Home Chlorate-induced molecular floral transition revealed by transcriptomes
Article Open Access

Chlorate-induced molecular floral transition revealed by transcriptomes

  • Songgang Li , Houbin Chen , Jiwang Hong , Xiuxu Ye , Jiabao Wang , Yeyuan Chen , Lei Zhang , Zuanxian Su and Ziqin Yang EMAIL logo
Published/Copyright: July 29, 2023

Abstract

Flowering in off-season longan (Dimocarpus longan L.) can be induced effectively by the application of potassium chlorate (KClO3), but the mechanism of the physiological induction is largely unknown to decipher its mechanism and identify genes potentially regulating the process, and comparative analysis via RNA-Seq was performed between vegetative and KClO3-induced floral buds. A total of 18,649 differentially expressed genes (DEGs) were identified between control and treated samples. Gene ontology and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis revealed that DEGs related to plant hormone signal transduction, mitogen-activated protein kinase (MAPK) signaling pathway, starch and sucrose metabolism, and phenylpropanoid biosynthesis were enriched in our data. A total of 29 flowering-related DEGs were identified in our study, such as APETALA1 (AP1), APETALA2 (AP2), AUXIN RESPONSE FACTOR 3/ETTIN (ARF3), SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 8 (SPL8), AGAMOUS (AG), and others. The upregulation of AP2 and SPL genes indicates that the age-related pathway is activated and influences the floral induction in KClO3-induced longan floral buds by coordinated regulation of genes related to AP1, AG, and ARF3. This study provides a valuable resource for studying molecular mechanisms underlying chlorate-induced floral transition in off-season longan, which may benefit the development and production of off-season tropical/subtropical fruit trees.

1 Introduction

Flowering is an important event in plants and can be controlled by environmental factors as well as endogenous factors. Flower induction requires the transition from the vegetative to the reproductive development stage, which is affected by light intensity and quality, photoperiod, low temperature (vernalization), as well as hormones and sugar status in plant cells. A perennial fruit tree longan (Dimocarpus longan) belongs to the family Sapindaceae and close relative of lychee (Litchi chinensis), which is commonly cultivated in subtropical and tropical countries including Southeast Asia and Australia [1]. Longan fruit is usually consumed for its nutritional and medicinal values [2]. Flower blossoming in longan mostly occurs once during the spring and requires low temperatures and dry conditions for flower bud differentiation. The mature centralized listing of longan has brought challenges to the development of the longan industry. The off-season flowering can be artificially induced by the application of chemicals such as potassium chlorate (KClO3) during noninductive temperature conditions [3]. However, the flowering response varies depending on the cultivars and regions and responds to a particular transient development stage of the terminal bud [4].

Due to the extended generation time, the detailed information related to molecular mechanisms of floral induction in longan is limited. The genetic basis of flower induction pathways and meristem development is similar across plant species. A significant amount of studies on model plants and perennial plants (e.g., A. thaliana) have identified key pathways and genes associated with floral transition including photoperiod, vernalization, gibberellic acid (GA), aging, etc. These pathways are regulated by floral integron genes such as flowering locus T (FT), flowering locus C (FLC), constans (CO), LEAFY (LFY), and suppressor of overexpression of constans (SOC1). The FT translocates from leaves to the apical meristem and interacts with another transcription factor encoded by the floral meristem (FM) identity gene APETALA1 (AP1) which targets downstream signals of flower development. The minichromosome maintenance1, agamous, deficiens and serum response factor (MADS)-domain protein, FLC, is a key repressor protein involved in vernalization, which interacts with another transcriptional repressor short vegetative phase (SVP) in Arabidopsis under a cold environment. The SVP protein further interacts with positive regulators of the FM development, SOC1, and AGL24. GA is a major player in a range of biological processes (BPs) and regulates the flower development. However, GA has been shown to act as a repressor of flowering in some plants. Two FM identity genes, LFY and AP1, act in a positive feedback loop and activate floral homeotic genes, which specify the identity of floral organs (sepals, petals, stamens, and carpels). In a proposed floral quartet model, floral homeotic proteins form organ-specific complexes and require another protein SEPALLATA (SEP; SEP1, SEP2, SEP3, and SEP4) for interaction. Moreover, several transcription factors involved in the flower development have been identified, such as MADS-domain transcription factors (TFs), AP2/ERF, MYB, NAC, WRKY, and DREB [5]. It has been reported that longan FT1 and FT2 genes have been ectopically expressed in Arabidopsis and showed early and late flowering in overexpressing lines (DlFT1 and DlFT2), respectively [6]. Further, DlAP1 and DlAP2 overexpressing Arabidopsis lines showed varying flowering time phenotypes. Studies showed that flower induction requires the presence of mature leaves, indicating the importance of flowering genes that express in mature leaves such as FT [7]. Interestingly, an analytical study on KClO3-treated longan revealed that a higher level of GA in shoot tips contributed to flower induction [8]. Many studies to date have been carried out on flowering induction and floral bud development in longan; however, the knowledge related to the molecular mechanism and its regulation during KClO3-induced flowering in longan are still evasive [1,6].

In this study, a comparative transcriptome analysis was performed using KClO3-treated and untreated off-season longan cultivars at a specific development stage. We ask if the treatment can induce expressions of genes like AP and ARF3 in off-season longan buds, as those in other plant species. We hypothesize that, as physiological induction of flowering has been observed in longan, genes related to flower initiation should be induced with the treatment in longan buds. This is the first comprehensive study to identify the differentially expressed genes and regulatory pathways involved in floral bud induction in longan in response to KClO3 application using the RNA-Seq approach. Our results may provide resourceful information related to flower induction and development, which may further be used to improve unstable flowering in subtropical fruit trees.

2 Materials and methods

2.1 Plant material and treatments

The experiments were conducted on the longan trees grown in a noninductive environment to avoid flower induction due to vernalization. At the national cultivar improvement center, 10- to 11-year-old tropical fruit trees, “Chuliang” trees, of similar size and developmental stage were selected for artificial flower induction treatment. Longan trees were treated with KClO3 (300 g per tree) as a solid drench. The generated flower buds were collected after 4 weeks of the treatment. Trees without treatment were set as a control (Figure 1). All samples were collected in triplicate. The collected samples were immediately frozen in liquid nitrogen and stored at −80°C.

Figure 1 
                  Shoots and flowers of longan without (a) and with (b) treatment of potassium chlorate (KClO3). Arrows indicate the emergence of floral buds after KClO3 application.
Figure 1

Shoots and flowers of longan without (a) and with (b) treatment of potassium chlorate (KClO3). Arrows indicate the emergence of floral buds after KClO3 application.

Total RNA was isolated using a plant RNA extraction kit according to the manufacturer’s instructions and treated with RNase-free DNase I to remove any DNA contamination. The quantity and quality checks for RNA samples were performed on Nanodrop ND1000 spectrophotometer and Agilent 2100 Bioanalyzer (Agilent Technologies, USA). A total of six RNA samples (three biological replicates for each treatment) with RNA integrity number value >8 were used for complementary DNA (cDNA) library preparation and sequencing.

