Home Life Sciences Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
Article Open Access

Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features

  • Jing Fu and Shengkun Peng EMAIL logo
Published/Copyright: March 3, 2023
Download Article (PDF)
Open Life Sciences
From the journal Open Life Sciences Volume 18 Issue 1

Abstract

Triple-negative breast cancer (TNBC) is a subtype of breast cancer that exhibits aggressive tumor phenotypes, including rapid metastasis and tumor recurrence. Integrins belong to the family of transmembrane glycoproteins involved in regulating cell adhesion, proliferation, and differentiation through cell–cell and cell–extracellular matrix interactions. Aberrant β1 integrin signaling has been implicated in cancer invasion and metastasis processes. The present work aimed to investigate the role of β1 integrin in TNBC cancer progression using a mouse 4T1 cell line as a model system. We have sorted a subset of tumor-initiating cells (TICs) from the 4T1 cell line based on CD133 positivity by flow cytometry. RT-PCR and protein analysis studies showed the transcriptional upregulation of β1 integrin and its downstream target focal adhesion kinase in 4T1-TICs compared to parental 4T1 cells. In addition, the expression of β1 receptors in TICs is significantly higher than in parental population cells. Furthermore, in vitro cellular assays revealed that CD133+ TICs have higher clonogenic ability, invasion, and sphere formation potential. These findings suggest that β1 integrin has a potential role in TNBC invasion and metastasis. Hence, β1 integrin could be a possible factor for future targeted cancer therapies.

Keywords: β1 integrin; extracellular matrix; focal adhesion kinase; metastasis; triple-negative breast cancer

1 Introduction

Triple-negative breast cancer (TNBC) is fundamentally characterized by the absence of estrogen receptors, progesterone receptors, and human epidermal growth factor receptor 2. Notably, there is no precise and targeted therapeutics available for TNBC and thus resulting in a patient’s poor survival rate. Due to the aggressive proliferation rate, poor prognosis, and rapid metastasis to distant sites (lungs, liver, and brain), TNBC hampers current chemotherapy and causes tumor recurrence [1,2]. Tumor recurrence has been reported to occur within 3 years after the first chemotherapy, with most deaths occurring in the first 5 years [3]. Mutations in the breast cancer 1 gene are the early onset for TNBC, and the subset of TNBC became highly metastatic with extremely poor prognosis and became chemotherapy resistant [4]. The small subset of self-renewing tumor cells that can initiate tumor growth is cancer stem cells (CSCs) or tumor-propagating cells (TICs). Importantly, these cells are highly chemoresistant, tumorigenic, and self-renewal due to the overexpression of cell surface antigens such as CD133, CD44, and CD22 [5]. CD133 is a surface glycoprotein widely used as a surface marker to identify CSC in many human tumors [6]. CD133+ cancer cells possess higher tumorigenic activity and are resistant to anticancer drugs and radiation [7]. Such cell population includes a more remarkable ability to form floating spheres and tumor mass than CD133− cells. Furthermore, studies have demonstrated that tumor-initiating cells (TICs) can be isolated based on CD133 positivity and CD133+ TICs could promote tumor growth in NOD/SCID mice [8]. Also, it has been shown that a higher percentage of CD44+/CD24+ expressing cells were found in TNBC compared to other breast cancer subtypes [9]. Hence, understanding the molecular mechanism of TICs-mediated tumorigenesis, metastasis, and invasion is an urgent need for developing targeted therapeutics.

Most cell–cell and cell–extracellular matrix (ECM) interactions are mediated by the integrins, a transmembrane heterodimeric protein containing α and β subunits. Amongst, β1 integrin was found to be abnormally activated in human breast carcinoma, which drives malignant phenotypes such as epithelial-to-mesenchymal transition, metastasis, invasion, angiogenesis, and also affects therapeutic modalities [10,11]. Studies on human breast cancer xenograft and treatment with a blocking agent against β1 integrin showed partial attenuation of tumor growth by inducing apoptosis [12,13]. In contrast, different breast cancer cells observed a significant inhibitory effect [14]. Consequently, understanding the targeting factors and multifunctional pathway of β1 integrin in breast cancer would undoubtedly enhance the treatment efficacy and outcomes.

The various downstream signaling targets of β1 integrin act as driving forces for tumor progression, including PI3K, ERK/MAPK, and focal adhesion kinase (FAK) [15,16]. Among these, the FAK is phosphorylated at the Y397 residue upon activation by integrin, which leads to aggressive cancer features such as enhanced cell spreading, cell proliferation, and invasion through multifaceted FAK-associated signal transduction pathways [17,18]. Indeed, overexpression of FAK has been reported in metastatic breast cancer, and the FAK inhibition indeed reduced the metastatic features. Thus, integrin-mediated FAK activation should be considered as a potential target to impede the aggressive cancer phenotypes of breast cancer. Aberrant activation and crosstalk between β1 integrin and other cellular targets are crucial for breast cancer carcinogenesis [19]. Remarkably, β1 integrin involved coordination and crosstalk with various signals to maintain the wide range of cellular functions. Deregulation of β1 integrin and its downstream signaling cascades favor mammary tumor development and progression [20]. The regulation of β1 integrin in these complex processes remains unclear. In the present study, we have used mouse TNBC cell line 4T1 to study the role of β1 integrin in breast cancer progression. We have sorted tumor-initiating TICs from 4T1 cells based on CD133 expression by flow cytometry and further investigated the potential mechanism of TICs-mediated TNBC metastasis and invasion. Our findings suggest that β1 integrin has a potential role in TNBC invasion and metastasis.

