Abstract
This study aimed to investigate effects of pulmonary fractalkine (FKN/CX3CL1) on angiogenesis and tube formation. Tube forming capability of pulmonary vascular endothelial cells (PVECs) was evaluated. CCK-8 assay was used to evaluate proliferation of PVECs. RT-PCR assay was used to determine angiogenesis specific biomarkers. Western blot was applied to identify CX3CR1, Akt, phosphorylated Akt (p-Akt), Erk1/2, phosphorylated Erk1/2 (p-Erk1/2), vascular endothelial growth factor A (VEGFA), and inducible nitric oxide synthase (iNOS) expression. VEGF-A and platelet-derived growth factor (PDGF) levels were examined using ELISA. FKN was safe and triggered tube formation in PVECs. FKN significantly enhanced VEGF-A, PDGF, and iNOS gene transcription compared to the Control group (p < 0.05). CX3CR1 interfering (LV5-CX3CR1 shRNA) remarkably reduced CX3CR1 expression compared to those in LV5 blank group (p < 0.05). Ratios of p-Akt/Akt and p-Erk/Erk were significantly decreased in CX3CR1 shRNA-treated PVECs administered Akt inhibitor (or Erk inhibitor) and 10 ng/mL FKN compared to CX3CR1 shRNA-treated PVECs administered 10 ng/mL FKN (p < 0.05). FKN increased VEGF-A and iNOS expression through activating Akt/Erk pathway. FKN promoted VEGF-A/iNOS expression and triggered p-Akt/Akt and p-Erk/Erk pathway through modulating CX3CR1. FKN-treated macrophages enhanced activation of Akt/Erk pathway. FKN-treated macrophages enhanced PDGF and VEGF-1 expression in PVECs. FKN modulated pulmonary angiogenesis and tube formation through modulating CX3CR1 and growth factors and activating p-Akt/Akt and p-Erk/Erk signaling pathway.
1 Introduction
Hepatopulmonary syndrome (HPS) is a progressive disease characterized by worsening hypoxemia due to intrapulmonary vascular dilatation, arteriovenous malformations, and increased vasoactive substances in the chronic liver disease [1,2]. Prevalence of HPS varies from 4 to 47% due to different cut-offs in defining arterial hypoxemia in primary studies, and mortality rate of HPS is about 41% [3]. Over the past two decades, the pathogenesis and precise mechanisms of HPS were under active investigation. Based on the experimental and clinical research, the mechanisms of HPS continue to be uncovered, which thus provides the chance of clearly understanding the HPS pathogenesis and potential therapeutic targets [4]. Although progress has been made in delineating the mechanisms underlying the imbalance of vasoactive substances, pulmonary vascular alterations, and angiogenesis in HPS, to date, there is still lack of related effective therapeutic approaches apart from liver transplantation [5].
Fractalkine (FKN or CX3CL1), as a member for CX3C molecule family, plays critical roles for initiating and developing the inflammation [6]. The FKN/CX3CL1 could bind to CX3C chemokine receptor 1 (CX3CR1) and trigger the pro-inflammatory responses [7]. FKN/CX3CL1 usually expresses on a series of cells, including dentritic cells, endothelial cells (ECs), and the intestinal ECs [8,9]. Recently, a few documents [10,11] reported that interaction between the FKN/CX3CL1 and the CX3CR1 is correlated with the angiogenesis and pathogenesis for the atherosclerosis. Meanwhile, FKN/CX3CL1 might also involve in the angiogenic processes via activating the endothelial cells [12]. We speculated that FKN/CX3CL1 might play critical effects on the pathogenesis of the HPS. Therefore, this study investigated the effects of FKN/CX3CL1 on pathogenesis of HPS and explored the underlying molecular pathological mechanisms.
2 Materials and methods
2.1 Cell culture, treatment, and grouping
The mouse pulmonary vascular endothelial cells (PVECs) were purchased from ATCC cell bank (Manassas, VA, USA) and cultured in Dulbecco’s modified Eagle medium (Gibco BRL Co. Ltd, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS, Gibco BRL), and containing penicillin (100 U/mL, Beyotime Biotech, Shanghai, China) and streptomycin (100 mg/mL, Beyotime Biotech). The PVECs were cultured and maintained in the humidified incubator at 37℃ under condition of 5% CO2.
PVECs in the Control group were administered the synthesized CX3CR1 shRNA only. PVECs in 10 ng/mL FKN group were administered the synthesized CX3CR1 shRNA and 10 ng/mL FKN. PVECs in Akt inhibitor + 10 ng/mL FKN group were administered the synthesized CX3CR1 shRNA, 10 ng/mL FKN, and 5 μM of Akt inhibitor (AZD5363). PVECs in Erk inhibitor + 10 ng/mL FKN group were administered the synthesized CX3CR1 shRNA, 10 ng/mL FKN, and 30 μM of Erk inhibitor (PD98059). Both Akt inhibitor and Erk inhibitor were administered simultaneously, and incubated for 30 min. Furthermore, the proliferation of the PVECs was evaluated using the cell counting kit 8 (CCK-8) assay according to the protocol of the manufacturer (Cat. No. C0037; Beyotime Biotech, Shanghai, China).
2.2 Tube formation assay in vitro levels
The tube forming capability of the PVECs (the tubule-like structures) was evaluated with the tube formation assay as described by a previous study [13], with a few modifications. In brief, the 24-well plates were pre-treated using the ice-cold Matrigel solution (BD biosciences, Franklin Lakes, NJ, USA) and then incubated for another 30 min at 37℃ to make Matrigel to solidify. The PVECs were cultured, harvested, and suspended in the FBS containing medium (2% FBS), and cultured in the Matrigel-pre-treated wells with density of 10 × 104 cells/well at 37℃ for 30 min. Finally, the tubule-like structures were assigned as the formed tubes.
