Home Life Sciences Experimental study on the optimization of ANM33 release in foam cells
Article Open Access

Experimental study on the optimization of ANM33 release in foam cells

  • Chen Yuan , Liyun Liu , Baihetiya Tayier , Ting Ma , Lina Guan , Yuming Mu EMAIL logo and Yanhong Li EMAIL logo
Published/Copyright: February 23, 2023
Download Article (PDF)
Open Life Sciences
From the journal Open Life Sciences Volume 18 Issue 1

Abstract

Given the miR-33’s mechanistic relationships with multiple etiological factors in the pathogenesis of atherosclerosis (AS), we investigated the therapeutic potentials of dual-targeted microbubbles (HA-PANBs) in foam cell-specific release of anti-miR-33 (ANM33) oligonucleotides, resulting in the early prevention of AS progression and severity. The intracellular localization, loading optimization, and therapeutic effects of HA-PANBs were examined in detail in a co-cultured cell model of phagocytosis. Compared with non-targeting nanobubbles (NBs) and single-targeted microbubbles as controls, HA-PANBs efficiently delivered the ANM33 specifically to foam cells via sustained release, exhibiting its clinical value in mediating RNA silencing. Moreover, when used at a dose of 12 µg/mL HA-PANBs per 107 cells for 48 h, a higher release rate and drug efficacy were observed. Therefore, HA-PANBs, effectively targeting early AS foam cells, may represent a novel and optimal gene therapy approach for AS management.

Keywords: drug delivery; dual targeting; foam cells; atherosclerosis

1 Introduction

AS is a chronic inflammatory vascular disease [1,2,3] that jeopardizes the quality of life and has become a major public health problem worldwide. Prevention and treatment of AS are urgently needed. Local inflammatory responses, particularly macrophages (Mφ), are considered to be one of the key factors leading to the occurrence and development of AS [4,5,6]. Early Mφ can delay the disease progression by disposal of cholesterol deposited in the atherosclerotic plaque (cholesterol efflux) [7,8,9,10]. When the oxidized low-density lipoprotein (ox-LDL) continues to accumulate in Mφ, macrophage-derived foam cell formation occurs, leading to early atherogenesis and disease progression. Recent studies have shown that miR-33 in Mφ accelerates the impairment of cholesterol efflux and that anti-miR-33 (ANM33) effectively reduces the inflammatory response within the plaque. However, a non-selective inhibition of miR-33 in systemic Mφ can lead to severe side effects [11,12].

The development of AS involves a series of cellular and molecular events. Ultrasound-based molecular imaging for targeted detection of cardiovascular disease-associated molecular markers and genetic signatures plays crucial roles in the diagnosis and therapy of adverse cardiovascular events [13]. Therefore, precise targeting of the damaged foam cells in AS plaques may provide new treatment possibilities. Ideally, a targeting agent should reach its destination with high specificity, but a wide distribution of immune Mφ cells throughout the body poses a great challenge to the targeting agents’ degree of specificity. Studies have shown that a two-stage targeting design and HA-coating of microbubbles effectively shield them from binding to off-target liver receptors, thereby enhancing their targeting efficiencies [14–16].

Based on the above findings, we have successfully constructed a dual-targeting ultrasound microbubble contrast agent, HA-PANB, with varying conjugation methods for a non-invasive assessment of early AS [17]. However, certain technical challenges are still unmet, particularly regarding the loading of ANM33 into microbubbles and their engulfment by Mφ through phagocytosis. We believe that a thorough investigation of the optimal dose and treatment conditions for HA-PANBs is the key to further improvement of its therapeutic efficacy, in addition to a better clinical value.

2 Materials and methods

2.1 Materials

Human umbilical vein endothelial HUVEC-T1 cells (Procell Life Science & Technology, China), RAW264.7-T1 Mφ (Procell Life Science & Technology, China), oxidized low-density lipoprotein (ox-LDL; Yiyuan Biotechnology, China), tumor necrosis factor-α (TNF-α; Bioss, China), and Transwell chambers (Corning, USA) were used. FITC-labelled anti-human CD44 flow cytometry antibody (Proteintech, USA), high-glucose DMEM (ScienCell, China), CCK-8 kit (Tongren Chemical, Japan), fetal bovine serum (FBS; ScienCell, USA, Israel), and double antibody (Gibco, USA) were purchased for this study. Endothelial cell basal medium (ECM; ScienCell, USA), FBS (ScienCell, USA), endothelial cell growth factor (ScienCell, USA), double antibodies (ScienCell, USA), and Fluorescence microscope (LEICA CTR6000, Germany); laser confocal microscope (Leica SP8, Germany); flow cytometer (Beckman, USA); laser nanoparticle size potential analyzer (Malvern, UK) were used.

2.2 Preparation of targeted ultrasound microbubbles

Carrier core nanobubbles (NBs) were prepared by thin film hydration, and microbubbles loaded with PM1 (PCNBs) were prepared by grafting DSPE-PEG2000-maleimide-PM1 onto the NB surface. ANM33 was connected via electrostatic adsorption and covalent bonding, and hyaluronic acid (HA) was covalently connected. PM1 and HA were the targets, and ANM33 was the intervention drug.

2.3 Establishment of in vitro co-culture system using damaged endothelial cells and Mφ (HUVEC/MΦ)

2.3.1 Culture of multilayer cells

The specific steps for simulating damaged blood vessels in the body are shown in Figure 1. HUVECs were first inoculated on a gelatin-coated Transwell polycarbonate filter membrane and cultured for 48 h to form an endothelial monolayer. Then, MΦs were seeded in the lower chamber of the Transwell and co-cultured with HUVECs in the upper chamber for 24 h, and the medium was replaced with M199 medium containing TNF-α and ox-LDL for 24 h. The inoculation density of HUVECs was 5.0 × 104/mL, and the inoculation density of MΦs was 2.0 × 104/mL.

Figure 1 Establishment of injured endothelial-macrophage co-culture system. (a) Schematic diagram of co-culture system; (b) upper HUVECs; and (c) lower macrophage MΦ.
Figure 1

Establishment of injured endothelial-macrophage co-culture system. (a) Schematic diagram of co-culture system; (b) upper HUVECs; and (c) lower macrophage MΦ.

Cells were monitored under a light microscope for the construction of a growth curve. This experiment was independently repeated for at least three times. When cells reached confluency, they are either passaged or used for the experiment.

2.3.2 Construction and identification of damaged HUVECs

After cell inoculation, the density reached 70–80% after 2 days of culture. According to the instructions, 5 µL of fluorescent CD44 antibody was added to 3.0 × 106 cells, mixed and incubated at 4°C in the dark for 30 m, the fluorescence intensity on the HUVEC surface was analyzed by flow cytometry [18] in at least three independent repetitions. HUVECs in the HUVEC/MΦ system without TNF-α and ox-LDL treatment were collected as the control group.