2 Materials and methods

2.1 Cells and culture conditions

Mouse TNBC cell line 4T1 was purchased from the Chinese Academy of Sciences, Shanghai. Monolayered cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) provided with 10% fetal bovine serum (FBS) and required antibiotics. Cells were incubated at 37°C with 5% CO2 in a humidified atmosphere.

2.2 Flow cytometry and cell sorting

In brief, 4T1 cells were seeded overnight onto sterile cultural plates at a 1.5 × 103 cells/plate density. For the TICs isolation, cells were stained with anti-CD133-FITC (Thermo Fisher; 1:200) and unstained cells were used as negative controls. After washing the samples with PBS solution three times, cells were resuspended in 500 μL PBS and then subjected to flow cytometry cell sorting. BD FACSort (BD Biosciences) was used for cell sorting. Live cells were gated as P1 population, and dead cells/cell debris were excluded by increasing the height of the photomultiplier threshold for forward scattering. The flow rate was set as 100 cells/s and the sorted cells were collected in a separate sterile tube containing a culture medium. The sorted cells were maintained at 37°C with 5% CO2 in a humidified atmosphere. To measure the mean fluorescence signal intensity, cells were stained with anti-CD29-FITC (Thermo Fisher; 1:100) and incubated on ice for 1 h. Subsequently, cells were washed with 1× PBS three times and subjected to fluorescence activated cell sorting analysis. The values presented in the quantification graphs are the average values of three independent experiments.

2.3 RT-PCR analysis

RNA was obtained from cells using the TRIzol method and then reversed to cDNA with RT Kit Superscript III (Invitrogen). Quantitative PCR was carried out using SYBRGreen (Takara) with appropriate primers against β1 integrin and GAPDH designed by Primer 5.0. The reaction conditions include an initial step of 10 min at 95°C and then 40 cycles of amplification, which includes 10 s at 95°C, 20 s at 58°C, and 25 s at 72°C. Quantification was determined by 2−ΔΔCT [21]. The internal control used was GAPDH.

β1 integrin – Forward primer: GAGGTTCAATTTGAAATTAGC and Reverse primer: GGCTCTGCACTGAACACATTC; GAPDH – Forward primer: ACGACCCCTTCATTGACCTC and Reverse primer CTTTCCAGAGGGGCCATCCAC.

2.4 Soft agar assay

The assay was performed as per the previously described protocol [22]. Cells were mixed with 0.3% agarose in DMEM and layered on top of 0.5% agar (acts as a base layer for the plate) in DMEM supplemented with 10% FBS and incubated at 37°C. The medium was changed every 2 days, and after 20 days the plates were stained with 0.005% crystal violet. The colonies were visualized under a microscope and the number of colonies were counted for three independent experiments.

2.5 Matrigel invasion assay

Cells cultured in DMEM in BD matrigel invasion chambers at 37°C for 48 h were subjected to swabbing matrigel top layer with Q-tip, and therefore, non-invading cells were washed off. The invading cells on the membrane were stained with hematoxylin, mounted on slides and visualized under a microscope at 40× objective lens. The number of invading cells was counted, and the values were represented as a quantitative graph.

2.6 Sphere formation assay

We performed the sphere formation assay as per the previously described protocol [23]. The flow cytometry sorted TICs and parental 4T1 cells were grown in a serum-free 1:1 mixture of Ham’s F-12/DMEM supplemented with N2 and bFGF (10 ng/mL) and EGF (10 ng/mL) at a density of 103 cells/mL in a 6-well plate. Spheres >50 µm diameter were counted after 2 weeks. Sphere formation efficiency was calculated using the formula: (Total number of spheres formed/total number of live cells seeded) × 100.

2.7 Protein separation and western blot analysis

Protein lysate was prepared from the samples using a standard protocol and was separated in 10% SDS gel as described previously [24]. Proteins were transferred (using the wet transfer method) to the PVDF membrane. After transfer, the membrane was blocked using 5% BSA. After the blocking step, the membrane was incubated with primary antibodies like polyclonal rabbit anti-CD29 (1:1,000; Thermo Fisher), monoclonal rabbit anti-CD44 (1:2,000; Invitrogen), rabbit anti-CD133 (1:1,000; Thermo Fisher), and rabbit anti-GAPDH (1:2,000; Sigma). Blots were developed with HRP-conjugated secondary antibodies, and the protein signal was detected by an enhanced chemiluminescence kit (Amersham Pharmacia Biotech).

2.8 Statistical analysis

Student’s t-test and one-way analysis of variance (ANOVA) were performed for the comparison between the two groups. The results presented in the graphs are mean  ±  SEM (standard error of mean) and the p-values such as *p  <  0.05 and **p  <  0.01 are considered statistically significant.

