Home Life Sciences α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
Article Open Access

α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer

  • Xiang Mao , Jun Wang and Fen Luo EMAIL logo
Published/Copyright: August 10, 2023

Abstract

This study aimed to investigate whether α-fetoprotein (AFP) could affect the malignant behavior of AFP-producing gastric cancer (AFP-GC) and to explore the relationship between AFP and mesenchymal–epithelial transition factor (c-Met) in AFP-GC. In this study, 23 patients with AFP-GC (AFP[+]) and 18 patients with common gastric cancer (AFP[−]) were evaluated for the c-Met expression using immunohistochemical analysis. The AFP-GC cell line, GCIY, was used. The AFP endoribonuclease-prepared small interfering RNA (siRNA) and eukaryotic AFP overexpression vector were used to increase/knockdown the expression of AFP. Afterward, the c-Met expression was evaluated by polymerase chain reaction and western blot. The proliferation, migration, and invasion of GCIY cells were estimated before and after the AFP overexpression/knockdown. The c-Met expression in both groups was the same (p > 0.05), and AFP[+] group had a higher positive incidence of the c-Met expression than the AFP[−] group (p < 0.01). Furthermore, the c-Met expression frequency was decreased by AFP knockdown and increased by AFP overexpression (p < 0.01). The cell counting kit-8 cell proliferation assay, cell invasion, and migration assays confirmed that the AFP could affect the malignant biological behavior of AFP-GC. These findings suggest that AFP contributes to the malignant biological properties of AFP-GC and the high expression of c-Met in AFP-GC.

1 Introduction

α-Fetoprotein (AFP) was identified in 1956 for the first time in a human fetus. AFP was synthesized in the fetus’s liver by the sixth week of conception [1,2]. AFP-producing gastric cancer (AFP-GC) is a distinct histological type of gastric adenocarcinoma, characterized mainly by positive immunoreactivity to AFP and hepatoid differentiation [3,4,5,6,7]. AFP-GC has been categorized as a unique subtype of gastric cancer (GC) [8]. Plenty of attention for further studies has been gained in the last two decades due to the lack of adequate studies on AFP-GC’s clinicopathologic features and prognosis [9]. AFP-GC is a highly malignant type and metastatic compared to the typical GC. However, the association mechanism between excessive malignancy and AFP production is not yet well-defined [10].

Generally, AFP-positive GC had more aggressive behavior than the AFP-negative GC [9]. Even though serum AFP levels are increased in patients with AFP-GC, its incidence may be recurrent without re-elevation of the level of serum AFP [11]. Chang et al. revealed that AFP-producing early GC has the same propensity for liver metastasis as the AFP-producing advanced GC [12]. AFP-GC is associated with high lymphatic metastasis, venous invasion of the gastric wall, and liver metastasis. Recently, AFP-GC was also reported with nonbiliary pancreatitis [13]. The survival rate for patients with AFP-GC is significantly poorer than for patients with other types of GC [3]. AFP-GC has a high degree of malignancy and metastasis frequency [14]. The genetic features of the disease and the essential genes associated with AFP-GC development have not been definitively identified [15]. In addition, AFP-GC has a poor prognosis, but the molecular mechanisms that cause the poor prognosis have not yet been revealed.

Hepatocyte growth factor (HGF) is a pleiotropic cytokine composed of an α-chain and a β-chain [16]. HGF and its receptor c-Met are involved in cancer cells’ progression to malignant invasive phenotypes and the development of distant metastases [17]. According to a study, AFP-GC is associated with a higher expression of c-Met than AFP-negative GC [18]. We designed this study to compare the expression of c-Met in AFP-GC and typical GC. In addition, to explore whether AFP can affect the c-Met expression and malignity in AFP-GC.

2 Materials and methods

2.1 Study population

A total of 248 patients with GC were admitted for surgery at the Department of General Surgery, Huashan Hospital, Fudan University, China. A total of 28 patients had elevated preoperative serum AFP levels (AFP > 10 ng/mL). AFP was detected in GC cells by immunohistochemical staining in 23 of these 28 patients composed of the AFP-GC group (AFP[+]). Other 23 patients with GC and normal serum AFP levels were selected at random for comparison, and samples of the correspondent GC were tested for AFP immunoreactivity after surgical removal. AFP-negative was confirmed in 18 of these patients, composed of the AFP-negative GC group (AFP[−]). The essential characteristics of these AFP[+] and AFP[−] patients are shown in Table 1. GC specimens from both groups were subjected to c-Met staining. All patients were staged according to the tumor, node, and metastasis (TNM) staging of GC, AJCC, 7th edition, 2010 (Table 2).

