Abstract
To explore the role of NAC transcription factors in mung bean (Vigna ratiata), we here comprehensively analyzed VrNAC13 structure and expression patterns in the mung bean cultivar “Yulin No.1”. The nucleotide sequence of VrNAC13 (GenBank accession number xp014518431.1) was determined by cloning and sequencing the gene. A predicted transcriptional activation domain in VrNAC13 was validated with a yeast one-hybrid assay. The composition and functional characteristics of VrNAC13 were analyzed using basic bioinformatics techniques, and the expression characteristics of VrNAC13 were analyzed via quantitative reverse transcription-PCR. The results showed that VrNAC13 was 1,068 bp in length and encoded a product of 355 amino acids. VrNAC13 was predicted to contain a NAM domain and to belong to the NAC transcription factor family. The protein was hydrophilic and contained several threonine phosphorylation sites. Phylogenetic analysis showed that VrNAC13 was highly similar in sequence to two Arabidopsis thaliana NAC proteins; we hypothesize that VrNAC13 may perform functions in mung bean similar to those of the two closely related proteins in Arabidopsis. Promoter analysis of VrNAC13 revealed cis-acting elements predicted to respond to abscisic acid (ABA), gibberellin, auxin, light, drought, low temperature, and other stressors. VrNAC13 was most highly expressed in the leaves and expressed at very low levels in the stem and root. It was experimentally determined to be induced by drought and ABA. Based on these results, VrNAC13 appears to regulate stress resistance in mung bean.
1 Introduction
The NAC family of transcription factors is a very large family that is found only in plants [1,2]. The family name is derived from those of several family members, namely NAM, ATAF1/2, and CUC1/2. Structurally, NAC transcription factors consist of a conserved N-terminal protein domain and a variable C-terminal transcriptional activation domain. The N-terminal domain contains five subdomains: A, B, C, D, and E. The structures of these subdomains are associated with nuclear localization and with the recognition and binding of downstream target gene sequences. The C-terminal domain is subject to transcriptional activation or inhibition [3]. Numerous studies have found that NAC transcription factors play important roles in plant growth, development, and stress responses and resistance [4,5,6].
Mung bean (Vigna ratiata L.) is an important crop plant in China. It is a popular dual-purpose crop for both food and medicine because it is rich in protein, vitamins, mineral elements, and other nutrients in addition to having medicinal value [7,8]. Mung bean is not only economically valuable and rich in nutrition, but it is also relatively hardy; it is drought resistant, requires minimal nutrient input, fixes nitrogen, and is suitable for intercropping with other plant species [9]. The Yulin mung bean production area has a unique environment with clean soil and air, sufficient light and heat resources, and high temperature variation between day and night; mung bean seeds from this area are large and have good color, strong germination potential, and are thus referred to as “green pearls” [10,11]. The Yulin area is located at the south edge of the Maowusu sandy land, which has less annual rainfall (mainly in July and August) and little rainfall from May to June. As a result, drought during the seedling stage is a key factor limiting the development of the mung bean industry in Yulin [12,13]. It is therefore desirable to cultivate mung bean germplasm with high yield and drought resistance to maintain the development of the mung bean industry. Publication of the mung bean genome [14] laid the foundation for molecular research in mung bean. Many studies have shown that NAC transcription factors have critical roles in plant growth and development, including in leaf and flower senescence [15,16,17], cell wall formation [18,19], fruit ripening [20,21,22], and root growth [23]. However, there have been few studies of NAC transcription factors in mung bean, and their functions in this economically valuable resource remain unexplored. Therefore, it is particularly important to identify important NAC transcription factors in mung bean, not only to enrich our understanding of these key transcription factors but also to lay a strong molecular foundation for the development of drought-resistant mung bean materials.