2.3 Real time PCR (RT-PCR) assay
The angiogenesis specific biomarkers, including vascular endothelial growth factor A (VEGFA), inducible nitric oxide synthase (iNOS), and platelet-derived growth factor (PDGF), were detected using the RT-PCR assay. Briefly, the total RNAs were isolated from the PVECs undergoing different treatments, using the commercial RNeasy Mini Kit (Cat. No. 74104; Qiagen, Hilden, Germany) as instructed by protocol of manufacturer. Then, a total of 0.5 μg of RNA was synthesized to the complementary DNA with PrimerScript RT Reagent Kit (Cat No. RR037A; Takara Bio., Dalian, China) as described by the manufacturer. The gene transcriptions of VEGFA, iNOS, and PDGF were determined with the Sybr Premix-Ex Taq (Cat No. DRR420A; Takara Bio., Dalian, China) on the ABI Real-time PCR Amplifying System (Model: PRISM 7500, ABI, Foster City, CA, USA). The primers are listed in Table 1. The RT-PCR amplifying conditions are listed as the follows: 95℃ for 4 min, followed by 35 cycles at 95℃ for 10 s and 60℃ for 30 s. The relative gene transcriptions of the above genes were analyzed with the 2−ΔΔCT method [14].
Primers for the RT-PCR assay
| Genes | Sequences (5′–3′) | Length (bp) | |
|---|---|---|---|
| VEGF | Forward | ATCATGCGGATCAAACCTCAC | 96 |
| Reverse | TGTTCTGTCTTTCTTTGGTCTGC | ||
| PDGF | Forward | CGCACCAACGCCAACTTC | 154 |
| Reverse | TGGGCTTCTTTCGCACAATC | ||
| iNOS | Forward | TTGGAGCGAGTTGTGGATTG | 147 |
| Reverse | GGTCGTAATGTCCAGGAAGTAGG | ||
| Reverse | ATGTCACGCACGATTTCCC |
2.4 Western blot assay
The cellular proteins in the PVECs were extracted using the ice pre-treated radioimmunoprecipitation assay (Beyotime Biotech) containing the protease inhibitor. The protein’s concentration was examined with a commercial BCA detection kit (Cat. No. P0010S; Beyotime Biotech) as instructed by the protocol of the manufacturer. Then, a total of 20 μg of protein in each group was separated with the 15% SDS-PAGE and electronically transferred onto the PVDF membranes (Beyotime Biotech). Post blocking with the non-fat milk (5%) dissolving in the PBS containing 0.1% Tween-20 for 60 min at 25℃, the PVDF membranes were incubated overnight at 4℃ with the rabbit anti-mouse CX3CR1 polyclonal antibody (Cat. No. ab8021, 1:1,000), rabbit anti-mouse Akt polyclonal antibody (Cat No. ab8805, 1:1,000), rabbit anti-mouse phosphorylated Akt (p-Akt, phospho T308), polyclonal antibody (Cat. No. ab38449, 1:1,000), rabbit anti-mouse Erk1/2 monoclonal antibody (Cat No. ab184699, 1:1,000), rabbit anti-mouse phosphorylated Erk1/2 (p-Erk1/2, phospho T202 + Y204), polyclonal antibody (Cat No. ab200807, 1:1,000), rabbit anti-mouse VEGFA polyclonal antibody (Cat No. ab51745, 1:1,000), rabbit anti-mouse iNOS monoclonal antibody (Cat No. ab115819, 1:1,000), and rabbit anti-mouse β-actin monoclonal antibody (Cat No. ab8226, 1:1,000) overnight at 4℃. Then, the PVDF membranes were washed using PBST three times (5 min per time) and incubated using the horse radish peroxidase-conjugated IgG (Cat No. ab6721, 1:1,000) for 2 h at room temperature. All the above first and second antibodies were purchased from Abcam Biotech (Cambridge, MA, USA). The ECL kit was used for conducting the chemiluminescent detection for the protein expressions. The western blot bands were analyzed with the Image Pro-Plus imaging software (version: 6.0, Media Cybernetics Inc.). The relative of above molecules was represented as the ratio of the target molecule to internal control β-actin.
2.5 Measurement for the VEGF-A and PDGF levels
The VEGF-A and PDGF levels in the supernatants of PVECs were measured using the commercial Mouse VEGF-A ELISA Kit (Cat No. ab119566; Abcam Biotech) and Mouse PDGF ELISA Kit (Cat. No. ab224879; Abcam Biotech), as instructed by the protocols of the manufacturers.
2.6 Statistical analysis
The data in this study were represented as mean ± SD and analyzed using the professional GraphPad Prism software (version: 8.0, GraphPad Software, Inc., La Jolla, CA, USA). The statistical analysis was conducted with the one-way ANOVA validated by Tukey’s post hoc test. P values less than 0.05 were assigned as the significant differences.
3 Results
3.1 Fractalkine (FKN) treatment is not toxic to the PVECs
In order to clarify the toxic effects of FKN on the PVECs, we observed the proliferation status of PVECs by microscope. According to the proliferation of PVECs, we found that there was no obvious toxicity appearing in the FKN-treated PVECs (Figure 1(a)). The CCK-8 findings also showed that there were no significant differences for the optical density (OD) values of PVECs among different groups (Figure 1(b)). Therefore, the FKN (from 1 to 10 ng/mL) is safe for the proliferation of PVECs.

