Home Life Sciences Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
Article Open Access

Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection

  • Chao Wu , Lianghua Guo , Xirennayi Muhataer , Qifeng Li , Zhichuang Lian , Yafang Li , Wenyi Wang , Wei Ding , Yuan Zhou , Xiaohong Yang EMAIL logo and Muzhi Chen EMAIL logo
Published/Copyright: April 15, 2023

Abstract

This study examined the effects of the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count after pulmonary infection. Sprague‒Dawley rats were subjected to tracheal injection of lipopolysaccharide (LPS) to establish animal models of pulmonary infection. By inhibiting the PI3K/AKT pathway or inhibiting/inducing mitochondrial autophagy in macrophages, the severity of the pulmonary infection and the leukocyte count were altered. The PI3K/AKT inhibition group did not show a significant difference in leukocyte counts compared with the infection model group. Mitochondrial autophagy induction alleviated the pulmonary inflammatory response. The infection model group had significantly higher levels of LC3B, Beclin1, and p-mTOR than the control group. The AKT2 inhibitor group exhibited significantly increased levels of LC3B and Beclin1 compared with the control group (P < 0.05), and the Beclin1 level was significantly higher than that in the infection model group (P < 0.05). Compared with the infection model group, the mitochondrial autophagy inhibitor group exhibited significantly decreased levels of p-AKT2 and p-mTOR, whereas the levels of these proteins were significantly increased in the mitochondrial autophagy inducer group (P < 0.05). PI3K/AKT inhibition promoted mitochondrial autophagy in macrophages. Mitochondrial autophagy induction activated the downstream gene mTOR of the PI3K/AKT pathway, alleviated pulmonary inflammatory reactions, and decreased leukocyte counts.

1 Introduction

Currently, infection-induced deaths account for approximately one-fourth of the total mortality worldwide; in recent years, the incident rate of infection has remained high due to complications, the use of glucocorticoids, low immune function, bacterial resistance, and invasive operations [1]. After infection, most patients develop leukocytosis, which is the result of the rapid initiation of the innate immune response; however, some patients exhibit leukocytopenia [2]. In our clinical practice, patients with leukocytopenia after infection are not rare. Moreover, in these patients, infection symptoms are more severe and more difficult to control because pathogens can more easily evade attacks from immune cells, and consequently, treatments tend to be longer [3].

Infections, whether with leukocytosis or leukocytopenia, are primarily caused by pathogens, which mainly include viruses and bacteria. After infection occurs, the innate immune response, also termed natural immunity, is activated first. Innate immunity plays a critical role in acute infection, and neutrophils, lymphocytes, eosinophils, and basophils are important innate immune cells. These cells arrive at the infection site through rolling, adhesion, tight binding, cell overflow, and migration and exert direct immune effects by engulfing, killing, and digesting the invaders through the release of reactive oxygen substances and antimicrobial cleaved granule proteins such as peroxidase, lysozyme, alkaline phosphatase, and acid hydrolase [4,5]. In patients with leukocytopenia after infection [6], however, cell migration disorder, abnormal bone marrow proliferation, decreased chemokine secretion, and the presence of abnormal receptors on the surface of immune cells may occur [7].

According to our previous work [3], abnormal chemokine secretion, cell migration disorder, ubiquitination modification disorder, and decreased oxidative stress may participate in the development of postinfection leukocytopenia; compared with the control group, the leukocytopenia group showed hypermethylation of the thymoma viral proto-oncogene 2 (AKT2) gene, whereas leukocytosis induced hypomethylation. AKT2 serves as a key protein in the PI3K/AKT pathway [8]. After pathogens invade the body, innate immune cells, such as dendritic cells, macrophages, NK cells and neutrophils, are activated first [9]. Although immune cells do not express specific antigen recognition receptors, they recognize immunologically activated receptors via pattern recognition and then secrete corresponding cytokines, thereby exerting immediate immune effects. However, the target cells of the PI3K/AKT pathway, as well as the mechanism underlying the interaction between these cells, remain to be examined [10,11].

PI3K/AKT is a typical autophagy signaling pathway [12]. Autophagy has a direct effect on microbial infection and can selectively remove intracellular microorganisms; autophagy even functions as an independent natural defense barrier [13]. The PI3K/AKT pathway is associated with mitochondrial autophagy in macrophages [14], and the mutual recruitment and accumulation of macrophages and neutrophils at the site of inflammation promote cooperation between phagocytes. At the infection site, a large amount of chemokines are released, which attract leukocytes to accumulate; the recruited immune cells further release chemokines to promote the generation of leukocytes, which are then released into blood, thereby forming a complex chemokine network system [15].

Because the PI3K/AKT signaling pathway might participate in the development of postinfection leukocytopenia and the PI3K/AKT pathway is closely associated with mitochondrial autophagy in macrophages, we hypothesized that the PI3K/AKT pathway participates in the development of leukocytopenia by inducing mitochondrial autophagy. To verify this hypothesis, we conducted the current study, which aimed to examine the molecular mechanism of leukocytopenia in a rat model of lipopolysaccharide (LPS)-induced pulmonary infection by interfering in the PI3K/AKT pathway and macrophage autophagy.

2 Materials and methods

2.1 Animals

Specific pathogen-free (SPF) Sprague‒Dawley rats were purchased from the Teaching and Scientific Research Condition Guarantee Center of Xinjiang Medical University (license no., SCXK(Xin)2018-0002). The age of the animals ranged from 6 weeks to 8 weeks, with body masses of 180–220 g. The rats were fed at the Animal Center of Xinjiang Medical University. The feeding environment was as follows: temperature, 21–25°C; relative humidity, 50–70%; ventilation frequently, 1–2 times per day; air velocity, 0.1–0.2 cm/s; environmental noise, under 60 dB; and illumination, 15–20 lx. The rats were used for the experiment after 1 w of quarantine.

  1. Ethical approval: The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals. The procedures of this study were approved by the Ethics Committee of People’s Hospital of Xinjiang Uygur Autonomous Region (approval no., 2020056). This study is reported in accordance with ARRIVE guidelines.

2.2 Groupings

The animals were randomized into five different groups, with six animals of the same sex in each group. To avoid artificial influences on grouping outcomes, a random number table was used. The detailed treatments for each group are described below.