2.2 Library construction and RNA sequencing

In total, six cDNA libraries were generated and sequenced, three biological replicates of 0 weeks and three replicates of 4 weeks after the treatment, using the Illumina HiSeq 2500 PE150 platform (Illumina Inc. CA, USA). The Illumina-generated paired-end raw reads were preprocessed with FastQC (v.0.11.3). The adapter sequences and low-quality reads were filtered by AdaperRemoval-v2 (version 2.2.0) followed by rRNA removal. The Q20, Q30, and GC content of the clean reads were determined. The high-quality clean reads were aligned to the longan genome and gene model downloaded from the website (http://gigadb.org/dataset/100276).

2.3 Differential gene expression analysis

The Kallisto program (v0.46.2) was used to count the number of reads mapped and to estimate the gene expression. The normalized gene expression level was computed as transcript per kilobase (kb) per million reads mapped (TPM). Differential expression analysis between samples was analyzed using the DESeq2 R package (v1.30.1). Genes with log2 fold change ≥1 or <−1 with adjusted p-value ≤0.05 were used as cutoff criteria for differentially expressed genes (DEGs). The p-values were adjusted using Benjamini and Hochberg’s false discovery rate method.

2.4 Functional annotation of DEGs

The functional annotation of longan genes was performed with the diamond (v2.0.8.146) tool by aligning the protein sequences to the NCBI nonredundant (Nr) database (e-value = 1 × 10−3). Gene ontology (GO) analysis was performed using InterproScan (v5.51–85.0). The GO and KEGG enrichment analysis for differentially expressed genes (DEGs) was carried out using ClusterProfiler (v3.18.1) R package. GO terms with an adjusted p-value ≤0.05 were depicted as significantly enriched. The ggplot2 (v3.3.3) was used to draw the volcano plot (Figure 3a) and MA plot (Figure 3b), and GO enrichment graph. The correlation coefficient for the correlation matrix was calculated using the corrplot (v0.88) R package.

2.5 Quantitative real-time polymerase chain reaction

Total RNAs were extracted from buds with the treatment of KClO3 (300 g per tree) after 0, 1, and 4 weeks, respectively, using the RNAprep Pure Plant Kit (TIANGEN, Beijing, China), following the manufacturer’s instructions. cDNA was synthesized using Reverse Transcriptase M-MLV kit (Takara, Beijing, China) according to the manufacturer’s instructions. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed using a TianLong 988 Real-Time PCR System (Tianlong Technologies, China) according to the manufacturer’s instructions. A total of 6 l of DNase/RNase-free water, 11 μl of Green Real-Time PCR master mix, 2 μl of diluted cDNA product, and 1 μl of gene-specific primers were added to each reaction mixture. Three biological replicates were used for each tissue and three technical repeats for each biological replicate. The thermal cycle was set as follows: denaturing at 95°C for 30 s, denaturing at 95°C for 15 s, and annealing and elongating at 58°C for 30 s with 45 cycles. The following are the primers used. AP1: CTTTGTGATGCTGAGGTTGCT (forward) and GGATTTTGCTGCTCCCATTGT (reverse); ARF3: GCATTTAGGGGCAGTCAAGAT (forward) and GGCATAGAAGTGGCTTACATTGG (reverse); BOP1: TAGCCAAACACCTGCCCATC (forward) and GCCTTCACCACTTCTCTGCT (reverse). The Actin7 gene (CCAGCCATCTCTCATCGGAA (forward) and GTCGGCAATACCAGGGAACA (reverse) are primers) was used as an internal reference for the normalization of gene expression. The relative expression levels were calculated using the 2−ΔΔCt method.

2.6 Data availability

All the raw sequencing data have been deposited in the NCBI Sequence Read Archive (SRA) database under the accession number PRJNA731294.

3 Results

3.1 RNA sequencing and mapping

We performed a comprehensive RNA-Seq profile of longan buds under the KClO3 treatment to explore the global gene expression changes in flower tissues. The transcriptome sequencing of the four buds RNA samples generated a total of 206.9 M clean reads of length 125 bp (paired-end), with an average of 172 M processed reads. An average of 75.56% of total reads passed ≥30 Phred score. The percentages of aligned reads were 76.85% and 74.26% for control and treated samples, respectively. The summary of reads and mapping statistics is presented in Table 1. The relation between gene expressions in all biological replicates indicates a high positive correlation between control and treated samples, respectively (Figure 2a).

Table 1

Summary of transcriptome analysis generated by RNA-Seq

Samples fastq Bases Q20 Q30 GC Average read length Total number of clean reads Percentage mapped reads to the reference genome
Control 1 R15050311_1 c1 1,917,358,250 95.35 90.82 44.08 125 17,090,142 77.52
R15050311_2 1,917,358,250 94.22 89.23 43.99 125 17,090,142 76.95
Control 2 R15050315_1 c2 2,288,825,500 95.25 90.69 44.01 125 15,338,866 77.38
R15050315_2 2,288,825,500 94.24 89.34 43.92 125 15,338,866 76.90
Control 3 R15050321_1 c3 2,036,296,250 95.24 90.68 44.74 125 18,240,475 76.44
R15050321_2 2,036,296,250 94.2 89.24 44.65 125 18,240,475 75.93
Treated 1 R15050310_1 t1 2,136,267,750 95.37 90.99 44.2 125 18,310,604 76.12
R15050310_2 2,136,267,750 93.94 89.03 44.09 125 18,310,604 75.68
Treated 2 R15050312_1 t2 2,280,059,375 95.54 91.16 43.88 125 18,215,170 74.30
R15050312_2 2,280,059,375 94.15 89.15 43.79 125 18,215,170 73.81
Treated 3 R15050320_1 t3 2,276,896,250 95.37 90.9 43.83 125 16,290,370 73.06
R15050320_2 2,276,896,250 94.1 89.11 43.74 125 16,290,370 72.61
Figure 2 
                  Summary of RNA-Seq results. (a) Heatmap showing correlation of expression between samples, suggesting a high positive correlation between control and treated samples. (b) Pie chart showing BLAST e-value distribution against NT database. (c) Pie chart showing species distribution as a percentage of total homologous sequences with an e-value <1 × 10−5 using the BLAST search against NT database. (d) Venn diagram showing common and uniquely expressed genes in control and treated samples.
Figure 2

Summary of RNA-Seq results. (a) Heatmap showing correlation of expression between samples, suggesting a high positive correlation between control and treated samples. (b) Pie chart showing BLAST e-value distribution against NT database. (c) Pie chart showing species distribution as a percentage of total homologous sequences with an e-value <1 × 10−5 using the BLAST search against NT database. (d) Venn diagram showing common and uniquely expressed genes in control and treated samples.