2.3.3 Influence of different treatments on MΦ cell viability

This group of experiments was performed in 96-well plates to seed only a single layer of MΦ cell suspension (100 µL/well). After the cells were allowed to adhere to the wall for 4 h, the medium was replaced with fresh medium containing different concentrations of TNF-α and ox-LDL, and the culture plate was placed in an incubator for pre-culture (37°C, 5% CO2) for 24 h. Next 10 µL of CCK-8 solution was added to each well. The culture plate was incubated in an incubator for 1–4 h, and the absorbance at 450 nm was measured with a microplate reader and analyzed.

A CCK-8 kit was used to evaluate the cytotoxicity of the HA-PANBs. RAW264.7 cells were cultured by adding 100 µL of cell suspension to a 96-well plate and preculturing the plate in an incubator for 24 h (37°C, 5% CO2). Then, 10 µL of HA-PANBs at concentrations of 108, 107, 106, 105, or 104 was added to the culture plate, which was incubated for 24 and 48 h. Ten microliters of CCK solution was added to each well, and the culture plate was incubated in the incubator for 1–4 h. The absorbance was measured at 450 nm with a microplate reader. The assay was repeated in at least three biological replicates.

2.3.4 HUVEC cell layer permeability test

FITC labeled albumin was added to the Transwell upper chamber. After 1 h, the fluorescence intensity of the upper chamber and the lower chamber were measured with a fluorometer and repeated the above operation at least three times. Permeability (P) = (V L × C L)/(V U × C U) × 100%; (C L and C U are the concentrations of FITC labeled albumin in the lower and upper chambers, respectively, and V L and V U are the medium volumes of the lower and upper chambers, respectively).

2.4 Identification of foam cells

2.4.1 Cholesterol quantification

A cholesterol quantification kit was used to observe the changes in the amount of cholesterol in Mφ after incubation with different concentrations of ox-LDL. After inducing the cells with ox-LDL at concentrations of 0 mg/L, 10 mg/L, 20 mg/L, 40 mg/L, 60 mg/L, and 80 mg/L, the total cholesterol (TC), free cholesterol (FC), and cholesterol ester (CE) contents and specific gravity of the cells were observed, and the proportion of CE was calculated as (TC – FC)/TC × 100% and the above operation was repeated for at least three times.

2.5 Evaluation of targeting in vitro

The fluorescent carbocyanine dye DiI was conjugated to various microbubbles and diluted with fresh serum medium and added to the upper chamber of the injured co-culture system when the cell count reaches to 107 observed with the microscope, followed by incubation for 30 min. This operation was repeated for at least three times.

2.5.1 Experimental grouping and intervention methods

The experimental grouping and intervention methods are given in Table 1.

Table 1

Experimental grouping

Group Intervention method Remarks
PBS PBS + cell model Blank
NBs NBs + cell model Non-targeted NBs
PNBs PNBs + cell model Single targeted NBs surface carrying PM1
HA-NBs HA-NBs + cell model Single targeted NBs surface carrying HA
HA-PNBs HA-PNBs + cell model Dual-targeted NBs, surface carrying HA PM1

2.5.2 Standing/shaking co-incubation method

Before the experiment, hyaluronidase (HAase; 2 mg/mL) was added to the lower chamber of the Transwell. Various NBs were then added to the double-layer co-culture system of injured endothelial-Mφ, incubated for 30 min, and rinsed three times with PBS. The homing effect of HA-PANBs was evaluated by the following detection methods: in vivo imaging system (IVIS) for the DiI fluorescent intensity in the lower chamber of the Transwell, confocal microscopy for the number of DiI in the lower chamber with respect to the underlying Mφ, and flow cytometry for the amount of DiI in the lower chamber [18]. The whole process was repeated at least three times for statistical validation.

2.6 Adhesion and release time optimization

Cells were plated at the upper chamber and pretreated with 2 mg/mL HAase, followed by the addition of AF-488 and Cy3 double fluorescently labeled HA-PANBs 104, 105, 106, 107, and 108 were added, respectively, for incubation of 2 h, 6 h, 12 h, 24 h, and 48 h. The loading dose of ANM33 into HA-PANBs was optimized at 12 µg/mL [17]. The above process was repeated at least three times. The same volume of DMEM containing 20% (v/v) FBS was added to all wells the next day, and the localization of lipid contrast agent particles in the MΦ was examined by confocal scanning microscopy. In the control group, normal HUVEC/MΦ cells that were not induced by injury were selected.

2.7 In vitro release of microbubbles

Different microbubbles with and without 2 mg/mL HAase were sealed in a dialysis bag (MW cutoff = 8–12 kDa) in 200 mL of release buffer (0.05% sodium dodecyl sulfate in PBS, pH 7.4), and stirred gently at 37°C. An equal volume (0.5 mL) of release buffer was collected and replenished at each time point to allow a total reaction time of 72 h. The ANM33 concentration in the release buffer collected at each time point was measured using a multi-function microplate reader repeatedly at least three times. As a control, the release of ANM33 from microbubbles in each group in the absence of HAase was also determined. Experimental grouping and intervention methods are shown in Table 1.

2.8 Fluorescence quantitative PCR

The RNA concentration and purity were detected by Nanodrop2000 after total RNA extraction. After reverse transcription reaction, Real-Time PCR was carried out for 40 cycles with melt curve analysis. GAPDH was used as the internal reference gene for normalization. The 1/2△△Ct value was used for calculation and analysis and the assay was repeated at least three times. The primer sequences were synthesized and purified by Wuhan Sevier Biotechnology Co, Ltd. The primer sequences are shown in Table 2.

Table 2

RT-PCR primer sequences

Amplified gene Primer sequence (5′–3′)
miR33 1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGTGATGCA
2 ACACTCCAGCTGGGCAATGTTTCCACAGTG

2.9 Statistical methods

Measurement data that conformed to a normal distribution are represented as the “mean value ± standard deviation,” while data that did not conform to a normal distribution are represented as the "median and interquartile range." Statistical analyses mainly consisted of one-way analysis of variance (ANOVA) and independent sample t tests. When the data did not conform to a normal distribution, a nonparametric test was used; repeated measurement data analysis used repeated measurement analysis of variance. The confidence interval for determining the differences between groups was set to 95%, and it was considered statistically significant when P < 0.05.

3 Results

3.1 Characterization of HA-PANBs

Morphology, particle size, size disruption, zeta potential of HA-PANBs were assessed as shown in Figure 2.

Figure 2 The morphology and structure of the NBs. (a) Preparation of NBs; (b) preparation of HA-PANBs; (c) the phospholipid suspension before and after mechanical vibration; (d) photomicrograph of NBs; (e) TEM image of HA-PANBs; (f) size of HA-PANBs; (g) zeta potential of HA-PANBs.
Figure 2

The morphology and structure of the NBs. (a) Preparation of NBs; (b) preparation of HA-PANBs; (c) the phospholipid suspension before and after mechanical vibration; (d) photomicrograph of NBs; (e) TEM image of HA-PANBs; (f) size of HA-PANBs; (g) zeta potential of HA-PANBs.