Table 1

Basic characteristics of patients

Gender Age Disease condition
AFP [+]
1 F 56 Ulcerative poorly differentiated adenocarcinoma, some of which are signet ring cell carcinoma T4aN1M0
2 F 77 Ulcerative adenocarcinoma T4aN2M0
3 M 67 Invasive adenocarcinoma, a small amount of mucinous adenocarcinoma T4aN2M0
4 M 45 Gastric infiltrating poorly differentiated adenocarcinoma T3N3bM1
5 F 59 Invasive poorly differentiated adenocarcinoma, some of which are signet ring cell carcinoma T4aN3aM0
6 F 72 Ulcerative adenocarcinoma T4bN3aM0
7 M 60 Ulcerative adenocarcinoma T4aN0M0
8 M 54 Ulcerative adenocarcinoma T4aN1M0
9 M 50 Ulcerative adenocarcinoma T3N1M0
10 M 80 Ulcerative adenocarcinoma T4aN0M0
11 M 71 Ulcerative adenocarcinoma T4aN2M0
12 F 75 Ulcerative adenocarcinoma T2N1M0
13 M 64 Ulcerative adenocarcinoma T4bN2M0
14 M 54 Ulcerative adenocarcinoma T4aN1M0
15 M 60 Ulcerative adenocarcinoma T4aN3bM0
16 M 73 Ulcerative adenocarcinoma T4aN3aM1
17 M 59 Ulcer and elevated adenocarcinoma T4bN3bM0
18 M 62 Superficial ulcerative adenocarcinoma T1bN3aM0
19 M 38 Mushroom adenocarcinoma T4aN0M0
20 M 61 Ulcerative adenocarcinoma T4aN1M0
21 M 60 Ulcerative adenocarcinoma T4aN1M0
22 M 65 Hepatoid adenocarcinoma, partly mucinous adenocarcinoma T4bN0M0
23 M 75 Ulcerative adenocarcinoma, partly differentiated towards neuroendocrine T4aN3aM0
AFP [−]
1 M 62 Ulcerative adenocarcinoma T4aN3aM0
2 M 75 Ulcerative adenocarcinoma T4bN3aM0
3 M 49 Mucinous adenocarcinoma T4aN0M0
4 F 58 Ulcerative adenocarcinoma T3N1M0
5 M 55 Ulcerative adenocarcinoma, partly mucinous adenocarcinoma T4aN0M0
6 M 69 Ulcerative poorly differentiated adenocarcinoma T4bN3bM0
7 M 72 Ulcerative adenocarcinoma T1bN3aM0
8 F 73 Ulcerative adenocarcinoma T4aN0M0
9 M 63 Ulcerative adenocarcinoma T4aN1M0
10 M 67 Ulcerative poorly differentiated adenocarcinoma T4bN0M0
11 F 54 Ulcerative adenocarcinoma T4aN3aM0
12 F 74 Mucinous adenocarcinoma, partial seal ring T4aN1M0
13 M 59 Ulcerative adenocarcinoma T4aN2M0
14 M 62 Ulcerative adenocarcinoma T4aN2M0
15 M 75 Ulcerative adenocarcinoma T3N3bM1
16 F 77 Ulcerative adenocarcinoma T4aN3aM0
17 M 47 Ulcerative adenocarcinoma T4bN3aM0
18 F 80 Ulcerative adenocarcinoma T4aN1M0
Table 2

Comparison of the c-Met expression in gastric carcinomas of the AFP(+) and AFP(−) groups

AFP (+) N = 23 AFP (−) N = 18 p value
Stage + ++ + ++
I 0 0 0 1 1 0
II 0 2 4 1 4 1
III 4 4 7 2 7 1
IV 0 1 1 0 0 0
4 7 12 4 12 2 <0.01

All patients were staged according to TNM staging of GC, AJCC, 7th edition, 2010. Significance according to the χ 2 test.

  1. Informed consent: Informed consent has been obtained from all individuals included in this study.

  2. Ethical approval: The research related to human use has been complied with all the relevant national regulations, institutional policies, and in accordance with the tenets of the Helsinki Declaration, and has been approved by the Medical Ethics Committee of Huashan Hospital, Fudan University (ethical number: #2018-280).

2.2 Inclusion and exclusion criteria

Subject inclusion criteria were as follows: (i) age from 18 to 80 years; (ii) the preoperative clinical diagnosis was a malignant gastric tumor, (iii) the tumor could be resected locally by preoperative assessment, (iv) the postoperative pathological specimen was more than 1 cm × 1 cm, (v) the patient chooses to undergo surgery first, and (vi) AFP-positive blood test and immunohistochemical staining of pathological specimens were included in the AFP[+] group; otherwise, they were included in the AFP[−] group.

Subject exclusion criteria were as follows: (i) postoperative pathological non-adenocarcinoma, (ii) the patient was suffering from other malignant tumors at the same time, (iii) pregnant patients, and (iv) patients already participated in other research.

2.3 Immunohistochemical staining and analysis

Immunohistochemical staining was performed using the streptavidin–biotin–peroxidase method [19]. Briefly, the sections were deparaffinized and rehydrated, followed by 3% hydrogen peroxide incubation and non-specific antibody-binding site blocking. Then, the sections were incubated overnight at 20–25°C with a 1:50 dilution of the primary antibodies – AFP and Met (diluted 1:1,000; Cell Signaling Technology, MA, USA). The anti-AFP antibody was a rabbit monoclonal antibody to human AFP (Invitrogen, No. 37-0100, D12C1, Rabbit mAb). The anti-Met antibody was a rabbit monoclonal antibody to human Met (Invitrogen, No. 14-6499-82, D1C2, XP®, Rabbit mAb). The following day, the sections were washed in phosphate buffered saline (PBS) and incubated at 20–25°C with biotinylated secondary antibodies. The sections were incubated with diaminobenzidine to visualize the antigens and afterward counterstained with hematoxylin, dehydrated, and mounted. Negative control sections were treated with PBS instead of the primary antibodies, and AFP- and Met-positive liver cancer sections were used as a positive control. All sections were classified according to the grade of immunostaining in the carcinoma cells: negative (−), no carcinoma cells were stained; moderate positive (+), less than two-thirds of the cells were stained; and strong positive (++), more than two-thirds of the cells were stained (Figure A1(b)).

2.4 Cell culture and grouping

The AFP-GC cell line GCIY purchased from RIKEN BioResource Center, Japan, was cultured in a minimum essential medium containing 15% fetal bovine serum (FBS) at 37°C in a 5% CO2 atmosphere. Cells after transfection were cultured in Dulbecco’s modified Eagle’s medium (DMEM) with 10% FBS.