Evaluation for the effects of FKN on proliferation and tube formation of PVECs undergoing different dosages of FKN treatments. (a) Effect of FKN on proliferation. Magnification, 100×. (b) Evaluation for the OD value of the PVECs in different groups. (c) Effect of FKN on tube formation and statistical analysis. Magnification, 100×. FKN: fractalkine; PVECs: pulmonary vascular endothelial cells.
3.2 FKN treatment triggered tube formation in PVECs
We investigated the effects of the different concentrations of FKN on tubular capability of the PVECs to differentiate the tube-like structures. As demonstrated in Figure 1(b), the PVECs exposing to the FKN differentiated to form the network of the tube-like structures with a dosage-dependent manner. For the 1 ng/mL FKN treating PVECs which elongated and connected with each other to form a tube-like network (Figure 1(c)), with more tube-like structures than the Control group. The tube-like structures were obviously more in PVECs undergoing 5 ng/mL FKN (p < 0.05) and 10 ng/mL FKN (p < 0.05) compared to those of PVECs in the Control group (Figure 1(c)). This process peaked in PVECs administered with 10 ng/mL of FKN.
3.3 FKN treatment enhanced VEGF-A, PDGF, and iNOS gene transcription
The growth factors, including VEGF-A, PDGF, and the downstream angiogenic signaling mediator, iNOS, were determined using RT-PCR assay. The results demonstrated that gene transcriptions of VEGF-A (Figure 2(a)), PDGF (Figure 2(b)), and iNOS (Figure 2(c)) in FKN administered PVECs were markedly higher compared to those in PVECs in Control group (p < 0.05). Meanwhile, gene transcriptions of VEGF-A, PDGF, and iNOS were up-regulated following with the increased amounts of FKN (from 1 to 10 ng/mL), with a dosage-dependent manner (Figure 2).

Effects of FKN treatment on gene transcription of growth factors, including VEGF-A, PDGF, and iNOS. (a) Gene transcription of VEGFA. (b) Gene transcription of PDGF. (c) Gene transcription of iNOS. *p < 0.05 versus 0 ng/mL FKN treatment. VEGFA: vascular endothelial growth factor A, iNOS: inducible nitric oxide synthase, PDGF: platelet-derived growth factor.
3.4 CX3CR1 interfering reduced the CX3CR1 expression
In this study, we synthesized the interfering RNA, which was divided into three samples, including LV5-CX3CR1 shRNA sample 1, LV5-CX3CR1 shRNA sample 2, and LV5-CX3CR1 shRNA sample 3, all of which were loaded onto the SDS-PAGE and identified using western blot assay (Figure 3(a)). The results showed that all three samples significantly reduced the CX3CR1 expression in PVECs compared to those in LV5 blank group (Figure 3(b), p < 0.05). Meanwhile, there was no significant difference for CX3CR1 expression among the three samples (Figure 3(b)).

Determination for the interfering efficacy of CX3CR1 shRNA samples. (a) Western blot image. (b) Statistical for the relative expression of CX3CR1. CX3CR1: CX3C chemokine receptor 1.
3.5 FKN activated p-Akt/Akt and p-Erk/Erk signaling pathway
Due to the effects of FKN on the p-Akt and (p-Erk via CX3CR1 activation [15], the expressions of p-Akt and p-Erk were determined with western blot assay (Figure 4(a)). The findings indicated that the ratios of p-Akt/Akt (Figure 4(b)) and p-Erk/Erk (Figure 4(c)) in CX3CR1 shRNA-treated PVECs undergoing 10 ng/mL FKN treatment were significantly increased to those in PVECs in the Control group (p < 0.05). Moreover, comparing with the CX3CR1 shRNA-treated PVECs administered 10 ng/mL FKN, the ratio of p-Akt/Akt (Figure 4(b)) in CX3CR1 shRNA-treated PVECs administered Akt inhibitor and 10 ng/mL FKN was significantly decreased and ratio of p-Erk/Erk (Figure 4(c)) in CX3CR1 shRNA-treated PVECs administered Erk inhibitor and 10 ng/mL FKN was remarkably decreased (p < 0.05). However, there were no effects of Akt inhibitor + 10 ng/mL FKN on ratio of p-Erk/Erk and no effects of Erk inhibitor + 10 ng/mL FKN on ratio of p-Akt/Akt in the CX3CR1 shRNA-treated PVECs, compared to those in the 10 ng/mL FKN group. Therefore, FKN-activated p-Akt/Akt and p-Erk/Erk signaling pathway might be independent of the CX3CR1 molecule.

FKN and/or CX3CR1/Akt/Erk-inhibitor treatment on p-Akt/Akt ratio, p-Erk/Erk ratio, VEGF, and iNOS expression. (a) Western blot images for the expressions of molecules. (b) Comparison and analysis for ratios of p-Akt/Akt. (c) Comparison and analysis for ratios of p-Erk/Erk. (d) Comparison and analysis for expressions of VEGF molecule. (e) Comparison and analysis for expressions of iNOS molecule. *p < 0.05 versus Control group. # p < 0.05 versus 10 ng/mL FKN treatment. FKN: fractalkine, CX3CR1: CX3C chemokine receptor 1, Akt: protein kinase B, p-Akt: phosphorylated Akt, Erk1/2: extracellular regulated kinase1/2, p-Erk1/2: phosphorylated extracellular regulated kinase1/2, VEGFA: vascular endothelial growth factor A, iNOS: inducible nitric oxide synthase.