In this study, the transcriptome data obtained from mung bean were selected to analyze and predict the bioinformatics of the VrNAC13 gene and the transcriptional initiation site and cis-acting element of the promoter of the VrNAC13 gene. We then experimentally validated the transcriptional activation domain. Expression levels of VrNAC13 in major mung bean tissues were measured with quantitative reverse transcription (qRT)-PCR. This study revealed novel information about the function of VrNAC13 in the mung bean stress response and serves as a valuable reference for further study of NAC genes in mung bean.
2 Materials and methods
2.1 Test materials
Mung bean seeds of the cultivar “Yulv No.1” were provided by the Yulin University Agricultural Water Saving Research Group.
2.1.1 Gene cloning materials
Healthy, plump seeds were sterilized with 5% sodium hypochlorite and then dried for later use. Individual pots were filled with 600 g of nutritious soil. Five seeds were sown in each pot. The soil moisture content was maintained between 70 and 80% by weight. For drought experiments, when the first trifoliate compound leaf was flattened, plants were divided into a control group and a treatment group. The control group had normal water management, whereas water was withheld from the treatment group. When the relative water content of the first trifoliate compound leaf in the treated sample significantly differed from that of the control group, the top leaf in the treatment group was collected and frozen in liquid nitrogen for further analysis.
2.1.2 Gene expression analysis materials
Tissue-specific gene expression analysis
Plants were grown as described above. At the seedling stage, the roots, stems, and leaves were collected separately and frozen in liquid nitrogen for further analysis as described below.
Gene expression analysis in drought-stressed seedlings
Plants were grown as described above. The top 3 leaves of the first three leaves were collected from seedlings at four timepoints as described in Section 3.8.
Gene expression analysis in ABA-treated seedlings
Plants were grown as described above. At the seedling stage, 100 µmol/l ABA was sprayed on the top leaf of the first three leaves compound leaf. Leaves were collected at 0, 2, 4, 8, 12, and 24 h after treatment and flash-frozen in liquid nitrogen prior to further analysis. Samples collected at the 0 h timepoint served as the control.
2.2 VrNAC13 cloning
Frozen mung bean leaves were ground to powder in liquid nitrogen [24]. RNA was extracted using a Transzol Kit (Gold, Beijing). RNA integrity was visualized with 1% agarose gel electrophoresis. cDNA was synthesized with a Transscript All In One First Strand cdnasvtheis Supermax for qPCR (One Step gDNA Removal) Reverse Transcription Kit [25]. oligo7 was used to design 21-bp primers specific for VrNAC13 [26] (Table 1). The primers had no predicted secondary structure, low mismatch rates, and high specificity. Cloning was carried out via PCR using the mung bean cDNA as a template. The reactions were carried out in a 50-µl system containing 5 µl template cDNA (as required), 1 µl of each primers (10 μM), 5 µl buffer, 4 µl dNTPs (0.2 mM), 1 µl DNA polymerase(5units), and 33 µl nuclease-free water. The thermocycling protocol was as follows: pre-denaturation at 94°C for 3 min; 30 cycles of denaturation at 94°C for 15 s, annealing at 56°C for 15 s, and extension at 72°C for 1 min; and then 72°C for 7 min. Ultraviolet gel imager (Bio Rad) was used for imaging. Connect the PCR-amplified VrNAC13 gene with the PMD-19T vector and then transform it into Escherichia coli DH5α. Conduct culture, then select monoclonal cells to propagate in liquid culture medium, use PCR to identify the strains, and after ensuring correct identification, and send them to Shanghai Biotechnology Co., Ltd. for sequencing. Extract plasmids from the correct sequencing bacterial solution and store them at −20°C.