A search performed against NCBI Nr database resulted in 21,493 genes with significant homology (e-value = 1 × 10−5). Analysis of e-value distribution for the sequence resulted from BLAST hit against NT database showed the even distribution ranging from e-value 0 to 10−5. More than 88.4% of sequences showed significant homology hits (e-value <1 × 10−30).

The species distribution result showed that 45.4% of best matching sequences was distributed among five plant species with Theobroma cacao (18.3%) and Cephalotus follicularis (7.6%), representing the top two species with the highest matching hits (Figure 2c).

Of 31,006 transcripts, a total of 21,493 genes were found to be expressed in control and treated samples with 701 and 2,143 unique genes in control and treated samples, respectively. A total of 18,649 genes were found common between both samples (Figure 2d).

3.2 Differential expression of genes

A total of 18,649 DEGs were identified between control and treated samples. The TPM values of several DEGs were observed to be <1; therefore genes with TPM ≥ 1 at least in one sample were also taken into consideration. Of 18,649 DEGs, only 4,904 genes were significant between control and treated groups, with 2,663 upregulated and 2,241 downregulated genes, indicating that the number of upregulated genes was higher in KClO3-induced flower buds. The total numbers of upregulated and downregulated DEGs (adjusted p-value ≤0.05) are represented in the volcano plot and MA plot (Figure 3a and b). To explore the potential functions of DEGs, all the transcripts were further annotated using UniProt databases.

Figure 3 
                  Distribution of upregualted and downregulated DEGs. (a) Volcano plot. (b) MA plot. The red and blue dots represent the upregulated and downregulated DEGs, respectively, in KClO3-induced floral buds as compared to untreated control (p adjust <0.05).
Figure 3

Distribution of upregualted and downregulated DEGs. (a) Volcano plot. (b) MA plot. The red and blue dots represent the upregulated and downregulated DEGs, respectively, in KClO3-induced floral buds as compared to untreated control (p adjust <0.05).

3.3 GO and KEGG enrichment analysis

The DEGs were classified according to GO terms of the BP, cellular component (CC), and molecular function (MF) and were distributed among 33 GO categories. In the BP category, the highest number of DEGs were involved in “protein phosphorylation” and “regulation of transcription.” While in the CC and MF categories, most DEGs were assigned to “membrane” and “protein kinase activity,” respectively (Figure 4). Among the upregulated significant GO term in the BP category, terms related to “regulation of transcription,” “diterpenoid biosynthetic process,” and “hydrogen peroxide catabolic process” were the most enriched. In the CC category, “nucleus” and “nucleosome” were overrepresented, whereas “DNA binding,” “ADP binding,” and “terpene synthase activity” were the most enriched terms in the MF category. On the other hand, “photosynthesis,” “photosystem II,” and “structural constituent of ribosome” were among the downregulated significant GO term in the BP, CC, and MF categories, respectively. The results of GO enrichment analysis to identify the major gene groups in longan flower buds are provided in File S3 and Figure S1.

Figure 4 
                  Gene ontology distribution of upregulated DEGs in KClO3-induced floral buds. The top 10 enriched GO terms are shown in the y-axis and categorized into the BP, MF, and CC groups. The x-axis indicates the number of DEGs.
Figure 4

Gene ontology distribution of upregulated DEGs in KClO3-induced floral buds. The top 10 enriched GO terms are shown in the y-axis and categorized into the BP, MF, and CC groups. The x-axis indicates the number of DEGs.

Furthermore, the KEGG pathway analysis revealed the molecular interactions among the DEGs that are enriched in various metabolic pathways. In this analysis, DEGs were classified into 50 upregulated and 50 downregulated functional categories. In “plant hormone signal transduction” pathway, DEGs related to ethylene-insensitive protein 3/transcription factor TCP21 (Dlo_030832.1), SAUR family protein|auxin responsive GH3 gene family (Dlo_024340.1), phosphorelay signal transduction system (Dlo_012378.2), pto-interacting protein 1 (Dlo_014807.1), abscisic acid (ABA)-responsive element binding factor (Dlo_010957.1), and salicylic acid (SA)-mediated signaling pathway/E3 ubiquitin-protein ligase SIAH1 (Dlo_000903.1) have been identified. Group “MAPK signaling pathway – plant” (e.g., chitinase (Dlo_024177.1), ATP-dependent RNA helicase DHX36 (Dlo_017595.1), pto-interacting protein 1 (Dlo_014807.1), “phenylpropanoid biosynthesis” (e.g., tropinone reductase (Dlo_021546.1), 2-oxoglutarate dehydrogenase E2 component (Dlo_021361.2)), and “Mismatch repair” (e.g., DNA topoisomerase III (Dlo_000018.1), DNA ligase 1 (Dlo_030125.2)) were significantly enriched among the upregulated DEGs (Figure 5 and Figure S2). Apart from that DEGs were also enriched in the “starch and sucrose metabolism” pathway. On the other hand, “photosynthesis” (e.g., photosystem II oxygen-evolving complex (Dlo_000140.1), light-harvesting complex II chlorophyll a/b binding protein 7 (Dlo_034774.1)), “porphyrin and chlorophyll metabolism” (e.g., ubiquinol-cytochrome c reductase cytochrome b subunit (Dlo_0103421), NADH dehydrogenase (ubiquinone) flavoprotein 2 (Dlo_028554.1)), and “carbon fixation in photosynthetic organisms” pathways (e.g., fructose-bisphosphate aldolase activity (Dlo_024376.1), pyruvate dehydrogenase E1 component (Dlo_031702.1)) were the most enriched pathways among the downregulated DEGs (Figures S3 and S4). The enrichment analysis of KEGG pathways is provided in File S4.

Figure 5 
                  KEGG pathway assignments of upregulated DEGs in KClO3-induced floral buds. The x-axis indicates the number of DEGs. The y-axis represents the pathways (p adjust < 0.05).
Figure 5

KEGG pathway assignments of upregulated DEGs in KClO3-induced floral buds. The x-axis indicates the number of DEGs. The y-axis represents the pathways (p adjust < 0.05).

3.4 Identification of DEGs related to flower induction and development

A heatmap representing the 29 flowering-related DEGs was generated to analyze the comparative expression of genes between control and treated flower samples (Figure 6a, b). Among these DEGs, 13 genes were upregulated in response to KClO3 treatment. DEGs related to AP2 Dlo_000287.1 (Log2FC 2.745), ARF3/ETTIN Dlo_022331.1 (Log2FC 1.166), BLADE ON PETIOLE 1 (BOP1) (Dlo_005090.1; Log2FC 3.045), PENNYWISE (PNY) (Dlo_024934.1; Log2FC 3.799), PERIANTHIA (PAN) (Dlo_010957.1; Log2FC 2.170), PETAL LOSS (PTL) (Dlo_023741.1; Log2FC 3.003), and SPL8 (Dlo_028807.2; Log2FC 5.18) were shown significant uplregulation (Figure 6b). However, DEGs related to AG (Dlo_030807.1; Log2FC −4.222), AGL42 (Dlo_005595.1; Log2FC −1.615), AP1 (Dlo_003537.1; Log2FC −1.718), and HISTONE DEACETYLASE 1 (HD1) (Dlo_036520.1; Log2FC −0.879) were significantly downregulated. Moreover, DEGs correspond to LATE MERISTEM IDENTITY 1 (LM1) (Dlo_002458.1), BLADE ON PETIOLE 2 (BOP2; Dlo_022503.1). LEUNIG (LUG; Dlo_013506.1), SEUSS (SEU; Dlo_007306.1), and ULTRAPETALA1 (UTL1; Dlo_006134.1) were also found to be induced in our data.