Cells were divided into the following groups: blank control group, GV230 group (vector GV230 with no AFP gene was transfected into the cells), GV230-AFP group (vector GV230-AFP was transfected into the cells), Met esiRNA group (Met esiRNA was transfected into the cells), GV230-AFP + Met esiRNA group (both GV230-AFP and Met esiRNA were transfected into the cells), NC esiRNA group (negative control esiRNA was transfected into the cells), and AFP esiRNA group (AFP esiRNA was transfected into the cells).

2.5 Cell transfection

AFP and Met endoribonuclease-prepared siRNA (esiRNA) were purchased from Sigma-Aldrich (Missouri, USA). esiRNA is a complex mixture of siRNA-like molecules prepared by enzymatic digestion of a long dsRNA molecule transcribed by an RNase III in vitro [20]. Lipofectamine® RNAiMAX (Invitrogen) was used as a transfection reagent. About 50 ng of each kind of esiRNA in 5 μL TE buffer was diluted with 0.05 μL Lipofectamine® RNAiMAX in 5 μL Opti-MEM (Gibco, USA) in a 24-well tissue culture plate. This reaction was then incubated for 20 min at room temperature. Wells containing the transfection reagent only were also prepared as the control group. As for AFP overexpression (GV230-AFP), the vector CMV-MCS-EGFP-SV40-Neomycin shown in Figure A1(a) was purchased from GeneChem (Shanghai, China) with the insertion sites XhoI/KpnI. The polymerase chain reaction (PCR) products of AFP were identified by gene sequencing and confirmed for uniformity with the human AFP gene sequence. For transfection, 0.8 μg GV230-AFP in 100 μL DMEM was diluted with 0.4 μL Lipofectamine® 2000 in 100 μL DMEM in a 24-well tissue culture plate and then incubated for 20 min at room temperature. For esiRNA and GV230-AFP co-transfection, Lipofectamine® 3000 (Invitrogen) was used as the transfection reagent to achieve better transfection efficacy.

2.6 Cell counting kit-8 (CCK-8) cell proliferation assay

Cells were plated in a 96-well plate at a density of 0.5 × 104 cells/well and cultured overnight. Cells were transfected with the indicated overexpression vector and/or esiRNA and incubated for 24, 48, and 72 h, respectively. The CCK-8 (Beyotime, Hangzhou, China) was performed to determine the cell viability after transfection. CCK-8 reagent of 10 μL was added to each well at 1 h before the endpoint of incubation. Absorbance at 450 nm was measured using an automatic microplate reader (RNE90002, Reagen Biology LLC, USA).

2.7 Cell invasion and migration assay

For cell migration assay, 1 × 105 cells in 100 µL of serum-free medium were added in the upper Transwell chamber (8.0-µm pore size; Corning, NY, CA, USA). For the invasion assay, the upper chamber was coated with Matrigel (1:10; BD Biosciences, MA, USA). Medium containing 10% FBS was added to the lower chambers. After migrating or invading for 48 h, the cells at the lower surface were fixed with methanol and stained with 0.1% crystal violet. Cells were counted, and images were acquired using an Olympus BX43 Motorized Microscope at a magnification of 100×. The experiments were repeated three times.

2.8 Total RNA extraction and qRT-PCR

Total RNAs of cells from blank control, GV230, GV230-AFP group, NC esiRNA, and AFP esiRNA group were isolated using TRIzol® reagent according to the standard RNA isolation protocol. According to the manufacturer’s protocol, cDNA synthesis was performed with SuperScript™ III Reverse Transcriptase (Invitrogen). The primers used were as follows. AFP: forward 5′–GCAGAGGAGATGTGCTGGATTG–3′, reverse 5′–CGTGGTCAGTTTGCAGCATTCTG–3′; Met: forward 5′–TGCACAGTTGGTCCTGCCATGA–3′, reverse 5–CAGCCATAGGACCGTATTTCGG–3. GAPDH: forward 5′ GGTGAAGGTCGGAGTCAACG–3′; reverse 5′ CAAAGTTGTCATGGATGHACC–3′ and β-actin: forward 5′ CACCATTGGCAATGAGCGGTTC–3′; reverse 5′ AGGTCTTTGCGGATGTCCACGT–3′. GAPDH and β-actin were used as internal references. The relative quantification of messenger RNA (mRNA) expression was calculated using the 2−∆∆Ct method.

2.9 Western blotting

Cells from the blank control group, GV230 group, and GV230-AFP group were harvested and lysed with RIPA buffer (Beyotime, Shanghai, China, No. P0013B). Protein concentrations were measured using a BCA protein quantification kit (Sigma-Aldrich, No. 71285-3). Protein samples of 50 µg were separated on 10% SDS gel and transferred to a polyvinylidene fluoride membrane, followed by 1 h of blocking with 5% skim milk. The membrane was then incubated with primary antibody of c-Met (Invitrogen, No. 37-0100), AFP (Invitrogen, No. 14-6499-82), and GAPDH (Invitrogen, No. 39-8600) overnight at 4°C, followed by three washes with Tris-buffered saline containing 0.1% Tween-20 (TBST). The membrane was then incubated with a horseradish peroxidase-conjugated secondary antibody HRP-labeled Goat Anti-Mouse IgG (H + L) (1:1,000, Beyotime, Shanghai, China; Cat. No. A0216) for 1 h at room temperature. After three washes with TBST, each single protein band of western blot was visualized using an enhanced chemiluminescence reagent and analyzed using ImageJ.

2.10 Statistical analysis

Data are presented as a mean ± standard deviation (SD), and the significance level was calculated according to the χ2 test. p < 0.5 was considered statistically significant.