Primers used in this study
| Primer name | Sequence (5–3′) | Purpose | Product length (bp) |
|---|---|---|---|
| VrNAC13-F | GAAGCTAGAACCGTGACCATC | Gene cloning | 1,068 |
| VrNAC13-R | CTAACCCAGTATCCACCCTAT | ||
| Q-VrNAC13-F | GTTCCTCTTCCTGTCGCCATCATC | qRT-PCR | 101 |
| Q-VrNAC13-R | AAGTACCACTCTTGCTCGCCAAAC | ||
| Vigna-actin-F | GTCGCACCACCAGAGAGGAAATAC | Internal reference gene | 99 |
| Vigna-actin-R | ATACTCAGCCTTCGCAATCCACATC | ||
| ADfra1-F | CGGAATTCACGGGGGACTCTAGAATGAAT | Yeast transcriptional activation assay | 458 |
| ADfra1-R | CGGGATCCCTGCCAACAAGCCGGTACTCG | ||
| ADfra12-F | CGGGATCCGAAGCTGAAACTGTTGCCTCA | Yeast transcriptional activation assay | 623 |
| ADfra2-R | CGGAATTCCGAGTACCGGCTTGTTGGCAG | ||
| ADfra3-F | CGGAATTCACGGGGGACTCTAGAATGAAT | Yeast transcriptional activation assay | 685 |
| ADfra3-R | CGGGATCCTGGTGTTATTGTTGGCCATTG | ||
| ADfra4-F | CGGAATTCACGGGGGACTCTAGAATGAAT | Yeast transcriptional activation assay | 1,060 |
| ADfra4-R | CGGGATCCGAAGCTGAAACTGTTGCCTCA |
2.3 Bioinformatics analysis
DNAMAN was used to analyze the nucleic acid composition and to translate the nucleic acid sequence to an aa sequence. The basic physical and chemical properties of VrNAC13 were analyzed with DNAMAN software. The secondary protein structure was predicted with SOPMA (http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_sopma.html, accessed on 14 May 2022). The tertiary protein structure was predicted with Phyre2 (http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index, accessed on 14 May 2022). Protein domain analysis was conducted on the NCBI website using the Conserved Domains Database (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi, accessed on 14 May 2022). Phosphorylation sites were predicted with NetPhos3.1 (http://www.cbs.dtu.dk/services/NetPhos/, accessed on 14 May 2022). All known NAC sequences in Arabidopsis were downloaded from The Arabidopsis Information Resource (https://www.arabidopsis.org/index.jsp, accessed on 14 May 2022). A phylogenetic tree was constructed in MEGA5.10 using the Arabidopsis sequences and VrNAC13. BDGP (https://www.fruitfly.org/seq_tools/promoter.html, accessed on 14 May 2022) was used to predict the transcription initiation site and putative core promoter regions in VrNAC13. Cis-acting elements in the promoter region of VrNAC13 were predicted with PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 14 may 2022) [27,28,29].
2.4 Verification of VrNAC13 transcriptional activity
Based on the structural characteristics of VrNAC13, the gene was divided into four parts (fra1, fra2, fra3, and fra4). Primers were designed for each of these fragments (ADfra1, ADfra2, ADfra3, and ADfra4, respectively) (Table 1). Each of the corresponding target fragments was amplified using these primers, and then they were inserted into the pGBKT7-BD vector (linearized with EcoRI and BamHI). The resulting recombinant vectors were named pGBKT7-fra1, pGBKT7-fra2, pGBKT7-fra3, and pGBKT7-fra4, respectively. E. coli was transformed with each vector separately to generate four strains, each containing a plasmid with one fragment. Transformants were screened with kanamycin, positive colonies were selected, and the target plasmid was extracted. The target plasmids were each transferred into competent yeast cells (Clontech) following the manufacturer’s instructions. The strains containing the pGBKT7-p53 + pGADT7-largeT and the pGBKT7-LamC + pGADT7-largeT vectors were used as the positive and negative controls, respectively. Transformed yeast cells were grown on solid SD/-Trp/+ 5Mm3-AT medium for three days. After colonies had grown, X-Gal was added and interactions were determined based on colony color.
2.5 VrNAC13 expression analysis
To determine tissue-specific VrNAC13 expression, the top leaves of the first three compound leaves and the roots and stems were collected from untreated plants. For abiotic stress experiments, samples were collected as described above. For all samples, RNA was extracted and cDNA was generated as described above. qRT-PCR was conducted on a CFX96 Real-Time System (Bio-Rad) using VrNAC13-specific primers (Table 1). The mung bean ACTIN gene served as the internal reference for gene expression normalization. VrNAC13 expression levels were normalized using the 2−ΔΔCt method [30].
