Home SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
Article Open Access

SPOP regulates the expression profiles and alternative splicing events in human hepatocytes

  • Jing Dai , Xiang Dong , Yuxin Chen , Wanying Xue , Qingqing Wang , Feifei Shang , Yunxia Zhao , Shujing Li , Yu Gao and Yuanyuan Wang EMAIL logo
Published/Copyright: October 24, 2023
Download Article (PDF)
Open Life Sciences
From the journal Open Life Sciences Volume 18 Issue 1

Abstract

Speckle type BTB/POZ protein (SPOP) may have cancer promoting or inhibiting effects. At present, the role of SPOP in hepatocellular carcinoma (HCC) has rarely been studied. In this study, to investigate the effects of SPOP in HCC and elucidate the underlying molecular mechanisms of its relationship with genes, differentially expressed genes (DEGs) were classified through RNA sequencing. The gene ontology analysis and Kyoto Encyclopedia of Genes and Genomes functional pathway analysis were used to further predict the function of DEGs after the overexpression of SPOP. The biological function of SPOP-regulated alternative splicing events in cells is comprehensively assessed. The Cancer Genome Atlas database and Gene Expression Omnibus dataset were performed to evaluate the correlation between SPOP and HCC progression. Due to SPOP overexpression, 56 DEGs in the HCC related pathway were further identified. The results showed that SPOP overexpression facilitated the cell proliferation and changed the gene expression profiles of human normal hepatocytes. SPOP-regulated alternative splicing events were involved in pathways associated with cellular processes, metabolism, environmental information procession, organismal systems, and so on. In conclusion, SPOP may potentially exhibit tumor-promoting effects, necessitating further investigations to unveil its molecular mechanisms comprehensively.

Keywords: speckle type BTB/POZ protein; gene expression profiles; alternative splicing events; human hepatocytes; hepatocellular carcinoma

1 Introduction

Hepatocellular carcinoma (HCC) stands as the most prevalent form of primary liver cancer and ranks as the fourth leading cause of cancer-related deaths globally [1]. Up to now, the exact molecular mechanism in the progression of HCC is not completely clear. Clinical data and laboratory research results show that external environmental factors such as virus infection, alcoholism, and nutritional disorders may associate with the occurrence, development, deterioration, and metastasis of HCC [2–4]. At the same time, the genetic background of the individual also plays an important role during HCC carcinogenesis [5].

The occurrence of cancer may be related to the abnormal function of signal transduction pathways during cell division and proliferation [6]. Abnormal signal transduction may lead to abnormal gene regulation, leading to uncontrolled cell proliferation [7,8]. The ubiquitination level of various signal factors in cellular signal transduction pathways and networks is closely related to their content and activity. Ubiquitination constitutes a significant post-translational modification of eukaryotic proteins, enabling an important pathway for the non-lysosomal degradation of proteins [9,10]. The dynamic balance of protein ubiquitination and deubiquitination plays an important role in maintaining the stability of individual genomes and regulating the process of tumorigenesis [11].

Speckle type BTB/POZ protein (SPOP) derives its name primarily from its nuclear distribution and the presence of a POZ domain [12]. The SPOP gene is located at human 17q21.33, with a coding region of 1,125 bp, encoding 374 amino acids, with an approximate molecular weight of 42 kDa [13]. The protein of SPOP contains an N-terminal MATH region, a BTB/POZ region, a 3-box region, and a C-terminal NLS region [14]. Notably, the MATH region predominantly governs substrate recognition and binding, while the POZ region chiefly interacts with the E3 ligase complex [15]. Being an aptamer of the E3 ubiquitin ligase complex, SPOP is a very crucial element in the ubiquitination of various substrate proteins [16]. In various cancer cell types and under differing expression conditions SPOP may play different roles and mechanisms. For example, SPOP can inhibit the growth rate of cancer cells in lung cancer, colorectal cancer, prostate cancer, and so on. However, SPOP might also play a role in promoting cancer. It was reported that SPOP could promote the epithelial–mesenchymal transition of kidney, epithelial–mesenchymal transition in renal cancer epithelial cells, and promote the development of renal cancer [17]. The role of SPOP in HCC is rarely studied, only Huang’s team reported that SPOP can inhibit the proliferation of HCC cells and suppress the metastasis and mesenchymalization of HCC cells by downregulating the mRNA transcription level of Zeb2 [18].

SPOP exhibits a dual role, both as a tumor promoter and a tumor suppressor, although the research about its specific mechanism is still limited. As ongoing research advances the mechanism of SPOP function in different tumors might become clearer. The main purpose of this study was to investigate the downstream signaling pathways and the corresponding molecular mechanisms of SPOP in HCC.

2 Materials and methods

2.1 Cell culture and lentivirus transfection

Human normal hepatocytes WRL68 (ATCC, Manassas, USA) were cultured in Dulbecco’s Modified Eagle Medium (cat. no. PM150210, Procell, Wuhan, China) with 10% Gibco™ fetal bovine serum (cat. no. 10099141C, Invitrogen, AUS) and 1% penicillin–streptomycin (10,000 U/mL) (cat. no. 15140122, Invitrogen, USA), at 37°C in a 5% CO2 humidified atmosphere. To establish the SPOP overexpression model, lentivirus containing the SPOP gene was constructed and packaged by GeneCopoeia (Guangzhou, China). SPOP-overexpressing lentivirus was transfected into WRL68 cells (the SPOP group), resulting in the formation of the SPOP group. In parallel, an empty lentivirus was transfected into WRL68 cells to serve as the control group (referred to as the vec group). The transfection flow was performed according to the reagent manufacturer’s instructions using the Lipofectamine™ 2000 Transfection Reagent (cat. no. 11668027, Invitrogen, USA). The cells were selected with 1.5 μg/mL puromycin for 2 weeks.

2.2 Assessment of SPOP gene overexpression

Total RNA was extracted from the SPOP group and the vec group cells, respectively, using the RNA isolater Total RNA Extraction Reagent (cat. no. R401-01, Vazyme, China). Subsequently, the cDNA was synthesized according to the reverse transcription instruction of Hiscript III Reverse Transcriptase (cat. no. R302-01, Vazyme, China). The real-time fluorescent quantitative PCR (qRT-PCR) was conducted using Taq Pro Universal SYBR qPCR Master Mix (cat. no. Q712-02, Vazyme, China) in LightCycler® 96SW1.1 real-time PCR system (Roche). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was selected as the mRNA internal reference to access the efficiency of the SPOP overexpression. The primer sequences are listed in Table 1. The expression levels of SPOP in different groups were normalized to GAPDH mRNA levels using the 2−ΔΔCT method.