3 Results

3.1 c-Met-positive expression in the AFP groups

As shown in Figure 1, the immunohistochemical analysis in our study revealed that the overall incidence of c-Met-positive expression in the AFP[+] group was 19/23 (82.5%), in which strong positive incidence was 12/23 (52.2%). At the same time, the overall incidence of c-Met-positive expression in the AFP[−] group was 14/18 (77.7%), but the strong positive incidence was relatively low, which was 2/18 (11.1%) (p < 0.01). However, the differences in the overall incidence of the c-Met expression between the two groups were not statistically significant (p > 0.05).

Figure 1 
                  C-Met expression in gastric carcinomas in the AFP(+) and AFP(−) groups. All patients were staged according to TNM staging of GC, AJCC, 7th edition, 2010.
Figure 1

C-Met expression in gastric carcinomas in the AFP(+) and AFP(−) groups. All patients were staged according to TNM staging of GC, AJCC, 7th edition, 2010.

3.2 Met played an essential role in AFP-induced proliferation in AFP-GC

To elucidate the phenotype effect of AFP and c-Met in AFP-GC, we first established AFP overexpression and Met knockdown cell lines. The transfection efficacy is shown in Figure 2a. Moreover, corresponding to the result of Figure 1, the cell numbers after transfection for 48 and 72 h increased significantly in the AFP overexpression group, which showed a significant decline in the Met knockdown group. Interestingly, the AFP overexpression/Met knockdown group’s cell numbers showed no significant difference from the blank control group. These results indicate that while AFP could affect the proliferation of AFP-GC, Met may be a critical factor (Figure 2b).

Figure 2 
                  CCK-8 cell proliferation assay results. a: The efficacy of AFP overexpression and Met knockdown. b: Comparison between a blank control group and the AFP overexpression/Met knockdown group cell numbers. b: (A) Blank control group, (B) GV230 group, (C) GV230-AFP group, (D) Met esiRNA group, and (E) GV230-AFP + Met esiRNA group.
Figure 2

CCK-8 cell proliferation assay results. a: The efficacy of AFP overexpression and Met knockdown. b: Comparison between a blank control group and the AFP overexpression/Met knockdown group cell numbers. b: (A) Blank control group, (B) GV230 group, (C) GV230-AFP group, (D) Met esiRNA group, and (E) GV230-AFP + Met esiRNA group.

3.3 Effect of AFP and Met on the invasion and migration of AFP-GC

Furthermore, Figures 3 and 4 show that the AFP overexpression enhanced the invasion and migration of GCIY cells, while Met knockdown showed the opposite effects. Simultaneously, the AFP overexpression/Met knockdown group showed no significant difference from the blank control group. These results further confirmed that while AFP could also affect the invasion and migration, Met may play an essential role in AFP-GC progressions.

Figure 3 
                  Cell migration assay results. a: (A) Blank control group, (B) GV230 group, (C) GV230-AFP group, (D) Met siRNA group, and (E) GV230-AFP + Met siRNA group. b: Migration cell number.
Figure 3

Cell migration assay results. a: (A) Blank control group, (B) GV230 group, (C) GV230-AFP group, (D) Met siRNA group, and (E) GV230-AFP + Met siRNA group. b: Migration cell number.

Figure 4 
                  Cell invasion assay results. a: (A) Blank control group, (B) GV230 group, (C) GV230-AFP group, (D) Met esiRNA group, and (E) GV230-AFP + Met esiRNA group. b: Invasion cell number.
Figure 4

Cell invasion assay results. a: (A) Blank control group, (B) GV230 group, (C) GV230-AFP group, (D) Met esiRNA group, and (E) GV230-AFP + Met esiRNA group. b: Invasion cell number.

3.4 AFP positively correlated with the c-Met expression

To explore the potential relationship between AFP and c-Met expression in AFP-GC, both qRT-PCR and western blot analysis were used to detect either AFP or c-Met expression levels in the AFP overexpression/knockdown GCIY cell lines. Figure 5a demonstrates that AFP esiRNA achieved a knockdown efficiency of approximately 80% and 40% in the c-Met expression at the mRNA level, showing the positive correlation between AFP and Met in GCIY cells. Correspondingly, western blot results showed that the AFP overexpression led to the upregulation of Met at protein levels in human GC cells (Figure 5b).

Figure 5 
                  The relationship between AFP and Met. a: Knockdown of AFP reduces the c-Met expression, while the AFP overexpression in GCIY human GC cells elevates the c-Met expression. The AFP-siRNA reduces the expression of c-Met. The c-Met expression is significantly increased when AFP is overexpressed. b: Western blot showing overexpression of AFP in GCIY cells markedly induced the expression of c-Met in comparison with cells transfected with an empty GV230 vector.
Figure 5

The relationship between AFP and Met. a: Knockdown of AFP reduces the c-Met expression, while the AFP overexpression in GCIY human GC cells elevates the c-Met expression. The AFP-siRNA reduces the expression of c-Met. The c-Met expression is significantly increased when AFP is overexpressed. b: Western blot showing overexpression of AFP in GCIY cells markedly induced the expression of c-Met in comparison with cells transfected with an empty GV230 vector.

4 Discussion

AFP-GC is a distinct type of GC, in which AFP can be tested in patients’ serum and/or cancer cells. A higher positive incidence of the c-Met expression was found in our study’s AFP[+] group. The frequency of the c-Met expression was increased by overexpression, whereas it was decreased by knockdown of AFP. In addition, our study also revealed that the AFP could affect the malignant biological properties of AFP-GC.