3.6 FKN increased VEGF-A and iNOS expression through activating Akt/Erk signaling pathway
As shown in Figure 4(d) and (e), 10 ng/mL FKN significantly increased VEGF-1 and iNOS expression in CX3CR1 shRNA-treated PVECs compared to those in Control group (p < 0.05). Meanwhile, expressions of VEGF-1 (Figure 4(d)) and iNOS (Figure 4(e)) in CX3CR1 shRNA-treated PVECs were significantly decreased in Akt inhibitor + 10 ng/mL FKN group and Erk inhibitor + 10 ng/mL FKN group compared to those in 10 ng/mL FKN group (p < 0.05). Moreover, the RT-PCR assay findings also demonstrated that Akt inhibitor or Erk inhibitor administration markedly blocked the 10 ng/mL FKN-triggered gene transcription of iNOS (Figure 5(a)) and VEGF-A (Figure 5(b)) in PVECs. Therefore, the results suggest that FKN increased the VEGF-A and iNOS expression via activating the Akt/Erk signaling pathway.

Reductive effects of 10 mg/mL FKN treatment combining Akt inhibitor or Erk inhibitor on gene transcriptions of iNOS and VEGF molecule. (a) RT-PCR analysis for gene transcription of iNOS. (b) RT-PCR analysis for gene transcription of VEGF. *p < 0.05 versus Control group. # p < 0.05 versus 10 ng/mL FKN treatment. FKN: fractalkine, Akt: protein kinase B, rk1/2: extracellular regulated kinase1/2, VEGFA: vascular endothelial growth factor A, iNOS: inducible nitric oxide synthase.
3.7 FKN-treated macrophages enhanced activation of Akt/Erk signaling pathway
In order to clarify the effects of FKN-mediated secretion of macrophages on the Akt/Erk signaling pathway in PVECs, the western blot assay was carried out (Figure 6(a)). The results showed that FKN-treated macrophages (PVECs + macrophage + CX3CL1 group) remarkably activated the Akt signaling pathway (increased ratio of p-Akt/Akt) (Figure 6(b)) and Erk signaling pathway (increased ratio of p-Erk/Erk) (Figure 6(c)), compared to those in PVECs + macrophages group (p < 0.05). These results suggest that FKN might activate a molecule in macrophages, which then triggered the Akt/Erk signaling pathway in PVECs.

FKN-treated macrophages triggered the Akt/Erk signaling pathway in PVECs. (a) Western blot images for Akt/Erk signaling pathway associated molecules. (b) Analysis and comparison for ratio of p-Akt/Akt. (c) Analysis and comparison for ratio of p-Erk/Erk. *p < 0.05 versus PVECs group. # p < 0.05 versus PVECs + macrophage group. PVECs: pulmonary vascular endothelial cells, Akt: protein kinase B, p-Akt: phosphorylated Akt, E rk1/2: extracellular regulated kinase1/2, p-Erk1/2: phosphorylated extracellular regulated kinase1/2.
3.8 FKN-treated macrophages enhanced PDGF and VEGF-1 expression of PVECS
In order to evaluate the effects of FKN-treated macrophages on the angiogenic ability of PVECS, the angiogenesis-associated biomarkers, PDGF and VEGF-A, were examined using ELISA. The results indicated that FKN-treated macrophages significantly increased PDGF (Figure 7(a)) and VEGF-A (Figure 7(b)) levels in PVECs compared to those in the single PVECs (p < 0.05).

FKN-treated macrophages enhanced PDGF levels (a) and VEGF levels (b) in PVECs. *p < 0.05 versus PVECs group. # p < 0.05 versus PVECs + macrophage group. PVECs: pulmonary vascular endothelial cells, VEGFA: vascular endothelial growth factor A, PDGF: platelet-derived growth factor.
4 Discussion
HPS has been proven to be a progressive disorder that is characterized by worsening hypoxemia clinically [1]. According to the previous studies [6,7], FKN or CX3CL1 plays critical roles for initiating and developing the inflammation; therefore, CX3CL1 might be associated with the occurrence and progression of HPS. Therefore, this study determined the effects of FKN/CX3CL1 on pathogenesis of HPS in mouse PVECs and explored the underlying molecular pathological mechanisms.
In this study, we found that the FKN treatment (from 1 to 10 ng/mL FKN) is safe for the proliferation of PVECs according to the CCK-8 findings, which is consistent with the previous study described in the other cell line [16]. As well known, the tube formation is closely associated with the angiogenesis in the HPS; therefore, we determined the effects of FKN on the tube formation in PVECs. The findings showed that the PVECs exposed to FKN differentiated to form network of tube-like structures with a dosage-dependent manner, with the most obvious effect at a dosage of 10 ng/mL FKN.
Generally, the tube formation (angiogenesis) is correlated with the production of growth factors, such as VEGF-A, PDGF, and downstream angiogenic signaling mediator, iNOS [17]. The RT-PCR results demonstrated that gene transcriptions of VEGF-A, PDGF, and iNOS in FKN administered PVECs were markedly higher compared to those in PVECs in the Control group, with a dosage-dependent manner. The results suggest that FKN treatment enhanced VEGF-A, PDGF, and iNOS gene transcription. Therefore, the activation of VEGF-A, PDGF, and iNOS triggered the tube formation and finally induced the angiogenesis.
In this study, we also synthesized the interfering RNA targeting the CX3CR1, which demonstrated the obvious inhibitive effects on the expression of CX3CR1. Therefore, LV5-CX3CR1 shRNA was applied for the following experiments.
