262. Distinguish Dianthus species or varieties based on chloroplast genomes
  263. Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
  264. Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
  265. An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
  266. Erratum
  267. Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
  268. Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
  269. Retraction
  270. Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
https://doi.org/10.1515/biol-2022-0629
Keywords for this article
ultra-multiplex polymer chain reaction; Aspergillus infection; aortic valve prostheses; infective endocarditis
Creative Commons
BY 4.0

Articles in the same Issue

  1. Biomedical Sciences
  2. Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
  3. Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
  4. Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
  5. Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
  6. A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
  7. Neutrophilia with subclinical Cushing’s disease: A case report and literature review
  8. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
  9. Immunoregulation of synovial macrophages for the treatment of osteoarthritis
  10. Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
  11. Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
  12. Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
  13. High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
  14. Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
  15. Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
  16. Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
  17. Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
  18. Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
  19. Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
  20. Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
  21. Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
  22. Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
  23. Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
  24. Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
  25. 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
  26. Experimental study on the optimization of ANM33 release in foam cells
  27. Primary retroperitoneal angiosarcoma: A case report
  28. Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
  29. Malignant pleural effusion diagnosis and therapy
  30. Effect of spaceflight on the phenotype and proteome of Escherichia coli
  31. Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
  32. Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
  33. Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
  34. The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
  35. Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
  36. mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
  37. The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
  38. Radiotherapy for primary thyroid adenoid cystic carcinoma
  39. Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
  40. Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
  41. Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
  42. Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
  43. PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
  44. The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
  45. Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
  46. Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
  47. NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
  48. Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
  49. Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
  50. Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
  51. Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
  52. Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
  53. Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
  54. Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
  55. Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
  56. Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
  57. Gemella morbillorum infective endocarditis: A case report and literature review
  58. An unusual ectopic thymoma clonal evolution analysis: A case report
  59. Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
  60. Detection of V. vulnificus septic shock with ARDS using mNGS
  61. Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
  62. The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
  63. Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
  64. ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
  65. Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
  66. Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
  67. Collagen changes in rabbit conjunctiva after conjunctival crosslinking
  68. Effects of NM23 transfection of human gastric carcinoma cells in mice
  69. Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
  70. Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
  71. Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
  72. Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
  73. Giant duplication of the transverse colon in an adult: A case report and literature review
  74. Ectopic thyroid tissue in the breast: A case report
  75. SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
  76. Vaginal metastasis from breast cancer: A case report
  77. Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
  78. Inhibition of TAZ impairs the migration ability of melanoma cells
  79. Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
  80. Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
  81. Identification of winter wheat pests and diseases based on improved convolutional neural network
  82. Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
  83. Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
  84. Immune checkpoint inhibitors in cancer patients with COVID-19
  85. Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
  86. Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
  87. Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
  88. DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
  89. Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
  90. Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
  91. Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
  92. Studying infant mortality: A demographic analysis based on data mining models
  93. Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
  94. Protein Z modulates the metastasis of lung adenocarcinoma cells
  95. Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
  96. TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
  97. Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
  98. Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
  99. Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
  100. Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
  101. Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
  102. HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
  103. Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
  104. Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
  105. Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
  106. Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
  107. Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
  108. Research progress on gas signal molecular therapy for Parkinson’s disease
  109. Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
  110. The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
  111. α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
  112. CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
  113. Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
  114. Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
  115. Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
  116. Research progress of AMP-activated protein kinase and cardiac aging
  117. TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
  118. Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
  119. Metastasis from small cell lung cancer to ovary: A case report
  120. The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
  121. The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
  122. Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
  123. Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
  124. Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
  125. Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
  126. Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
  127. Traumatic brain injury and rTMS-ERPs: Case report and literature review
  128. Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
  129. Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
  130. The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
  131. Inflammation-related signaling pathways in tendinopathy
  132. CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
  133. Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
  134. Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
  135. Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
  136. Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
  137. Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
  138. Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
  139. TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
  140. Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
  141. Ferroptosis: A potential target of macrophages in plaque vulnerability
  142. Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
  143. Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
  144. HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
  145. IL-17 in osteoarthritis: A narrative review
  146. Circadian cycle and neuroinflammation
  147. Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
  148. Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
  149. SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
  150. Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
  151. PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
  152. Pancreatic ectopic thyroid tissue: A case report and analysis of literature
  153. The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
  154. Report on a case of liver-originating malignant melanoma of unknown primary
  155. Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
  156. The fibroblast growth factor–Klotho axis at molecular level
  157. Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
  158. A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
  159. Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
  160. Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
  161. Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
  162. Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
  163. Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
  164. Case report of atypical undernutrition of hypoproteinemia type
  165. Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
  166. Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
  167. Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
  168. Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
  169. Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
  170. Precisional detection of lymph node metastasis using tFCM in colorectal cancer
  171. Advances in diagnosis and treatment of perimenopausal syndrome
  172. A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
  173. Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
  174. Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
  175. Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
  176. Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
  177. Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
  178. Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
  179. An online diagnosis method for cancer lesions based on intelligent imaging analysis
  180. Medical imaging in rheumatoid arthritis: A review on deep learning approach
  181. Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
  182. Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
  183. A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
  184. TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
  185. Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
  186. Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
  187. Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
  188. Hepatobiliary surgery based on intelligent image segmentation technology
  189. Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
  190. Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
  191. Early diagnosis for the onset of peri-implantitis based on artificial neural network
  192. Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
  193. Forecast of pain degree of lumbar disc herniation based on back propagation neural network
  194. SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
  195. Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
  196. Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
  197. A novel approach for minimising anti-aliasing effects in EEG data acquisition
  198. ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
  199. Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
  200. Lung nodule segmentation via semi-residual multi-resolution neural networks
  201. Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
  202. A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
  203. Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
  204. Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
  205. Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
  206. Monitoring and evaluation of anesthesia depth status data based on neuroscience
  207. Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
  208. Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
  209. Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
  210. Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
  211. Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
  212. From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
  213. Ecology and Environmental Science
  214. Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
  215. Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
  216. Effects of cadmium stress on fruits germination and growth of two herbage species
  217. Bamboo charcoal affects soil properties and bacterial community in tea plantations
  218. Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
  219. Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
  220. Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
  221. Food Science
  222. Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
  223. Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
  224. Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
  225. Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
  226. Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
  227. Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
  228. Microbiological transglutaminase: Biotechnological application in the food industry
  229. Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
  230. Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
  231. The potential for the use of leghemoglobin and plant ferritin as sources of iron
  232. Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
  233. Bioengineering and Biotechnology
  234. Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
  235. Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
  236. Agriculture
  237. Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
  238. On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
  239. Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
  240. A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
  241. Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
  242. Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
  243. Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
  244. Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
  245. Animal Sciences
  246. Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
  247. Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
  248. Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
  249. Tracking behavioral changes of confined sows from the first mating to the third parity
  250. The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
  251. Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
  252. Plant Sciences
  253. Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
  254. Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
  255. Tissue culture and rapid propagation technology for Gentiana rhodantha
  256. Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
  257. Cloning and expression analysis of VrNAC13 gene in mung bean
  258. Chlorate-induced molecular floral transition revealed by transcriptomes
  259. Effects of warming and drought on growth and development of soybean in Hailun region
  260. Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
  261. Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
  262. Distinguish Dianthus species or varieties based on chloroplast genomes
  263. Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
  264. Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
  265. An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
  266. Erratum
  267. Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
  268. Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
  269. Retraction
  270. Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2026 De Gruyter Brill
Downloaded on 27.1.2026 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0629/html
Scroll to top button