AFP-GC was first reported by Bourreille et al. in 1973. However, AFP-GC with hepatoid differentiation was described for the first time by Ooi et al. in 1985 and named “hepatoid gastric cancer (hepatoid GC)” [7]. This hepatoid GC and AFP-GC exhibit a high frequency of vascular invasion, lymph node and liver metastasis, and poor prognosis. A recent study found that liver metastasis in patients with hepatoid GC is 75.6%, and 1-, 3-, and 5-year survival rates are 30, 13, and 9%, respectively. The study also revealed that the liver metastasis rate of AFP-GC patients without hepatoid differentiation is 49.2%, and 1-, 3-, and 5-year survival rates are 64, 47, and 41%, respectively. Furthermore, the rate of liver metastasis in patients with typical GC is 11.5%, and 1-, 3-, and 5-year survival rates are 95, 57, and 38%, respectively [21]. Therefore, AFP-GC is associated with a higher incidence of liver metastasis and a lower survival rate than typical GC, even without hepatoid differentiation.

Correspondingly, the high frequency of liver metastasis in AFP-GC may be linked with overexpression of c-Met, a receptor of HGF and encoded by the c-Met proto-oncogene. Gardner et al., in their study, have shown that the expression of c-Met can enhance the ability of metastatic liver melanomas [22]. Subsequently, Krause et al. proved that the c-Met pathway is related to liver metastasis of colon cancer. They found that a higher frequency of the c-Met expression leads to a higher recurrence rate after resectioning of metastatic liver cancer [23]. Lee et al. also indicated that the c-Met expression in metastatic liver GC is much higher than in the primary cancer [24]. Another study reported a higher c-Met expression level in AFP-GC than in GCs that do not express AFP [18]. The overall positive incidence of c-Met in common GCs ranges from 18% to 71.1%. In addition, gene amplification of c-Met is correlated with cancer stages, and overexpression of c-Met is noticed in GCs with deeper invasion and distant metastasis [25].

Nevertheless, the mechanism linking the c-Met expression and AFP remains uncertain. Our research revealed that there is no significant difference between the incidence of the c-Met expression in AFP-positive and AFP-negative GC. However, the strong positive incidence of the c-Met expression was much higher in AFP-positive GC than in AFP-negative GC, reinforcing the previous studies.

While the Met pathway plays a critical role in cancer cells’ invasion and metastasis abilities, the Met proto-oncogene encodes a transmembrane receptor–protein tyrosine kinase. Overexpression of this transmembrane receptor is associated with poor prognosis in various cancers [22]. On the other hand, knockdown and overexpression of AFP can cause a change in the Met expression, which implies that AFP can affect the expression of c-Met through an unknown pathway. Apart from this, AFP may directly play a role in c-Met as a transcription factor or regulate the expression via other transcription factors. However, all these assumptions need further exploration. Therefore, an in-depth understanding of how AFP regulates Met may be essential for developing therapeutics to treat AFP-GC.

Furthermore, the results of this study may indicate that AFP regulates the expression of c-Met, and the effect might be direct. It would require the translocation of AFP to the nucleus or indirectly through the action of AFP on one or more transcription factors that regulate c-Met directly. However, more studies are needed for further exploration of these assumptions. For instance, recent reports have demonstrated that AFP may function as a regulator of the phosphatidylinositol 3-kinase/Akt pathway hepatocellular carcinoma cells in humans [26,27]. They found that transfection of AFP-cDNA into hepatoma HLE cells (originally AFP-negative) led to a significant activation of the Akt signaling pathway [26]. Another study found that transcription factor protein 1 (Sp1) and mothers against decapentaplegic homolog 3 (Smad3) mediate the c-Met expression in renal epithelial cells [28]. Moreover, an increased expression of c-Met is associated with the upregulation of hypoxia-inducible factor-1 (HIF-1) in tumor cells, especially in papillary carcinoma of the thyroid [29]. Despite this, multiple studies reported the regulation of Sp1 and HIF-1 expression and Smad3 phosphorylation by the Akt signaling pathway [30,31,32].

Taken together, a better understanding of the biological activities of AFP as a growth regulatory cell-signaling factor has emerged [13]. This study revealed that AFP could affect the malignant behavior properties of AFP-GC. However, according to a recent study, there are several controversies regarding the clinicopathologic and prognostic features of the AFP-GC [15]. Another recent study suggested that a significant decline in the serum AFP level was found to be associated with good treatment response and prognosis of AFP-GC. Moreover, TNM staging classification stage, liver metastasis, and curable surgery were also noticed to be associated with prognosis in their observational study [33]. Therefore, this provides new insight for further studies considering AFP affects the malignant behavior’s properties in AFP-GC and thereby with a possible decline in the serum AFP level. These demonstrate that future research on this topic will benefit from finding the potential therapeutic targets/adjunct therapy due to the relevance of AFP for patients with AFP-GC.

This study also has several limitations. (i) This study does not provide the detailed mechanisms by which AFP affects the c-Met expression. At this stage, some hypotheses can only be made and require further exploration through studies. (ii) Some of the SDs of this study seem high. (iii) Furthermore, some figures do not show all data points and proper error bars. However, additional experiments/results could not be provided due to the ongoing pandemic situation in China and will consider in future studies.

In conclusion, based on these studies, we suggest that AFP might regulate the expression of c-Met through the activation of the Akt pathway. We plan to investigate this hypothesis in the future.


# These authors contributed equally to this work.

tel: +86-13918980488

  1. Funding information: The study was supported by the Science and Technology Commission of Shanghai Municipality (#13ZR1405100).

  2. Author contributions: Xiang Mao contributed to the design, acquisition of data, analysis of data, interpretation of data, and manuscript drafting. Jun Wang contributed to data acquisition, analysis of data, and interpretation of data. Fen Luo contributed to the conception and design and critically revised the manuscript. All authors have read and approved the final manuscript.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

Appendix

Figure A1 
                  GV230 component sequence, AFP, and Met staining. (a) The component sequence of GV230. (b) AFP-positive staining (40×). Met-positive staining (40×).
Figure A1

GV230 component sequence, AFP, and Met staining. (a) The component sequence of GV230. (b) AFP-positive staining (40×). Met-positive staining (40×).