Because of the association between growth factors and Akt/Erk signaling pathways [18], the p-Akt and p-Erk were examined in the present study. The findings indicated that the ratio of p-Akt/Akt in CX3CR1 shRNA-treated PVECs administered Akt inhibitor and 10 ng/mL FKN was significantly decreased and ratio of p-Erk/Erk in CX3CR1 shRNA-treated PVECs administered Erk inhibitor and 10 ng/mL FKN was remarkably decreased, compared to CX3CR1 shRNA-treated PVECs administered 10 ng/mL FKN. These results suggest that FKN-activated p-Akt/Akt and p-Erk/Erk signaling pathway might be not directly associated with the CX3CR1 molecule. Different from our previously published study [19] reporting that CX3CR1 participating in the pulmonary angiogenesis by inhibiting Akt/Erk signaling pathway, our study further proved that FKN triggered the p-Akt/Akt and p-Erk/Erk signaling pathway.
Hou et al. [20] also reported that interaction between FKN and CX3CR1, however, is involved in the pathogenesis of endometriosis. Moreover, Gu et al. [19] reported that the Akt/Erk signaling pathway is correlated with the NO/NOS release and production. In our study, the expressions of VEGF-1 and iNOS in CX3CR1 shRNA-treated PVECs were significantly decreased in Akt inhibitor + 10 ng/mL FKN group and Erk inhibitor + 10 ng/mL FKN group compared to those in 10 ng/mL FKN group (p < 0.05). These results suggest that FKN increases VEGF-A and iNOS expression in CX3CR1 shRNA-treated PVECs via activating Akt/Erk signaling pathway. Therefore, FKN promoted VEGF-A/iNOS expression and triggered the p-Akt/Akt and p-Erk/Erk signaling pathway through modulating CX3CR1 molecule. However, Liu et al. [21] showed that CX3CR1 regulated angiogenesis and activation of p-ERK, iNOS, and VEGF in theHPS process, which is essentially consistent with the findings of this study.
Moreover, it is important to evaluate whether and how intravascular macrophages accumulate and mediate adhesion in the pulmonary vasculature as HPS develops [22]. In order to clarify the role of FKN in the intravascular macrophages accumulation HPS develops, this study investigated the effects of FKN on macrophages. The present study also demonstrated that FKN-treated macrophages significantly increased PDGF and levels in PVECs compared to those in the single PVECs. Thus, the macrophages accumulation in the progression of HPS was mediated by the activation of the FKN.
Although this received a few interesting results, there are also some limitations. First, the standardization of the inhibitor concentration on the cell lines has not been conducted. Therefore, this study cannot define whether these inhibitors can properly inhibit AKT and ERK phosphorylation. Second, though 30 min of incubation of inhibitors is enough due to our pre-experiments, a time-course experiment checking the level of phosphorylated proteins at various timepoints has not been carried out in this study. Third, the effect of individual Akt inhibitor or Erk inhibitor on the Akt phosphorylation or Erk phosphorylation has not been clarified. Fourth, this study did not show the results of similar experiments performed using either naive cells or cells treated with non-silencing (control) shRNA, which is the limitation of our study. In the following study, we would further confirm the results and conclusion of this study by conducting some associated experiments.
5 Conclusions
FKN promoted the tube formation in PVECs and triggered the pulmonary angiogenesis. The angiogenesis process was initiated through modulating the CX3CR1 molecule and growth factors (VEGF, PDGF, iNOS), and activating p-Akt/Akt and p-Erk/Erk signaling pathway. However, FKN-activated p-Akt/Akt and p-Erk/Erk signaling pathway might be independent the CX3CR1 molecule. Therefore, this study would provide the insight for application of CX3CR1 in modulating the angiogenesis. The link between FKN and the pulmonary angiogenesis in the PVECs might have the relationship to the HPS. Understanding the specific mechanism of the HPS might provide critical insight into the knowledges and treatments of human diseases. In the following study, we would explore the effects of FKN on the tube formation in the established animal model for further verifying the results of this study. Meanwhile, blocking the biological activity of the FKN or the related downstream molecules might affect the pathogenesis of HPS, which needs to be clarified in following study.
-
Funding information: This study was granted by the National Natural Science Foundation of China (Grant No. 81560106) and the Basic Research Plan of Guizhou Science and Technology Program (Grant No. [2017]1145), and the National Natural Science Foundation of Guizhou Medical University (Grant No. 20NSP036).
-
Author contributions: Huajian Gu, Jun Liao contributed to the conception of the study; Jun Liao, Huajian Gu, Xianwu Yang performed the experiment; Jun Liao, Huajian Gu, Xianwu Yang performed the data analyses and wrote the manuscript; Jiejie Yang, Jingjing Xiao, Xuyang Liu contributed significantly to analysis and manuscript preparation; Jiejie Yang, Jingjing Xiao, Xuyang Liu, Yingquan Zhuo, Jiafei Yang contributed significantly to supplementary experiments and several rounds of revistions. Huajian Gu, Jingjing Xiao helped perform the analysis with constructive discussions.
-
Conflict of interest: Authors state no conflict of interest.