3.2 Identification of damaged HUVECs

The results of flow cytometry showed that the proportion of HUVECs expressing CD44 was 70.9 ± 0.2% after treatment with 10 ng/mL TNF-α, while the proportion in the 20 ng/mL TNF-α group was 75.6 ± 0.9%. There was no significant difference between the experimental groups (P > 0.05), while both the experimental groups compared with the blank control had differences (P < 0.05), as shown in Figure 3.

Figure 3 Identification of damaged HUVECs. (a) Treated with 10 ng/mL TNF-α and ox-LDL; (b) treated with 20 ng/mL TNF-α and ox-LDL; (c) control group; (d) quantitative results showing that the model significantly expressed CD44 antibody; **: P < 0.01.
Figure 3

Identification of damaged HUVECs. (a) Treated with 10 ng/mL TNF-α and ox-LDL; (b) treated with 20 ng/mL TNF-α and ox-LDL; (c) control group; (d) quantitative results showing that the model significantly expressed CD44 antibody; **: P < 0.01.

3.3 Identification of foam cells

The results showed that the TC and CE contents in the cell and the specific gravity increased in a concentration-dependent manner, and the degree of foam cell formation gradually increased, when the concentration of ox-LDL exceeded 60 mg/L, the intracellular cholesteryl ester specific gravity exceeded 50%, as shown in Table 3. At the same time, as the concentration of treatment drugs increased, MΦ activity decreased, as shown in Figure 4.

Table 3

Specific gravity of cholesteryl esters in different degrees of lipid-bearing cells

ox-LDL (mg/L) TC (µmol/L) FC (µmol/L) CE (µmol/L) CE/TC (%)
0 36.54 ± 1.1 26.45 ± 1.8 10.09 ± 1.1 28 ± 1.3
10 41.55 ± 3.8 24.63 ± 2.6 16.92 ± 1.2 41 ± 2.1
20 48.33 ± 5.5 26.49 ± 3.7 21.84 ± 1.2 45 ± 2.6
40 76.12 ± 6.1 37.65 ± 3.9 38.47 ± 4.2 51 ± 4.8
60 93.9 ± 6.7 37.79 ± 4.5 56.12 ± 5.5 60 ± 5.1
80 113.94 ± 3.9 34.7 ± 6.3 79.25 ± 4.3 70 ± 3.9
Figure 4 Cell growth curve and cell viability after intervention. (a) Endothelial cell growth curve; (b) macrophage growth curve; (c) macrophage activity after ox-LDL intervention; (d) cytotoxicity changes over time; and (e) in vitro hemolysis test.
Figure 4

Cell growth curve and cell viability after intervention. (a) Endothelial cell growth curve; (b) macrophage growth curve; (c) macrophage activity after ox-LDL intervention; (d) cytotoxicity changes over time; and (e) in vitro hemolysis test.

3.4 Effect of microvesicles on cell viability

Mφ reached a saturation density of 2.7 × 106 on the sixth day. The endothelial cells reached a saturation density of 1.1 × 106 on the fifth day (Figure 4). The results of the biosafety evaluation of HA-PANBs showed that when the concentration of ox-LDL was gradually increased, the cell viability decreased accordingly. In addition, the solutions containing HA-PANBs at different concentrations were clear (Figure 4e).

3.5 Permeability test of HUVEC cell layer

After adding 5, 10, and 15 µL FITC labeled albumin, respectively, the fluorescence intensity of the lower macrophage layer can reach more than 50% as shown in Figure 5. When measuring the permeability, it can be found that there is no significant increase in the permeability of the endothelial cell layer without intervention or only adding ox-LDL, but higher permeability can be achieved only by adding TNF-α and ox-LDL group, that is, more than 60%.

Figure 5 HUVEC cell layer permeability assay. (a) Estimation of endothelial layer permeability after addition of different doses of albumin; (b) quantitation of endothelial layer permeability; (c) effect of different intervention methods on endothelial layer permeability; and (d) quantitative comparisons among different interventional approaches; **P < 0.01.
Figure 5

HUVEC cell layer permeability assay. (a) Estimation of endothelial layer permeability after addition of different doses of albumin; (b) quantitation of endothelial layer permeability; (c) effect of different intervention methods on endothelial layer permeability; and (d) quantitative comparisons among different interventional approaches; **P < 0.01.

3.6 In vitro targeting situation

When using IVIS to detect the fluorescence intensity of DiI in the lower chamber of the Transwell, the targeting efficiencies are as follows: 9.57 ± 0.7% for PBS, 6.935 ± 1.1% for NBs, 9.27 ± 1.3% for ANBs, 9.27 ± 1.3% for PANBs, 23.055 ± 3.5% for HA-CBNs, and 64.945 ± 1.2% for HA-PANBs (as shown in Figure 6).

Figure 6 Observation of in vitro targeting by small animal imager. (a) Targeting situation of each group after intervention in foam cell bilayer model and (b) quantitative results; **: P < 0.01.
Figure 6

Observation of in vitro targeting by small animal imager. (a) Targeting situation of each group after intervention in foam cell bilayer model and (b) quantitative results; **: P < 0.01.

3.7 Optimization of adhesion and transfection conditions

The green fluorescence intensity of the 106 group transfected with HA-PANBs for 30 m was 40.33 ± 1.1%, and the red fluorescence intensity was 0.067 ± 1.7%. The green fluorescence intensity of the 107 group was 41.22 ± 1.3%, and the red fluorescence intensity was 41.22 ± 1.3%. The green fluorescence intensity of the 108 group was 47.26 ± 1.9% and the red fluorescence intensity was 8.762 ± 0.9%, as shown in Appendix Material Figure A1.

As shown in Appendix Material Figure A2, the binding of HA-PANBs to foam cells increased with the prolonged transfection time. At 48 h, the adsorption to cells of both AF-488 labeled PM1 and Cy3-labeled ANM33 reached an optimal level, as indicated by yellow colocalization. Flow cytometry showed that the binding rate of ANM33 was 91.5 ± 0.9%.

The number of microbubbles around each foam cell in the HA-PANBs group was 14.7 ± 1.67, which was significantly higher than that in the NBs group (2.13 ± 0.57) (P < 0.05). The release rates for different groups are 0.6 ± 1.3% for NB and 23.6 ± 3.2% for HA-PANBs after 30 min, and 14.4 ± 1.9% for NB and 76.8 ± 2.1% for HA-PANBs after 24 h. The binding of HA-PANBs to foam cells is significantly different from those of non-target microvesicles and significantly higher than that of the NB group (P < 0.001) (Figure 7).