2.2.1 The negative control group

The animals were subjected to tracheal injection of 5 mg/kg saline and intraperitoneal injection of 25 mg/kg saline. Saline (10 mg/kg day) was administered by gavage. After 6 days of treatment, experiments were then performed.

2.2.2 The infection model group

The animals were subjected to tracheal injection of 5 mg/kg LPS (Sigma; article no., L2880) and intraperitoneal injection of 25 mg/kg saline. Saline (10 mg/kg day) was administered by gavage. After 6 days of treatment, experiments were then performed.

2.2.3 AKT2 inhibitor (MCE; article no., HY-13260) group

The animals were subjected to tracheal injection of 5 mg/kg LPS (Sigma; article no., L2880) and intraperitoneal injection of the AKT2 inhibitor (25 mg/kg). After 6 days of treatment, experiments were performed.

2.2.4 The mitochondrial autophagy inhibitor group

The animals were subjected to tracheal injection of 5 mg/kg LPS followed by gavage administration of 10 mg/kg day cyclosporin A (CsA; MCE; article no., HY-B0579). After 6 days of treatment, experiments were then performed.

2.2.5 The mitochondrial autophagy inducer group

The animals were subjected to tracheal injection of 5 mg/kg LPS followed by intraperitoneal injection of 4 mg/kg day carbonyl cyanide 3-chlorophenylhydrazone (CCCP; MCE; article no., HY-100941). After 6 days of treatment, experiments were then performed.

2.3 Whole blood leukocyte counting

The rats were anesthetized intraperitoneally with 10% chloral hydrate (0.3 mL/100 g). The abdominal skin was cut open in a “V” shape. A blood-collecting needle was inserted into the branch of the common iliac artery and then pushed centripetally along the abdominal aorta. A total of 0.5 mL of whole blood was collected from each group. Hemolysin (1×) (3 mL) was added. After vortex mixing, the sample was placed in the dark for 10 min. After sufficient lysis, the sample was centrifuged at 1,500 rpm for 5 min. The supernatant was removed, and the residue was washed twice with PBS. Leukocytes were isolated. PBS (0.5 mL) was added to resuspend the cells. A cover glass was placed in the center of the cell counting plate. An appropriate volume of the cell suspension was applied. The total number of cells in the five central squares was counted. The number of leukocytes was calculated based on the following formula:

Number of leukocytes / L = N / 5 × 25 × 10 × 10 6 ,

where N is the total cell number within the five squares.

2.4 Flow cytometry

Macrophages were isolated using flow cytometry. A total of 4 mL of whole blood was collected from each group, which was added to four flow tubes (1 mL each). Then, 3 mL of 1× hemolysin was added, and the solution was well mixed. The solution was placed in the dark for 10 min. After complete lysis, centrifugation at 1,500 rpm for 5 min was performed. The supernatant was discarded, and PBS washes were performed twice. Leukocytes were separated. PBS (1 mL) was added to resuspend the cells. Afterward, 15 μl of CD14 antibody was added. The solution was incubated at 4°C in the dark for 15 min. After centrifugation at 1,500 rpm for 5 min, the supernatant was removed. Prechilled serum-free RPMI 1640 culture medium (5 mL) was used to resuspend the cells. CD14 single-positive cells were separated using flow cytometry. The isolated cells were subjected to statistical analysis for subsequent gene and protein detection.

2.5 Hematoxylin–eosin (H&E) staining

The animals were anesthetized with 10% chloral hydrate (0.3 mL/100 g) and then killed by decapitation. Pulmonary tissue was isolated for paraffin embedding. After being dehydrated, the sections were stained with a hematoxylin aqueous solution for several minutes. After color separation with acidic water and ammonia in water, the specimen was dehydrated with 70 and 90% ethanol for 10 min each. Afterward, eosin staining was performed for 2–3 min. The sections were dehydrated with pure ethanol, made transparent with xylene, and then sealed with Canadian gum.

The stained sections were scored based on neutrophil infiltration, airway epithelial cell injury, interstitial edema, pulmonary hyaline membrane, and bleeding, and the scoring criteria were as follows [16]: normal, 0 points; minor changes, 1 point; mild changes, 2 points; moderate changes, 3 points; and severe changes, 4 points.

2.6 qRT‒PCR

Total RNA was extracted using the TRIzol method, and gene primers were designed with Primer 5. The primer sequences (5′- to -3′) are listed as follows:

AKT2, GGAGCTCTGTTAGCACCGTT (F) and AGTGGAAATCCAGTTCCGAGC (R) (product size, 101 bp);

LC3B, GAGCGAGAGAGATGAAGACGG (F) and ACGTCCCTTTTTGCCTTGGT (R) (product size, 133 bp);

PI3K, ACATCGACCTACACTTGGGG (F) and TCCCCTCTCCCCAGTAGTTT (R) (product size, 140 bp);

mTOR, AGAACCTGGCTCAAGTACGC (F) and AGGATGGTCAAGTTGCCGAG (R) (product size, 114 bp); and

GAPDH, CAGGGCTGCCTTCTCTTGTG (F) and GATGGTGATGGGTTTCCCGT (R) (product size, 172 bp).

A total of 20 µL of the reference reaction system for cDNA synthesis included 7 µL of total RNA, 1 µL of random primers (0.1 g/l), 10 µL of 2× TS reaction mix, 1 µL of TransScript@RT/RI enzyme mix, 1 µL of gDNA Remover, and 20 µL of RNase-free water. The PCR system was prepared, and a total of 10 µL of the system included 1 µL of cDNA, 5 µL of 2× SYBR Green Select Mix, 0.7 µL of forward primer, 0.7 µL of reverse primer, 0.05 µL of ROX, and RNase-free water. The reaction conditions consisted of 95°C for 5 min followed by 40 cycles of 95°C for 5 sec and 60°C for 30 s. The CT values were determined, β-actin was used as the internal reference, and the relative expression of Orexin-A was calculated using the 2−△△Ct method.