Table 1

Primer sequences for qRT-PCR

Gene name Forward primer sequence (5′−3′) Reverse primer sequence (5′−3′)
GAPDH ATGGGTGTGAACCATGAGAAGTA GAGTGGGTGTCGCTGTTGAAGTC
SPOP GCCCCGTAGCTGAGAGTTG ACTCGCAAACACCATTTCAGT
CALU AATAGACGCGGATAAAGATGGGT GCCATTGGTTTTCAACATTGTCA
CCNA1 GAGGTCCCGATGCTTGTCAG GTTAGCAGCCCTAGCACTGTC
CCNA2 CGCTGGCGGTACTGAAGTC GAGGAACGGTGACATGCTCAT
CCNC CCTTGCATGGAGGATAGTGAATG AAGGAGGATACAGTAGGCAAAGA
CDK1 GGATGTGCTTATGCAGGATTCC CATGTACTGACCAGGAGGGATAG
CDK4 ATGGCTACCTCTCGATATGAGC CATTGGGGACTCTCACACTCT
CDK6 CCAGATGGCTCTAACCTCAGT AACTTCCACGAAAAAGAGGCTT
FXR1 CTGCGACAGATTGGTTCTAGG TGTACCATAACCGGAGGTGTAA
GIGYF1 AACCTGCTCCCGACGATGA AGGCTGAGGTATGTACGTCCC
KIAA1522 CCAGGACAACGTCTTCTTTCC CAGCCACCCTTGTTCAGTTTC
KRAS ACAGAGAGTGGAGGATGCTTT ACAGAGAGTGGAGGATGCTTT
MYBL2 CCGGAGCAGAGGGATAGCA CAGTGCGGTTAGGGAAGTGG
PAPOLG TGTCTCTGGATAGCAGTTGTCTGG TTCGTCCTACTACGGTAGGAATGG
PER1 GCCAACCAGGAATACTACCAGC GTGTGTACTCAGACGTGATGTG
PRKAG2 TGCCCGTTATTGACCCTATCA CAGGCTTTGGCATATCAGACAT
SOX12 AAGAGGCCGATGAACGCATT TAGTCCGGGTAATCCGCCAT
TP53 CAGCACATGACGGAGGTTGT TCATCCAAATACTCCACACGC
XPO1 ATCTGACCCAACTTGTGTAGAGA TGGTCCTACTTGCTCCAACAAT

2.3 Cell counting kit 8 (CCK8) assay

Cell proliferation was tested using CCK8 (cat. no. C0038, Beyotime Biotechnology, China). Cells from different groups were seeded at a density of 1 × 103 cells in 100 μL culture medium per 96-well plates for cell culture for 24, 48, 72, and 96 h. Then, CCK8 reagent was added with 10 μL to each well. After incubation at 37°C for 2 h, the absorbance at 450 nm (OD) of each well was measured.

2.4 Colony formation assay

During colony formation assay, cells were seeded at a density of 1 × 103 cells/well into six-well plates, and cultured for 2 weeks. Two weeks later, colonies were fixed in 4% paraformaldehyde for 10 min, stained with 0.5% crystal violet for 10 min, and gently rinsed three times with PBS. A spot with more than 50 cells was counted as one clone.

2.5 RNA sequencing

The RNA samples of the SPOP group and the vec group cells were sequenced with three replicates per group at Novogene Co., Ltd (Beijing, China). RNA was extracted from cells using TRIzol reagent, followed by strict quality control of RNA samples using RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system. For library preparation, the NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB, USA) was used. The insert size of the resulting library was assessed using the Agilent 2100 Bioanalyzer. After library preparation, the samples were subjected to sequencing on an Illumina platform, which generated 150 bp paired-end reads. The paired-end clean reads were aligned to the human reference genome using the software HISAT2 [19]. The data files for RNA-seq have been deposited in the Sequence Read Archive database under PRJNA853057.

2.6 Screening of differentially expressed genes (DEGs)

After processing and analysis of RNA sequencing data, the alignment results were transferred to the program StringTie for transcript assembly [20]. The gene expression levels of RNA-seq were expressed as fragments per kilobase of transcript sequence per million base pairs sequenced (FPKM). To identify DEGs between the SPOP group and the vec group, the DESeq algorithm, implemented as a package in the R software, was utilized. The resulting p-values were adjusted using the Benjamini and Hochberg’s approach for controlling the false discovery rate. The thresholds to screen DEGs were |log2Fold change (FC)| > 0 and adjust p-value <0.05.

2.7 qRT-PCR validation of selected DEGs

To verify the validity of the RNA-seq results, qRT-PCR was conducted on some randomly selected DEGs, which were identified using RNA-sequencing. The primer sequences used for DEGs validation are also presented in Table 1. During the validation process, the RNA expression levels of the selected genes were standardized with that of GAPDH.

2.8 Gene function enrichment analysis

The gene ontology (GO) analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) functional pathway analysis were used to predict the function of DEGs between the SPOP group and the vec group. Additionally, the DisGeNET databases were also used to screen coronary liver disease-related disease targets. The enrichment was regarded as be significant when the corrected p-value was less than 0.05.

2.9 Alternative splicing events (ASEs) analysis

The ASEs between the SPOP group and the vec group were defined and quantified using the rMATS software. In this study, according to the splice junction reads, five types of ASEs were identified, including alternative 3′ splice site (A3SS), alternative 5′ splice site (A5SS), mutually exclusive exons (MXE), retained intron (RI), and skipped exon (SE). To evaluate the significance of SPOP-regulated ASEs, a Student’s t-test was performed to evaluate the significance of the ratio alteration of ASEs. The thresholds to screen DEGs were adjust to a p-value <0.05.

2.10 Public data source bioinformatics analysis

HCC expression profile data were obtained from The Cancer Genome Atlas (TCGA) database and Gene Expression Omnibus (GEO) database. The TCGA database encompassed 374 HCC patients vs 50 normal control individuals and 50 pairs of HCC tissues vs matched adjacent non-tumor tissues. The relevant clinical data, including, age, sex, grade, invasion depth, lymph node metastasis, and distant metastasis were also obtained from TCGA database. Additionally, we retrieved raw-intensity expression files of GSE14520, GSE25097, and GSE45436 from GEO database. The SPOP expression levels in the paraneoplastic and HCC tissues of every patient were analyzed. The effect of SPOP expression levels on the survival of HCC patients was estimated through the Kaplan–Meier (KM) plotter (http://kmplot.com/analysis/), an online survival analysis tool.

2.11 Statistical analysis

All the above analyses were performed by using R software version 4.0.3. Differential gene expression analysis was performed using the limma package in R. To investigate the association between DEGs and survival outcomes, KM survival curves were generated using the ggsurvplot function from the survminer package. All experiments were repeated three times, and the data were expressed as mean ± standard deviation. T-test and paired t-test were used to analyze the differences between the two groups by independent samples. Pearson correlation test provided the basis for correlation analysis. The relationship between SPOP expression and clinical characters was performed using the Wilcoxon test. Statically significance was defined as p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***).