Figure 7 In vitro targeting of HA-PANBs. (a) Representative microscopic images of Mφ; (b) representative microscopic images of foam cells; (c) a large number of HA-PANBs targeting foam cells; (d) quantitative analysis of cell targeting; **P < 0.01; (e–h) laser confocal microscopy images of NBs and HA-PANBs targeting foam cells in vitro at different times; (i and l) flow cytometric analysis of NBs and HA-PANBs at different times.
Figure 7

In vitro targeting of HA-PANBs. (a) Representative microscopic images of Mφ; (b) representative microscopic images of foam cells; (c) a large number of HA-PANBs targeting foam cells; (d) quantitative analysis of cell targeting; **P < 0.01; (e–h) laser confocal microscopy images of NBs and HA-PANBs targeting foam cells in vitro at different times; (i and l) flow cytometric analysis of NBs and HA-PANBs at different times.

3.8 In vitro release of dual-targeted lipid microbubbles

Figure 8 shows the schematics of ANM33 release from different microbubbles in the presence and absence of HAase. In the presence of HAase, the release rates from ANBs and PANBs within 72 h were approximately 23.19 ± 1.91% and 22.00 ± 1.71%, respectively. In the absence of HAase, the release rate from HA-PANBs was approximately 16.46 ± 1.57% after 72 h. In the case of HAase-catalyzed degradation, the ANM33 release rate from HA-PANBs was much higher (20.58% ± 1.43), which was almost at the same level as HA-ANBs and PANBs with or without HAase.

Figure 8 In vitro release of ANM33 in the presence and absence of HAase. (a) ANM33 release in HA-PANBs group within 72 h without HAase; (b) ANM33 release in the presence of HAase; and (c) ANM33 release profile in the absence of HAase. *: P < 0.05.
Figure 8

In vitro release of ANM33 in the presence and absence of HAase. (a) ANM33 release in HA-PANBs group within 72 h without HAase; (b) ANM33 release in the presence of HAase; and (c) ANM33 release profile in the absence of HAase. *: P < 0.05.

3.9 RT-PCR situation

As shown in Figure 9, the quantitative RT-PCR shows the expression fold change of miR-33: control group 1.50 ± 0.9; model group 5.75 ± 1.1; ANM33 group 3.01 ± 2.3; NBs group: 4.55 ± 0.7; ANBs group 2.82 ± 1.1; PANBs group 2.03 ± 1.9; HA-PCNBs group 3.40 ± 0.6; HA-PANBs group 1.93 ± 2.3.

Figure 9 Effects of different interventions on miR33 expression in RAW264.7 cells and foam cell models. (a) Amplification curve; (b) dissolution curve; (c) quantitative results; *: P < 0.01 vs control group, #: P < 0.05 vs model group, &: P < 0.05 vs HA-PANBs group.
Figure 9

Effects of different interventions on miR33 expression in RAW264.7 cells and foam cell models. (a) Amplification curve; (b) dissolution curve; (c) quantitative results; *: P < 0.01 vs control group, #: P < 0.05 vs model group, &: P < 0.05 vs HA-PANBs group.

4 Discussion

We explored the optimal loading amount and release conditions of HA-PANBs. Our results indicate the following: (i) HA-PANBs efficiently delivers the ANM33 drug load into cells to exert its RNA silencing effect in a continuous manner. (ii) When using HA-PANBs at 12 mg/mL for 48 h, a higher release rate and drug efficacy were observed. (iii) It may represent a novel gene therapy approach to atherosclerosis (AS), making it an ideal ultrasound contrast agent.

It should be emphasized that accurate target adhesion is the basis of ultrasound molecular imaging. Furthermore, we showed that a large number of dual-target HA-PANBs microbubbles clustered around the foam cells but only a few with NB microbubbles. The HA-PANBs microbubbles also weakly adhere to Mφ, possibly due to non-specific endocytosis of Mφ. Quantitatively, the number of HA-PANBs adhering to foam cells was 6.9 times more than that of NBs. Meantime, more fluorescently labeled PM1 (green) and ANM33 (red) signals were associated with HA-PANBs than with NBs. After co-incubating with foam cells for 24 h, the release rate of targeted vesicles was 5.3 times more than that of non-targeted vesicles. Although a small number of cells in the NB group expressed red fluorescence peripherally under the fluorescence microscope, the flow cytometry revealed a cellular fluorescence carry-over rate of 14.4 ± 1.9%. The cellular transfection rate of dual-targeted lipid microvesicles reached about 76.8 ± 2.1%, which was five times higher than that of non-targeted vesicles (Figure 7). Guided by the results of HA-PANBs efficiently bound to foam cells, phased targeting strategy may be the direct reason for higher targeting rate: (i) the “invisible” HA coating might behave very similar to the hydrophilic polyethylene glycol [19], effectively shielding the internal lipid and drug contents from ineffective phagocytosis and uptake by the liver receptors, and (ii) HA-PANBs could target various biological barriers to Mφ through a multi-stage targeting mechanism.

Indeed, several previous studies have validated that the HA-coating may hinder the release of the therapeutic agent from HA-PANBs due to its potential in forming hydrophilic matrices around nanoparticles [20]. However, compared with the previous research, the present study, to the best of our knowledge, is the first attempt to examine the effect of dual-target microbubble loaded with ANM33 in foam cells. We found that ANM33 was continuously released from NBs, ANBs, PANBs, HA-CNBs, and HA-PANBs in the absence of HAase. Of note, compared with CNBs, HA-PANBs showed slower drug diffusion, probably due to a larger surface coverage by HA. In addition, there were no significant differences in the release pattern between NBs and ANBs in the presence and absence of HAase. When the enzyme treatment removed the HA coating from HA-PANBs and HA-CNBs, a higher drug release was observed, similar to the level of PANBs. This finding implies that both HA-PANBs and HA-CNBs are highly susceptible to HAase activity, subsequently exposing the encapsulated ANM33. As was our expectation, compared with microbubbles without the HA coating, the dissolution and drug release rates of HA-coated microbubbles were steadier, confirming that HA is better for lipid microbubble protection.

To further determine the optimal dose and release conditions of HA-PANBs, we concentrated with respect on the cellular phagocytic capacity with prolonged release time. Notably, the concentration of intracellular ANM33 gradually increased with increase in the time. The results showed, when 12 mg of HA-PANBs per 107 cell for 48 h, a better foam cell targeting were observed than for 24 h. Laser confocal microscopy and flow cytometry results in Figure A1 from supplement materials provide us with a reasonable evidence to this result. Indeed, Bousoik et al. [21] have found that bivalent CD44 antibodies can promote Mφ-mediated phagocytosis. Rho is vital for phagocytosis of apoptotic cells by bone marrow-derived Mφ in mice [22,23], and given that the first phase of wrapping HA on the surface of our microvesicles for foam cell targeting resulted in an effective increase in targeting efficiency, it is reasonable to expect that it is due to the interaction of HA with CD44 expressed at endothelial cells that activates the Rho family in Mφ and drives its phagocytic process. This provides a new idea for HA to activate the intracellular Rho family after binding to the extracellular domain of CD44 on the surface of Mφ at the site of inflammation [24,25].