Figure 6 
                  Heatmap representing the differential expression of flowering-related genes between untreated control and KClO3-induced floral buds. (a) Heatmap of non-normalized expression values. (b) Heatmap of row-normalized expression values.
Figure 6

Heatmap representing the differential expression of flowering-related genes between untreated control and KClO3-induced floral buds. (a) Heatmap of non-normalized expression values. (b) Heatmap of row-normalized expression values.

To confirm the gene expression results based on transcriptomic quantification, we measured the expression levels of AP2 (Figure 7a), ARF3/ETTIN (Figure 7b), and BOP1 (Figure 7c) using qRT-PCR. We sampled buds with the treatment of KClO3 at 0, 1, and 4 weeks, respectively. All the genes demonstrated elevated expression, agreeing with the transcriptomic results. Expression of all the genes showed higher expression levels at 1 week after the treatment than the starting point, and at 4 weeks than 1 week, suggesting continuous elevation of the gene expression with the treatment. The AP2 (Figure 7a) expression showed the elevation of 20-folds at 4 weeks after the treatment, which was particularly striking.

Figure 7 
                  Expression levels of the longan genes at 0, 1, and 4 weeks after the treatment measured by quantitative RT-PCR. (a) Expression levels of AP2; (b) ARF3/ETTIN expression levels; and (c) BOP1 expression level.
Figure 7

Expression levels of the longan genes at 0, 1, and 4 weeks after the treatment measured by quantitative RT-PCR. (a) Expression levels of AP2; (b) ARF3/ETTIN expression levels; and (c) BOP1 expression level.

4 Discussion

The floral induction is crucial for the production of subtropical fruit trees such as longan, which depends on the temperature, nutrient availability, etc. To optimize the off-season flowering in longan trees, many cultural management techniques have been employed. The applications of chemicals such as KClO3, sodium chlorite, and sodium hypochlorite have demonstrated the off-season floral induction in longan [9]. In the present study, we performed a comparative transcriptome of vegetative and flower buds induced in response to KClO3 treatment to identify the differentially expressed genes in longan. A total of 4,904 DEGs out of 18,649 genes were identified as significant in our dataset, and among them, 2,663 were upregulated and 2,241 were downregulated genes.

FM establishment and maintenance, organ initiation, flower transition, and morphogenesis depend on the tight regulation of a complex gene regulatory network. This complex network involves the sequential and coordinated function of TFs, which control the floral transition and development [10]. The GO analysis revealed that most DEGs were involved in the regulation of transcription, nucleus, DNA binding, and ADP binding. The highly induced DEGs such as Apyrase (Dlo_027533.2), transcription factor TCP21 (Dlo_032272.1), and DNA topoisomerase III (Dlo_009019.1) suggest that these genes actively participate in the transcriptional regulation of flowering-related genes. These results are consistent with the results of recent publications [11,12,13,14], suggesting similar mechanisms in different plant species.

Plant hormones play a key role in the regulation of plant growth and development. In KEGG pathway analysis, several DEGs involved in “plant hormone signal transduction” such as EIN3/transcription factor TCP21, SAUR family protein/auxin-responsive GH3 gene family, phosphorelay signal transduction system, pto-interacting protein 1, ABF, and SA-mediated signaling pathway/E3 ubiquitin-protein ligase SIAH1 have been identified. Ethylene levels in the plant can influence the regulatory network that controls the flowering timing [15]. EIN3 acts as an activator of ethylene-inducible genes. The regulatory role of ein3-1 mutants was observed in the transition from vegetative to reproductive growth in Arabidopsis [16]. The expression of auxin-responsive GH3 gene family and SAUR family protein was observed to be differentially regulated during floral transition in two longan cultivars and speculated to be involved in perpetual flowering by regulating the FM [17]. ABA also plays an important role in floral transition as previously reported [18]. In our study, a gene related to ABF was upregulated, indicating that the ABA signaling pathway might regulate the floral induction in longan in response to the KClO3 treatment. Similarly, the SA signaling pathway also affects flower induction [19]. A gene involved in SA-mediated signaling pathway (Dlo_000903.1) was also induced in our study. The aforementioned result suggests that these genes might play a critical role in the flowering-related signaling pathway via hormone regulation in the longan bud initiation process.

Further, mitogen-activated protein kinase (MAPK) pathways play a crucial role in environmental and developmental signal transduction. MAPKs are involved in various cellular processes and regulate plant hormone signaling pathways via molecular crosstalk. Ethylene signaling is influenced by MAPK-dependent phosphorylation and activation of transcription factor EIN3 [20]. Several genes related to the MAPK signaling pathway were induced in the present study such as phosphatidylinositol phospholipase C (Dlo_016250.2), phosphoglycerate kinase (Dlo_001972.1), 5-amino-6-(5-phospho-d-ribitylamino) uracil phosphatase (Dlo_021916.1), S-phase kinase-associated protein 1 (Dlo_011083.1), phosphorelay signal transduction system (Dlo_012378.2), and pto-interacting protein 1 (Dlo_014807.1), indicating that MAPK signaling controls the flowering via crosstalk between plant hormone signaling and flowering-related pathway in longan. MAPK has been shown to be related to other physiological processes in flower, such as heat-stress response [21] and self-incompatibility [22], but the rare report relates MAPK with chemical treatment-induced expression MAPK. This indicates that MAPK might be involved in other flowering-related physiological processes.

Carbohydrates are an important source of energy for plant development and other cellular processes. The previous study has shown a higher rate of sucrose export during floral induction in Arabidopsis [23]. In a study of comparative expression analysis of two longan varieties, genes related to trehalose-6-phosphate synthase (TPS1), granule bound starch synthase 1 (GBSS1), and starch synthase 2 (SS2) have shown downregulation in longan genotype with PF trait suggested that these genes act as an inhibitor of PF traits in longan [17]. TPS1 is required for flower induction in Arabidopsis and apple, and the loss of TPS1 function causes a delay in flowering [24]. We observed several DEGs related to starch and sucrose metabolism and carbohydrate metabolism in this study such as glucan endo-1,3-beta-glucosidase (Dlo_024378.1), trehalose biosynthetic process (Dlo_012338.1), gluconokinase (Dlo_001453.1), beta-fructofuranosidase (Dlo_013696.1), UDP-glucose--hexose-1-phosphate uridylyltransferase (Dlo_035054.1), and mannose-1-phosphate guanylyltransferase (Dlo_022083.1), which indicate the importance of carbohydrate metabolism regulation during the flower development in longan. Our results also identified the DEGs involved in “phenylpropanoid biosynthesis” and “diterpenoid biosynthesis” pathways such as tropinone reductase and thujopsene synthase, which were highly induced. It was reported that floral terpene volatiles play an important role in the plant development [25].