2.7 Western blot analysis

Cells were washed three times with prechilled PBS and then lysed for protein extraction. The protein concentration was measured with the bicinchoninic acid (BCA) method. Afterward, electrophoresis (the formula for preparing separating gel and concentrated gel was summarized in Supplementary File 1), and membrane transfer were performed. Nonfat milk (50 g/L) was applied for 2 h of blocking, and then, the membrane was washed three times with TBST (10 min each time). Primary and secondary antibodies were applied according to the instructions. The detailed information of the antibodies was as follows: mouse beta-actin antibody (dilution, 1:15,000; 100166-MM10; Sinobiological, Beijing, China), recombinant anti-AKT2 (1:5,000; ab131168; Abcam), anti-AKT2 (phospho S474) (1:5,000; ab38513; Abcam), PI3 kinase p110α (C73F8) rabbit mAb (1:5,000; 4249S; CST), mTOR (7C10) rabbit mAb (1:5,000; 2983S; CST), phospho-mTOR (Ser2448) antibody (1:5,000; 2971S; CST), recombinant anti-LC3B (1:5,000; ab192890; Abcam), and recombinant anti-Beclin 1 (1:5,000; ab210498; Abcam). Chemiluminescence reactions were performed. The gray values of the developed protein bands were detected with ImageJ, and statistical analyses were performed based on the gray value of the internal reference.

2.8 Statistical analysis

All data are presented as the mean ± standard deviation ( x ¯ ± s ) , and analyses were performed with SPSS 19.0. The student t-test was used to compare two groups, and the Student–Newman–Keuls test was used for comparisons among three or more groups. P < 0.05 (two-tailed) was considered significantly different. Graphs were plotted with GraphPad Prism 5.0.

3 Results

3.1 H&E staining

In the control group, pulmonary tissue structure was normal, and there was a small number of chronic inflammatory cells in the stroma (Figure 1). In the model group, part of the bronchus exhibited membranous epithelial erosion and loss, and the infiltration with a large amount of chronic inflammatory cells was observed in the submucosa. The alveolar septa were thickened, and edema and the infiltration of many neutrophils were observed. A large number of red blood cells were observed in the stroma and alveolar cavity, and bleeding foci formed in some areas. The walls of some alveoli were dilated and fractured. Compared with the model group, the AKT2 inhibitor group and the mitochondrial autophagy inhibitor group did not show noticeable pathological changes. In the mitochondrial autophagy inducer group, the severity of pulmonary tissue injury was lower than that in the model group. The H&E scores are shown in Figure 2.

Figure 1 
                  Hematoxylin–eosin staining outcomes of the pulmonary tissue in the different groups (n = 3). The black arrow indicates normal alveolus, the green arrow indicates inflammatory cell infiltration, the blue arrow indicates inflammatory exudation, and the red arrow indicates alveolar septal edema.
Figure 1

Hematoxylin–eosin staining outcomes of the pulmonary tissue in the different groups (n = 3). The black arrow indicates normal alveolus, the green arrow indicates inflammatory cell infiltration, the blue arrow indicates inflammatory exudation, and the red arrow indicates alveolar septal edema.

Figure 2 
                  Hematoxylin–eosin staining scores of the pulmonary tissue in different groups (n = 3). One-way analysis of variance is used for comparison among groups. △P < 0.05, vs the control group; ▲P < 0.05, vs the infection model group; ▽P < 0.05, vs the AKT2 inhibitor group; and ▼P < 0.05, vs the mitochondrial autophagy inhibitor group.
Figure 2

Hematoxylin–eosin staining scores of the pulmonary tissue in different groups (n = 3). One-way analysis of variance is used for comparison among groups. △P < 0.05, vs the control group; ▲P < 0.05, vs the infection model group; ▽P < 0.05, vs the AKT2 inhibitor group; and ▼P < 0.05, vs the mitochondrial autophagy inhibitor group.

3.2 Leukocyte counts

The infection model group had a significantly higher leukocyte count than the control group (10.575 ± 2.447 vs 6.800 ± 1.047; P < 0.05) (Table 1). The cell counts in the AKT2 inhibitor group and mitochondrial autophagy inhibitor group were 10.363 ± 2.005 and 11.575 ± 1.946, respectively, both of which showed significant differences compared with the control group (P < 0.05). No significant differences were observed among the infection model group, the AKT2 inhibitor group, and the mitochondrial autophagy inhibitor group. The cell count in the mitochondrial autophagy inducer group was 4.563 ± 1.298, which was significantly lower than that in any of the other groups (P < 0.05).

Table 1

Whole blood leukocyte counts in the different groups ( x ¯ ± s , n = 6)

Group Leukocyte count (109/L)
Negative control 6.800 ± 1.047
Infection 10.575 ± 2.447
AKT2 inhibitor 10.363 ± 2.005
Mitochondrial autophagy inhibitor 11.575 ± 1.946
Mitochondrial autophagy inducer 4.563 ± 1.298△▲▽▼

P < 0.05, vs the control group; ▲P < 0.05, vs the infection model group; ▽P < 0.05, vs the AKT2 inhibitor group; and ▼P < 0.05, vs the mitochondrial autophagy inhibitor group.

3.3 Gene expression in CD14+ monocyte/macrophages

The RNA expression of the investigated genes in blood monocyte/macrophages was analyzed (Table 2). AKT2 expression in the AKT2 inhibitor group was significantly lower than that in any of the other groups (P < 0.05). The control group, the infection model group, and the AKT2 inhibitor groups did not show significant differences in LC3B expression (P > 0.05). Compared with these groups, the mitochondrial inhibitor group exhibited significantly lower LC3B expression, whereas the mitochondrial inducer group showed significantly higher expression (P < 0.05). There were no significant differences in PI3K expression among the five groups (P > 0.05). mTOR expression in the control group and the infection model group was 1.069 ± 0.470 and 1.400 ± 0.544, respectively, and no significant difference was observed between the groups (P > 0.05). mTOR expression in the AKT2 inhibitor group and the mitochondrial autophagy inhibitor group was 0.761 ± 0.213 and 0.803 ± 0.286, respectively, and showed significant differences compared with the infection model group (P < 0.05). mTOR expression in the mitochondrial autophagy inducer group was 1.360 ± 0.479, which was comparable to that in the control group and infection model group (P > 0.05) but was significantly higher than that in the AKT2 inhibitor group and mitochondrial autophagy inhibitor group (P < 0.05).