Guided by the results of RT-PCR situation, continuous and efficient targeted dissolution and release are the direct reasons for such recovery of the deregulation of miR-33 in HA-PANBs group: (1) The highest expression of miR-33 in the model group were consistent with the expectations. (2) The efficiency of single-target groups was increased compared with the model group, indicating that the target selection was reasonable; (3) The ANM33 group and ANBs group showed similar results, with not much of a reduction; (4) The HA-PANBs group obtained the ideal silencing effect. Our data are consistent with Kai and Xiaoqiu [26] for enhanced intracellular delivery of nanoparticles and provide the basis for further investigation of function and metabolic changes.

Cytotoxicity assays, including in vitro cell activity assays and in vitro hemolysis assays, were also performed in this study and the above results provide ample evidence of the safety of HA-PANBs. Of note, the material DSPE-PEG2000 can be dispersed in water to form micelles, and its critical micelle concentration is lower than that of surfactants [27,28]. Therefore, it is more suitable for the preparation of long-term nanomaterials, so as to prolong the circulation time in the blood and increase the chance of entering pathological tissues. Moreover, this experiment exploited the co-culture cell model referring to a study by Zhang et al. [29]. Our data showed that CD44 was significantly expressed in HUVECs of the experimental group (Figure 3), turning on early inflammatory responses of AS, which confirmed that the addition of TNF-α accelerated the recruitment of inflammatory cells. Additionally, the study by Tanzer et al. [30] has shown that TNF-α induces cell death (apoptosis and necrosis) similarly as reported by Li et al. [31]. On comparing with the control group, microbubble treatment groups did not exhibit any significant advancements in disease progression, possibly by suppressing the expression of miR-33 in these cells.

5 Conclusion

The results of the present study revealed that the dual-target ultrasound microbubble contrast agent HA-PANBs can effectively target the foam cells for RNA silencing. Moreover, we highlight that when HA-PANBs are used at 12 mg/mL per 107 cells for 48 h, a higher release rate and drug efficacy were observed. In summary, we report a promising strategy for cardiovascular diseases, that exploits the providential advantages of AS therapy and multi-stage targeted delivery system.

# These authors contributed equally to this work.

tel: +86-0991-4366187

Acknowledgements

We would like to thank the Xinjiang Key Laboratory of Ultrasound Medicine and Experimental Animal Center of Xinjiang Medical University for their technical laboratory assistance and proficiency in the animal surgeries, and all anonymous reviewers for their helpful remarks.

  1. Funding information: This work was supported by the National Natural Science Foundation of China (Grant No. 82060321, Grant No. 32071459), Natural Science Foundation of Xinjiang Uygur Autonomous Region (Grant No. 2022D01C254), State Key Laboratory of Pathogenesis, Prevention and Treatment of High Incidence Diseases in Central Asia Fund (Grant No. SKL-HIDCA-2021-XXG6, Grant No. SKL-HIDCA-2022-XXG2), The Chinese Central Government Guides Local Special Funds for scientific and Technological Development (ZYYD2023A02).

  2. Author contributions: Chen Yuan, Yuming Mu, and Yanhong Li conceived and designed the manuscript, Chen Yuan and Liyun Liu wrote the manuscript. Baihetiya Tayier, Ting Ma, and Lina Guan participated in the data collection, analysis of data, and preparation of the manuscript. All authors read and approved the final manuscript.

  3. Conflict of interest: Authors state no conflicts of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

Appendix

Figure A1 Laser confocal microscope observation of in vitro targeting of HA-PANBs with different concentrations. (a) Laser confocal images after different concentrations of HA-PANBs were incubated with foam cells for 30 min; and (b and c) quantitative results; *: P ＜ 0.05, **: P ＜ 0.01.
Figure A1

Laser confocal microscope observation of in vitro targeting of HA-PANBs with different concentrations. (a) Laser confocal images after different concentrations of HA-PANBs were incubated with foam cells for 30 min; and (b and c) quantitative results; *: P ＜ 0.05, **: P ＜ 0.01.

Figure A2 Laser confocal microscopy observation of HA-PANBs targeting in vitro at different times. (a) Representative images of laser confocal microscopy of different targeting conditions at different time points and (b) flow cytometric analysis of cell survival under different treatment conditions at indicated time points.
Figure A2

Laser confocal microscopy observation of HA-PANBs targeting in vitro at different times. (a) Representative images of laser confocal microscopy of different targeting conditions at different time points and (b) flow cytometric analysis of cell survival under different treatment conditions at indicated time points.

References

[1] Bima AI, Mahdi AS, Al Fayez FF, Khawaja TM, Abo El-Khair SM, Elsamanoudy AZ. Cellular senescence and vitamin D deficiency play a role in the pathogenesis of obesity-associated subclinical atherosclerosis: study of the potential protective role of vitamin D supplementation. Cells. 2021 Apr 16;10(4):920.10.3390/cells10040920Search in Google Scholar PubMed PubMed Central

[2] Yang Y, Kong Q, Ma X, Wang C, Xue S, Du X. A whole-scope evaluation of cervicocephalic atherosclerotic burden is essential to predict 90-day functional outcome in large-artery atherosclerotic stroke. J Atheroscler Thromb. 2022 Oct 1;29(10):1522–33.10.5551/jat.63226Search in Google Scholar PubMed PubMed Central

[3] Miao B, Hernandez AV, Alberts MJ, Mangiafico N, Roman YM, Coleman CI. Incidence and predictors of major adverse cardiovascular events in patients with established atherosclerotic disease or multiple risk factors. J Am Heart Assoc. 2020 Jan 21;9(2):e014402.10.1161/JAHA.119.014402Search in Google Scholar PubMed PubMed Central

[4] Wang Q, Chen K, Zhang F, Peng K, Wang Z, Yang D, et al. TRPA1 regulates macrophages phenotype plasticity and atherosclerosis progression. Atherosclerosis. 2020 May;301:44–53.10.1016/j.atherosclerosis.2020.04.004Search in Google Scholar PubMed

[5] Zhao ZW, Zhang M, Zou J, Wan XJ, Zhou L, Wu Y, et al. TIGAR mitigates atherosclerosis by promoting cholesterol efflux from macrophages. Atherosclerosis. 2021 Jun;327:76–86.10.1016/j.atherosclerosis.2021.04.002Search in Google Scholar PubMed

[6] Lin B, Xie W, Zeng C, Wu X, Chen A, Li H, et al. Transfer of exosomal microRNA-203-3p from dendritic cells to bone marrow-derived macrophages reduces development of atherosclerosis by downregulating Ctss in mice. Aging. 2021 Jun 2;13(11):15638–58.10.18632/aging.103842Search in Google Scholar PubMed PubMed Central

[7] Xu Y, Xu Y, Zhu Y, Sun H, Juguilon C, Li F, et al. Macrophage miR-34a is a key regulator of cholesterol efflux and atherosclerosis. Mol Ther. 2020 Jan 8;28(1):202–16.10.1016/j.ymthe.2019.09.008Search in Google Scholar PubMed PubMed Central

[8] Ouimet M, Barrett TJ, Fisher EA. HDL and reverse cholesterol transport. Circ Res. 2019 May 10;124(10):1505–18.10.1161/CIRCRESAHA.119.312617Search in Google Scholar PubMed PubMed Central