3 Results

3.1 SPOP overexpression facilitated the proliferation of WRL68 human normal hepatocytes

To investigate the influence of SPOP on the proliferation of human normal hepatocytes (WRL68), the SPOP overexpression model in WRL68 cells was constructed by transfection with SPOP-overexpressing lentivirus (the SPOP group). Simultaneously, the empty lentivirus was transfected into WRL68 cells as a control group (the vec group). qRT-PCR was operated to verify the transfection efficiency, which successfully induced the increased expression of SPOP in WRL68 cells (Figure 1a). The proliferation ability of the SPOP group was significantly higher than that of the vec group at each period of 48, 72, and 96 h (Figure 1b). The colony formation assay was also conducted to access cell proliferation. It turned out that there was a considerable increase of cell proliferation in the SPOP group compared with the vec group (Figure 1c, p < 0.05). These findings strongly suggest the SPOP overexpression and the proliferation ability of WRL68 cells.

Figure 1 Overexpression of SPOP could facilitate the proliferation of human normal hepatocytes (WRL68). (a) Transfection efficiency of SPOP in WRL68 cells was measured by qRT-PCR. (b) Proliferative abilities of WRL68 cells in the SPOP group and the vec group were detected by CCK8 assay. (c) Colony formation assay detected the proliferations of WRL68 cells in the SPOP group and the vec group. *p < 0.05, **p < 0.01.
Figure 1

Overexpression of SPOP could facilitate the proliferation of human normal hepatocytes (WRL68). (a) Transfection efficiency of SPOP in WRL68 cells was measured by qRT-PCR. (b) Proliferative abilities of WRL68 cells in the SPOP group and the vec group were detected by CCK8 assay. (c) Colony formation assay detected the proliferations of WRL68 cells in the SPOP group and the vec group. *p < 0.05, **p < 0.01.

3.2 SPOP overexpression changed the gene expression profiles of WRL68 human normal hepatocytes

To characterize the function of SPOP in human normal hepatocytes, RNA-seq of SPOP overexpressed WRL68 cells (the SPOP group) and control WRL68 cells (the vec group) was performed (PRJNA853057). The gene expression levels of RNA-seq were quantified in FPKM. The distribution of gene expression levels in each sample of the SPOP group and the vec group is shown as the boxplots (Figure 2a). Despite having only three biological replicates in each group, there was a significant correlation between the SPOP group and the vec group (Figure 2b). Genes with |log2 (Fold Change)| > 0 and p adj <0.05 were assigned as DEGs, and there were 3,838 DEGs induced by SPOP overexpressing, including 1,522 upregulated genes and 2,316 downregulated genes (Figure 2c). The list of DEGs is presented in Table S1. To verify DEGs identified through from RNA-seq analysis, the gene expression levels of 18 genes were also measured by qRT-PCR. Between the two techniques, the Pearson’s correlation coefficient of fold change in gene expression levels was 0.8576 (p < 0.001) (Figure 2d).

Figure 2 Overexpression of SPOP could change the gene expression profiles of WRL68. (a) Boxplot of sample gene expression distribution. (b) Correlation between SPOP overexpression (SPOP rep1/2/3) and control (vec rep1/2/3) samples. (c) DEGs between the SPOP group and the vec group. (d) Correlation of log2 fold-change between RNA-Seq and RT-qPCR for significantly DEGs.
Figure 2

Overexpression of SPOP could change the gene expression profiles of WRL68. (a) Boxplot of sample gene expression distribution. (b) Correlation between SPOP overexpression (SPOP rep1/2/3) and control (vec rep1/2/3) samples. (c) DEGs between the SPOP group and the vec group. (d) Correlation of log2 fold-change between RNA-Seq and RT-qPCR for significantly DEGs.

3.3 Overview of affected biological functions in WRL68 human normal hepatocytes with SPOP overexpressing

To explore the potential biological functions of SPOP-related genes, we conducted GO, KEGG, and DisGeNET analyses using significant DEGs.

For the upregulated genes, the enriched GO biological processes were mostly related to the regulation of mRNA metabolic process, mRNA stability, and translation (Figure 3a). The complete list is given in Table S2. Conversely, the GO biological processes enriched by the downregulated genes were mostly related to protein targeting and the response to type I interferon and virus, and so on (Figure 3b, Table S3). SPOP overexpression led to the identification of 11 KEGG pathways with p adj <0.05, including oxidative phosphorylation, drug metabolism, pyrimidine metabolism, and so on (Figure 3c, Table S4). Since less than 20 enriched KEGG pathways reached significant according to adjusted p-values, the top 20 most enriched KEGG pathways of all DEGs are listed in Figure 3c based on p-values. With SPOP overexpressing, 25 DisGeNET with p adj <0.05 were identified, including neoplasm invasiveness, undifferentiated carcinoma, hepatic methionine adenosyltransferase deficiency, steatohepatitis, and so on (Figure 3d, Table S5).

Figure 3 Potential biological functions of SPOP-related genes in WRL68 cells. (a) Top 30 most enriched GO terms of the upregulated DEGs. (b) Top 30 most enriched GO terms of the downregulated DEGs. (c) Top 20 most enriched KEGG pathways of all DEGs. (d) Top 20 most enriched DisGeNET lists of all DEGs.
Figure 3

Potential biological functions of SPOP-related genes in WRL68 cells. (a) Top 30 most enriched GO terms of the upregulated DEGs. (b) Top 30 most enriched GO terms of the downregulated DEGs. (c) Top 20 most enriched KEGG pathways of all DEGs. (d) Top 20 most enriched DisGeNET lists of all DEGs.

3.4 Analysis of potential SPOP‑regulated ASEs and enrichment biological function analysis

To identify the regulatory effect of SPOP on alternative splicing, SPOP-affected ASEs were analyzed by using transcriptional sequencing data from WRL68 SPOP cells in the SPOP group and the vec group. This analysis identified a total of 158 RASEs that showed significant differences between the two groups. Of the RASE types, there were 16 A3SS events, 11 A5SS events, 20 MXE events, 11 RI events, and 100 SE events (Figure 4a). The complete list of RASEs is given in Table S6. When SPOP was overexpressed, the proportion of SE events was increased. The GO enrichment results revealed that SPOP-regulated ASEs were mainly enriched in modulation by virus of host morphology or physiology, cell division, sarcomere organization, and so on (Figure 4b). Furthermore, KEGG pathway enrichment showed that SPOP-regulated ASEs were involved in pathways associated with cellular processes, metabolism, environmental information procession, organismal systems, and more (Figure 4c).