-
Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
References
[1] Kumar P, Rao PN. Hepatopulmonary syndrome. N Engl J Med. 2020;382(10):e14.10.1056/NEJMicm1901205Search in Google Scholar PubMed
[2] Zhang L, Zhang H, Wang L, Fan Y, Zhang C, Li X, et al. Protective effects of emodin on lung injuries in rat models of liver fibrosis. Open Life Sci. 2019;14:611–8.10.1515/biol-2019-0069Search in Google Scholar PubMed PubMed Central
[3] Ceza MR, Garcia E, Anselmi CE, Epifanio M, Melere MU, Ferreira CT, et al. Prevalence and characteristics of hepatopulmonary syndrome in children with cirrhosis in southern Brazil. Eur J Gastroenterol Hepatol. 2019;31:10–5.10.1097/MEG.0000000000001207Search in Google Scholar PubMed
[4] Chen L, Han Y, Li Y, Chen B, Bai X, Belguise K, et al. Hepatocyte-derived exosomal MiR-194 activates PMVECs and promotes angiogenesis in hepatopulmonary syndrome. Cell Death Dis. 2019;10:853.10.1038/s41419-019-2087-ySearch in Google Scholar PubMed PubMed Central
[5] Cheong KL, Yu B, Chen J, Zhong S. A comprehensive review of the cardioprotective effect of marine algae polysaccharide on the gut microbiota. Foods. 2022;11:3550.10.3390/foods11223550Search in Google Scholar PubMed PubMed Central
[6] Fang L, Ellims AH, Beale AL, Taylor AJ, Murphy A, Dart AM. Systemic inflammation is associated with myocardial fibrosis, diastolic dysfunction, and cardiac hypertrophy in patients with hypertrophic cardiomyopathy. Am J Transl Res. 2017;9:5063–73.10.1016/j.hlc.2017.06.155Search in Google Scholar
[7] Lee SJ, Namkoong S, Kim YM, Kim CK, Lee H, Ha KS, et al. Fractalkine stimulates angiogenesis by activating the Raf-1/MEK/ERK and PI3K/Akt/eNOS-dependent signal pathways. Am J Physiol Heart Circ Physiol. 2006;291:H2836–46.10.1152/ajpheart.00113.2006Search in Google Scholar PubMed
[8] Lucas AD, Chadwick N, Warren BF, Jewell DP, Gordon S, Powrie F, et al. The transmembrane form of the CX3CL1 chemokine fractalkine is expressed predominantly by epithelial cells in vivo. Am J Pathol. 2001;158:855–6.10.1016/S0002-9440(10)64034-5Search in Google Scholar PubMed PubMed Central
[9] Ancuta P, Moses A, Gabuzda D. Transendothelial migration of CD16+ monocytes in response to fractalkine under constitutive and inflammatory conditions. Immunobiology. 2004;209:11–20.10.1016/j.imbio.2004.04.001Search in Google Scholar PubMed
[10] Eriksson EE. Mechanisms of leukocyte recruitment to atherosclerotic lesions: future prospects. Curr Opin Lipidol. 2004;15:553–8.10.1097/00041433-200410000-00009Search in Google Scholar PubMed
[11] Chen G, Zhou Z, Sha W, Wang L, Yan F, Yang X, et al. A novel CX3CR1 inhibitor AZD8797 facilitates early recovery of rat acute spinal cord injury by inhibiting inflammation and apoptosis. Int J Mol Med. 2020;45:1373–84.10.3892/ijmm.2020.4509Search in Google Scholar PubMed PubMed Central
[12] Nanki T, Urasaki Y, Imai T, Nishimura M, Muramoto K, Kubota T, et al. Inhibition of fractalkine ameliorates murine collagen-induced arthritis. J Immunol. 2004;173:7010–6.10.4049/jimmunol.173.11.7010Search in Google Scholar PubMed
[13] Kim MK, Park HJ, Kim SR, Choi YK, Bae SK, Bae MK. Involvement of heme oxygenase-1 in orexin-A-induced angiogenesis in vascular endothelial cells. Korean J Physiol Pharmacol. 2015;19:327–34.10.4196/kjpp.2015.19.4.327Search in Google Scholar PubMed PubMed Central
[14] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta CT) method. Methods. 2001;25:402–8.10.1006/meth.2001.1262Search in Google Scholar PubMed
[15] Zhang J, Yang W, Luo B, Hu B, Maheshwari A, Fallon MB. The role of CX₃CL1/CX₃CR1 in pulmonary angiogenesis and intravascular monocyte accumulation in rat experimental hepatopulmonary syndrome. J Hepatol. 2012;57:752–8.10.1016/j.jhep.2012.05.014Search in Google Scholar PubMed PubMed Central
[16] Rowinska Z, Koeppel TA, Sanati M, Schelzig H, Jankowski J, Weber C, et al. Role of the CX3C chemokine receptor CX3CR1 in the pathogenesis of atherosclerosis after aortic transplantation. PLoS One. 2017;12:e0170644.10.1371/journal.pone.0170644Search in Google Scholar PubMed PubMed Central
[17] Dohan Ehrenfest DM, Pinto NR, Pereda A, Jiménez P, Corso MD, Kang BS, et al. The impact of the centrifuge protocols on the cells, growth factors, and fibrin architecture of a leukocyte- and platelet-rich fibrin (L-PRF) clot and membrane. Platelets. 2018;29:171–84.10.1080/09537104.2017.1293812Search in Google Scholar PubMed
[18] Shi H, Lin B, Huang Y, Wu J, Zhang H, Lin C, et al. Basic fibroblast growth factor promotes melanocyte migration via activating PI3K/Akt-Rac1-FAK-JNK and ERK signaling pathways. IUBMB Life. 2016;68:735–47.10.1002/iub.1531Search in Google Scholar PubMed
[19] Gu HJ, Zuo S, Liu HY, Gu LL, Yang XW, Liao J, et al. CX3CR1 participates in pulmonary angiogenesis in experimental hepatopulmonary syndrome mice through inhibiting AKT/ERK signaling pathway and regulating NO/NOS release. Eur Rev Med Pharmacol Sci. 2019;23:6645–56.Search in Google Scholar
[20] Hou XX, Zhou WJ, Wang XQ, Li DJ. Fractalkine/CX3CR1 is involved in the pathogenesis of endometriosis by regulating endometrial stromal cell proliferation and invasion. Am J Reprod Immunol. 2016;76:318–25.10.1111/aji.12557Search in Google Scholar PubMed
[21] Liu H, Gu H, Gu L, Liao J, Yang X, Wu C, et al. CX3CR1 regulates angiogenesis and activation of pro-angiogenic factors and triggers macrophage accumulation in experimental hepatopulmonary syndrome model. Gastroenterol Hepatol. 2021;44:115–24.10.1016/j.gastrohep.2020.05.021Search in Google Scholar PubMed
[22] Jalce G, Guignabert C. Multiple roles of macrophage migration inhibitory factor in pulmonary hypertension. Am J Physiol Lung Cell Mol Physiol 2020;318(1):L1–9.10.1152/ajplung.00234.2019Search in Google Scholar PubMed
© 2023 the author(s), published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Articles in the same Issue
- Biomedical Sciences
- Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
- Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
- Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
- Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
- A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
- Neutrophilia with subclinical Cushing’s disease: A case report and literature review
- Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
- Immunoregulation of synovial macrophages for the treatment of osteoarthritis
- Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
- Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
- Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
- High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
- Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
- Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
- Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
- Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
- Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
- Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
- Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
- Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
- Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
- Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
- Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
- 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
- Experimental study on the optimization of ANM33 release in foam cells
- Primary retroperitoneal angiosarcoma: A case report
- Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
- Malignant pleural effusion diagnosis and therapy
- Effect of spaceflight on the phenotype and proteome of Escherichia coli
- Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
- Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
- Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
- The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
- Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
- mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
- The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
- Radiotherapy for primary thyroid adenoid cystic carcinoma
- Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
- Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
- Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
- Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
- PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
- The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
- Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
- Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
- NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
- Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
- Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
- Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
- Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
- Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
- Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
- Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
- Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
- Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
- Gemella morbillorum infective endocarditis: A case report and literature review
- An unusual ectopic thymoma clonal evolution analysis: A case report
- Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
- Detection of V. vulnificus septic shock with ARDS using mNGS
- Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
- The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
- Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
- ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
- Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
- Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
- Collagen changes in rabbit conjunctiva after conjunctival crosslinking
- Effects of NM23 transfection of human gastric carcinoma cells in mice
- Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
- Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
- Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
- Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
- Giant duplication of the transverse colon in an adult: A case report and literature review
- Ectopic thyroid tissue in the breast: A case report
- SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
- Vaginal metastasis from breast cancer: A case report
- Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
- Inhibition of TAZ impairs the migration ability of melanoma cells
- Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
- Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
- Identification of winter wheat pests and diseases based on improved convolutional neural network
- Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
- Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
- Immune checkpoint inhibitors in cancer patients with COVID-19
- Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
- Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
- Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
- DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
- Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
- Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
- Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
- Studying infant mortality: A demographic analysis based on data mining models
- Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
- Protein Z modulates the metastasis of lung adenocarcinoma cells
- Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
- TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
- Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
- Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
- Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
- Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
- Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
- HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
- Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
- Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
- Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
- Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
- Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
- Research progress on gas signal molecular therapy for Parkinson’s disease
- Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
- The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
- α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
- CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
- Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
- Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
- Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
- Research progress of AMP-activated protein kinase and cardiac aging
- TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
- Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
- Metastasis from small cell lung cancer to ovary: A case report
- The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
- The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
- Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
- Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
- Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
- Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
- Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
- Traumatic brain injury and rTMS-ERPs: Case report and literature review
- Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
- Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
- The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
- Inflammation-related signaling pathways in tendinopathy
- CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
- Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
- Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
- Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
- Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
- Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
- Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
- TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
- Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
- Ferroptosis: A potential target of macrophages in plaque vulnerability
- Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
- Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
- HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
- IL-17 in osteoarthritis: A narrative review
- Circadian cycle and neuroinflammation
- Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
- Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
- SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
- Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
- PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
- Pancreatic ectopic thyroid tissue: A case report and analysis of literature
- The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
- Report on a case of liver-originating malignant melanoma of unknown primary
- Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
- The fibroblast growth factor–Klotho axis at molecular level
- Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
- A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
- Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
- Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
- Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
- Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
- Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
- Case report of atypical undernutrition of hypoproteinemia type
- Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
- Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
- Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
- Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
- Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
- Precisional detection of lymph node metastasis using tFCM in colorectal cancer
- Advances in diagnosis and treatment of perimenopausal syndrome
- A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
- Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
- Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
- Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
- Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
- Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
- Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
- An online diagnosis method for cancer lesions based on intelligent imaging analysis
- Medical imaging in rheumatoid arthritis: A review on deep learning approach
- Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
- Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
- A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
- TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
- Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
- Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
- Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
- Hepatobiliary surgery based on intelligent image segmentation technology
- Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
- Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
- Early diagnosis for the onset of peri-implantitis based on artificial neural network
- Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
- Forecast of pain degree of lumbar disc herniation based on back propagation neural network
- SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
- Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
- Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
- A novel approach for minimising anti-aliasing effects in EEG data acquisition
- ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
- Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
- Lung nodule segmentation via semi-residual multi-resolution neural networks
- Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
- A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
- Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
- Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
- Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
- Monitoring and evaluation of anesthesia depth status data based on neuroscience
- Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
- Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
- Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
- Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
- Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
- From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
- Ecology and Environmental Science
- Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
- Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
- Effects of cadmium stress on fruits germination and growth of two herbage species
- Bamboo charcoal affects soil properties and bacterial community in tea plantations
- Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
- Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
- Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
- Food Science
- Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
- Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
- Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
- Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
- Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
- Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
- Microbiological transglutaminase: Biotechnological application in the food industry
- Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
- Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
- The potential for the use of leghemoglobin and plant ferritin as sources of iron
- Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
- Bioengineering and Biotechnology
- Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
- Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
- Agriculture
- Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
- On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
- Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
- A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
- Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
- Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
- Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
- Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
- Animal Sciences
- Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
- Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
- Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
- Tracking behavioral changes of confined sows from the first mating to the third parity
- The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
- Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
- Plant Sciences
- Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
- Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
- Tissue culture and rapid propagation technology for Gentiana rhodantha
- Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
- Cloning and expression analysis of VrNAC13 gene in mung bean
- Chlorate-induced molecular floral transition revealed by transcriptomes
- Effects of warming and drought on growth and development of soybean in Hailun region
- Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
- Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
- Distinguish Dianthus species or varieties based on chloroplast genomes
- Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
- Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
- An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
- Erratum
- Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
- Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
- Retraction
- Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
Articles in the same Issue
- Biomedical Sciences
- Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
- Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
- Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
- Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
- A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
- Neutrophilia with subclinical Cushing’s disease: A case report and literature review
- Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
- Immunoregulation of synovial macrophages for the treatment of osteoarthritis
- Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
- Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
- Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
- High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
- Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
- Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
- Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
- Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
- Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
- Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
- Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
- Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
- Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
- Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
- Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
- 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
- Experimental study on the optimization of ANM33 release in foam cells
- Primary retroperitoneal angiosarcoma: A case report
- Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
- Malignant pleural effusion diagnosis and therapy
- Effect of spaceflight on the phenotype and proteome of Escherichia coli
- Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
- Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
- Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
- The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
- Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
- mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
- The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
- Radiotherapy for primary thyroid adenoid cystic carcinoma
- Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
- Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
- Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
- Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
- PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
- The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
- Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
- Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
- NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
- Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
- Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
- Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
- Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
- Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
- Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
- Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
- Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
- Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
- Gemella morbillorum infective endocarditis: A case report and literature review