Table 2

Gene expression in CD14+ monocyte/macrophages in the different groups ( x ¯ ± s , n = 6)

Group AKT2 LC3B PI3K mTOR
Negative control 1.082 ± 0.458 1.074 ± 0.437 1.040 ± 0.307 1.069 ± 0.470
Infection 1.249 ± 0.252 1.257 ± 0.358 1.258 ± 0.254 1.400 ± 0.544
AKT2 inhibitor 0.849 ± 0.239 1.280 ± 0.301 1.010 ± 0.284 0.761 ± 0.213
Mitochondrial autophagy inhibitor 1.164 ± 0.392 0.715 ± 0.262△▲▽ 1.041 ± 0.382 0.803 ± 0.286
Mitochondrial autophagy inducer 1.169 ± 0.252 1.466 ± 0.363△▲▽▼ 1.090 ± 0.235 1.360 ± 0.479▽▼

P < 0.05, vs the control group; ▲P < 0.05, vs the infection model group; ▽P < 0.05, vs the AKT2 inhibitor group; and ▼P < 0.05, vs the mitochondrial autophagy inhibitor group.

3.4 Protein levels in CD14+ monocyte/macrophages

Protein levels in blood monocyte/macrophages were analyzed (Figure 3; uncropped gels and blots are shown in Supplementary File 2). No significant differences in the levels of AKT2, PI3K, or mTOR were observed among the five groups. Compared with the control group, the AKT2 inhibitor group showed significantly higher levels of LC3B and Beclin1 (P < 0.05). The Beclin1 level was significantly higher than that in the infection model group (P < 0.05). Compared with the infection model group, the mitochondrial autophagy inhibitor group exhibited significantly lower levels of p-AKT2 and p-mTOR, whereas the mitochondrial autophagy inducer group exhibited significantly higher levels of these proteins (P < 0.05).

Figure 3 
                  Protein levels in peripheral CD14+ monocyte/macrophages in the different rat groups. Each group contains three animals, and flow cytometry is used for western blot analysis of CD14+ CELLS, with three repetitions in each group. One-way analysis of variance is used for comparison among groups. A, Splicing band diagram of the target proteins. B, The levels of different proteins in macrophages. B1-5, The levels of the key proteins in the PI3K/AKT pathway. B6-7, Markers of mitochondrial autophagy in macrophages. △P < 0.05, vs the control group; ▲P < 0.05, vs the infection model group; ▽P < 0.05, vs the AKT2 inhibitor group; and ▼P < 0.05, vs the mitochondrial autophagy inhibitor group.
Figure 3

Protein levels in peripheral CD14+ monocyte/macrophages in the different rat groups. Each group contains three animals, and flow cytometry is used for western blot analysis of CD14+ CELLS, with three repetitions in each group. One-way analysis of variance is used for comparison among groups. A, Splicing band diagram of the target proteins. B, The levels of different proteins in macrophages. B1-5, The levels of the key proteins in the PI3K/AKT pathway. B6-7, Markers of mitochondrial autophagy in macrophages. △P < 0.05, vs the control group; ▲P < 0.05, vs the infection model group; ▽P < 0.05, vs the AKT2 inhibitor group; and ▼P < 0.05, vs the mitochondrial autophagy inhibitor group.

4 Discussion

To date, the mechanism underlying the development of leukocytopenia after the infection has not been completely clarified. AKT participates in the innate immune response and inflammatory reactions [17]; the PI3K/AKT signaling pathway is a tyrosine kinase cascade and signal transduction pathway [18]. PIP3 serves as an important second messenger in cellular signaling pathways. PIP3 recruits signaling molecules containing PH domains (e.g., AKT) onto the plasma membrane for activation, which in turn initiates the downstream signaling pathway. AKT is a direct target gene of PI3K. After AKT is recruited by PI3K-medicated second messengers to the cell membrane, its conformation is changed [19]. Activated AKT inhibits the inflammatory reaction in mice and rabbits with LPS-induced sepsis, and the possible mechanisms may be attributed to increased IL-12, TNF-α, and IL-6 (proinflammatory cytokines) levels and decreased IL-10 (an anti-inflammatory cytokine) levels after PI3K or AKT is inhibited [19,20]. Therefore, it is reasonable to expect that postinfection leukocytopenia is associated with the inhibition of the PI3K/AKT pathway. However, our study showed that the leukocyte count was significantly increased in rats after LPS-induced pulmonary infection, but AKT2 inhibition did not result in leukocytopenia, which suggested that AKT2 and its downstream cytokines were not the key genes that led to leukocytopenia after infection and that postinfection leukocytopenia might be the consequence of decreased AKT2 activity due to immunosuppression. We found that compared with the control group, the infection model group, which was induced by LPS, showed significantly increased p-mTOR levels in macrophages, as well as increased levels of LC3B II and Beclin1 (mitochondrial autophagy markers in macrophages); after AKT2 inhibition, LC3B II and Beclin1 levels were further increased, although the pathological changes were not noticeable, compared with those in the infection model group, suggesting that AKT2 inhibition might further exacerbate postinfection mitochondrial autophagy. mTOR participates in the inflammatory reaction and serves as a key protein in the PI3K/AKT downstream signaling pathway; it also serves as an important negative regulator of autophagy [18]. Therefore, we hypothesized that postinfection leukocytopenia was associated with autophagy mediated by the PI3K-AKT-mTOR signaling pathway.

The PI3K/AKT signaling pathway is the only known autophagy-inhibiting signal transduction pathway. This pathway regulates the levels of multiple inflammatory factors in sepsis; it may be of great importance in regulating autophagy [21]. mTOR is a conserved serine-threonine protein kinase and the substrate of AKT after activation. Activated AKT can phosphorylate mTOR to increase its activity. In this study, AKT2 inhibition greatly strengthened mitochondrial autophagy in macrophages after pulmonary infection in rats. According to the literature [14], activation of the PI3K/AKT pathway promotes the levels of the key proteins associated with granulocyte autophagy in macrophages, such as Parkin and PINK1; after the pathway is inhibited, however, this beneficial effect disappears. Our results were consistent with the reported results. Currently, it is thought that mTOR regulates autophagy in two ways [22]. First, mTOR directly acts on ATG proteins. mTOR can phosphorylate multiple autophagy proteins to block the dimerization of ULK1 and impair the formation of autophagosomes during the induction period, thereby inhibiting autophagy. Second, mTOR is at the intersection of multiple signaling pathways and can integrate nutrient and growth factor signals; mTOR promotes transcription and translation to adjust the life cycle of cells [22]. Based on these theories, we performed further intervention in rats by inhibiting/inducing mitochondrial autophagy and observed the effects of the changes in mitochondrial autophagy in macrophages on the PI3K/AKT pathway and leukocyte counts after LPS-induced pulmonary infection. We found that autophagy inhibition did not noticeably alter pulmonary inflammation, whereas autophagy induction alleviated the severity of inflammation to some extent. In addition, autophagy inhibition did not significantly increase leukocyte counts, whereas autophagy induction significantly decreased leukocyte counts. Our findings were consistent with the reported theory: after bacteria invade the body, an immune response is initiated, and neutrophils immediately penetrate the vascular wall to arrive at the infection site [23]. To remove the bacteria, the demand for granulocytes at the infection site increases, and autophagy in increased in the immune cells at the site, which increases the consumption rate of neutrophils; under these conditions, if immune cells in blood vessels cannot be effectively supplemented, leukocytopenia will occur [23,24].