References

[1] Bergstrand CG, Czar B. Demonstration of a new protein fraction in serum from the human fetus. Scand J Clin Lab Invest. 1956;8(2):174.10.3109/00365515609049266Search in Google Scholar PubMed

[2] Gitlin D, Boesman M. Serum alpha-fetoprotein, albumin, and gamma-G-globulin in the human conceptus. J Clin Invest. 1966;45(11):1826–38.10.1172/JCI105486Search in Google Scholar PubMed PubMed Central

[3] Bourreille J, Metayer P, Sauger F, Matray F, Fondimare A. Existence of alpha feto protein during gastric-origin secondary cancer of the liver. Presse Med. 1970;78(28):1277–8.Search in Google Scholar

[4] Nishimura H, Okamoto Y, Takahashi M, Fujita T. Occurrence of alpha-fetoprotein, Regan isoenzyme, and variant alkaline phosphatase in the serum of a patient with gastric cancer. Gastroenterology. 1976;71(3):497–9.10.1016/S0016-5085(76)80463-5Search in Google Scholar

[5] Masuzawa M, Lee PK, Kamada T, Akeyama T, Abe H, Shimano T, et al. Carcinoembryonic antigen, alpha-fetoprotein and carcinoplacental alkaline phosphatase in gastric carcinoma metastatic to the liver. Cancer. 1977;39(3):1175–80.10.1002/1097-0142(197703)39:3<1175::AID-CNCR2820390324>3.0.CO;2-LSearch in Google Scholar

[6] Kodama T, Kameya T, Hirota T, Shimosato Y, Ohkura H, Mukojima T, et al. Production of alpha-fetoprotein, normal serum proteins, and human chorionic gonadotropin in stomach cancer: histologic and immunohistochemical analyses of 35 cases. Cancer. 1981;48(7):1647–55.10.1002/1097-0142(19811001)48:7<1647::AID-CNCR2820480729>3.0.CO;2-VSearch in Google Scholar

[7] Ooi A, Okada Y, Minamoto T, Imabori T, Shima K. A case of alpha-fetoprotein-producing gastric carcinoma with histologic features of embryonal carcinoma. Gan No Rinsho. 1985;31(3):334–40.Search in Google Scholar

[8] Iida M, Imura J, Furuichi T, Sawada T, Nagawa H, Fujimori T. Alteration of the AT motif binding factor-1 expression in alpha-fetoprotein producing gastric cancer: is it an event for differentiation and proliferation of the tumors? Oncol Rep. 2004;11(1):3–7.10.3892/or.11.1.3Search in Google Scholar

[9] Liu X, Cheng Y, Sheng W, Lu H, Xu Y, Long Z, et al. Clinicopathologic features and prognostic factors in alpha-fetoprotein-producing gastric cancers: analysis of 104 cases. J Surg Oncol. 2010;102(3):249–55.10.1002/jso.21624Search in Google Scholar

[10] Kataoka H, Miura Y, Joh T, Seno K, Tada T, Tamaoki T, et al. Alpha-fetoprotein producing gastric cancer lacks transcription factor ATBF1. Oncogene. 2001;20(7):869–73.10.1038/sj.onc.1204160Search in Google Scholar

[11] Sun W, Liu B, Chen J, Gong P, Wu X, Liu C, et al. Novel characteristics of alpha-fetoprotein (AFP)-producing gastric cancer. Oncotarget. 2017;8(60):101944–51.10.18632/oncotarget.22109Search in Google Scholar

[12] Chang YC, Nagasue N, Abe S, Kohno H, Yamanoi A, Uchida M, , et al. The characters of AFP-producing early gastric cancer. Nihon Geka Gakkai Zasshi. 1990;91(10):1574–80.Search in Google Scholar

[13] Yavuz A, Gulec B, Girgin R, Tuncer I. Alpha-Fetoprotein-Producing gastric cancer with nonbiliary pancreatitis. Case Rep Gastroenterol. 2021;15:80–6.10.1159/000511294Search in Google Scholar

[14] Mizejewski GJ. Alpha-Fetoprotein (AFP) and gastric cancer: Why is lethality more prevalent in afp-secreting than non- secreting tumors? Cancer Ther Oncol Int J. 2018;9(1):555753.10.19080/CTOIJ.2018.09.555753Search in Google Scholar

[15] Zhao L, Yang C, Lin Y, Wang S, Ye Y, Shen Z. Research progress and prospects of AFP-positive gastric cancer. Foregut Surg. 2022;2(1):29–38.10.51666/fs.2022.2.e3Search in Google Scholar

[16] Imamura R, Matsumoto K. Hepatocyte growth factor in physiology and infectious diseases. Cytokine. 2017;98:97–106.10.1016/j.cyto.2016.12.025Search in Google Scholar PubMed

[17] Weidner KM, Behrens J, Vandekerckhove J, Birchmeier W. Scatter factor: molecular characteristics and effect on the invasiveness of epithelial cells. J Cell Biol. 1990;111(5 Pt 1):2097–108.10.1083/jcb.111.5.2097Search in Google Scholar PubMed PubMed Central

[18] Amemiya H, Kono K, Mori Y, Takahashi A, Ichihara F, Iizuka H, et al. High frequency of c-Met expression in gastric cancers producing alpha- fetoprotein. Oncology. 2000;59(2):145–51.10.1159/000012152Search in Google Scholar PubMed

[19] Wu J, Chen Y, Yang M, Wang Y, Zhang C, Yang M, et al. Streptavidin-biotin-peroxidase nanocomplex-amplified microfluidics immunoassays for simultaneous detection of inflammatory biomarkers. Anal Chim Acta. 2017;982:138–47.10.1016/j.aca.2017.05.031Search in Google Scholar PubMed