Figure 4 Enrichment biological function of SPOP RASEs in WRL68 cells. (a) Number of significant RASEs. (b) GO functional enrichment of different RASEs. (c) KEGG pathway enrichment analysis results: A3SS events, 11 A5SS events, 20 MXE events, 11 RI events, and 100 SE events.
Figure 4

Enrichment biological function of SPOP RASEs in WRL68 cells. (a) Number of significant RASEs. (b) GO functional enrichment of different RASEs. (c) KEGG pathway enrichment analysis results: A3SS events, 11 A5SS events, 20 MXE events, 11 RI events, and 100 SE events.

3.5 Bioinformatics analysis of SPOP in HCC

To explore the correlation between SPOP expression levels and the procession of HCC, the bioinformatics analysis of SPOP was carried out. According to the data from TCGA database, the significant upregulations of SPOP expression were observed in HCC tissues compared to normal liver tissues (Figure 5a). The expression of SPOP was also significantly higher in HCC tissues compared to paraneoplastic tissues (Figure 5b). The result of relationship between SPOP expression and clinicopathological parameters showed that SPOP expression was positively correlated with tumor stage (Figure 5c). According to the results of the KM mapper analysis, it was evident that the survival rate of SPOP high expression group was remarkably lower than that of low expression group (Figure 5d).

Figure 5 Results of bioinformatics analysis of SPOP in HCC. (a) Differential expression of SPOP in HCC tissues and normal liver tissues. (b) Differential expression of SPOP in paraneoplastic and HCC tissues. (c) Correlation of SPOP expression with tumor stage. (d) Analysis of overall survival of SPOP expression in HCC patients.
Figure 5

Results of bioinformatics analysis of SPOP in HCC. (a) Differential expression of SPOP in HCC tissues and normal liver tissues. (b) Differential expression of SPOP in paraneoplastic and HCC tissues. (c) Correlation of SPOP expression with tumor stage. (d) Analysis of overall survival of SPOP expression in HCC patients.

3.6 DEGs due to SPOP overexpression in the HCC-related pathway in WRL68 cells

The result of bioinformatics analysis showed that of SPOP might play a role in procession of HCC. Due to SPOP overexpression, a total of 56 DEGs were implicated in the HCC pathway, among which 33 were downregulated and 23 were upregulated. In Figure 6, genes colored in red represent upregulated expression in WRL68 cells with SPOP overexpression compared to cells in the control group, while genes colored in green indicate downregulated expression. From the status of the normal liver to dysplastic nodules, nine were downregulated and only four were upregulated. From the status of dysplastic nodules to early HCC, nine were downregulated and only four were upregulated. In the process of HCC metastasis, approximately nine genes were downregulated and four were upregulated. The proteins encoded by DEGs were located in different parts of the cells. About four down- and two upregulated genes were located outside, and three down- and five upregulated genes were located on the cell membrane. Moreover, nine down- and eight upregulated genes were located in the nucleus.

Figure 6 HCC pathway modified by SPOP overexpression in WRL68 (the figure was drawn according to the information from KEGG PATHWAY database. The molecules in red were upregulated with SPOP overexpression and the molecules in green were downregulated with SPOP overexpression).
Figure 6

HCC pathway modified by SPOP overexpression in WRL68 (the figure was drawn according to the information from KEGG PATHWAY database. The molecules in red were upregulated with SPOP overexpression and the molecules in green were downregulated with SPOP overexpression).

4 Discussion

The development of HCC is a complex process influenced by both environmental and genetic factors [21,22]. It is well known that the ubiquitin proteasome pathway could play an important role in the progression of cirrhosis and HCC [23]. Ubiquitination serves as a crucial post-transcriptional modification of eukaryotic proteins and represents an important pathway for non-lysosomal degradation of proteins [24]. SPOP, as an important protein molecule involved in the regulation of the occurrence and development of various tumors, has limited reports regarding its molecular mechanism in liver cancer metastasis [25]. For instance, Huang’s team reported that SPOP could inhibit hepatoma cell migration, including the suppression of ZEB2 expression and the related program of epithelial–mesenchymal transition [18]. The results from Ji’s group showed that SPOP expression was downregulated in HCC and also related to tumor size, differentiation, and metastasis [26]. However, according to the TCGA data, SPOP was upregulated markedly in HCC tissues compared to normal liver tissues. The expression of SPOP was also significantly higher in HCC tissues compared to paraneoplastic tissues. SPOP expression was upregulated in HHC patients, which is significantly related to lower survival rate and poor prognosis. Collectively, all of these indicated that SPOP has a tumor-promoting effect in HCC, prompting us to explore its impact further. Despite limited knowledge about the transcriptional levels of SPOP in human normal hepatocytes, our bioinformatics analysis which involved SPOP overexpression in WRL68 showed that SPOP regulates the expression profiles and ASEs in human hepatocytes.

SPOP, a crucial ubiquitinylation ligase, also serves as a bridging component of Cul3 (a member of the E3 family of ubiquitin ligases) which binds to substrate proteins. SPOP is involved in the regulation of a variety of cellular activities, influencing two major categories of fundamental cellular activities including genome modification and cellular signaling. In these processes, SPOP mediates ubiquitination modifications of many nuclear proteins, leading to protein degradation and thus regulating a variety of cellular functions. In this study, we aimed to uncover the mechanism through which SPOP is involved in human hepatocytes. To achieve this, we established a cell model with SPOP overexpressed. A total of 3,838 DEGs were reliably detected by transcriptome profile, including 1,522 upregulated genes and 2,316 downregulated genes. The enrichment of gene function indicated that the upregulated genes were mostly related to the regulation of mRNA metabolic process, mRNA stability, and translation, while the downregulated genes were mostly related to response to type I interferon, response to virus, and protein targeting. Moreover, RASEs were identified with SPOP overexpression.

In this study, a total of 56 DEGs were identified in the pathway of HCC with SPOP overexpression. During the early stage of HCC development, the reduced expression of transforming growth factor-beta (TGF-β) emerges as a crucial factor [27,28]. It has been reported that TGF-β plays a vital role in cell proliferation and differentiation [29–31]. In response to TGF-β-mediated dimerization between TGF-β receptor I (TGF-βRI) and TGF-βRII, receptor-regulated SMADs (SMAD2/3) are phosphorylated, interact with SMAD4, and translocate to the nucleus with some DNA-binding partners and transcriptional co-activators or co-repressors to form a complex controlling gene transcription [32]. TGF-β/SMAD3 signaling pathway plays a critical role in inhibiting tumor formation by suppressing cell growth and promoting apoptosis, both in normal cells and during the early stages of tumorigenesis. Jiao et al. reveals that SPOP expression is repressed by TGF-β/SMAD signaling axis in PCa CSCs [29]. Our data demonstrated that overexpressed SPOP in human normal hepatocytes WRL68 decreased the mRNA level of TGF-β in a novel TGF-β/SMAD3 signaling pathway. Downregulated TGF-β may play a role in promoting cell proliferation and tumor formation in WRL68. In this study, SPOP expression may negatively regulate SMAD3-mediated TGF-β signaling pathway in human normal hepatocytes. Moreover, during the early HCC, the expression levels of certain genes involved in the PI3K-Akt signaling pathway, p53 signaling pathway, and Wnt signaling were also regulated with SPOP overexpression. These gene alterations may indeed affect various aspects of cellular function, including cell proliferation, cell cycle progression, telomeric DNA repeats, maintenance of telomere ends, DNA damage, genomic instability, and so on.