Organisms are constantly altered, and cells and cellular components are constantly being remolded and recycled. Therefore, low levels of basic autophagy occur to maintain homeostasis. However, autophagy can be highly induced, particularly under intracellular and/or extracellular stress, such as nutrient deficiency, hypoxia, oxidative stress, metabolic imbalance, oncogene activation, and pathogen infection; these conditions initiate autophagy to protect the organism [25]. Macrophages are usually present in the lung stroma and alveoli, and these cells are important for initiating lung inflammation during injury, such as infection. When inflammation occurs, more macrophages gather in the lungs to maintain and exacerbate inflammatory damage. In LPS-induced inflammation, macrophage autophagy inhibits inflammatory reactions; in contrast, in mice with autophagy deficits, a large number of abnormal mitochondria accumulate in macrophages, which further activates the NALP3 inflammasome and mitochondrial reactive oxygen species (ROS) to induce inflammation, increasing the mortality of the mice [26,27]. After macrophages were treated with Toll-like receptor ligands, proinflammatory factors could bind to autophagosomes, while rapamycin (RAPA) could degrade these factors and inhibit inflammatory factor secretion [28]. Beclin1 (an autophagy gene) knockout could increase the probability of septicemia in mouse models of cecal ligation and puncture (CLP), whereas CO could increase the expression of Beclin1 in mice and in macrophages, thereby promoting macrophage phagocytosis of bacteria [29,30]. In this study, we found that autophagy inhibition decreased the expression of p-mTOR in macrophages, whereas autophagy induction increased the expression of p-AKT2 and p-mTOR. As a typical autophagy inhibition signaling pathway, PI3K/AKT plays a role throughout the development of pulmonary infection. Basic research has shown that dysregulated autophagy activation in the early stage will lead to autophagy disorder and immunosuppression with disease progression, which in turn affects the function of multiple organs [26]. In our study, after pulmonary infection, mitochondrial autophagy induction decreased leukocyte counts, and pathological examination showed the alleviation of pulmonary inflammation. Therefore, targeting different elements in the autophagy pathway and altering the activity of different sections of the pathway during the course of the disease may be a strategy in the treatment of sepsis. At present, mTOR serves as a target that is easily regulated according to research in the field of cancer and other fields; by inhibiting mTOR, autophagy can be effectively activated; however, whether this technique is applicable to preventing severe infection from progressing to sepsis and multiple organ dysfunction remains to be examined in future basic research and clinical trials [31,32].

In our previous study, after bacterial infection, patients with leukocytopenia exhibited abnormal methylation of AKT2 [3]. This study aimed to examine the molecular mechanism underlying postinfection leukocytopenia, focusing on the innate immune system after infection, and one of the hypotheses was that the PI3K/AKT pathway regulates macrophage autophagy via the key protein AKT2 and leads to postinfection leukocytopenia. However, our results suggested that the PI3K/AKT pathway was not the cause of this condition and that leukocytopenia and abnormal AKT2 hypermethylation were possibly manifestations of immunosuppression during bacterial infection. Although we did not obtain positive results to verify this hypothesis, our results could partially explain the regulatory mechanism underlying the interaction between the PI3K/AKT pathway and mitochondrial autophagy after pulmonary infection.

Therefore, this study suffered from limitations, particularly regarding mitochondrial autophagy inhibition/induction. We altered mitochondrial autophagy in macrophages, and mitochondrial autophagy in other immune cells was altered accordingly, particularly in neutrophils, whose immune response is a crucial immune link after pulmonary bacterial infection. According to the literature, the effect of altering neutrophil autophagy on inflammation was opposite to that of macrophages [33,34]. In LPS-induced inflammatory reactions, macrophage autophagy could inhibit inflammatory reactions, whereas in mice with autophagy deficits, abnormal mitochondrial accumulation was observed in macrophages, which further activated NALP3 inflammasomes and ROS to induce inflammation, increasing the mortality of the mice [33]. In mouse models of LPS-induced ALI, neutrophil autophagy is required for the activation of cells and the release of particulate contents from these cells; during ALI, the increased autophagy in neutrophils increases the release of particulate contents, and therefore, inhibiting neutrophil autophagy and Atg5 (an autophagy gene) ameliorate the effect of LPS and fMLP on the release of MPO from neutrophils and inhibit the release of particulate contents, thereby alleviating ALI [34]. In addition, our study showed that patients with leukocytopenia after infection exhibited abnormal hypermethylation of AKT2 [3] and that inhibiting the PI3K/AKT pathway could strengthen mitochondrial autophagy in macrophages, which in turn alleviated the pulmonary inflammatory response. Encouraged by these results, it would be reasonable to hypothesize that the probability of critical illness, such as sepsis, might be decreased in patients with leukocytopenia due to immunosuppression. This concept is worth further exploration in the future. In addition, the results obtained in this study were based on animal experiments, and the sample size was small. Therefore, the results of this study could only reflect a trend, which needs to be validated by increasing the sample size or conducting clinical trials.

PI3K/AKT inhibition promotes mitochondrial autophagy in macrophages. Mitochondrial autophagy induction alleviates the pulmonary inflammatory response and decreases leukocyte counts. Furthermore, mitochondrial autophagy induction strengthens the activity of mTOR, a downstream gene of the PI3K/AKT pathway, which may be the result of the negative regulation of this pathway. The results of this study provide a theoretical foundation for preventing the progression of leukocytopenia after pulmonary infection to severe conditions such as sepsis and multiple organ dysfunction. However, whether the ideal therapeutic target is mTOR remains to be experimentally validated.