[20] Theis M, Buchholz F. High-throughput RNAi screening in mammalian cells with esiRNAs. Methods. 2011;53(4):424–9.10.1016/j.ymeth.2010.12.021Search in Google Scholar PubMed

[21] Liu X, Sheng W, Wang Y. An analysis of clinicopathological features and prognosis by comparing hepatoid adenocarcinoma of the stomach with AFP-producing gastric cancer. J Surg Oncol. 2012;106(3):299–303.10.1002/jso.23073Search in Google Scholar PubMed

[22] Gardner FP, Serie DJ, Salomao DR, Wu KJ, Markovic SN, Pulido JS, et al. c-MET expression in primary and liver metastases in uveal melanoma. Melanoma Res. 2014;24(6):617–20.10.1097/CMR.0000000000000118Search in Google Scholar PubMed

[23] Krause P, Flikweert H, Monin M, Seif Amir Hosseini A, Helms G, Cantanhede G, et al. Increased growth of colorectal liver metastasis following partial hepatectomy. Clin Exp Metastasis. 2013;30(5):681–93.10.1007/s10585-013-9572-ySearch in Google Scholar PubMed PubMed Central

[24] Lee HE, Kim MA, Lee HS, Jung EJ, Yang HK, Lee BL, et al. MET in gastric carcinomas: comparison between protein expression and gene copy number and impact on clinical outcome. Br J Cancer. 2012;107(2):325–33.10.1038/bjc.2012.237Search in Google Scholar PubMed PubMed Central

[25] Wang JY, Hsieh JS, Chen CC, Tzou WS, Cheng TL, Chen FM, et al. Alterations of APC, c-met, and p53 genes in tumor tissue and serum of patients with gastric cancers. J Surg Res. 2004;120(2):242–8.10.1016/j.jss.2003.12.018Search in Google Scholar PubMed

[26] Li M, Li H, Li C, Wang S, Jiang W, Liu Z, et al. Alpha-fetoprotein: a new member of intracellular signal molecules in regulation of the PI3K/AKT signaling in human hepatoma cell lines. Int J Cancer. 2011;128(3):524–32.10.1002/ijc.25373Search in Google Scholar PubMed

[27] Wang S, Zhu M, Wang Q, Hou Y, Li L, Weng H, et al. Alpha-fetoprotein inhibits autophagy to promote malignant behaviour in hepatocellular carcinoma cells by activating PI3K/AKT/mTOR signalling. Cell Death Dis. 2018;9(10):1027.10.1038/s41419-018-1036-5Search in Google Scholar PubMed PubMed Central

[28] Zhang X, Yang J, Li Y, Liu Y. Both Sp1 and Smad participate in mediating TGF-beta1-induced HGF receptor expression in renal epithelial cells. Am J Physiol Ren Physiol. 2005;288(1):F16–26.10.1152/ajprenal.00318.2003Search in Google Scholar PubMed

[29] Scarpino S, Cancellario d’Alena F, Di Napoli A, Pasquini A, Marzullo A, Ruco LP. Increased expression of Met protein is associated with up-regulation of hypoxia inducible factor-1 (HIF-1) in tumour cells in papillary carcinoma of the thyroid. J Pathol. 2004;202(3):352–8.10.1002/path.1522Search in Google Scholar PubMed

[30] Zundel W, Schindler C, Haas-Kogan D, Koong A, Kaper F, Chen E, et al. Loss of PTEN facilitates HIF-1-mediated gene expression. Genes Dev. 2000;14(4):391–6.10.1101/gad.14.4.391Search in Google Scholar

[31] Conery AR, Cao Y, Thompson EA, Townsend CM Jr., Ko TC, Luo K. Akt interacts directly with Smad3 to regulate the sensitivity to TGF-beta induced apoptosis. Nat Cell Biol. 2004;6(4):366–72.10.1038/ncb1117Search in Google Scholar PubMed

[32] Chen Y, Tang Q, Wu J, Zheng F, Yang L, Hann SS. Inactivation of PI3-K/Akt and reduction of SP1 and p65 expression increase the effect of solamargine on suppressing EP4 expression in human lung cancer cells. J Exp Clin Cancer Res. 2015;34:154.10.1186/s13046-015-0272-0Search in Google Scholar PubMed PubMed Central

[33] Wang R, Li J, Xu D, Li R, Gong P. Dynamic Change in Serum Alpha-fetoprotein Level Predicts Treatment Response and Prognosis of Alpha-fetoprotein-producing Gastric Cancer. Medicine (Baltim). 2020;99(47):e23326.10.1097/MD.0000000000023326Search in Google Scholar PubMed PubMed Central

Received: 2021-06-28
Revised: 2022-07-02
Accepted: 2022-07-17
Published Online: 2023-08-10