During the metastasis stage, the cellular-mesenchymal epithelial transition factor (c-Met) might play the key role [33]. The protein of c-Met is implicated in the central carbon metabolism in various cancer types, including renal cell carcinoma, melanoma, HCC, gastric cancer, non-small cell lung cancer, and so on [34]. The overexpression of SPOP was found to trigger a cascade phosphorylation reaction of c-Met, which in turn amplified the signaling process, ultimately leading to the activation of various downstream pathways such as PI3K/Akt and RAS/MAPK. These activated signaling pathways collectively regulated a range of biological processes, including cell growth, survival, motility, and proliferation. The abnormal c-Met signaling pathway has been reported in a variety of tumor studies. Normally, the c-Met signaling pathway is only fully activated during wound healing and tissue regeneration, but c-Met signaling pathway in tumor could be frequently activated by cancer cells, leading to tumor formation, invasive growth, and metastasis. The c-Met signaling pathway has been reported that it might be abnormally regulated in many types of solid tumors (lung, gastric, liver, colorectal, etc.) and could play a crucial role in the development of colorectal cancer, the invasion and metastasis of HCC, and the formation, growth and metastasis of oral squamous cancer [35].

RASEs are key biological processes that extend gene expression patterns and generate protein diversity [36]. Growing evidence indicates that protein heterodimers resulted by variable splicing are closely linked in the formation of many tumors, including HCC, and are valuable as next-generation diagnostic markers due to their specificity of expression. In this study, a total of 158 RASEs were identified with SPOP overexpressed. The enrichment analysis suggested that RASEs would modify the function via calcium, FoxO, HIF-1, Hippo, PI3K-Akt, Rap1, TGF-beta, and Wnt signaling pathways, which play key roles during environmental information processing. Moreover, the changes of transcripts might be related to viral carcinogenesis, non-alcoholics fatty liver disease, cancer development, and so on.

5 Conclusions

In conclusion, RNA sequencing analysis offered a novel idea into the molecular mechanisms of SPOP in HCC. We explored the regulatory mechanism of SPOP overexpression in human normal hepatocytes. The downstream signaling pathways and the corresponding molecular mechanisms of SPOP manifest the potential of its tumor-promoting effect in HCC, and thus SPOP may serve as a new opinion for underlying tumor-promoting effect in HCC. Further studies are needed to better reveal the molecular mechanism of SPOP, and the effect of SPOP in the progression of HCC will become clear.

tel: +86-552 3175396

  1. Funding information: This research was funded by Anhui Provincial Natural Science Foundation (No. 2108085MH284), the Key Project of Natural Science Foundation of Anhui Provincial Department of Education (2023AH052002), Key Research and Development Program of Anhui Province (2022e07020034), National Innovation and Entrepreneurship Training Program for college students (202110367057), Science Research Project of Bengbu Medical College (No. 2020byzd080), and National College Students’ innovation and entrepreneurship training program (No. 202110367054).

  2. Author contributions: Conceptualization: J.D. and Y.W.; methodology: X.D.; software: Y.C.; validation: W.X., Q.W., and F.S.; formal analysis: Y.Z.; investigation: Y.G.; resources: X.D.; data curation: Y.C.; writing – original draft preparation: J.D.; writing – review and editing: Y.W.; visualization: S.L.; supervision: Y.G. and Y.W.; project administration: Y.W. All authors have read and agreed to the published version of the manuscript.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Cao J, Wu L, Lei X, Shi K, Shi L, Shi Y. Long non-coding RNA-based signature for predicting prognosis of hepatocellular carcinoma. Bioengineered. 2021;12(1):673–81.Search in Google Scholar

[2] Liu Y, Cheng H, Cheng C, Zheng F, Zhao Z, Chen Q, et al. ZNF191 alters DNA methylation and activates the PI3K-AKT pathway in hepatoma cells via transcriptional regulation of DNMT1. Cancer Med. 2022;11(5):1269–80.Search in Google Scholar

[3] Shi F, Fu Y, Wang J, Li L, Wang A, Yuan Y, et al. Trametenolic acid b triggers HSP90AA4P and autophagy in HepG2/2.2.15 cells by proteomic analysis. ACS Omega. 2020;5(22):13042–51.Search in Google Scholar

[4] Zhang C, Li J, Huang T, Duan S, Dai D, Jiang D, et al. Meta-analysis of DNA methylation biomarkers in hepatocellular carcinoma. Oncotarget. 2016;7(49):81255–67.Search in Google Scholar

[5] Jain S, Chen S, Chang KC, Lin YJ, Hu CT, Boldbaatar B, et al. Impact of the location of CpG methylation within the GSTP1 gene on its specificity as a DNA marker for hepatocellular carcinoma. PLoS One. 2012;7(4):e35789.Search in Google Scholar

[6] Chen FY, Li X, Zhu HP, Huang W. Regulation of the ras-related signaling pathway by small molecules containing an indole core scaffold: a potential antitumor therapy. Front Pharmacol. 2020;11:280.Search in Google Scholar

[7] Liu Y, Guan S, Luo Z, Han F, Han W, Wang S, et al. How different substitution positions of F, Cl atoms in benzene ring of 5-methylpyrimidine pyridine derivatives affect the inhibition ability of EGFR(L858R/T790M/C797S) inhibitors: a molecular dynamics simulation study. Molecules. 2020;25(4):895.Search in Google Scholar

[8] Xu GQ, Li LH, Wei JN, Xiao LF, Wang XT, Pang WB, et al. Identification and profiling of microRNAs expressed in oral buccal mucosa squamous cell carcinoma of Chinese hamster. Sci Rep. 2019;9(1):15616.Search in Google Scholar

[9] Hatakeyama S. Ubiquitin-mediated regulation of JAK-STAT signaling in embryonic stem cells. Jakstat. 2012;1(3):168–75.Search in Google Scholar

[10] Qu J, Lin Z. Autophagy regulation by crosstalk between miRNAs and ubiquitination system. Int J Mol Sci. 2021;22(21):11912.Search in Google Scholar

[11] Li YC, Cai SW, Shu YB, Chen MW, Shi Z. USP15 in cancer and other diseases: from diverse functionsto therapeutic targets. Biomedicines. 2022;10(2):474.Search in Google Scholar