3 Results
3.1 Cloning and sequence analysis of VrNAC13
VrNAC13 was sequenced and determined to be 1,068 bp in length (Figure 1a). The start codon was ATG and the stop codon was TAG. The nucleotide content was 28.1% A, 25.9% T, 23.7% C, and 22.3% G. There were no unresolved nucleotides in the sequence (Figure 1b).

Analysis of VrNAC13 structure and content. (a) Visualization of amplified VrNAC13 with 1% agarose gel electrophoresis. M, Trans2K Plus DNA Marker. (b) Nucleotide content of VrNAC13 as determined by sequencing.
3.2 Physical and chemical properties of VrNAC13
The amino acid sequence of VrNAC13 was next analyzed (Figure 2). A NAM domain was predicted, comprising residues 19–145 (Figure 2a). VrNAC13 was 355 amino acids (aa) in length (Figure 2b) with a molecular weight of 39.9 KDa and an isoelectric point of 9.51. Ser was the most abundant residue at 13.52%, whereas Cys was the least abundant (0.56%). The protein contained 39 positively or negatively charged residues (Arg or Lys and Asp or Glu, respectively). ProtScale was used to analyze the hydrophilic and hydrophobic properties of VrNAC13 (Figure 2c). The lower the score, the stronger the hydrophilicity; the higher the score, the stronger the hydrophobicity. The protein encoded by VrNAC13 is in the region with score <0, which is significantly more than that with score >0. It is predicted that VrNAC13 is a hydrophilic protein.

Physical and chemical properties of VrNAC13. Predictions of the conserved domains (a), amino acid composition (b), and hydrophobicity of each region (c) in VrNAC13.
3.3 Prediction and analysis of phosphorylation sites in VrNAC13
Phosphorylation sites in VrNAC13 were predicted with NetPhos3.1. The protein was predicted to contain 11 threonine phosphorylation sites (Figure 3).

Predicted phosphorylation sites within VrNAC13.
3.4 Predicted secondary and tertiary structures of VrNAC13
SOPMA and Phyre2 were used to predict the structure of VrNAC13 at the secondary and tertiary levels (Figure 4). The secondary structure of VrNAC13 was predicted to be 14.08% α-helixes (50 aa), 67.04% random coils (238 aa), 16.06% extended chains (57 aa), and 2.82% β-turns (10 aa) (Figure 4a). The main spatial structure of VrNAC13 protein is composed of α-Helix and irregular curl constitute, which is consistent with the secondary structure prediction analysis.

Predicted secondary (a) and tertiary (b) structures of VrNAC13.
3.5 Phylogenetic analysis of VrNAC13
Amino acid sequences of all predicted NAC proteins in Arabidopsis were collected, totaling 241 proteins. These sequences and VrNAC13 were used to construct a phylogenetic tree in MEGA5.10 using the maximum likelihood method. The 242 proteins were grouped into 10 categories (labeled I–X) (Figure 5). VrNAC13 and 31 Arabidopsis NAC proteins clustered together in subclass Ⅹ. The genes in each subclass had similar predicted functions, and we therefore hypothesized that VrNAC13 was similar in function to the proteins encoded by AT1G60380.1 and AT5G50820.1, which had the highest similarity scores with VrNAC13.

Phylogenetic analysis of VrNAC13 and Arabidopsis thaliana NAC proteins.