[9] Tall AR, Westerterp M. Inflammasomes, neutrophil extracellular traps, and cholesterol. J Lipid Res. 2019 Apr;60(4):721–7.10.1194/jlr.S091280Search in Google Scholar PubMed PubMed Central

[10] Suzuki K. Chronic Inflammation as an Immunological Abnormality and Effectiveness of Exercise. Biomolecules. 2019 Jun 7;9(6):223.10.3390/biom9060223Search in Google Scholar PubMed PubMed Central

[11] Zhang X, Rotllan N, Canfrán-Duque A, Sun J, Toczek J, Moshnikova A, et al. Targeted Suppression of miRNA-33 Using pHLIP Improves Atherosclerosis Regression. Circ Res. 2022 Jun 24;131(1):77–9.10.1161/CIRCRESAHA.121.320296Search in Google Scholar PubMed PubMed Central

[12] Zhang J, Zhao WS, Xu L, Wang X, Li XL, Yang XC. Endothelium-specific endothelin-1 expression promotes pro-inflammatory macrophage activation by regulating miR-33/NR4A axis. Exp Cell Res. 2021 Feb 1;399(1):112443.10.1016/j.yexcr.2020.112443Search in Google Scholar PubMed

[13] Kosareva A, Abou-Elkacem L, Chowdhury S, Lindner JR, Kaufmann BA. Seeing the invisible-ultrasound molecular imaging. Ultrasound Med Biol. 2020 Mar;46(3):479–97.10.1016/j.ultrasmedbio.2019.11.007Search in Google Scholar PubMed

[14] Krolikoski M, Monslow J, Puré E. The CD44-HA axis and inflammation in atherosclerosis: a temporal perspective. Matrix Biol. 2019;78:201–18.10.1016/j.matbio.2018.05.007Search in Google Scholar PubMed PubMed Central

[15] Liu X, Liu H, Wang SL, Liu JW. Hyaluronic acid derivative-modified nano-structured lipid carrier for cancer targeting and therapy. J Zhejiang Univ Sci B. 2020 Jul;21(7):571–80.10.1631/jzus.B1900624Search in Google Scholar PubMed PubMed Central

[16] Gao M, Deng H, Zhang W. Hyaluronan-based multifunctional nano-carriers for combination cancer therapy. Curr Top Med Chem. 2021;21(2):126–9.10.2174/1568026620666200922113846Search in Google Scholar PubMed

[17] Yuan C, Li Y, Liu L, Tayier B, Yang L, Guan L, et al. Experimental study on the compatibility and characteristics of a dual-target microbubble loaded with anti-miR-33. Int J Nanomed. 2021 Sep 11;16:6265–80.10.2147/IJN.S324514Search in Google Scholar PubMed PubMed Central

[18] Džopalić T, Kostić M, Kostić M, Marjanović G, Guzina J, Jurišić V, et al. Effects of galectin-1 on immunomodulatory properties of human monocyte-derived dendritic cells. Growth Factors. 2020 Dec;38(5-6):235–46.10.1080/08977194.2021.1947267Search in Google Scholar PubMed

[19] Li Y, Zhang T, Liu Q, He J. PEG-derivatized dual-functional nanomicelles for improved cancer therapy. Front Pharmacol. 2019 Jul 19;10:808.10.3389/fphar.2019.00808Search in Google Scholar PubMed PubMed Central

[20] Mou C, Yang Y, Bai Y, Yuan P, Wang Y, Zhang L. Hyaluronic acid and polydopamine functionalized phase change nanoparticles for ultrasound imaging-guided photothermal-chemotherapy. J Mater Chem B. 2019 Feb 28;7(8):1246–57.10.1039/C8TB03056ASearch in Google Scholar

[21] Bousoik E, Qadri M, Elsaid KA. CD44 receptor mediates urate crystal phagocytosis by macrophages and regulates inflammation in a murine peritoneal model of acute gout. Sci Rep. 2020 Apr 1;10(1):5748.10.1038/s41598-020-62727-zSearch in Google Scholar PubMed PubMed Central

[22] Norris PAA, Kaur G, Khan R, Zhu G, Ni H, Lazarus AH. Anti-inflammatory activity of CD44 antibodies in murine immune thrombocytopenia is mediated by Fcγ receptor inhibition. Blood. 2021 Apr 15;137(15):2114–24.10.1182/blood.2020009497Search in Google Scholar PubMed

[23] Sun L, Li L, Sun T, Zhang L, Li C, Xu M, et al. Antihuman CD44 antibody BJ18 inhibits platelet phagocytosis by correcting aberrant FcɣR expression and M1 polarization in immune thrombocytopenia. Int Immunopharmacol. 2021 Jun;95:107502.10.1016/j.intimp.2021.107502Search in Google Scholar PubMed

[24] Zhu Y, Liang H, Liu X, Wu J, Yang C, Wong TM, et al. Regulation of macrophage polarization through surface topography design to facilitate implant-to-bone osteointegration. Sci Adv. 2021 Apr 2;7(14):eabf6654.10.1126/sciadv.abf6654Search in Google Scholar PubMed

[25] Bros M, Haas K, Moll L, Grabbe S. RhoA as a key regulator of innate and adaptive immunity. Cells. 2019 Jul 17;8(7):733.10.3390/cells8070733Search in Google Scholar PubMed PubMed Central

[26] Kai C, Xiaoqiu X. Enhanced intracellular delivery and tissue retention of nanoparticles by mussel-inspired surface chemistry. Biomacromolecule. 2015;16(11):3574–83.10.1021/acs.biomac.5b01056Search in Google Scholar PubMed

[27] Esparza K, Jayawardena D, Onyuksel H. Phospholipid micelles for peptide drug delivery. Methods Mol Biol. 2019;2000:43–57.10.1007/978-1-4939-9516-5_4Search in Google Scholar PubMed

[28] Kulkarni JA, Witzigmann D, Leung J, Tam YYC, Cullis PR. On the role of helper lipids in lipid nanoparticle formulations of siRNA. Nanoscale. 2019 Nov 21;11(45):21733–9.10.1039/C9NR09347HSearch in Google Scholar PubMed

[29] Zhang M, He J, Jiang C, Zhang W, Yang Y, Wang Z, et al. Plaque-hyaluronidase-responsive high-density-lipoprotein-mimetic nanoparticles for multistage intimal-macrophage-targeted drug delivery and enhanced anti-atherosclerotic therapy. Int J Nanomed. 2017 Jan 13;12:533–8.10.2147/IJN.S124252Search in Google Scholar PubMed PubMed Central

[30] Tanzer MC, Bludau I, Stafford CA, Hornung V, Mann M. Phosphoproteome profiling uncovers a key role for CDKs in TNF signaling. Nat Commun. 2021 Oct 18;12(1):6053.10.1038/s41467-021-26289-6Search in Google Scholar PubMed PubMed Central