3 Results

3.1 Overexpression of β1 integrin and FAK in CD133+ mouse TNBC 4T1-TICs

To determine the factors and signaling pathways involved in breast cancer metastasis and invasion, we have used breast mouse adenocarcinoma cell line 4T1 as a model system in this study. TICs possess the characteristic features of stem cells, such as high proliferation, self-renewal, and enhanced stem cell surface markers [25]. For isolating a population of TICs, cells were stained with CD133-FITC antibody to differentiate and sort the population of cancer stem-like TICs. By flow cytometry, we have isolated a sub-population of TICs whose mean intensity for CD133-FITC signal (P2 gated region) is significantly higher than parental 4T1 cells (Figure 1a) and accounts for more than 25% of the total cell population (Figure 1b). Furthermore, protein analysis confirmed that sorted 4T1-TICs displayed higher expression of CD133 and cell surface glycoproteins such as CD24 and CD44 [26], which are essential for cell adhesion and migration (Figure 1c). Next, we analyzed and compared the expression profile of β1 integrin between sorted TICs and parental mouse 4T1 cells. Flow cytometry was performed to measure and quantify the mean intensity of β1 integrin (CD29-FITC). As a result, we found that β1 integrin signaling is significantly overexpressed in sorted TICs (Figure 2a). Consequently, the cell surface level of β1 integrin is significantly higher in 4T1-TICs, rather than parental 4T1 cells (Figure 2b). In addition, RT-PCR and protein analysis data revealed that TICs has enhanced transcriptional regulation (p < 0.01), and protein expression was observed for the β1 integrin gene (Figure 2c–e). Similarly, the FAK, which is crucial for cell migration and invasion by interaction with integrins, is also upregulated in TICs (Figure 2c–e). Therefore, these results suggest that β1 integrin is overexpressed in mouse breast adenocarcinoma TICs isolated from the 4T1 cell line. Furthermore, these cells also possess enhanced expression of protein, which are crucial for cancer cell adhesion, migration, and invasion.

Figure 1 Sorting of CD133+ TICs from mouse TNBC 4T1 cell line. (a) Flow cytometry-based sorting of TICs. Live cells selected in the P1 gated region and TICs were isolated based on CD133 fluorescence intensity (P2 gated region). (b) Quantification graph showing percentage of TICs in mouse TNBC 4T1 cells. (c) Western blot showing that isolated 4T1-TICs displayed overexpression of stem cell surface markers like CD133 and CD44, while as downregulation of CD24. The values represented in the quantitative data as means  ±  SEM (*p  <  0.05; **p  <  0.01).
Figure 1

Sorting of CD133+ TICs from mouse TNBC 4T1 cell line. (a) Flow cytometry-based sorting of TICs. Live cells selected in the P1 gated region and TICs were isolated based on CD133 fluorescence intensity (P2 gated region). (b) Quantification graph showing percentage of TICs in mouse TNBC 4T1 cells. (c) Western blot showing that isolated 4T1-TICs displayed overexpression of stem cell surface markers like CD133 and CD44, while as downregulation of CD24. The values represented in the quantitative data as means  ±  SEM (*p  <  0.05; **p  <  0.01).

Figure 2 Overexpression of β1 integrin in mouse TNBC 4T1-TICs. Quantification graphs from flow cytometry analysis (a–c) showing significantly higher β1 integrin signal and cell surface receptors in sorted TICs, respectively. RT-PCR (d and e) and western blot data (f) significantly enhanced transcriptional upregulation and protein overexpression in 4T1-TICs. The values represented in the quantitative data as means  ±  SEM (*p  <  0.05; **p  <  0.01).
Figure 2

Overexpression of β1 integrin in mouse TNBC 4T1-TICs. Quantification graphs from flow cytometry analysis (a–c) showing significantly higher β1 integrin signal and cell surface receptors in sorted TICs, respectively. RT-PCR (d and e) and western blot data (f) significantly enhanced transcriptional upregulation and protein overexpression in 4T1-TICs. The values represented in the quantitative data as means  ±  SEM (*p  <  0.05; **p  <  0.01).

3.2 CD133+ mouse TNBC 4T1-TICs display more aggressive tumorigenic features compared to 4T1 cells

The flow cytometer sorted TICs displayed overexpressed stem cell surface glycoproteins essential for self-renewal, cell adhesion, migration, and invasion [5]. Hence, we compared the clonogenic ability, invasion, and tumorsphere-forming potential between TICs and parental 4T1 cells. The TICs can produce more tumor clones on soft agar plates than 4T1 cells (Figure 3a and b). Furthermore, the TIC-produced tumor clones grew more prominent and faster, whereas the clones produced by 4T1 were relatively smaller in size and had slower growth. Similarly, the sphere formation assay showed that TICs could produce more tumorspheres expeditiously, and their size increases with time (Figure 3c and d). Subsequent matrigel invasion assay confirmed the increased migratory potential of TICs. The number of cells migrated/invaded through the matrigel is significantly higher in TICs compared to 4T1 cells (Figure 3e). Altogether, these findings suggest that sorted CD133+ TICs from mouse 4T1 cell line possess strong clonogenic and higher tumor invasion properties, possibly owing to overexpression of β1 integrin and FAK.

Figure 3 Effect of β1 integrin overexpression in mouse TNBC malignancy. Soft agar assay (a and b) showing that 4T1-TICs able to produce bigger and greater number of tumor clones rapidly. Similarly, the TICs were able to generate tumorspheres efficiently and the size increases over the time (c and d). (e) TICs were able to invade through the matrigel more efficiently than parental 4T1 cells. The values represented in the quantitative data as means  ±  SEM (*p  <  0.05; **p  <  0.01).
Figure 3

Effect of β1 integrin overexpression in mouse TNBC malignancy. Soft agar assay (a and b) showing that 4T1-TICs able to produce bigger and greater number of tumor clones rapidly. Similarly, the TICs were able to generate tumorspheres efficiently and the size increases over the time (c and d). (e) TICs were able to invade through the matrigel more efficiently than parental 4T1 cells. The values represented in the quantitative data as means  ±  SEM (*p  <  0.05; **p  <  0.01).