# Contributed equally.


  1. Funding information: This study was supported by the Special Project for the Construction of Innovation Environment (Talent and Base) in the Autonomous Region-Construction of Scientific and Technological Innovation Base (Resource Sharing Platform) (grant no., PT1903) and the Special Project for Research and Development of Key Public Health Technologies and Construction of Epidemic Prevention System in Xinjiang, Construction of Three-Dimensional Prevention, Control System for Major Outbreaks of New (Sudden) Infectious Diseases (grant no., 2020A03004-3) and Tianshan Innovation Team Programme of Xinjiang Uygur Autonomous Region (grant no., 2022D14006).

  2. Author contributions: C.W. and L.H.G. devised the study plan, C.W. led the writing of the article, and X.M., Q.F.L., and Z.C.L. conducted the experiments and collected the data. Y.F.L., W.D., and Y.Z. conducted the analysis, W.Y.W. was responsible for the visualization of the data, and X.H.Y. and M.Z.C. were in charge of the project and supervised the entire process.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Kruger MM, Martin LJ, Maistry S, Heathfield LJ. A systematic review exploring the relationship between infection and sudden unexpected death between 2000 and 2016: A forensic perspective. Forensic Sci Int. 2018;289:108–19.10.1016/j.forsciint.2018.05.023Search in Google Scholar PubMed

[2] Schmidt-Hieber M, Teschner D, Maschmeyer G, Schalk E. Management of febrile neutropenia in the perspective of antimicrobial de-escalation and discontinuation. Expert Rev Anti Infect Ther. 2019;17:983–95.10.1080/14787210.2019.1573670Search in Google Scholar PubMed

[3] Wu C, Muhataer X, Wang WY, Deng MQ, Jin R, Lian ZC, et al. Abnormal DNA methylation patterns in patients with infectioncaused leukocytopenia based on methylation microarrays. Mol Med Rep. 2020;21:2335–48.10.3892/mmr.2020.11061Search in Google Scholar PubMed PubMed Central

[4] Marcinkiewicz J, Walczewska M. Neutrophils as sentinel cells of the immune system: A role of the MPO-halide-system in innate and adaptive immunity. Curr Med Chem. 2020;27:2840–51.10.2174/0929867326666190819123300Search in Google Scholar PubMed

[5] Mantovani A, Cassatella MA, Costantini C, Jaillon S. Neutrophils in the activation and regulation of innate and adaptive immunity. Nat Rev Immunol. 2011;11:519–31.10.1038/nri3024Search in Google Scholar PubMed

[6] Gudiol C, Albasanz-Puig A, Laporte-Amargós J, Pallarès N, Mussetti A, Ruiz-Camps I, et al. Clinical predictive model of multidrug resistance in neutropenic cancer patients with bloodstream infection due to pseudomonas aeruginosa. Antimicrob Agents Chemother. 2020;64:e02494-19.10.1128/AAC.01521-19Search in Google Scholar PubMed PubMed Central

[7] Ghosh S, Chakraborty M, Samanta S, Sinha N, Saha S, Chattopadhyay A, et al. Analysis of blood stream infections, antibiograms and clinical outcomes in haematological patients with febrile neutropenia: data from a tertiary care haematology institute in India. Ann Hematol. 2021;100:395–403.10.1007/s00277-020-04324-8Search in Google Scholar PubMed

[8] Ersahin T, Tuncbag N, Cetin-Atalay R. The PI3K/AKT/mTOR interactive pathway. Mol Biosyst. 2015;11:1946–54.10.1039/C5MB00101CSearch in Google Scholar PubMed

[9] Thaiss CA, Zmora N, Levy M, Elinav E. The microbiome and innate immunity. Nature. 2016;535:65–74.10.1038/nature18847Search in Google Scholar PubMed

[10] Venet F, Monneret G. Advances in the understanding and treatment of sepsis-induced immunosuppression. Nat Rev Nephrol. 2018;14:121–37.10.1038/nrneph.2017.165Search in Google Scholar PubMed

[11] Qiu P, Liu Y, Zhang J. Review: The role and mechanisms of macrophage autophagy in sepsis. Inflammation. 2019;42:6–19.10.1007/s10753-018-0890-8Search in Google Scholar PubMed

[12] Liu BB, Deng XL, Jiang QQ, Li GX, Zhang JL, Zhang N, et al. Scoparone improves hepatic inflammation and autophagy in mice with nonalcoholic steatohepatitis by regulating the ROS/P38/Nrf2 axis and PI3K/AKT/mTOR pathway in macrophages. Biomed Pharmacother. 2020;125:109895.10.1016/j.biopha.2020.109895Search in Google Scholar PubMed

[13] Larabi A, Barnich N, Nguyen HTT. New insights into the interplay between autophagy, gut microbiota and inflammatory responses in IBD. Autophagy. 2020;16:38–51.10.1080/15548627.2019.1635384Search in Google Scholar PubMed PubMed Central

[14] Shi J, Yu JB, Zhang Y, Wu LL, Dong S, Wu LN, et al. PI3K/Akt pathway-mediated HO-1 induction regulates mitochondrial quality control and attenuates endotoxin-induced acute lung injury. Lab Invest. 2019;99:1795–809.10.1038/s41374-019-0286-xSearch in Google Scholar PubMed

[15] Grégoire M, Uhel F, Lesouhaitier M, Gacouin A, Guirriec M, Mourcin F, et al. Impaired efferocytosis and neutrophil extracellular trap clearance by macrophages in ARDS. Eur Respir J. 2018;52:1702590.10.1183/13993003.02590-2017Search in Google Scholar PubMed

[16] Liu J, Huang XH, Hu SP, He HZ, Meng ZP. Dexmedetomidine attenuates lipopolysaccharide induced acute lung injury in rats by inhibition of caveolin-1 downstream signaling. Biomed Pharmacother. 2019;118:109314.10.1016/j.biopha.2019.109314Search in Google Scholar PubMed

[17] Vergadi E, Ieronymaki E, Lyroni K, Vaporidi K, Tsatsanis C. Akt signaling pathway in macrophage activation and M1/M2 polarization. J Immunol. 2017;198:1006–14.10.4049/jimmunol.1601515Search in Google Scholar PubMed