[31] Li W, Sultana N, Yuan L, Forssell C, Yuan XM. CD74 in apoptotic macrophages is associated with inflammation, plaque progression and clinical manifestations in human atherosclerotic lesions. Metabolites 2022 Jan 10;12(1):54.10.3390/metabo12010054Search in Google Scholar PubMed PubMed Central

Received: 2022-10-22
Revised: 2022-12-13
Accepted: 2023-01-04
Published Online: 2023-02-23

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
  3. Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
  4. Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
  5. Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
  6. A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
  7. Neutrophilia with subclinical Cushing’s disease: A case report and literature review
  8. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
  9. Immunoregulation of synovial macrophages for the treatment of osteoarthritis
  10. Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
  11. Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
  12. Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
  13. High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
  14. Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
  15. Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
  16. Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
  17. Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
  18. Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
  19. Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
  20. Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
  21. Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
  22. Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
  23. Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
  24. Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
  25. 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
  26. Experimental study on the optimization of ANM33 release in foam cells
  27. Primary retroperitoneal angiosarcoma: A case report
  28. Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
  29. Malignant pleural effusion diagnosis and therapy
  30. Effect of spaceflight on the phenotype and proteome of Escherichia coli
  31. Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
  32. Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
  33. Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
  34. The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
  35. Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
  36. mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
  37. The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
  38. Radiotherapy for primary thyroid adenoid cystic carcinoma
  39. Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
  40. Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
  41. Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
  42. Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
  43. PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
  44. The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
  45. Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
  46. Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
  47. NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
  48. Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
  49. Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
  50. Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
  51. Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
  52. Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
  53. Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
  54. Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
  55. Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
  56. Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
  57. Gemella morbillorum infective endocarditis: A case report and literature review
  58. An unusual ectopic thymoma clonal evolution analysis: A case report
  59. Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
  60. Detection of V. vulnificus septic shock with ARDS using mNGS
  61. Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
  62. The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
  63. Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
  64. ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
  65. Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
  66. Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
  67. Collagen changes in rabbit conjunctiva after conjunctival crosslinking
  68. Effects of NM23 transfection of human gastric carcinoma cells in mice
  69. Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
  70. Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
  71. Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
  72. Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
  73. Giant duplication of the transverse colon in an adult: A case report and literature review
  74. Ectopic thyroid tissue in the breast: A case report
  75. SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
  76. Vaginal metastasis from breast cancer: A case report
  77. Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
  78. Inhibition of TAZ impairs the migration ability of melanoma cells
  79. Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
  80. Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
  81. Identification of winter wheat pests and diseases based on improved convolutional neural network
  82. Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
  83. Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
  84. Immune checkpoint inhibitors in cancer patients with COVID-19
  85. Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
  86. Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
  87. Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
  88. DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
  89. Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
  90. Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
  91. Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
  92. Studying infant mortality: A demographic analysis based on data mining models
  93. Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
  94. Protein Z modulates the metastasis of lung adenocarcinoma cells
  95. Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
  96. TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
  97. Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
  98. Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
  99. Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
  100. Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
  101. Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
  102. HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
  103. Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
  104. Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
  105. Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
  106. Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
  107. Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
  108. Research progress on gas signal molecular therapy for Parkinson’s disease
  109. Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
  110. The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
  111. α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
  112. CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
  113. Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
  114. Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
  115. Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
  116. Research progress of AMP-activated protein kinase and cardiac aging
  117. TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
  118. Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
  119. Metastasis from small cell lung cancer to ovary: A case report
  120. The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
  121. The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
  122. Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
  123. Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
  124. Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
  125. Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
  126. Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
  127. Traumatic brain injury and rTMS-ERPs: Case report and literature review
  128. Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
  129. Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
  130. The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
  131. Inflammation-related signaling pathways in tendinopathy
  132. CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
  133. Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
  134. Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
  135. Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
  136. Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
  137. Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
  138. Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
  139. TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
  140. Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
  141. Ferroptosis: A potential target of macrophages in plaque vulnerability
  142. Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
  143. Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
  144. HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
  145. IL-17 in osteoarthritis: A narrative review
  146. Circadian cycle and neuroinflammation
  147. Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
  148. Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
  149. SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
  150. Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
  151. PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
  152. Pancreatic ectopic thyroid tissue: A case report and analysis of literature
  153. The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
  154. Report on a case of liver-originating malignant melanoma of unknown primary
  155. Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
  156. The fibroblast growth factor–Klotho axis at molecular level
  157. Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
  158. A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
  159. Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
  160. Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
  161. Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
  162. Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
  163. Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
  164. Case report of atypical undernutrition of hypoproteinemia type
  165. Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
  166. Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
  167. Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
  168. Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
  169. Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
  170. Precisional detection of lymph node metastasis using tFCM in colorectal cancer
  171. Advances in diagnosis and treatment of perimenopausal syndrome
  172. A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
  173. Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
  174. Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
  175. Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
  176. Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
  177. Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
  178. Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
  179. An online diagnosis method for cancer lesions based on intelligent imaging analysis
  180. Medical imaging in rheumatoid arthritis: A review on deep learning approach
  181. Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
  182. Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
  183. A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
  184. TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
  185. Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
  186. Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
  187. Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
  188. Hepatobiliary surgery based on intelligent image segmentation technology
  189. Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
  190. Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
  191. Early diagnosis for the onset of peri-implantitis based on artificial neural network
  192. Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
  193. Forecast of pain degree of lumbar disc herniation based on back propagation neural network
  194. SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
  195. Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
  196. Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
  197. A novel approach for minimising anti-aliasing effects in EEG data acquisition
  198. ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
  199. Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
  200. Lung nodule segmentation via semi-residual multi-resolution neural networks
  201. Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
  202. A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
  203. Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
  204. Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
  205. Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
  206. Monitoring and evaluation of anesthesia depth status data based on neuroscience
  207. Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
  208. Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
  209. Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
  210. Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
  211. Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
  212. From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
  213. Ecology and Environmental Science
  214. Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
  215. Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
  216. Effects of cadmium stress on fruits germination and growth of two herbage species
  217. Bamboo charcoal affects soil properties and bacterial community in tea plantations
  218. Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
  219. Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
  220. Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
  221. Food Science
  222. Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
  223. Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
  224. Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
  225. Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
  226. Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
  227. Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
  228. Microbiological transglutaminase: Biotechnological application in the food industry
  229. Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
  230. Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
  231. The potential for the use of leghemoglobin and plant ferritin as sources of iron
  232. Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
  233. Bioengineering and Biotechnology
  234. Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
  235. Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
  236. Agriculture
  237. Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
  238. On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
  239. Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
  240. A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
  241. Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
  242. Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
  243. Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
  244. Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
  245. Animal Sciences
  246. Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
  247. Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
  248. Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
  249. Tracking behavioral changes of confined sows from the first mating to the third parity
  250. The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
  251. Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
  252. Plant Sciences
  253. Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
  254. Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
  255. Tissue culture and rapid propagation technology for Gentiana rhodantha
  256. Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
  257. Cloning and expression analysis of VrNAC13 gene in mung bean
  258. Chlorate-induced molecular floral transition revealed by transcriptomes
  259. Effects of warming and drought on growth and development of soybean in Hailun region
  260. Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
  261. Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
  262. Distinguish Dianthus species or varieties based on chloroplast genomes
  263. Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
  264. Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
  265. An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
  266. Erratum
  267. Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
  268. Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
  269. Retraction
  270. Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
https://doi.org/10.1515/biol-2022-0564
Keywords for this article
drug delivery; dual targeting; foam cells; atherosclerosis
Creative Commons
BY 4.0