4 Discussion

Integrins are essential for cell motility, proliferation, and survival. Increasing evidence shows the implications of dysregulated integrin signaling in breast cancer tumorigenesis and progression [27]. In the present study, we found higher β1 integrin and FAK expression in CD133+ TIC from highly metastatic and invasive mouse TNBC cell line 4T1. A subset of a small population of TICs was isolated by flow cytometry based on increased positive staining of stem cell surface protein CD133. It has already been reported that overexpression of stemness proteins contributes to high self-renewal, tumorigenic, and differentiation potential of CSCs or TICs [8,28]. These TICs showed an increased mRNA and protein expression of β1 integrin compared to parental 4T1 cells. Previous reports in human TNBC cell lines also showed aberrant regulation of integrins and the role of distinct integrins in breast cancer metastasis [14]. Abundantly expressed β1 integrin was associated with high metastasis with non-small-cell lung carcinoma [29]. In contrast, downregulated β1 integrin expression promotes carcinogenesis of pancreatic cancer [30]. However, the underlying mechanism of integrin-mediated breast cancer progression remains unclear. Hence, it is a pressing quest to unravel the factors and mechanisms involved in the β1 integrin-mediated tumorigenesis to solve these discrepancies.

β1 integrins can stimulate and activate downstream targets such PI3K, ERK/MAPK, EGFR, and FAK, which drive cell–ECM interaction for cell proliferation events [14]. At the same time, β1 integrin knockdown and treatment with a blocking agent against β1 integrin can suppress the aggressive phenotypes of breast cancer by inducing apoptotic cell death [12,13]. Our study showed that FAK is also overexpressed as β1 integrin in CD133+ TNBC-TICs. It is well documented that FAK expression is correlated with breast malignancy progression and poor clinical outcomes. Hence, FAK overexpression is associated with aggressiveness in breast tumorigenesis, metastasis, and invasion [31,32]. Consistent with the previous report, β1 integrin and FAK overexpressing TNBC 4T1-TICs have high clone formation efficiency, invading through matrigel and tumorsphere formation. This finding confirms the tumorigenic and invasion role of TICs. FAK activation might involve integrin–ECM interaction and further clustering of proteins (such as paxillin) at focal adhesion sites with integrins [33]. Another possible underlying mechanism of FAK-mediated tumorigenesis might be the activation of FAK downstream cascades such as Src and PI3/AKT signaling pathways, which are crucial for unlimited cell proliferation by impeding apoptosis [34]. Nonetheless, reports suggest that FAK is stimulated by various extracellular factors such as cytokines, lipid mediators, growth factors, and GPCRs pathways [31]. In this respect, studies have used FAK inhibitors and observed promising outcomes such as the prevention of cancer cell migration, particularly in TNBC cells [31].

In summary, our results showed that β1 integrin and FAK are overexpressed in TICs of mouse TNBC 4T1 cells. Notably, these findings are the outcome of fundamental research. Furthermore, knockdown approaches and animal models would shed more light on the molecular mechanism of β1 integrin mediating tumorigenesis in TICs of breast cancer. Meanwhile, considering the carcinogenic role of deregulated β1 integrin and FAK, new anti-cancer drugs should be designed to target them to enhance the treatment efficacy.

tel: +86-028-85422953, fax: +86-028-85422873

  1. Funding information: This work was financially supported by the Sichuan Academy of Medical Sciences, China.

  2. Author contributions: Both the authors participated in the research design, experimental work, data analysis, interpretation of the results, and manuscript preparation.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Bianchini G, De Angelis C, Licata L, Gianni L. Treatment landscape of triple-negative breast cancer – expanded options, evolving needs. Nat Rev Clin Oncol. 2022;19(2):91–113.10.1038/s41571-021-00565-2Search in Google Scholar PubMed

[2] Schmid P, Cortes J, Pusztai L, McArthur H, Kummel S, Bergh J, et al. Pembrolizumab for early triple-negative breast cancer. N Engl J Med. 2020;382(9):810–21.10.1056/NEJMoa1910549Search in Google Scholar PubMed

[3] Marsolier J, Prompsy P, Durand A, Lyne AM, Landragin C, Trouchet A, et al. H3K27me3 conditions chemotolerance in triple-negative breast cancer. Nat Genet. 2022;54(4):459–68.10.1038/s41588-022-01047-6Search in Google Scholar PubMed PubMed Central

[4] Maqbool M, Bekele F, Fekadu G. Treatment strategies against triple-negative breast cancer: an updated review. Breast Cancer. 2022;14:15–24.10.2147/BCTT.S348060Search in Google Scholar PubMed PubMed Central

[5] Yang L, Shi P, Zhao G, Xu J, Peng W, Zhang J, et al. Targeting cancer stem cell pathways for cancer therapy. Signal Transduction Targeted Ther. 2020;5(1):8.10.1038/s41392-020-0110-5Search in Google Scholar PubMed PubMed Central

[6] Yang Y, Liu Z, Wang Q, Chang K, Zhang J, Ye D, et al. Presence of CD133-positive circulating tumor cells predicts worse progression-free survival in patients with metastatic castration-sensitive prostate cancer. Int J Urol Off J Jpn Urol Assoc. 2022;29(5):383–9.10.1111/iju.14801Search in Google Scholar PubMed PubMed Central

[7] Jung KH, Lee JH, Kim M, Lee EJ, Cho YS, Lee KH. Celecoxib-induced modulation of colon cancer CD133 expression occurs through AKT inhibition and is monitored by (89)Zr Immuno-PET. Mol Imaging. 2022;2022:4906934.10.1155/2022/4906934Search in Google Scholar PubMed PubMed Central