Environmental signals including photoperiod, temperature, age, and nutrient supply can affect the floral transition involving the conversion of shoot apical meristem (SAM) into an inflorescence meristemleading to flower initiation [18]. These pathways trigger the floral integrator genes such as FT and SOC1, which in turn activate the FM identity genes LFY and AP1. In our study, the expression of LFY, FT, and SOC1 was not detected as observed by Jia et al. [26]. However, in contrast to the previous study [27], AP1 expression showed downregulation in our result. On the other hand, we observed upregulation in gene-related to AP2, which is a member of the AP2/ethylene response factor (ERF) transcription factor family and a target of miR172 involved in floral stem cell control [28]. It is reported that the AP2 restricts the expression of AG during the regulation of floral stem cells in Arabidopsis. Previous reports demonstrated that AP2 expression was downregulated in longan [17,26]; however, AP2 seems to control the regulation of flowering genes in KClO3-induced floral buds in our study. Further, genes related to AG and AGL42 were downregulated supporting the previous finding. An SBP box domain TF-related gene SPL8 was highly upregulated in this study. SPL8 and other miR156-targeted SPL genes play a crucial role in anther development and gynoecium patterning [29]. Both AP2 and SPL are involved in the regulation of age-dependent response to vernalization [30]. ARF3/ETTIN is involved in the regulation of expression of auxin-responsive genes as well as cytokinin biosynthesis genes and plays a role in leaf polarity specification and floral organ patterning [31]. It was observed that ARF3 participates in FM determinacy by repression of WUSCHEL (WUS) gene expression, a central player in FM determinacy. AP2 and AG control the action of WUS by the activation and repression of WUS expression, respectively. In Arabidopsis, ARF3 acts as a target of AP2 and integrates the function of AP2 and AG in FM determinacy [32]. Interestingly, ARF3 expression is upregulated in our study, which indicates that ARF3 peculiarly coordinates with AP2 and AG to regulate the KClO3-induced flowering in longan. It was reported that another player that regulates the floral stem cell termination is UTL1, which induces the AG expression and MADS-Box genes during flower development. It was revealed that UTL1 genetically interacts with LFY via the regulation of AG and MADS box genes; however, UTL1 and LFY appear to act independently to regulate genes involved in floral organogenesis [33].

A gene related to BLR or PNY, which belongs to a BELL homeodomain transcription factors family, was shown a higher fold of induction. A study showed that BLR/PNY has a role in the maintenance of SAM and FM specification as well as the suppression of AG [34]. Similarly, a bZIP transcription factor, PAN, binds and activates the expression of AG in the center of FM [35]. We observed the upregulation in PAN expression in our data. A gene related to LMI1 was also found to be upregulated. LMI1 is activated by LFY and activates the CAULIFLOWER (CAL), another FMI gene, which ultimately induces AP1 expression together with LFY [36]. Grandi et al. [37] observed that AP1 represses the LM1 expression, indicating that a regulatory feedback loop is required to maintain the relative expression of these genes to establish the FM identity. However, little is known about whether the BELL transcription factor is involved in flowering initiation, although our results suggest its role in flowering initiation in longan. This indicates its value for further studies to confirm its role in such processes.

Next, LUG and SEU, two transcriptional co-repressors interact with AP1 and SEP3 and repress the AG expression in outer floral whorls [38]. Both LUG and SEU showed upregulation in this study. Transcriptional co-regulators, BOP1 and BOP2, regulate the architecture of leaves, fruits, and flowers. Loss-of-function mutant bop1 bop2 revealed defective inflorescence and floral architecture [39]. A study showed that BOP1/2 interacts with PAN and induces the expression of AP1 in floral primordial as well as downregulates AGL24. BOP1/2 activates AP1 in FM in an LFY-independent manner [40]. We observed upregulation in BOP1/2 expression in our study. PTL is another regulator in flower development, which showed higher expression in this study and was reported to be expressed in boundaries between sepal primordial and restricts growth between newly formed sepals [41].

Histone modification plays an important role in flower development. In Arabidopsis, an antisense AtHD1 showed ectopic expression of tissue-specific gene SUPERMAN (SUP) in floral whorls with aberrant phenotype and other flower defects [42]. In another study, it was observed that HUA ENHANCER 3 (HEN3) encoding cyclin-dependent kinase E plays a role in the specification of stamen and carpel identity, whereas HEN4 plays a role in delaying flowering by activating repressor genes FLC and MADS AFFECTING FLOWERING 4 (MAF4) [43]. In our study, genes related to HD1, HEN3, and HEN4 have shown downregulation, suggesting that these genes regulate the expression of flowering-related genes in KClO3-induced longan flower differently as compared to Arabidopsis.

The expression of floral integrators FT, SOC1, and LFY is absent in our results, whereas AP1 expression is downregulated. Moreover, the expression of the key regulators in floral transition, FLC, and TFL1 could not be detected in this study. The absence of FT expression in longan bud is consistent with the previous study, where FT expression was only detected in mature leaves during floral induction. We speculate that the floral induction pathway in KClO3-induced longan floral bud is primarily associated with the activation of AP2 and suppression of AG. The factors such as ARF3, BLR/PNY, LUG, SUS, and PAN regulate the expression of AP2 and AG for FM specification and determinacy, whereas genes related to LMI1, BOP1, BOP2, and UTL1 might control the expression of AP1 and AG via influencing LFY expression through a regulatory feedback loop.