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
  3. Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
  4. Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
  5. Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
  6. A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
  7. Neutrophilia with subclinical Cushing’s disease: A case report and literature review
  8. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
  9. Immunoregulation of synovial macrophages for the treatment of osteoarthritis
  10. Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
  11. Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
  12. Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
  13. High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
  14. Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
  15. Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
  16. Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
  17. Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
  18. Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
  19. Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
  20. Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
  21. Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
  22. Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
  23. Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
  24. Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
  25. 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
  26. Experimental study on the optimization of ANM33 release in foam cells
  27. Primary retroperitoneal angiosarcoma: A case report
  28. Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
  29. Malignant pleural effusion diagnosis and therapy
  30. Effect of spaceflight on the phenotype and proteome of Escherichia coli
  31. Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
  32. Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
  33. Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
  34. The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
  35. Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
  36. mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
  37. The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
  38. Radiotherapy for primary thyroid adenoid cystic carcinoma
  39. Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
  40. Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
  41. Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
  42. Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
  43. PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
  44. The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
  45. Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
  46. Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
  47. NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
  48. Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
  49. Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
  50. Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
  51. Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
  52. Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
  53. Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
  54. Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
  55. Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
  56. Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
  57. Gemella morbillorum infective endocarditis: A case report and literature review
  58. An unusual ectopic thymoma clonal evolution analysis: A case report
  59. Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
  60. Detection of V. vulnificus septic shock with ARDS using mNGS
  61. Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
  62. The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
  63. Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
  64. ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
  65. Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
  66. Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
  67. Collagen changes in rabbit conjunctiva after conjunctival crosslinking
  68. Effects of NM23 transfection of human gastric carcinoma cells in mice
  69. Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
  70. Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
  71. Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
  72. Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
  73. Giant duplication of the transverse colon in an adult: A case report and literature review
  74. Ectopic thyroid tissue in the breast: A case report
  75. SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
  76. Vaginal metastasis from breast cancer: A case report
  77. Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
  78. Inhibition of TAZ impairs the migration ability of melanoma cells
  79. Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
  80. Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
  81. Identification of winter wheat pests and diseases based on improved convolutional neural network
  82. Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
  83. Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
  84. Immune checkpoint inhibitors in cancer patients with COVID-19
  85. Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
  86. Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
  87. Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
  88. DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
  89. Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
  90. Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
  91. Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
  92. Studying infant mortality: A demographic analysis based on data mining models
  93. Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
  94. Protein Z modulates the metastasis of lung adenocarcinoma cells
  95. Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
  96. TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
  97. Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
  98. Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
  99. Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
  100. Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
  101. Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
  102. HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
  103. Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
  104. Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
  105. Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
  106. Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
  107. Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
  108. Research progress on gas signal molecular therapy for Parkinson’s disease
  109. Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
  110. The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
  111. α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
  112. CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
  113. Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
  114. Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
  115. Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
  116. Research progress of AMP-activated protein kinase and cardiac aging
  117. TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
  118. Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
  119. Metastasis from small cell lung cancer to ovary: A case report
  120. The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
  121. The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
  122. Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
  123. Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
  124. Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
  125. Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
  126. Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
  127. Traumatic brain injury and rTMS-ERPs: Case report and literature review
  128. Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
  129. Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
  130. The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
  131. Inflammation-related signaling pathways in tendinopathy
  132. CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
  133. Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
  134. Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
  135. Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
  136. Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
  137. Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
  138. Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
  139. TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
  140. Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
  141. Ferroptosis: A potential target of macrophages in plaque vulnerability
  142. Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
  143. Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
  144. HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
  145. IL-17 in osteoarthritis: A narrative review
  146. Circadian cycle and neuroinflammation
  147. Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
  148. Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
  149. SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
  150. Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
  151. PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
  152. Pancreatic ectopic thyroid tissue: A case report and analysis of literature
  153. The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
  154. Report on a case of liver-originating malignant melanoma of unknown primary
  155. Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
  156. The fibroblast growth factor–Klotho axis at molecular level
  157. Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
  158. A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
  159. Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
  160. Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
  161. Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
  162. Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
  163. Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
  164. Case report of atypical undernutrition of hypoproteinemia type
  165. Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
  166. Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
  167. Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
  168. Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
  169. Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
  170. Precisional detection of lymph node metastasis using tFCM in colorectal cancer
  171. Advances in diagnosis and treatment of perimenopausal syndrome
  172. A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
  173. Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
  174. Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
  175. Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
  176. Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
  177. Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
  178. Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
  179. An online diagnosis method for cancer lesions based on intelligent imaging analysis
  180. Medical imaging in rheumatoid arthritis: A review on deep learning approach
  181. Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
  182. Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
  183. A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
  184. TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
  185. Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
  186. Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
  187. Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
  188. Hepatobiliary surgery based on intelligent image segmentation technology
  189. Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
  190. Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
  191. Early diagnosis for the onset of peri-implantitis based on artificial neural network
  192. Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
  193. Forecast of pain degree of lumbar disc herniation based on back propagation neural network
  194. SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
  195. Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
  196. Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
  197. A novel approach for minimising anti-aliasing effects in EEG data acquisition
  198. ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
  199. Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
  200. Lung nodule segmentation via semi-residual multi-resolution neural networks
  201. Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
  202. A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
  203. Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
  204. Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
  205. Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
  206. Monitoring and evaluation of anesthesia depth status data based on neuroscience
  207. Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
  208. Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
  209. Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
  210. Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
  211. Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
  212. From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
  213. Ecology and Environmental Science
  214. Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
  215. Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
  216. Effects of cadmium stress on fruits germination and growth of two herbage species
  217. Bamboo charcoal affects soil properties and bacterial community in tea plantations
  218. Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
  219. Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
  220. Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
  221. Food Science
  222. Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
  223. Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
  224. Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
  225. Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
  226. Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
  227. Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
  228. Microbiological transglutaminase: Biotechnological application in the food industry
  229. Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
  230. Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
  231. The potential for the use of leghemoglobin and plant ferritin as sources of iron
  232. Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
  233. Bioengineering and Biotechnology
  234. Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
  235. Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
  236. Agriculture
  237. Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
  238. On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
  239. Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
  240. A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
  241. Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
  242. Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
  243. Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
  244. Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
  245. Animal Sciences
  246. Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
  247. Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
  248. Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
  249. Tracking behavioral changes of confined sows from the first mating to the third parity
  250. The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
  251. Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
  252. Plant Sciences
  253. Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
  254. Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
  255. Tissue culture and rapid propagation technology for Gentiana rhodantha
  256. Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
  257. Cloning and expression analysis of VrNAC13 gene in mung bean
  258. Chlorate-induced molecular floral transition revealed by transcriptomes
  259. Effects of warming and drought on growth and development of soybean in Hailun region
  260. Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
  261. Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
  262. Distinguish Dianthus species or varieties based on chloroplast genomes
  263. Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
  264. Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
  265. An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
  266. Erratum
  267. Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
  268. Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
  269. Retraction
  270. Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
Downloaded on 27.1.2026 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0476/html
Scroll to top button