[12] Wang Y, Dai J, Zeng Y, Guo J, Lan J. E3 ubiquitin ligases in breast cancer metastasis: a Systematic review of pathogenic functions and clinical implications. Front Oncol. 2021;11:752604.Search in Google Scholar

[13] Zhu Q, Zhang G, Tang M, Zheng R, Gan H. SPOP Inhibition of endometrial carcinoma and its clinicopathological relationship. Appl Bionics Biomech. 2022;2022:5721630.Search in Google Scholar

[14] Song Y, Xu Y, Pan C, Yan L, Wang ZW, Zhu X. The emerging role of SPOP protein in tumorigenesis and cancer therapy. Mol Cancer. 2020;19(1):2.Search in Google Scholar

[15] Palicelli A, Croci S, Bisagni A, Zanetti E, De Biase D, Melli B, et al. What do we have to know about PD-L1 expression in prostate cancer? A systematic literature review (Part 6): correlation of PD-L1 expression with the status of mismatch repair system, BRCA, PTEN, and other genes. Biomedicines. 2022;10(2):236.Search in Google Scholar

[16] Samara TD, Liem IK, Prijanti AR, Andrijono. SEMA3B but not CUL1 as marker for pre-eclampsia progression. Malays J Med Sci. 2019;26(1):66–72.Search in Google Scholar

[17] Wang L, Lin M, Chu M, Liu Y, Ma J, He Y, et al. SPOP promotes ubiquitination and degradation of LATS1 to enhance kidney cancer progression. EBioMedicine. 2020;56:102795.Search in Google Scholar

[18] Huang Y, Tan N, Jia D, Jing Y, Wang Q, Li Z, et al. Speckle-type POZ protein is negatively associated with malignancies and inhibits cell proliferation and migration in liver cancer. Tumour Biol. 2015;36(12):9753–61.Search in Google Scholar

[19] Kim D, Paggi JM, Park C, Bennett C, Salzberg SL. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat Biotechnol. 2019;37(8):907–15.Search in Google Scholar

[20] Pertea M, Pertea GM, Antonescu CM, Chang TC, Mendell JT, Salzberg SL. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat Biotechnol. 2015;33(3):290–5.Search in Google Scholar

[21] Ji J, Xu M, Tu J, Zhao Z, Gao J, Chen M, et al. MiR-155 and its functional variant rs767649 contribute to the susceptibility and survival of hepatocellular carcinoma. Oncotarget. 2016;7(37):60303–9.Search in Google Scholar

[22] Kan H, Huang Y, Li X, Liu D, Chen J, Shu M. Zinc finger protein ZBTB20 is an independent prognostic marker and promotes tumor growth of human hepatocellular carcinoma by repressing FoxO1. Oncotarget. 2016;7(12):14336–49.Search in Google Scholar

[23] Lee K, Kim MY, Ahn H, Kim HS, Shin HI, Jeong D. Blocking of the ubiquitin-proteasome system prevents inflammation-induced bone loss by accelerating M-CSF receptor c-Fms degradation in osteoclast differentiation. Int J Mol Sci. 2017;18(10):2054.Search in Google Scholar

[24] Li X, Stevens PD, Yang H, Gulhati P, Wang W, Evers BM, et al. The deubiquitination enzyme USP46 functions as a tumor suppressor by controlling PHLPP-dependent attenuation of Akt signaling in colon cancer. Oncogene. 2013;32(4):471–8.Search in Google Scholar

[25] Kilroy G, Carter LE, Newman S, Burk DH, Manuel J, Möller A, et al. The ubiquitin ligase Siah2 regulates obesity-induced adipose tissue inflammation. Obesity (Silver Spring). 2015;23(11):2223–32.Search in Google Scholar

[26] Ji P, Liang S, Li P, Xie C, Li J, Zhang K, et al. Speckle-type POZ protein suppresses hepatocellular carcinoma cell migration and invasion via ubiquitin-dependent proteolysis of SUMO1/sentrin specific peptidase 7. Biochem Biophys Res Commun. 2018;502(1):30–42.Search in Google Scholar

[27] Reichl P, Haider C, Grubinger M, Mikulits W. TGF-β in epithelial to mesenchymal transition and metastasis of liver carcinoma. Curr Pharm Des. 2012;18(27):4135–47.Search in Google Scholar

[28] Yang JD, Nakamura I, Roberts LR. The tumor microenvironment in hepatocellular carcinoma: current status and therapeutic targets. Semin Cancer Biol. 2011;21(1):35–43.Search in Google Scholar

[29] Jiao C, Meng T, Zhou C, Wang X, Wang P, Lu M, et al. TGF-β signaling regulates SPOP expression and promotes prostate cancer cell stemness. Aging (Albany NY). 2020;12(9):7747–60.Search in Google Scholar

[30] Parra-Medina R, Correa PL, Moreno JJ, Lucero PM, Yaspe E, Polo F. Carcinosarcoma with choriocarcinomatous and osteosarcomatous differentiation in a patient with juvenile polyposis syndrome. Rare Tumors. 2015;7(3):5778.Search in Google Scholar

[31] Zheng L, Guan Z, Xue M. TGF-β signaling pathway-based model to predict the subtype and prognosis of head and neck squamous cell carcinoma. Front Genet. 2022;13:862860.Search in Google Scholar

[32] Koinuma D, Shinozaki M, Nagano Y, Ikushima H, Horiguchi K, Goto K, et al. RB1CC1 protein positively regulates transforming growth factor-beta signaling through the modulation of Arkadia E3 ubiquitin ligase activity. J Biol Chem. 2011;286(37):32502–12.Search in Google Scholar

[33] Galun D, Srdic-Rajic T, Bogdanovic A, Loncar Z, Zuvela M. Targeted therapy and personalized medicine in hepatocellular carcinoma: drug resistance, mechanisms, and treatment strategies. J Hepatocell Carcinoma. 2017;4:93–103.Search in Google Scholar

[34] Kim JH, Jang HJ, Kim HS, Kim BJ, Park SH. Prognostic impact of high c-Met expression in ovarian cancer: a meta-analysis. J Cancer. 2018;9(19):3427–34.Search in Google Scholar

[35] Zhang QW, Ye ZD, Shen C, Tie HX, Wang L, Shi L. Synthesis of novel 6,7-dimethoxy-4-anilinoquinolines as potent c-Met inhibitors. J Enzyme Inhib Med Chem. 2019;34(1):124–33.Search in Google Scholar

[36] Liu N, Wu Z, Chen A, Wang Y, Cai D, Zheng J, et al. SNRPB promotes the tumorigenic potential of NSCLC in part by regulating RAB26. Cell Death Dis. 2019;10(9):667.Search in Google Scholar
Received: 2023-01-17
Revised: 2023-09-08
Accepted: 2023-09-19
Published Online: 2023-10-24