- An unusual ectopic thymoma clonal evolution analysis: A case report
- Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
- Detection of V. vulnificus septic shock with ARDS using mNGS
- Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
- The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
- Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
- ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
- Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
- Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
- Collagen changes in rabbit conjunctiva after conjunctival crosslinking
- Effects of NM23 transfection of human gastric carcinoma cells in mice
- Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
- Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
- Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
- Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
- Giant duplication of the transverse colon in an adult: A case report and literature review
- Ectopic thyroid tissue in the breast: A case report
- SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
- Vaginal metastasis from breast cancer: A case report
- Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
- Inhibition of TAZ impairs the migration ability of melanoma cells
- Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
- Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
- Identification of winter wheat pests and diseases based on improved convolutional neural network
- Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
- Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
- Immune checkpoint inhibitors in cancer patients with COVID-19
- Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
- Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
- Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
- DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
- Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
- Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
- Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
- Studying infant mortality: A demographic analysis based on data mining models
- Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
- Protein Z modulates the metastasis of lung adenocarcinoma cells
- Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
- TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
- Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
- Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
- Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
- Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
- Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
- HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
- Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
- Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
- Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
- Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
- Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
- Research progress on gas signal molecular therapy for Parkinson’s disease
- Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
- The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
- α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
- CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
- Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
- Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
- Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
- Research progress of AMP-activated protein kinase and cardiac aging
- TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
- Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
- Metastasis from small cell lung cancer to ovary: A case report
- The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
- The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
- Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
- Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
- Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
- Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
- Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
- Traumatic brain injury and rTMS-ERPs: Case report and literature review
- Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
- Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
- The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
- Inflammation-related signaling pathways in tendinopathy
- CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
- Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
- Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
- Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
- Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
- Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
- Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
- TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
- Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
- Ferroptosis: A potential target of macrophages in plaque vulnerability
- Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
- Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
- HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
- IL-17 in osteoarthritis: A narrative review
- Circadian cycle and neuroinflammation
- Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
- Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
- SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
- Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
- PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
- Pancreatic ectopic thyroid tissue: A case report and analysis of literature
- The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
- Report on a case of liver-originating malignant melanoma of unknown primary
- Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
- The fibroblast growth factor–Klotho axis at molecular level
- Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
- A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
- Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
- Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
- Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
- Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
- Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
- Case report of atypical undernutrition of hypoproteinemia type
- Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
- Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
- Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
- Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
- Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
- Precisional detection of lymph node metastasis using tFCM in colorectal cancer
- Advances in diagnosis and treatment of perimenopausal syndrome
- A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
- Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
- Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
- Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
- Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
- Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
- Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
- An online diagnosis method for cancer lesions based on intelligent imaging analysis
- Medical imaging in rheumatoid arthritis: A review on deep learning approach
- Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
- Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
- A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
- TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
- Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
- Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
- Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
- Hepatobiliary surgery based on intelligent image segmentation technology
- Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
- Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
- Early diagnosis for the onset of peri-implantitis based on artificial neural network
- Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
- Forecast of pain degree of lumbar disc herniation based on back propagation neural network
- SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
- Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
- Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
- A novel approach for minimising anti-aliasing effects in EEG data acquisition
- ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
- Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
- Lung nodule segmentation via semi-residual multi-resolution neural networks
- Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
- A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
- Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
- Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
- Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
- Monitoring and evaluation of anesthesia depth status data based on neuroscience
- Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
- Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
- Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
- Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
- Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
- From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
- Ecology and Environmental Science
- Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
- Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
- Effects of cadmium stress on fruits germination and growth of two herbage species
- Bamboo charcoal affects soil properties and bacterial community in tea plantations
- Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
- Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
- Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
- Food Science
- Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
- Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
- Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
- Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
- Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
- Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
- Microbiological transglutaminase: Biotechnological application in the food industry
- Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
- Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
- The potential for the use of leghemoglobin and plant ferritin as sources of iron
- Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
- Bioengineering and Biotechnology
- Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
- Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
- Agriculture
- Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
- On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
- Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
- A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
- Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
- Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
- Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
- Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
- Animal Sciences
- Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
- Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
- Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
- Tracking behavioral changes of confined sows from the first mating to the third parity
- The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
- Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
- Plant Sciences
- Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
- Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
- Tissue culture and rapid propagation technology for Gentiana rhodantha
- Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
- Cloning and expression analysis of VrNAC13 gene in mung bean
- Chlorate-induced molecular floral transition revealed by transcriptomes
- Effects of warming and drought on growth and development of soybean in Hailun region
- Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
- Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
- Distinguish Dianthus species or varieties based on chloroplast genomes
- Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
- Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
- An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
- Erratum
- Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
- Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
- Retraction
- Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”