[8] Singh SK, Hawkins C, Clarke ID, Squire JA, Bayani J, Hide T, et al. Identification of human brain tumour initiating cells. Nature. 2004;432(7015):396–401.10.1038/nature03128Search in Google Scholar PubMed

[9] Hennessy BT, Gonzalez-Angulo AM, Stemke-Hale K, Gilcrease MZ, Krishnamurthy S, Lee JS, et al. Characterization of a naturally occurring breast cancer subset enriched in epithelial-to-mesenchymal transition and stem cell characteristics. Cancer Res. 2009;69(10):4116–24.10.1158/0008-5472.CAN-08-3441Search in Google Scholar PubMed PubMed Central

[10] Zhang Y, Sun L, Li H, Ai L, Ma Q, Qiao X, et al. Binding blockade between TLN1 and integrin beta1 represses triple-negative breast cancer. eLife. 2022;11:11.10.7554/eLife.68481Search in Google Scholar

[11] Baltes F, Pfeifer V, Silbermann K, Caspers J, Wantoch von Rekowski K, Schlesinger M, et al. Beta1-integrin binding to collagen type 1 transmits breast cancer cells into chemoresistance by activating ABC efflux transporters. Biochim Biophys Acta Mol Cell Res. 2020;1867(5):118663.10.1016/j.bbamcr.2020.118663Search in Google Scholar PubMed

[12] Park CC, Zhang H, Pallavicini M, Gray JW, Baehner F, Park CJ, et al. Beta1 integrin inhibitory antibody induces apoptosis of breast cancer cells, inhibits growth, and distinguishes malignant from normal phenotype in three dimensional cultures and in vivo. Cancer Res. 2006;66(3):1526–35.10.1158/0008-5472.CAN-05-3071Search in Google Scholar PubMed PubMed Central

[13] Park CC, Zhang HJ, Yao ES, Park CJ, Bissell MJ. Beta1 integrin inhibition dramatically enhances radiotherapy efficacy in human breast cancer xenografts. Cancer Res. 2008;68(11):4398–405.10.1158/0008-5472.CAN-07-6390Search in Google Scholar PubMed PubMed Central

[14] Hou S, Isaji T, Hang Q, Im S, Fukuda T, Gu J. Distinct effects of beta1 integrin on cell proliferation and cellular signaling in MDA-MB-231 breast cancer cells. Sci Rep. 2016;6:18430.10.1038/srep18430Search in Google Scholar PubMed PubMed Central

[15] Aksorn N, Chanvorachote P. Integrin as a molecular target for anti-cancer approaches in lung cancer. Anticancer Res. 2019;39(2):541–618.10.21873/anticanres.13146Search in Google Scholar PubMed

[16] Yu C, Zhang M, Song J, Zheng X, Xu G, Bao Y, et al. Integrin-Src-YAP1 signaling mediates the melanoma acquired resistance to MAPK and PI3K/mTOR dual targeted therapy. Mol Biomed. 2020;1(1):12.10.1186/s43556-020-00013-0Search in Google Scholar PubMed PubMed Central

[17] Golubovskaya VM, Ylagan L, Miller A, Hughes M, Wilson J, Wang D, et al. High focal adhesion kinase expression in breast carcinoma is associated with lymphovascular invasion and triple-negative phenotype. BMC Cancer. 2014;14:769.10.1186/1471-2407-14-769Search in Google Scholar PubMed PubMed Central

[18] Cance WG, Harris JE, Iacocca MV, Roche E, Yang X, Chang J, et al. Immunohistochemical analyses of focal adhesion kinase expression in benign and malignant human breast and colon tissues: correlation with preinvasive and invasive phenotypes. Clin Cancer Res. 2000;6(6):2417–23.Search in Google Scholar

[19] Winkler J, Abisoye-Ogunniyan A, Metcalf KJ, Werb Z. Concepts of extracellular matrix remodelling in tumour progression and metastasis. Nat Commun. 2020;11(1):5120.10.1038/s41467-020-18794-xSearch in Google Scholar PubMed PubMed Central

[20] Ma R, Gong D, You H, Xu C, Lu Y, Bergers G, et al. LGL1 binds to integrin beta1 and inhibits downstream signaling to promote epithelial branching in the mammary gland. Cell Rep. 2022;38(7):110375.10.1016/j.celrep.2022.110375Search in Google Scholar PubMed PubMed Central

[21] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25(4):402–8.10.1006/meth.2001.1262Search in Google Scholar PubMed

[22] Borowicz S, Van Scoyk M, Avasarala S, Karuppusamy Rathinam MK, Tauler J, Bikkavilli RK, et al. The soft agar colony formation assay. J Vis Exp. 2014;27(92):e51998.10.3791/51998Search in Google Scholar PubMed PubMed Central

[23] Relier S, Yazdani L, Ayad O, Choquet A, Bourgaux JF, Prudhomme M, et al. Antibiotics inhibit sphere-forming ability in suspension culture. Cancer Cell Int. 2016;16:6.10.1186/s12935-016-0277-6Search in Google Scholar PubMed PubMed Central

[24] Ahmad Waza A, Andrabi K, Ul Hussain M. Adenosine-triphosphate-sensitive K + channel (Kir6.1): a novel phosphospecific interaction partner of connexin 43 (Cx43). Exp Cell Res. 2012;318(20):2559–66.10.1016/j.yexcr.2012.08.004Search in Google Scholar PubMed

[25] Cortes-Dericks L, Galetta D. Impact of cancer stem cells and cancer stem cell-driven drug resiliency in lung tumor: options in sight. Cancers. 2022;14(2):267.10.3390/cancers14020267Search in Google Scholar PubMed PubMed Central