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
  3. Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
  4. Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
  5. Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
  6. A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
  7. Neutrophilia with subclinical Cushing’s disease: A case report and literature review
  8. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
  9. Immunoregulation of synovial macrophages for the treatment of osteoarthritis
  10. Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
  11. Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
  12. Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
  13. High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
  14. Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
  15. Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
  16. Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
  17. Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
  18. Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
  19. Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
  20. Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
  21. Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
  22. Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
  23. Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
  24. Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
  25. 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
  26. Experimental study on the optimization of ANM33 release in foam cells
  27. Primary retroperitoneal angiosarcoma: A case report
  28. Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
  29. Malignant pleural effusion diagnosis and therapy
  30. Effect of spaceflight on the phenotype and proteome of Escherichia coli
  31. Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
  32. Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
  33. Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
  34. The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
  35. Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
  36. mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
  37. The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
  38. Radiotherapy for primary thyroid adenoid cystic carcinoma
  39. Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
  40. Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
  41. Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
  42. Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
  43. PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
  44. The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
  45. Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
  46. Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
  47. NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
  48. Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
  49. Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
  50. Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
  51. Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
  52. Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
  53. Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
  54. Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
  55. Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
  56. Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
  57. Gemella morbillorum infective endocarditis: A case report and literature review
  58. An unusual ectopic thymoma clonal evolution analysis: A case report
  59. Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
  60. Detection of V. vulnificus septic shock with ARDS using mNGS
  61. Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
  62. The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
  63. Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
  64. ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
  65. Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
  66. Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
  67. Collagen changes in rabbit conjunctiva after conjunctival crosslinking
  68. Effects of NM23 transfection of human gastric carcinoma cells in mice
  69. Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
  70. Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
  71. Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
  72. Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
  73. Giant duplication of the transverse colon in an adult: A case report and literature review
  74. Ectopic thyroid tissue in the breast: A case report
  75. SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
  76. Vaginal metastasis from breast cancer: A case report
  77. Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
  78. Inhibition of TAZ impairs the migration ability of melanoma cells
  79. Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
  80. Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
  81. Identification of winter wheat pests and diseases based on improved convolutional neural network
  82. Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
  83. Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
  84. Immune checkpoint inhibitors in cancer patients with COVID-19
  85. Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
  86. Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
  87. Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
  88. DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
  89. Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
  90. Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
  91. Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
  92. Studying infant mortality: A demographic analysis based on data mining models
  93. Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
  94. Protein Z modulates the metastasis of lung adenocarcinoma cells
  95. Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
  96. TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
  97. Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
  98. Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
  99. Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
  100. Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
  101. Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
  102. HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
  103. Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
  104. Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
  105. Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
  106. Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
  107. Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
  108. Research progress on gas signal molecular therapy for Parkinson’s disease
  109. Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
  110. The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
  111. α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
  112. CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
  113. Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
  114. Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
  115. Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
  116. Research progress of AMP-activated protein kinase and cardiac aging
  117. TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
  118. Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
  119. Metastasis from small cell lung cancer to ovary: A case report
  120. The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
  121. The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
  122. Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
  123. Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
  124. Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
  125. Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
  126. Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
  127. Traumatic brain injury and rTMS-ERPs: Case report and literature review
  128. Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
  129. Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
  130. The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
  131. Inflammation-related signaling pathways in tendinopathy
  132. CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
  133. Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
  134. Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
  135. Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
  136. Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
  137. Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
  138. Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
  139. TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
  140. Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
  141. Ferroptosis: A potential target of macrophages in plaque vulnerability
  142. Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
  143. Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
  144. HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
  145. IL-17 in osteoarthritis: A narrative review
  146. Circadian cycle and neuroinflammation
  147. Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
  148. Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
  149. SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
  150. Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
  151. PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
  152. Pancreatic ectopic thyroid tissue: A case report and analysis of literature
  153. The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
  154. Report on a case of liver-originating malignant melanoma of unknown primary
  155. Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
  156. The fibroblast growth factor–Klotho axis at molecular level
  157. Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
  158. A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
  159. Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
  160. Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
  161. Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
  162. Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
  163. Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
  164. Case report of atypical undernutrition of hypoproteinemia type
  165. Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
  166. Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
  167. Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
  168. Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
  169. Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
  170. Precisional detection of lymph node metastasis using tFCM in colorectal cancer
  171. Advances in diagnosis and treatment of perimenopausal syndrome
  172. A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
  173. Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
  174. Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
  175. Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
  176. Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
  177. Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
  178. Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
  179. An online diagnosis method for cancer lesions based on intelligent imaging analysis
  180. Medical imaging in rheumatoid arthritis: A review on deep learning approach
  181. Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
  182. Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
  183. A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
  184. TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
  185. Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
  186. Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
  187. Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
  188. Hepatobiliary surgery based on intelligent image segmentation technology
  189. Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
  190. Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
  191. Early diagnosis for the onset of peri-implantitis based on artificial neural network
  192. Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
  193. Forecast of pain degree of lumbar disc herniation based on back propagation neural network
  194. SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
  195. Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
  196. Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
  197. A novel approach for minimising anti-aliasing effects in EEG data acquisition
  198. ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
  199. Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
  200. Lung nodule segmentation via semi-residual multi-resolution neural networks
  201. Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
  202. A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
  203. Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
  204. Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
  205. Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
  206. Monitoring and evaluation of anesthesia depth status data based on neuroscience
  207. Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
  208. Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
  209. Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
  210. Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
  211. Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
  212. From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
  213. Ecology and Environmental Science
  214. Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
  215. Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
  216. Effects of cadmium stress on fruits germination and growth of two herbage species
  217. Bamboo charcoal affects soil properties and bacterial community in tea plantations
  218. Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
  219. Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
  220. Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
  221. Food Science
  222. Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
  223. Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
  224. Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
  225. Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
  226. Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
  227. Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
  228. Microbiological transglutaminase: Biotechnological application in the food industry
  229. Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
  230. Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
  231. The potential for the use of leghemoglobin and plant ferritin as sources of iron
  232. Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
  233. Bioengineering and Biotechnology
  234. Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
  235. Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
  236. Agriculture
  237. Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
  238. On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
  239. Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
  240. A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
  241. Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
  242. Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
  243. Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
  244. Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
  245. Animal Sciences
  246. Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
  247. Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
  248. Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
  249. Tracking behavioral changes of confined sows from the first mating to the third parity
  250. The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
  251. Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
  252. Plant Sciences
  253. Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
  254. Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
  255. Tissue culture and rapid propagation technology for Gentiana rhodantha
  256. Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
  257. Cloning and expression analysis of VrNAC13 gene in mung bean
  258. Chlorate-induced molecular floral transition revealed by transcriptomes
  259. Effects of warming and drought on growth and development of soybean in Hailun region
  260. Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
  261. Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
  262. Distinguish Dianthus species or varieties based on chloroplast genomes
  263. Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
  264. Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
  265. An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
  266. Erratum
  267. Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
  268. Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
  269. Retraction
  270. Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
https://doi.org/10.1515/biol-2022-0755
Keywords for this article
speckle type BTB/POZ protein; gene expression profiles; alternative splicing events; human hepatocytes; hepatocellular carcinoma
Creative Commons
BY 4.0