Articles in the same Issue

  1. Biomedical Sciences
  2. Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
  3. Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
  4. Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
  5. Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
  6. A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
  7. Neutrophilia with subclinical Cushing’s disease: A case report and literature review
  8. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
  9. Immunoregulation of synovial macrophages for the treatment of osteoarthritis
  10. Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
  11. Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
  12. Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
  13. High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
  14. Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
  15. Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
  16. Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
  17. Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
  18. Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
  19. Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
  20. Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
  21. Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
  22. Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
  23. Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
  24. Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
  25. 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
  26. Experimental study on the optimization of ANM33 release in foam cells
  27. Primary retroperitoneal angiosarcoma: A case report
  28. Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
  29. Malignant pleural effusion diagnosis and therapy
  30. Effect of spaceflight on the phenotype and proteome of Escherichia coli
  31. Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
  32. Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
  33. Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
  34. The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
  35. Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
  36. mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
  37. The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
  38. Radiotherapy for primary thyroid adenoid cystic carcinoma
  39. Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
  40. Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
  41. Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
  42. Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
  43. PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
  44. The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
  45. Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
  46. Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
  47. NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
  48. Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
  49. Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
  50. Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
  51. Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
  52. Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
  53. Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
  54. Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
  55. Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
  56. Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
  57. Gemella morbillorum infective endocarditis: A case report and literature review
  58. An unusual ectopic thymoma clonal evolution analysis: A case report
  59. Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
  60. Detection of V. vulnificus septic shock with ARDS using mNGS
  61. Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
  62. The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
  63. Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
  64. ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
  65. Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
  66. Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
  67. Collagen changes in rabbit conjunctiva after conjunctival crosslinking
  68. Effects of NM23 transfection of human gastric carcinoma cells in mice
  69. Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
  70. Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
  71. Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
  72. Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
  73. Giant duplication of the transverse colon in an adult: A case report and literature review
  74. Ectopic thyroid tissue in the breast: A case report
  75. SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
  76. Vaginal metastasis from breast cancer: A case report
  77. Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
  78. Inhibition of TAZ impairs the migration ability of melanoma cells
  79. Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
  80. Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
  81. Identification of winter wheat pests and diseases based on improved convolutional neural network
  82. Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
  83. Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
  84. Immune checkpoint inhibitors in cancer patients with COVID-19
  85. Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
  86. Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
  87. Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
  88. DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
  89. Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
  90. Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
  91. Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
  92. Studying infant mortality: A demographic analysis based on data mining models
  93. Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
  94. Protein Z modulates the metastasis of lung adenocarcinoma cells
  95. Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
  96. TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
  97. Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
  98. Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
  99. Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
  100. Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
  101. Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
  102. HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
  103. Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
  104. Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
  105. Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
  106. Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
  107. Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
  108. Research progress on gas signal molecular therapy for Parkinson’s disease
  109. Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
  110. The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
  111. α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
  112. CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
  113. Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
  114. Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
  115. Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
  116. Research progress of AMP-activated protein kinase and cardiac aging
  117. TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
  118. Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
  119. Metastasis from small cell lung cancer to ovary: A case report
  120. The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
  121. The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
  122. Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
  123. Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
  124. Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
  125. Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
  126. Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
  127. Traumatic brain injury and rTMS-ERPs: Case report and literature review
  128. Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
  129. Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
  130. The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
  131. Inflammation-related signaling pathways in tendinopathy
  132. CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
  133. Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
  134. Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
  135. Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
  136. Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
  137. Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
  138. Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
  139. TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
  140. Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
  141. Ferroptosis: A potential target of macrophages in plaque vulnerability
  142. Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
  143. Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
  144. HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
  145. IL-17 in osteoarthritis: A narrative review
  146. Circadian cycle and neuroinflammation
  147. Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
  148. Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
  149. SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
  150. Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
  151. PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
  152. Pancreatic ectopic thyroid tissue: A case report and analysis of literature
  153. The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
  154. Report on a case of liver-originating malignant melanoma of unknown primary
  155. Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
  156. The fibroblast growth factor–Klotho axis at molecular level
  157. Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
  158. A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
  159. Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
  160. Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
  161. Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
  162. Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
  163. Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
  164. Case report of atypical undernutrition of hypoproteinemia type
  165. Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
  166. Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
  167. Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
  168. Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
  169. Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
  170. Precisional detection of lymph node metastasis using tFCM in colorectal cancer
  171. Advances in diagnosis and treatment of perimenopausal syndrome
  172. A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
  173. Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
  174. Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
  175. Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
  176. Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
  177. Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
  178. Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
  179. An online diagnosis method for cancer lesions based on intelligent imaging analysis
  180. Medical imaging in rheumatoid arthritis: A review on deep learning approach
  181. Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
  182. Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
  183. A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
  184. TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
  185. Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
  186. Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
  187. Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
  188. Hepatobiliary surgery based on intelligent image segmentation technology
  189. Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
  190. Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
  191. Early diagnosis for the onset of peri-implantitis based on artificial neural network
  192. Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
  193. Forecast of pain degree of lumbar disc herniation based on back propagation neural network
  194. SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
  195. Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
  196. Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
  197. A novel approach for minimising anti-aliasing effects in EEG data acquisition
  198. ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
  199. Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
  200. Lung nodule segmentation via semi-residual multi-resolution neural networks
  201. Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
  202. A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
  203. Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
  204. Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
  205. Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
  206. Monitoring and evaluation of anesthesia depth status data based on neuroscience
  207. Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
  208. Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
  209. Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
  210. Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
  211. Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
  212. From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
  213. Ecology and Environmental Science
  214. Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
  215. Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
  216. Effects of cadmium stress on fruits germination and growth of two herbage species
  217. Bamboo charcoal affects soil properties and bacterial community in tea plantations
  218. Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
  219. Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
  220. Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
  221. Food Science
  222. Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
  223. Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
  224. Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
  225. Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
  226. Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
  227. Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
  228. Microbiological transglutaminase: Biotechnological application in the food industry
  229. Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
  230. Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
  231. The potential for the use of leghemoglobin and plant ferritin as sources of iron
  232. Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
  233. Bioengineering and Biotechnology
  234. Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
  235. Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
  236. Agriculture
  237. Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
  238. On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
  239. Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
  240. A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
  241. Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
  242. Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
  243. Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
  244. Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
  245. Animal Sciences
  246. Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
  247. Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
  248. Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
  249. Tracking behavioral changes of confined sows from the first mating to the third parity
  250. The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
  251. Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
  252. Plant Sciences
  253. Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
  254. Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
  255. Tissue culture and rapid propagation technology for Gentiana rhodantha
  256. Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
  257. Cloning and expression analysis of VrNAC13 gene in mung bean
  258. Chlorate-induced molecular floral transition revealed by transcriptomes
  259. Effects of warming and drought on growth and development of soybean in Hailun region
  260. Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
  261. Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
  262. Distinguish Dianthus species or varieties based on chloroplast genomes
  263. Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
  264. Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
  265. An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
  266. Erratum
  267. Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
  268. Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
  269. Retraction
  270. Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2026 De Gruyter Brill
Downloaded on 27.1.2026 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0564/html
Scroll to top button