[26] Kaur P, Nagaraja GM, Zheng H, Gizachew D, Galukande M, Krishnan S, et al. A mouse model for triple-negative breast cancer tumor-initiating cells (TNBC-TICs) exhibits similar aggressive phenotype to the human disease. BMC Cancer. 2012;12:120.10.1186/1471-2407-12-120Search in Google Scholar PubMed PubMed Central

[27] Desgrosellier JS, Cheresh DA. Integrins in cancer: biological implications and therapeutic opportunities. Nat Rev Cancer. 2010;10(1):9–22.10.1038/nrc2748Search in Google Scholar PubMed PubMed Central

[28] Singh SK, Clarke ID, Terasaki M, Bonn VE, Hawkins C, Squire J, et al. Identification of a cancer stem cell in human brain tumors. Cancer Res. 2003;63(18):5821–8.Search in Google Scholar

[29] Dingemans AM, van den Boogaart V, Vosse BA, van Suylen RJ, Griffioen AW, Thijssen VL. Integrin expression profiling identifies integrin alpha5 and beta1 as prognostic factors in early stage non-small cell lung cancer. Mol Cancer. 2010;9:152.10.1186/1476-4598-9-152Search in Google Scholar PubMed PubMed Central

[30] Kren A, Baeriswyl V, Lehembre F, Wunderlin C, Strittmatter K, Antoniadis H, et al. Increased tumor cell dissemination and cellular senescence in the absence of beta1-integrin function. EMBO J. 2007;26(12):2832–42.10.1038/sj.emboj.7601738Search in Google Scholar PubMed PubMed Central

[31] Rigiracciolo DC, Santolla MF, Lappano R, Vivacqua A, Cirillo F, Galli GR, et al. Focal adhesion kinase (FAK) activation by estrogens involves GPER in triple-negative breast cancer cells. J Exp Clin Cancer Res. 2019;38(1):58.10.1186/s13046-019-1056-8Search in Google Scholar PubMed PubMed Central

[32] Worthmuller J, Ruegg C. The crosstalk between FAK and Wnt signaling pathways in cancer and its therapeutic implication. Int J Mol Sci. 2020;21(23):9107.10.3390/ijms21239107Search in Google Scholar PubMed PubMed Central

[33] Mitra SK, Schlaepfer DD. Integrin-regulated FAK-Src signaling in normal and cancer cells. Curr Opin Cell Biol. 2006;18(5):516–23.10.1016/j.ceb.2006.08.011Search in Google Scholar PubMed

[34] Zhao X, Guan JL. Focal adhesion kinase and its signaling pathways in cell migration and angiogenesis. Adv Drug Delivery Rev. 2011;63(8):610–5.10.1016/j.addr.2010.11.001Search in Google Scholar PubMed PubMed Central

Received: 2022-04-22
Revised: 2022-09-05
Accepted: 2022-09-14
Published Online: 2023-03-03