Articles in the same Issue

  1. Biomedical Sciences
  2. Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
  3. Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
  4. Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
  5. Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
  6. A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
  7. Neutrophilia with subclinical Cushing’s disease: A case report and literature review
  8. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
  9. Immunoregulation of synovial macrophages for the treatment of osteoarthritis
  10. Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
  11. Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
  12. Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
  13. High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
  14. Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
  15. Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
  16. Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
  17. Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
  18. Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
  19. Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
  20. Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
  21. Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
  22. Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
  23. Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
  24. Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
  25. 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
  26. Experimental study on the optimization of ANM33 release in foam cells
  27. Primary retroperitoneal angiosarcoma: A case report
  28. Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
  29. Malignant pleural effusion diagnosis and therapy
  30. Effect of spaceflight on the phenotype and proteome of Escherichia coli
  31. Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
  32. Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
  33. Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
  34. The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
  35. Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
  36. mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
  37. The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
  38. Radiotherapy for primary thyroid adenoid cystic carcinoma
  39. Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
  40. Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
  41. Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
  42. Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
  43. PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
  44. The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
  45. Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
  46. Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
  47. NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
  48. Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
  49. Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
  50. Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
  51. Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
  52. Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
  53. Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
  54. Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
  55. Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
  56. Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
  57. Gemella morbillorum infective endocarditis: A case report and literature review
  58. An unusual ectopic thymoma clonal evolution analysis: A case report
  59. Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
  60. Detection of V. vulnificus septic shock with ARDS using mNGS
  61. Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
  62. The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
  63. Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
  64. ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
  65. Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
  66. Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
  67. Collagen changes in rabbit conjunctiva after conjunctival crosslinking
  68. Effects of NM23 transfection of human gastric carcinoma cells in mice
  69. Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
  70. Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
  71. Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
  72. Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
  73. Giant duplication of the transverse colon in an adult: A case report and literature review
  74. Ectopic thyroid tissue in the breast: A case report
  75. SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
  76. Vaginal metastasis from breast cancer: A case report
  77. Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
  78. Inhibition of TAZ impairs the migration ability of melanoma cells
  79. Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
  80. Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
  81. Identification of winter wheat pests and diseases based on improved convolutional neural network
  82. Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
  83. Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
  84. Immune checkpoint inhibitors in cancer patients with COVID-19
  85. Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
  86. Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
  87. Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
  88. DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
  89. Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
  90. Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
  91. Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
  92. Studying infant mortality: A demographic analysis based on data mining models
  93. Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
  94. Protein Z modulates the metastasis of lung adenocarcinoma cells
  95. Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
  96. TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
  97. Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
  98. Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
  99. Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
  100. Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
  101. Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
  102. HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
  103. Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
  104. Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
  105. Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
  106. Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
  107. Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
  108. Research progress on gas signal molecular therapy for Parkinson’s disease
  109. Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
  110. The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
  111. α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
  112. CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
  113. Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
  114. Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
  115. Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
  116. Research progress of AMP-activated protein kinase and cardiac aging
  117. TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
  118. Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
  119. Metastasis from small cell lung cancer to ovary: A case report
  120. The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
  121. The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
  122. Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
  123. Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
  124. Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
  125. Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
  126. Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
  127. Traumatic brain injury and rTMS-ERPs: Case report and literature review
  128. Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
  129. Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
  130. The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
  131. Inflammation-related signaling pathways in tendinopathy
  132. CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
  133. Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
  134. Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
  135. Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
  136. Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
  137. Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
  138. Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
  139. TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
  140. Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
  141. Ferroptosis: A potential target of macrophages in plaque vulnerability
  142. Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
  143. Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
  144. HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
  145. IL-17 in osteoarthritis: A narrative review
  146. Circadian cycle and neuroinflammation
  147. Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
  148. Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
  149. SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
  150. Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
  151. PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
  152. Pancreatic ectopic thyroid tissue: A case report and analysis of literature
  153. The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
  154. Report on a case of liver-originating malignant melanoma of unknown primary
  155. Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
  156. The fibroblast growth factor–Klotho axis at molecular level
  157. Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
  158. A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
  159. Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
  160. Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
  161. Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
  162. Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
  163. Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
  164. Case report of atypical undernutrition of hypoproteinemia type
  165. Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
  166. Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
  167. Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
  168. Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
  169. Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
  170. Precisional detection of lymph node metastasis using tFCM in colorectal cancer
  171. Advances in diagnosis and treatment of perimenopausal syndrome
  172. A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
  173. Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
  174. Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
  175. Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
  176. Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
  177. Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
  178. Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
  179. An online diagnosis method for cancer lesions based on intelligent imaging analysis
  180. Medical imaging in rheumatoid arthritis: A review on deep learning approach
  181. Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
  182. Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
  183. A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
  184. TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
  185. Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
  186. Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
  187. Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
  188. Hepatobiliary surgery based on intelligent image segmentation technology
  189. Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
  190. Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
  191. Early diagnosis for the onset of peri-implantitis based on artificial neural network
  192. Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
  193. Forecast of pain degree of lumbar disc herniation based on back propagation neural network
  194. SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
  195. Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
  196. Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
  197. A novel approach for minimising anti-aliasing effects in EEG data acquisition
  198. ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
  199. Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
  200. Lung nodule segmentation via semi-residual multi-resolution neural networks
  201. Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
  202. A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
  203. Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
  204. Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
  205. Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
  206. Monitoring and evaluation of anesthesia depth status data based on neuroscience
  207. Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
  208. Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
  209. Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
  210. Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
  211. Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
  212. From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
  213. Ecology and Environmental Science
  214. Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
  215. Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
  216. Effects of cadmium stress on fruits germination and growth of two herbage species
  217. Bamboo charcoal affects soil properties and bacterial community in tea plantations
  218. Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
  219. Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
  220. Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
  221. Food Science
  222. Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
  223. Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
  224. Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
  225. Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
  226. Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
  227. Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
  228. Microbiological transglutaminase: Biotechnological application in the food industry
  229. Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
  230. Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
  231. The potential for the use of leghemoglobin and plant ferritin as sources of iron
  232. Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
  233. Bioengineering and Biotechnology
  234. Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
  235. Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
  236. Agriculture
  237. Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
  238. On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
  239. Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
  240. A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
  241. Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
  242. Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
  243. Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
  244. Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
  245. Animal Sciences
  246. Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
  247. Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
  248. Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
  249. Tracking behavioral changes of confined sows from the first mating to the third parity
  250. The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
  251. Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
  252. Plant Sciences
  253. Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
  254. Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
  255. Tissue culture and rapid propagation technology for Gentiana rhodantha
  256. Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
  257. Cloning and expression analysis of VrNAC13 gene in mung bean
  258. Chlorate-induced molecular floral transition revealed by transcriptomes
  259. Effects of warming and drought on growth and development of soybean in Hailun region
  260. Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
  261. Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
  262. Distinguish Dianthus species or varieties based on chloroplast genomes
  263. Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
  264. Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
  265. An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
  266. Erratum
  267. Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
  268. Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
  269. Retraction
  270. Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 6.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0755/html
Scroll to top button