[18] Jhanwar-Uniyal M, Wainwright JV, Mohan AL, Tobias ME, Murali R, Gandhi CD, et al. Diverse signaling mechanisms of mTOR complexes: mTORC1 and mTORC2 in forming a formidable relationship. Adv Biol Regul. 2019;72:51–62.10.1016/j.jbior.2019.03.003Search in Google Scholar PubMed

[19] Yin H, Zhou HX, Kang Y, Zhang XJ, Duan XX, Alnabhan R, et al. Syk negatively regulates TLR4-mediated IFNbeta and IL-10 production and promotes inflammatory responses in dendritic cells. Biochim Biophys Acta. 2016;1860:588–98.10.1016/j.bbagen.2015.12.012Search in Google Scholar PubMed PubMed Central

[20] Wang L, Lu YY, Zhang X, Zhang Y, Jiang DS, Dong XM, et al. Mindin is a critical mediator of ischemic brain injury in an experimental stroke model. Exp Neurol. 2013;247:506–16.10.1016/j.expneurol.2013.01.022Search in Google Scholar PubMed

[21] Wang F, Li H, Yan XG, Zhou ZW, Yi ZG, He ZX, et al. Alisertib induces cell cycle arrest and autophagy and suppresses epithelial-to-mesenchymal transition involving PI3K/Akt/mTOR and sirtuin 1-mediated signaling pathways in human pancreatic cancer cells. Drug Des Dev Ther. 2015;9:575–601.10.2147/DDDT.S75221Search in Google Scholar PubMed PubMed Central

[22] Krakauer T. PI3K/Akt/mTOR, a pathway less recognized for staphylococcal superantigen-induced toxicity. Toxins (Basel). 2012;4:1343–66.10.3390/toxins4111343Search in Google Scholar PubMed PubMed Central

[23] Kolaczkowska E, Kubes P. Neutrophil recruitment and function in health and inflammation. Nat Rev Immunol. 2013;13:159–75.10.1038/nri3399Search in Google Scholar PubMed

[24] Giustina AD, Bonfante S, Zarbato GF, Danielski LG, Mathias K, Oliveira AN Jr, et al. Dimethyl fumarate modulatesoxidative stress and inflammation in organs after sepsis in rats. Inflammation. 2018;41:315–27.10.1007/s10753-017-0689-zSearch in Google Scholar PubMed

[25] Kuma A, Komatsu M, Mizushima N. Autophagy-monitoring and autophagy-deficient mice. Autophagy. 2017;13:1619–28.10.1080/15548627.2017.1343770Search in Google Scholar PubMed PubMed Central

[26] Zhao J, Geng WJ, Wan KF, Guo KL, Xi FJ, Xu XQ, et al. Lipoxin A4 promotes autophagy and inhibits overactivation of macrophage inflammasome activity induced by Pg LPS. J Int Med Res. 2021;49:300060520981259.10.1177/0300060520981259Search in Google Scholar PubMed PubMed Central

[27] Patoli D, Mignotte F, Deckert V, Dusuel A, Dumont A, Rieu A, et al. Inhibition of mitophagy drives macrophage activation and antibacterial defense during sepsis. J Clin Invest. 2020;130:5858–74.10.1172/JCI130996Search in Google Scholar PubMed PubMed Central

[28] Harris J, Hartman M, Roche C, Zeng SG, O’Shea A, Sharp FA, et al. Autophagy controls IL-1beta secretion by targeting pro-IL-1beta for degradation. J Biol Chem. 2011;286:9587–97.10.1074/jbc.M110.202911Search in Google Scholar PubMed PubMed Central

[29] Lee S, Lee SJ, Coronata AA, Fredenburgh LE, Chung SW, Perrella MA, et al. Carbon monoxide confers protection in sepsis by enhancing beclin 1-dependent autophagy and phagocytosis. Antioxid Redox Signal. 2014;20:432–42.10.1089/ars.2013.5368Search in Google Scholar PubMed PubMed Central

[30] Xu F, Ma YX, Huang W, Gao J, Guo MM, Li JX, et al. Typically inhibiting USP14 promotes autophagy in M1-like macrophages and alleviates CLP-induced sepsis. Cell Death Dis. 2020;11:666.10.1038/s41419-020-02898-9Search in Google Scholar PubMed PubMed Central

[31] Xu ZR, Han X, Ou DM, Liu T, Li Z, Jiang G, et al. Targeting PI3K/AKT/mTOR-mediated autophagy for tumor therapy. Appl Microbiol Biotechnol. 2020;104:575–87.10.1007/s00253-019-10257-8Search in Google Scholar PubMed

[32] Collins DC, Chenard-Poirier M, Lopez JS. The PI3K pathway at the crossroads of cancer and the immune system: Strategies for next generation immunotherapy combinations. Curr Cancer Drug Targets. 2018;18:355–64.10.2174/1568009617666170927114440Search in Google Scholar PubMed

[33] Nakahira K, Haspel JA, Rathinam VAK, Lee SJ, Dolinay T, Lam HC, et al. Autophagy proteins regulate innate immune responses by inhibiting the release of mitochondrial DNA mediated by the NALP3 inflammasome. Nat Immunol. 2011;12:222–30.10.1038/ni.1980Search in Google Scholar PubMed PubMed Central

[34] Zhu QT, Wang H, Wang HR, Luo Y, Yu Y, Du QR, et al. Protective effects of ethyl pyruvate on lipopolysaccharideinduced acute lung injury through inhibition of autophagy in neutrophils. Mol Med Rep. 2017;15:1272–8.10.3892/mmr.2017.6118Search in Google Scholar PubMed PubMed Central

Received: 2022-04-10
Revised: 2023-02-26
Accepted: 2023-03-02
Published Online: 2023-04-15