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
  3. Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
  4. Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
  5. Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
  6. A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
  7. Neutrophilia with subclinical Cushing’s disease: A case report and literature review
  8. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
  9. Immunoregulation of synovial macrophages for the treatment of osteoarthritis
  10. Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
  11. Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
  12. Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
  13. High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
  14. Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
  15. Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
  16. Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
  17. Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
  18. Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
  19. Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
  20. Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
  21. Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
  22. Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
  23. Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
  24. Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
  25. 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
  26. Experimental study on the optimization of ANM33 release in foam cells
  27. Primary retroperitoneal angiosarcoma: A case report
  28. Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
  29. Malignant pleural effusion diagnosis and therapy
  30. Effect of spaceflight on the phenotype and proteome of Escherichia coli
  31. Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
  32. Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
  33. Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
  34. The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
  35. Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
  36. mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
  37. The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
  38. Radiotherapy for primary thyroid adenoid cystic carcinoma
  39. Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
  40. Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
  41. Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
  42. Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
  43. PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
  44. The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
  45. Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
  46. Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
  47. NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
  48. Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
  49. Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
  50. Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
  51. Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
  52. Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
  53. Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
  54. Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
  55. Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
  56. Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
  57. Gemella morbillorum infective endocarditis: A case report and literature review
  58. An unusual ectopic thymoma clonal evolution analysis: A case report
  59. Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
  60. Detection of V. vulnificus septic shock with ARDS using mNGS
  61. Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
  62. The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
  63. Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
  64. ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
  65. Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
  66. Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
  67. Collagen changes in rabbit conjunctiva after conjunctival crosslinking
  68. Effects of NM23 transfection of human gastric carcinoma cells in mice
  69. Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
  70. Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
  71. Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
  72. Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
  73. Giant duplication of the transverse colon in an adult: A case report and literature review
  74. Ectopic thyroid tissue in the breast: A case report
  75. SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
  76. Vaginal metastasis from breast cancer: A case report
  77. Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
  78. Inhibition of TAZ impairs the migration ability of melanoma cells
  79. Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
  80. Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
  81. Identification of winter wheat pests and diseases based on improved convolutional neural network
  82. Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
  83. Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
  84. Immune checkpoint inhibitors in cancer patients with COVID-19
  85. Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
  86. Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
  87. Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
  88. DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
  89. Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
  90. Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
  91. Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
  92. Studying infant mortality: A demographic analysis based on data mining models
  93. Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
  94. Protein Z modulates the metastasis of lung adenocarcinoma cells
  95. Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
  96. TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
  97. Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
  98. Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
  99. Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
  100. Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
  101. Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
  102. HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
  103. Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
  104. Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
  105. Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
  106. Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
  107. Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
  108. Research progress on gas signal molecular therapy for Parkinson’s disease
  109. Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
  110. The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
  111. α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
  112. CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
  113. Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
  114. Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
  115. Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
  116. Research progress of AMP-activated protein kinase and cardiac aging
  117. TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
  118. Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
  119. Metastasis from small cell lung cancer to ovary: A case report
  120. The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
  121. The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
  122. Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
  123. Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
  124. Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
  125. Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
  126. Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
  127. Traumatic brain injury and rTMS-ERPs: Case report and literature review
  128. Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
  129. Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
  130. The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
  131. Inflammation-related signaling pathways in tendinopathy
  132. CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
  133. Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
  134. Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
  135. Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
  136. Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
  137. Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
  138. Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
  139. TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
  140. Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
  141. Ferroptosis: A potential target of macrophages in plaque vulnerability
  142. Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
  143. Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
  144. HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
  145. IL-17 in osteoarthritis: A narrative review
  146. Circadian cycle and neuroinflammation
  147. Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
  148. Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
  149. SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
  150. Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
  151. PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
  152. Pancreatic ectopic thyroid tissue: A case report and analysis of literature
  153. The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
  154. Report on a case of liver-originating malignant melanoma of unknown primary
  155. Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
  156. The fibroblast growth factor–Klotho axis at molecular level
  157. Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
  158. A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
  159. Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
  160. Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
  161. Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
  162. Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
  163. Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
  164. Case report of atypical undernutrition of hypoproteinemia type
  165. Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
  166. Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
  167. Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
  168. Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
  169. Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
  170. Precisional detection of lymph node metastasis using tFCM in colorectal cancer
  171. Advances in diagnosis and treatment of perimenopausal syndrome
  172. A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
  173. Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
  174. Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
  175. Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
  176. Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
  177. Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
  178. Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
  179. An online diagnosis method for cancer lesions based on intelligent imaging analysis
  180. Medical imaging in rheumatoid arthritis: A review on deep learning approach
  181. Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
  182. Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
  183. A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
  184. TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
  185. Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
  186. Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
  187. Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
  188. Hepatobiliary surgery based on intelligent image segmentation technology
  189. Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
  190. Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
  191. Early diagnosis for the onset of peri-implantitis based on artificial neural network
  192. Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
  193. Forecast of pain degree of lumbar disc herniation based on back propagation neural network
  194. SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
  195. Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
  196. Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
  197. A novel approach for minimising anti-aliasing effects in EEG data acquisition
  198. ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
  199. Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
  200. Lung nodule segmentation via semi-residual multi-resolution neural networks
  201. Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
  202. A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
  203. Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
  204. Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
  205. Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
  206. Monitoring and evaluation of anesthesia depth status data based on neuroscience
  207. Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
  208. Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
  209. Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
  210. Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
  211. Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
  212. From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
  213. Ecology and Environmental Science
  214. Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
  215. Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
  216. Effects of cadmium stress on fruits germination and growth of two herbage species
  217. Bamboo charcoal affects soil properties and bacterial community in tea plantations
  218. Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
  219. Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
  220. Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
  221. Food Science
  222. Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
  223. Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
  224. Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
  225. Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
  226. Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
  227. Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
  228. Microbiological transglutaminase: Biotechnological application in the food industry
  229. Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
  230. Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
  231. The potential for the use of leghemoglobin and plant ferritin as sources of iron
  232. Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
  233. Bioengineering and Biotechnology
  234. Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
  235. Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
  236. Agriculture
  237. Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
  238. On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
  239. Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
  240. A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
  241. Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
  242. Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
  243. Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
  244. Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
  245. Animal Sciences
  246. Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
  247. Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
  248. Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
  249. Tracking behavioral changes of confined sows from the first mating to the third parity
  250. The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
  251. Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
  252. Plant Sciences
  253. Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
  254. Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
  255. Tissue culture and rapid propagation technology for Gentiana rhodantha
  256. Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
  257. Cloning and expression analysis of VrNAC13 gene in mung bean
  258. Chlorate-induced molecular floral transition revealed by transcriptomes
  259. Effects of warming and drought on growth and development of soybean in Hailun region
  260. Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
  261. Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
  262. Distinguish Dianthus species or varieties based on chloroplast genomes
  263. Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
  264. Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
  265. An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
  266. Erratum
  267. Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
  268. Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
  269. Retraction
  270. Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
https://doi.org/10.1515/biol-2022-0510
Keywords for this article
β1 integrin; extracellular matrix; focal adhesion kinase; metastasis; triple-negative breast cancer
Creative Commons
BY 4.0