3.6 Verification of transcriptional activation in VrNAC13
Conserved domain analysis indicated that VrNAC13 was divided into four parts: the first, from nucleotides 1 to 458, encoded the NAM domain. The second spanned positions 437–1,060 and was the sequence from which the NAM domain was removed. The third component was from positions 1 to 685 and contained C-terminal sequences on the basis of the NAM domain. The fourth part, from position 1 to position 1060, comprised the entire ORF. The positive control was blue when grown on SD/-Trp/X-α-gal + 5 mM 3-AT medium. Yeast transformed with the pGBKT7-fra2 or pGBKT7-fra4 vectors was also blue, indicating that VrNAC13 had an active domain with transcriptional activation activity (Figure 6).

Analysis of the transcriptional activation activity of VrNAC13. Yeast was transformed with the recombinant vectors pGBKT7-fra1, pGBKT7-fra2, pGBKT7-fra3, and pGBKT7-fra4. pGBKT7-53 + pGADT7-largeT (P) was the positive control and pGBKT7 -LamC + pGADT7-largeT (N) was the negative control.
3.7 Sequence analysis of the VrNAC13 promoter
BDGP was used to predict the transcription initiation site of VrNAC13. This analysis revealed three potential core promoter regions, located from −955 to −905 bp, from −875 to −825 bp, and from −137 to −87 bp. The associated scores were 0.89, 0.87, and 0.92, respectively, and the possible transcription initiation sites were A, G, and A, respectively, the higher the score, the greater the possibility that the region is the core promoter region. The region from −137 to −87 bp had the highest score in addition to a TATA box ∼20–30 bp upstream and a CAAT box ∼70–80 bp upstream, indicating that that region was the most likely core promoter region of the gene; the transcription initiation site was at 2,362 bp. The cis-acting element prediction tool PlantCARE was used to analyze VrNAC13, and this analysis showed that the promoter contained not only core elements (such as the CAAT-box and the TATA-box) but also response elements for hormones such as abscisic acid (ABRE element) and gibberellin (GAREmotif). Predicted cis-acting elements, including stress response elements (LTRs) and light response elements (AREs), are shown in Table 2.
Analysis of predicted cis-acting elements in the VrNAC13 promoter
| Element type | Element name | Copy number | Motif sequence | Function |
|---|---|---|---|---|
| Basal element | TATA-box | 2 | TATA/ATATAA/TATACA | Core promoter element |
| CAAT-box | 16 | CAATT/CAAT/CCAAT | Common cis-acting element in promoter and enhancer regions | |
| Phytohormone response | ABRE | 1 | ACGTG | Cis-acting elements involved in abscisic acid reaction |
| CGTCA-motif | 1 | CGTCA | Cis-acting regulatory element involved in methyl jasmonate (MeJA) responsiveness | |
| TGACG-motif | 1 | TGACG | Cis-acting regulatory element involved in the MeJA-responsiveness | |
| Light response | G-box | 1 | TACGTG | Cis-acting regulatory element involved in light responsiveness |
| AE-box | 1 | AGAAACTT | Component of light response module | |
| GATA-motif | 1 | GATAGGA | Component of light-responsive element | |
| GT1-motif | 1 | GGTTAA | Light-responsive element | |
| CAG-motif | 1 | GAAAGGCAGAC | Component of light-response element | |
| Stress response | LTR | 1 | CCGAAA | Cis-acting element involved in low-temperature responsiveness |
| ARE | 1 | AAACCA | Cis-acting regulatory element essential for anaerobic induction | |
| Other | ABRE3a | 1 | TACGTG | |
| WRE3 | 2 | CCACCT | ||
| ABRE4 | 1 | CACGTA | ||
| W box | 1 | TTGACC | ||
| as-1 | 1 | TGACG | ||
| box S | 1 | AGCCACC |
3.8 Response of VrNAC13 to drought and ABA stress
To clarify the function of VrNAC13, expression levels of this gene in three different tissues and in response to stress conditions were analyzed with qRT-PCR (Figure 7). VrNAC13 was found to be specifically expressed in the leaves, with relatively low expression in the roots and stems. Drought stress was carried out and analyzed at several stages: T1, the stage in which there were clear differences in stomatal conductance between the leaves of the drought-stressed group and the control group; T2, the stage in which there were clear differences in relative leaf water content between the drought-stressed group and the control; T3, the stage in which mung bean leaves were visibly wilted; and T4, the stage in which plants were re-hydrated. Drought stress was found to significantly promote VrNAC13 expression in the leaves, with relative expression levels peaking at T3. There were no significant differences in VrNAC13 levels between the control and T4 plants. Expression levels were also assessed at several timepoints after treatment with ABA, an important stress hormone that regulates plant physiological processes and drought responses. There were significant differences in VrNAC13 expression between timepoints after ABA treatment; VrNAC13 levels first decreased and then increased again, peaking at 8 h at a level below that of the untreated control. This indicated that VrNAC13 was induced by drought and inhibited by ABA treatment (Figure 7).