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
  3. Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
  4. Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
  5. Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
  6. A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
  7. Neutrophilia with subclinical Cushing’s disease: A case report and literature review
  8. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
  9. Immunoregulation of synovial macrophages for the treatment of osteoarthritis
  10. Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
  11. Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
  12. Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
  13. High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
  14. Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
  15. Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
  16. Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
  17. Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
  18. Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
  19. Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
  20. Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
  21. Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
  22. Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
  23. Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
  24. Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
  25. 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
  26. Experimental study on the optimization of ANM33 release in foam cells
  27. Primary retroperitoneal angiosarcoma: A case report
  28. Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
  29. Malignant pleural effusion diagnosis and therapy
  30. Effect of spaceflight on the phenotype and proteome of Escherichia coli
  31. Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
  32. Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
  33. Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
  34. The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
  35. Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
  36. mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
  37. The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
  38. Radiotherapy for primary thyroid adenoid cystic carcinoma
  39. Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
  40. Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
  41. Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
  42. Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
  43. PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
  44. The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
  45. Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
  46. Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
  47. NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
  48. Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
  49. Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
  50. Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
  51. Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
  52. Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
  53. Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
  54. Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
  55. Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
  56. Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
  57. Gemella morbillorum infective endocarditis: A case report and literature review
  58. An unusual ectopic thymoma clonal evolution analysis: A case report
  59. Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
  60. Detection of V. vulnificus septic shock with ARDS using mNGS
  61. Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
  62. The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
  63. Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
  64. ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
  65. Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
  66. Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
  67. Collagen changes in rabbit conjunctiva after conjunctival crosslinking
  68. Effects of NM23 transfection of human gastric carcinoma cells in mice
  69. Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
  70. Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
  71. Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
  72. Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
  73. Giant duplication of the transverse colon in an adult: A case report and literature review
  74. Ectopic thyroid tissue in the breast: A case report
  75. SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
  76. Vaginal metastasis from breast cancer: A case report
  77. Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
  78. Inhibition of TAZ impairs the migration ability of melanoma cells
  79. Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
  80. Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
  81. Identification of winter wheat pests and diseases based on improved convolutional neural network
  82. Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
  83. Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
  84. Immune checkpoint inhibitors in cancer patients with COVID-19
  85. Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
  86. Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
  87. Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
  88. DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
  89. Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
  90. Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
  91. Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
  92. Studying infant mortality: A demographic analysis based on data mining models
  93. Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
  94. Protein Z modulates the metastasis of lung adenocarcinoma cells
  95. Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
  96. TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
  97. Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
  98. Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
  99. Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
  100. Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
  101. Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
  102. HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
  103. Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
  104. Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
  105. Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
  106. Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
  107. Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
  108. Research progress on gas signal molecular therapy for Parkinson’s disease
  109. Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
  110. The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
  111. α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
  112. CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
  113. Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
  114. Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
  115. Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
  116. Research progress of AMP-activated protein kinase and cardiac aging
  117. TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
  118. Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
  119. Metastasis from small cell lung cancer to ovary: A case report
  120. The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
  121. The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
  122. Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
  123. Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
  124. Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
  125. Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
  126. Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
  127. Traumatic brain injury and rTMS-ERPs: Case report and literature review
  128. Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
  129. Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
  130. The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
  131. Inflammation-related signaling pathways in tendinopathy
  132. CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
  133. Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
  134. Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
  135. Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
  136. Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
  137. Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
  138. Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
  139. TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
  140. Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
  141. Ferroptosis: A potential target of macrophages in plaque vulnerability
  142. Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
  143. Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
  144. HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
  145. IL-17 in osteoarthritis: A narrative review
  146. Circadian cycle and neuroinflammation
  147. Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
  148. Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
  149. SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
  150. Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
  151. PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
  152. Pancreatic ectopic thyroid tissue: A case report and analysis of literature
  153. The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
  154. Report on a case of liver-originating malignant melanoma of unknown primary
  155. Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
  156. The fibroblast growth factor–Klotho axis at molecular level
  157. Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
  158. A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
  159. Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
  160. Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
  161. Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
  162. Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
  163. Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
  164. Case report of atypical undernutrition of hypoproteinemia type
  165. Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
  166. Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
  167. Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
  168. Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
  169. Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
  170. Precisional detection of lymph node metastasis using tFCM in colorectal cancer
  171. Advances in diagnosis and treatment of perimenopausal syndrome
  172. A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
  173. Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
  174. Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
  175. Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
  176. Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
  177. Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
  178. Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
  179. An online diagnosis method for cancer lesions based on intelligent imaging analysis
  180. Medical imaging in rheumatoid arthritis: A review on deep learning approach
  181. Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
  182. Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
  183. A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
  184. TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
  185. Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
  186. Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
  187. Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
  188. Hepatobiliary surgery based on intelligent image segmentation technology
  189. Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
  190. Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
  191. Early diagnosis for the onset of peri-implantitis based on artificial neural network
  192. Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
  193. Forecast of pain degree of lumbar disc herniation based on back propagation neural network
  194. SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
  195. Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
  196. Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
  197. A novel approach for minimising anti-aliasing effects in EEG data acquisition
  198. ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
  199. Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
  200. Lung nodule segmentation via semi-residual multi-resolution neural networks
  201. Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
  202. A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
  203. Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
  204. Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
  205. Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
  206. Monitoring and evaluation of anesthesia depth status data based on neuroscience
  207. Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
  208. Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
  209. Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
  210. Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
  211. Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
  212. From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
  213. Ecology and Environmental Science
  214. Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
  215. Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
  216. Effects of cadmium stress on fruits germination and growth of two herbage species
  217. Bamboo charcoal affects soil properties and bacterial community in tea plantations
  218. Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
  219. Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
  220. Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
  221. Food Science
  222. Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
  223. Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
  224. Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
  225. Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
  226. Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
  227. Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
  228. Microbiological transglutaminase: Biotechnological application in the food industry
  229. Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
  230. Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
  231. The potential for the use of leghemoglobin and plant ferritin as sources of iron
  232. Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
  233. Bioengineering and Biotechnology
  234. Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
  235. Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
  236. Agriculture
  237. Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
  238. On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
  239. Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
  240. A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
  241. Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
  242. Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
  243. Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
  244. Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
  245. Animal Sciences
  246. Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
  247. Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
  248. Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
  249. Tracking behavioral changes of confined sows from the first mating to the third parity
  250. The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
  251. Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
  252. Plant Sciences
  253. Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
  254. Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
  255. Tissue culture and rapid propagation technology for Gentiana rhodantha
  256. Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
  257. Cloning and expression analysis of VrNAC13 gene in mung bean
  258. Chlorate-induced molecular floral transition revealed by transcriptomes
  259. Effects of warming and drought on growth and development of soybean in Hailun region
  260. Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
  261. Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
  262. Distinguish Dianthus species or varieties based on chloroplast genomes
  263. Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
  264. Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
  265. An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
  266. Erratum
  267. Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
  268. Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
  269. Retraction
  270. Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
Downloaded on 27.1.2026 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0588/html
Scroll to top button