Articles in the same Issue

  1. Biomedical Sciences
  2. Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
  3. Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
  4. Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
  5. Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
  6. A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
  7. Neutrophilia with subclinical Cushing’s disease: A case report and literature review
  8. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
  9. Immunoregulation of synovial macrophages for the treatment of osteoarthritis
  10. Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
  11. Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
  12. Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
  13. High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
  14. Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
  15. Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
  16. Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
  17. Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
  18. Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
  19. Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
  20. Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
  21. Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
  22. Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
  23. Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
  24. Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
  25. 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
  26. Experimental study on the optimization of ANM33 release in foam cells
  27. Primary retroperitoneal angiosarcoma: A case report
  28. Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
  29. Malignant pleural effusion diagnosis and therapy
  30. Effect of spaceflight on the phenotype and proteome of Escherichia coli
  31. Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
  32. Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
  33. Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
  34. The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
  35. Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
  36. mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
  37. The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
  38. Radiotherapy for primary thyroid adenoid cystic carcinoma
  39. Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
  40. Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
  41. Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
  42. Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
  43. PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
  44. The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
  45. Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
  46. Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
  47. NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
  48. Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
  49. Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
  50. Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
  51. Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
  52. Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
  53. Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
  54. Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
  55. Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
  56. Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
  57. Gemella morbillorum infective endocarditis: A case report and literature review
  58. An unusual ectopic thymoma clonal evolution analysis: A case report
  59. Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
  60. Detection of V. vulnificus septic shock with ARDS using mNGS
  61. Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
  62. The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
  63. Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
  64. ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
  65. Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
  66. Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
  67. Collagen changes in rabbit conjunctiva after conjunctival crosslinking
  68. Effects of NM23 transfection of human gastric carcinoma cells in mice
  69. Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
  70. Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
  71. Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
  72. Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
  73. Giant duplication of the transverse colon in an adult: A case report and literature review
  74. Ectopic thyroid tissue in the breast: A case report
  75. SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
  76. Vaginal metastasis from breast cancer: A case report
  77. Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
  78. Inhibition of TAZ impairs the migration ability of melanoma cells
  79. Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
  80. Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
  81. Identification of winter wheat pests and diseases based on improved convolutional neural network
  82. Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
  83. Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
  84. Immune checkpoint inhibitors in cancer patients with COVID-19
  85. Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
  86. Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
  87. Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
  88. DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
  89. Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
  90. Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
  91. Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
  92. Studying infant mortality: A demographic analysis based on data mining models
  93. Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
  94. Protein Z modulates the metastasis of lung adenocarcinoma cells
  95. Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
  96. TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
  97. Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
  98. Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
  99. Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
  100. Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
  101. Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
  102. HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
  103. Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
  104. Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
  105. Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
  106. Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
  107. Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
  108. Research progress on gas signal molecular therapy for Parkinson’s disease
  109. Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
  110. The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
  111. α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
  112. CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
  113. Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
  114. Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
  115. Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
  116. Research progress of AMP-activated protein kinase and cardiac aging
  117. TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
  118. Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
  119. Metastasis from small cell lung cancer to ovary: A case report
  120. The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
  121. The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
  122. Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
  123. Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
  124. Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
  125. Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
  126. Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
  127. Traumatic brain injury and rTMS-ERPs: Case report and literature review
  128. Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
  129. Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
  130. The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
  131. Inflammation-related signaling pathways in tendinopathy
  132. CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
  133. Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
  134. Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
  135. Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
  136. Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
  137. Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
  138. Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
  139. TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
  140. Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
  141. Ferroptosis: A potential target of macrophages in plaque vulnerability
  142. Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
  143. Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
  144. HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
  145. IL-17 in osteoarthritis: A narrative review
  146. Circadian cycle and neuroinflammation
  147. Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
  148. Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
  149. SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
  150. Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
  151. PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
  152. Pancreatic ectopic thyroid tissue: A case report and analysis of literature
  153. The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
  154. Report on a case of liver-originating malignant melanoma of unknown primary
  155. Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
  156. The fibroblast growth factor–Klotho axis at molecular level
  157. Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
  158. A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
  159. Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
  160. Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
  161. Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
  162. Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
  163. Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
  164. Case report of atypical undernutrition of hypoproteinemia type
  165. Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
  166. Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
  167. Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
  168. Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
  169. Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
  170. Precisional detection of lymph node metastasis using tFCM in colorectal cancer
  171. Advances in diagnosis and treatment of perimenopausal syndrome
  172. A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
  173. Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
  174. Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
  175. Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
  176. Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
  177. Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
  178. Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
  179. An online diagnosis method for cancer lesions based on intelligent imaging analysis
  180. Medical imaging in rheumatoid arthritis: A review on deep learning approach
  181. Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
  182. Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
  183. A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
  184. TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
  185. Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
  186. Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
  187. Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
  188. Hepatobiliary surgery based on intelligent image segmentation technology
  189. Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
  190. Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
  191. Early diagnosis for the onset of peri-implantitis based on artificial neural network
  192. Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
  193. Forecast of pain degree of lumbar disc herniation based on back propagation neural network
  194. SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
  195. Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
  196. Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
  197. A novel approach for minimising anti-aliasing effects in EEG data acquisition
  198. ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
  199. Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
  200. Lung nodule segmentation via semi-residual multi-resolution neural networks
  201. Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
  202. A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
  203. Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
  204. Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
  205. Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
  206. Monitoring and evaluation of anesthesia depth status data based on neuroscience
  207. Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
  208. Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
  209. Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
  210. Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
  211. Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
  212. From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
  213. Ecology and Environmental Science
  214. Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
  215. Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
  216. Effects of cadmium stress on fruits germination and growth of two herbage species
  217. Bamboo charcoal affects soil properties and bacterial community in tea plantations
  218. Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
  219. Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
  220. Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
  221. Food Science
  222. Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
  223. Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
  224. Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
  225. Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
  226. Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
  227. Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
  228. Microbiological transglutaminase: Biotechnological application in the food industry
  229. Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
  230. Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
  231. The potential for the use of leghemoglobin and plant ferritin as sources of iron
  232. Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
  233. Bioengineering and Biotechnology
  234. Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
  235. Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
  236. Agriculture
  237. Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
  238. On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
  239. Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
  240. A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
  241. Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
  242. Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
  243. Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
  244. Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
  245. Animal Sciences
  246. Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
  247. Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
  248. Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
  249. Tracking behavioral changes of confined sows from the first mating to the third parity
  250. The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
  251. Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
  252. Plant Sciences
  253. Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
  254. Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
  255. Tissue culture and rapid propagation technology for Gentiana rhodantha
  256. Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
  257. Cloning and expression analysis of VrNAC13 gene in mung bean
  258. Chlorate-induced molecular floral transition revealed by transcriptomes
  259. Effects of warming and drought on growth and development of soybean in Hailun region
  260. Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
  261. Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
  262. Distinguish Dianthus species or varieties based on chloroplast genomes
  263. Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
  264. Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
  265. An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
  266. Erratum
  267. Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
  268. Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
  269. Retraction
  270. Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2026 De Gruyter Brill
Downloaded on 27.1.2026 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0510/html
Scroll to top button