In conclusion, our comparative transcriptome analysis of KClO3-induced flowering in longan revealed that the synergistic action of flowering-related genes and genes involved in plant hormone signaling, MAPK signaling cascades, and carbohydrate metabolism is required for FM determinacy in longan buds. Further studies involving specific development stages of floral buds in a temporal-spatial manner are required for future work, which might explain the exact role of these genes in flower induction in off-season longan. Our study provides a detailed insight into the molecular mechanisms underlying KClO3-induced floral induction in longan which will offer a platform to study flower development for improved production in off-season fruit trees.


tel: +86-187-8918-7088

  1. Funding information: This work was supported by the China National Litchi and Longan Research System (CARS-32).

  2. Author contributions: S.L. and Z.Y. designed the analysis workflow and experiments. S.L., L.Z., Z.S., and Z.Y. performed the experiments. S.L., H.C., J.H., X.Y., J.W., Y.C., and Z.Y. analyzed the data. Z.Y. wrote the paper. S.L. and Z.Y. revised and edited the manuscript.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Matsumoto TK. Genes uniquely expressed in vegetative and potassium chlorate induced floral buds of Dimocarpus longan. Plant Sci. 2006;170:500–10.10.1016/j.plantsci.2005.09.016Search in Google Scholar

[2] Zee F, Chan HT Jr, Yen CR. Lychee, longan, rambutan and pulasan. In: Shaw PE, Chan HT Jr, Nagy S, editors. Tropical and subtropical fruits. Auburndal, Fla: Agscience; 1998. p. 290–335.Search in Google Scholar

[3] Manochai P, Sruamsiri P, Wiriya-alongkorn W, Naphrom D, Hegele M, Bangerth F. Year around off-season flower induction in longan (Dimocarpus longan, Lour.) trees by KClO3 applications: potentials and problems. Sci Hortic. 2005;104:379–90.10.1016/j.scienta.2005.01.004Search in Google Scholar

[4] Wilkie JD, Sedgley M, Olesen T. Regulation of floral initiation in horticultural trees. J Exp Bot. 2008;59(12):3215–28.10.1093/jxb/ern188Search in Google Scholar PubMed

[5] Zhang S, Zhu C, Lyu Y, Chen Y, Zhang Z, Lai Z, et al. Genome-wide identification, molecular evolution, and expression analysis provide new insights into the APETALA2/ethylene responsive factor (AP2/ERF) superfamily in Dimocarpus longan Lour. BMC Genomics. 2020;21(1):62.10.1186/s12864-020-6469-4Search in Google Scholar PubMed PubMed Central

[6] Winterhagen P, Tiyayon P, Samach A, Hegele M, Wünsche JN. Isolation and characterization of FLOWERING LOCUS T subforms and APETALA1 of the subtropical fruit tree Dimocarpus longan. Plant Physiol Biochem. 2013;71:184–90.10.1016/j.plaphy.2013.07.013Search in Google Scholar PubMed

[7] Hegele M, Naphrom D, Manochai P, Chattrakul A, Sruamsiri P, Bangerth F. Effect of leaf age on the response of flower induction and related hormonal changes in longan trees after KClO3 treatment. Acta Hortic. 2004;653:41–9.10.17660/ActaHortic.2004.653.4Search in Google Scholar

[8] Susawaengsup C, Rayanakorn M, Wongpornchai S, Wangkarn S. Investigation of plant hormone level changes in shoot tips of longan (Dimocarpus longan Lour.) treated with potassium chlorate by liquid chromatography-electrospray ionization mass spectrometry. Talanta. 2011;85:897–905.10.1016/j.talanta.2011.04.073Search in Google Scholar PubMed

[9] Matsumoto TK, Nagao MA, Mackey B. Off-season flower induction of longan with potassium chlorate, sodium chlorite, and sodium hypochlorite. Hort Technol. 2007;17:296–300.10.21273/HORTTECH.17.3.296Search in Google Scholar

[10] Chen D, Yan W, Fu LY, Kaufmann K. Architecture of gene regulatory networks controlling flower development in Arabidopsis thaliana. Nat Commun. 2018;9:4534.10.1038/s41467-018-06772-3Search in Google Scholar PubMed PubMed Central

[11] Guo H, Zhong Q, Tian F, Zhou X, Tan X, Luo Z. Transcriptome Analysis Reveals Putative Induction of Floral Initiation by Old Leaves in Tea-Oil Tree (Camellia oleifera ‘changlin53’). Int J Mol Sci. 2022;23(21):13021.10.3390/ijms232113021Search in Google Scholar PubMed PubMed Central

[12] Milyaev A, Kofler J, Moya YAT, Lempe J, Stefanelli D, Hanke MV, et al. Profiling of phytohormones in apple fruit and buds regarding their role as potential regulators of flower bud formation. Tree Physiol. 2022;42(11):2319–35.10.1093/treephys/tpac083Search in Google Scholar PubMed PubMed Central

[13] Shah K, Wang M, Li X, Shang W, Wang S, Han M, et al. Transcriptome analysis reveals dual action of salicylic acid application in the induction of flowering in Malus domestica. Plant Sci. 2022;324:111433.10.1016/j.plantsci.2022.111433Search in Google Scholar PubMed

[14] Yang MC, Wu ZC, Chen RY, Abbas F, Hu GB, Huang XM, et al. SnRNA-seq and mRNA hybridization indicate key bud events and LcFT1 and LcTFL1-2 mRNA transportability during floral transition in litchi. J Exp Bot. 2023;74(12):3613–29.10.1093/jxb/erad103Search in Google Scholar PubMed

[15] Achard P, Baghour M, Chapple A, Hedden P, Van DSD, Genschik P, et al. The plant stress hormone ethylene controls floral transition via DELLA-dependent regulation of floral meristem-identity genes. Proc Natl Acad Sci U S A. 2007;104(15):6484–9.10.1073/pnas.0610717104Search in Google Scholar PubMed PubMed Central

[16] Ogawara T, Higashi K, Kamada H, Ezura H. Ethylene advances the transition from vegetative growth to flowering in Arabidopsis thaliana. J Plant Physiol. 2003;160(11):1335–40.10.1078/0176-1617-01129Search in Google Scholar PubMed

[17] Jue D, Sang X, Liu L, Shu B, Wang Y, Liu C, et al. Comprehensive analysis of the longan transcriptome reveals distinct regulatory programs during the floral transition. BMC Genomics. 2019;20:126.10.1186/s12864-019-5461-3Search in Google Scholar PubMed PubMed Central

[18] Xing LB, Zhang D, Li YM, Shen YW, Zhao CP, Ma JJ, et al. Transcription Profiles Reveal Sugar and Hormone Signaling Pathways Mediating Flower Induction in Apple (Malus domestica Borkh.). Plant Cell Physiol. 2015;56(10):2052–68.10.1093/pcp/pcv124Search in Google Scholar PubMed

[19] Cho LH, Yoon J, An G. The control of flowering time by environmental factors. Plant J. 2017;90(4):708–19.10.1111/tpj.13461Search in Google Scholar PubMed

[20] Yoo SD, Cho YH, Tena G, Xiong Y, Sheen J. Dual control of nuclear EIN3 by bifurcate MAPK cascades in C2H4 signalling. Nature. 2008;451(7180):789–95.10.1038/nature06543Search in Google Scholar PubMed PubMed Central

[21] Ikram M, Chen J, Xia Y, Li R, Siddique KHM, Guo P. Comprehensive transcriptome analysis reveals heat-responsive genes in flowering Chinese cabbage (Brassica campestris L. ssp. chinensis) using RNA sequencing. Front Plant Sci. 2022;13:1077920.10.3389/fpls.2022.1077920Search in Google Scholar PubMed PubMed Central

[22] Li C, Long Y, Lu M, Zhou J, Wang S, Xu Y, et al. Gene coexpression analysis reveals key pathways and hub genes related to late-acting self-incompatibility in Camellia oleifera. Front Plant Sci. 2022;13:1065872.10.3389/fpls.2022.1065872Search in Google Scholar PubMed PubMed Central

[23] Corbesier L, Lejeune P, Bernier G. The role of carbohydrates in the induction of flowering in Arabidopsis thaliana: comparison between the wild type and a starchless mutant. Planta. 1998;206(1):131–7.10.1007/s004250050383Search in Google Scholar PubMed

[24] Wahl V, Ponnu J, Schlereth A, Arrivault S, Langenecker T, Franke A, et al. Regulation of flowering by trehalose-6-phosphate signaling in Arabidopsis thaliana. Science. 2013;339(6120):704–7.10.1126/science.1230406Search in Google Scholar PubMed

[25] Tholl D, Chen F, Petri J, Gershenzon J, Pichersky E. Two sesquiterpene synthases are responsible for the complex mixture of sesquiterpenes emitted from Arabidopsis flowers. Plant J. 2005;42(5):757–71.10.1111/j.1365-313X.2005.02417.xSearch in Google Scholar PubMed

[26] Jia T, Wei D, Meng S, Allan AC, Zeng L. Identification of regulatory genes implicated in continuous flowering of longan (Dimocarpus longan L.). PLoS One. 2014;9(12):e114568.10.1371/journal.pone.0114568Search in Google Scholar PubMed PubMed Central

[27] Winterhagen P, Hegele M, Tiyayon P, Wünsche JN. Cytokinin accumulation and flowering gene expression are orchestrated for floral meristem development in longan (Dimocarpus longan Lour.) after chemical flower induction. Sci Hortic. 2020;27:109467.10.1016/j.scienta.2020.109467Search in Google Scholar

[28] Huang Z, Shi T, Zheng B, Yumul RE, Liu X, You C, et al. APETALA2 antagonizes the transcriptional activity of AGAMOUS in regulating floral stem cells in Arabidopsis thaliana. N Phytol. 2017;215(3):1197–209.10.1111/nph.14151Search in Google Scholar PubMed PubMed Central

[29] Xing S, Salinas M, Garcia-Molina A, Höhmann S, Berndtgen R, Huijser P. SPL8 and miR156-targeted SPL genes redundantly regulate Arabidopsis gynoecium differential patterning. Plant J. 2013;75:566–77.10.1111/tpj.12221Search in Google Scholar PubMed

[30] Zhou CM, Zhang TQ, Wang X, Yu S, Lian H, Tang H, et al. Molecular basis of age-dependent vernalization in Cardamine flexuosa. Science. 2013;340(6136):1097–100.10.1126/science.1234340Search in Google Scholar PubMed

[31] Zhang K, Wang R, Zi H, Li Y, Cao X, Li D, et al. AUXIN RESPONSE FACTOR3 Regulates Floral Meristem Determinacy by Repressing Cytokinin Biosynthesis and Signaling. Plant Cell. 2018;30(2):324–46.10.1105/tpc.17.00705Search in Google Scholar PubMed PubMed Central

[32] Liu X, Dinh TT, Li D, Shi B, Li Y, Cao X, et al. AUXIN RESPONSE FACTOR 3 integrates the functions of AGAMOUS and APETALA2 in floral meristem determinacy. Plant J. 2014;80(4):629–41.10.1111/tpj.12658Search in Google Scholar PubMed PubMed Central

[33] Engelhorn J, Moreau F, Fletcher JC, Carles CC. ULTRAPETALA1 and LEAFY pathways function independently in specifying identity and determinacy at the Arabidopsis floral meristem. Ann Bot. 2014;114(7):1497–505.10.1093/aob/mcu185Search in Google Scholar PubMed PubMed Central

[34] Ung N, Lal S, Smith HMS. The Role of PENNYWISE and POUND-FOOLISH in the Maintenance of the Shoot Apical Meristem in Arabidopsis. Plant Physiol. 2011;156(2):605–14.10.1104/pp.110.171462Search in Google Scholar PubMed PubMed Central

[35] Maier AT, Stehling-Sun S, Wollmann H, Demar M, Hong RL, Haubeiss S, et al. Dual roles of the bZIP transcription factor PERIANTHIA in the control of floral architecture and homeotic gene expression. Development. 2009;136:1613–20.10.1242/dev.033647Search in Google Scholar PubMed PubMed Central

[36] Parcy F, Nilsson O, Busch MA, Lee I, Weigel D. A genetic framework for floral patterning. Nature. 1998;395:561–6.10.1038/26903Search in Google Scholar PubMed

[37] Grandi V, Gregis V, Kater MM. Uncovering genetic and molecular interactions among floral meristem identity genes in Arabidopsis thaliana. Plant J. 2012;69(5):881–93.10.1111/j.1365-313X.2011.04840.xSearch in Google Scholar PubMed

[38] Conner J, Liu Z. LEUNIG, a putative transcriptional corepressor that regulates AGAMOUS expression during flower development. Proc Natl Acad Sci U S A. 2000;97:12902–7.10.1073/pnas.230352397Search in Google Scholar PubMed PubMed Central

[39] Hepworth SR, Zhang Y, McKim S, Li X, Haughn GW. BLADE-ON-PETIOLE-dependent signaling controls leaf and floral patterning in Arabidopsis. Plant Cell. 2005;17(5):1434–48.10.1105/tpc.104.030536Search in Google Scholar PubMed PubMed Central

[40] Xu M, Hu T, McKim SM, Murmu J, Haughn GW, Hepworth SR. Arabidopsis BLADE-ON-PETIOLE1 and 2 promote floral meristem fate and determinacy in a previously undefined pathway targeting APETALA1 and AGAMOUS-LIKE24. Plant J. 2010;63(6):974–89.10.1111/j.1365-313X.2010.04299.xSearch in Google Scholar PubMed

[41] Lampugnani ER, Kilinc A, Smyth DR. PETAL LOSS is a boundary gene that inhibits growth between developing sepals in Arabidopsis thaliana. Plant J. 2012;71(5):724–35.10.1111/j.1365-313X.2012.05023.xSearch in Google Scholar PubMed

[42] Tian L, Chen ZJ. Blocking histone deacetylation in Arabidopsis induces pleiotropic effects on plant gene regulation and development. Proc Natl Acad Sci U S A. 2001;98(1):200–5.10.1073/pnas.98.1.200Search in Google Scholar PubMed PubMed Central

[43] Ortuño-Miquel S, Rodríguez-Cazorla E, Zavala-Gonzalez EA, Martínez-Laborda A, Vera A. Arabidopsis HUA ENHANCER 4 delays flowering by upregulating the MADS-box repressor genes FLC and MAF4. Sci Rep. 2019;9:1478.10.1038/s41598-018-38327-3Search in Google Scholar PubMed PubMed Central

Received: 2021-10-13
Revised: 2023-03-25
Accepted: 2023-04-08
Published Online: 2023-07-29

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
  3. Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
  4. Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
  5. Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
  6. A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
  7. Neutrophilia with subclinical Cushing’s disease: A case report and literature review
  8. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
  9. Immunoregulation of synovial macrophages for the treatment of osteoarthritis
  10. Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
  11. Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
  12. Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
  13. High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
  14. Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
  15. Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
  16. Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
  17. Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
  18. Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
  19. Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
  20. Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
  21. Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
  22. Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
  23. Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
  24. Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
  25. 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
  26. Experimental study on the optimization of ANM33 release in foam cells
  27. Primary retroperitoneal angiosarcoma: A case report
  28. Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
  29. Malignant pleural effusion diagnosis and therapy
  30. Effect of spaceflight on the phenotype and proteome of Escherichia coli
  31. Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
  32. Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
  33. Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
  34. The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
  35. Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
  36. mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
  37. The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
  38. Radiotherapy for primary thyroid adenoid cystic carcinoma
  39. Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
  40. Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
  41. Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
  42. Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
  43. PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
  44. The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
  45. Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
  46. Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
  47. NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
  48. Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
  49. Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
  50. Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
  51. Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
  52. Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
  53. Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
  54. Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
  55. Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
  56. Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
  57. Gemella morbillorum infective endocarditis: A case report and literature review
  58. An unusual ectopic thymoma clonal evolution analysis: A case report
  59. Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
  60. Detection of V. vulnificus septic shock with ARDS using mNGS
  61. Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
  62. The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
  63. Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
  64. ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
  65. Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
  66. Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
  67. Collagen changes in rabbit conjunctiva after conjunctival crosslinking
  68. Effects of NM23 transfection of human gastric carcinoma cells in mice
  69. Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
  70. Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
  71. Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
  72. Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
  73. Giant duplication of the transverse colon in an adult: A case report and literature review
  74. Ectopic thyroid tissue in the breast: A case report
  75. SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
  76. Vaginal metastasis from breast cancer: A case report
  77. Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
  78. Inhibition of TAZ impairs the migration ability of melanoma cells
  79. Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
  80. Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
  81. Identification of winter wheat pests and diseases based on improved convolutional neural network
  82. Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
  83. Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
  84. Immune checkpoint inhibitors in cancer patients with COVID-19
  85. Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
  86. Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
  87. Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
  88. DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
  89. Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
  90. Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
  91. Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
  92. Studying infant mortality: A demographic analysis based on data mining models
  93. Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
  94. Protein Z modulates the metastasis of lung adenocarcinoma cells
  95. Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
  96. TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
  97. Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
  98. Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
  99. Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
  100. Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
  101. Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
  102. HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
  103. Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
  104. Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
  105. Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
  106. Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
  107. Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
  108. Research progress on gas signal molecular therapy for Parkinson’s disease
  109. Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
  110. The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
  111. α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
  112. CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
  113. Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
  114. Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
  115. Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
  116. Research progress of AMP-activated protein kinase and cardiac aging
  117. TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
  118. Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
  119. Metastasis from small cell lung cancer to ovary: A case report
  120. The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
  121. The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
  122. Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
  123. Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
  124. Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
  125. Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
  126. Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
  127. Traumatic brain injury and rTMS-ERPs: Case report and literature review
  128. Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
  129. Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
  130. The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
  131. Inflammation-related signaling pathways in tendinopathy
  132. CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
  133. Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
  134. Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
  135. Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
  136. Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
  137. Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
  138. Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
  139. TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
  140. Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
  141. Ferroptosis: A potential target of macrophages in plaque vulnerability
  142. Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
  143. Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
  144. HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
  145. IL-17 in osteoarthritis: A narrative review
  146. Circadian cycle and neuroinflammation
  147. Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
  148. Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
  149. SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
  150. Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
  151. PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
  152. Pancreatic ectopic thyroid tissue: A case report and analysis of literature
  153. The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
  154. Report on a case of liver-originating malignant melanoma of unknown primary
  155. Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
  156. The fibroblast growth factor–Klotho axis at molecular level
  157. Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
  158. A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
  159. Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
  160. Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
  161. Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
  162. Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
  163. Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
  164. Case report of atypical undernutrition of hypoproteinemia type
  165. Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
  166. Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
  167. Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
  168. Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
  169. Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
  170. Precisional detection of lymph node metastasis using tFCM in colorectal cancer
  171. Advances in diagnosis and treatment of perimenopausal syndrome
  172. A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
  173. Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
  174. Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
  175. Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
  176. Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
  177. Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
  178. Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
  179. An online diagnosis method for cancer lesions based on intelligent imaging analysis
  180. Medical imaging in rheumatoid arthritis: A review on deep learning approach
  181. Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
  182. Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
  183. A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
  184. TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
  185. Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
  186. Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
  187. Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
  188. Hepatobiliary surgery based on intelligent image segmentation technology
  189. Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
  190. Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
  191. Early diagnosis for the onset of peri-implantitis based on artificial neural network
  192. Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
  193. Forecast of pain degree of lumbar disc herniation based on back propagation neural network
  194. SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
  195. Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
  196. Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
  197. A novel approach for minimising anti-aliasing effects in EEG data acquisition
  198. ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
  199. Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
  200. Lung nodule segmentation via semi-residual multi-resolution neural networks
  201. Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
  202. A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
  203. Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
  204. Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
  205. Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
  206. Monitoring and evaluation of anesthesia depth status data based on neuroscience
  207. Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
  208. Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
  209. Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
  210. Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
  211. Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
  212. From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
  213. Ecology and Environmental Science
  214. Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
  215. Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
  216. Effects of cadmium stress on fruits germination and growth of two herbage species
  217. Bamboo charcoal affects soil properties and bacterial community in tea plantations
  218. Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
  219. Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
  220. Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
  221. Food Science
  222. Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
  223. Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
  224. Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
  225. Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
  226. Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
  227. Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
  228. Microbiological transglutaminase: Biotechnological application in the food industry
  229. Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
  230. Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
  231. The potential for the use of leghemoglobin and plant ferritin as sources of iron
  232. Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
  233. Bioengineering and Biotechnology
  234. Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
  235. Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
  236. Agriculture
  237. Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
  238. On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
  239. Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
  240. A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
  241. Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
  242. Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
  243. Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
  244. Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
  245. Animal Sciences
  246. Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
  247. Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
  248. Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
  249. Tracking behavioral changes of confined sows from the first mating to the third parity
  250. The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
  251. Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
  252. Plant Sciences
  253. Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
  254. Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
  255. Tissue culture and rapid propagation technology for Gentiana rhodantha
  256. Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
  257. Cloning and expression analysis of VrNAC13 gene in mung bean
  258. Chlorate-induced molecular floral transition revealed by transcriptomes
  259. Effects of warming and drought on growth and development of soybean in Hailun region
  260. Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
  261. Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
  262. Distinguish Dianthus species or varieties based on chloroplast genomes
  263. Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
  264. Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
  265. An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
  266. Erratum
  267. Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
  268. Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
  269. Retraction
  270. Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
Downloaded on 6.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0612/html
Scroll to top button