Expression levels of VrNAC13 in multiple tissues and after treatment with abiotic stressors. (a) VrNAC13 expression in three mung bean tissues. (b) VrNAC13 expression in response to drought. CK, control (untreated). T1, the stage in which there were clear differences in stomatal conductance between the leaves of the drought-stressed group and the control group. T2, the stage in which there were clear differences in relative leaf water content between the drought-stressed group and the control. T3, the stage in which mung bean leaves were visibly wilted. T4, the stage after rehydration treatment. (c) VrNAC13 expression in response to exogenous treatment with 100 µmol/l abscisic acid (ABA). Lowercase and uppercase letters indicate statistical significance groups at p < 0.05 and p < 0.01, respectively.
4 Discussion
Non-biotic stress triggers a wide range of plant responses, including gene expression, cell metabolism, plant growth and development, and crop yield. In recent years, multiple transcription factors have been confirmed to participate in the regulation of growth and development, defense regulation, and stress response in different types of plants [31,32,33,34]. As one of the largest TF families in plants, NAC has been proven to play an important role in drought stress [35,36,37,38].
Members of the NAC transcription factor family have important roles in numerous plant processes. Studies have shown that these genes play key roles in plant growth, development, stress responses, and specialized metabolite biosynthesis. It is of great significance to study the roles of NAC genes in plant growth and development and in responses to biotic and abiotic stresses, ultimately to develop plants that can more effectively resist drought. In the present study, VrNAC13 was cloned from mung bean. Sequence analysis showed that VrNAC13 was 1,068 bp in length and contained 28.1% A, 25.9% T, 23.7% C, and 22.3% G content. There were no unresolved nucleotides from the sequencing process. The gene encodes 355 amino acids, and conserved domain analysis revealed the presence of a conserved NAM domain and an AD transcriptional activation domain at the C-terminal (from nucleotide positions 437–1,060). The latter was validated with a yeast transcriptional activation experiment. This is consistent with previous research on NAC transcription factors such as Chickpea (Cicer arietinum L.) [39] and Soybean (Glycine max) [40] and conforms to the structural characteristics of NAC transcription factors. VrNAC13 was predicted to have 11 threonine phosphorylation sites, suggesting that this protein may be modified and regulated through phosphorylation. Phylogenetic analysis of VrNAC13 and Arabidopsis NAC VrNAC13 shared the highest levels of similarity with AT1G60380.1 and AT5G50820.1, and these two Arabidopsis proteins are primarily involved in transcriptional regulation, indicating that VrNAC13 may have a similar function in mung bean.
The promoter region is an important component in gene expression regulation. Cis-acting elements are specific sequences in the promoter that are bound by transcription factors. The type, number, sequence, and distance to other cis-elements affect their efficiency and strength in modulating the gene expression [41]. Analysis of the VrNAC13 promoter region revealed the presence of numerous cis-acting elements related to abiotic stress and responses to hormones, including ABA and methyl jasmonate (MeJA). Changes in ABA levels activate many stress-response genes that function to induce stomatal closure, thus reducing transpiration and maintaining internal water levels [42]. Numerous studies have shown that there are certain differences in the expression patterns of NAC transcription factor genes in different plants. For example, soybean GmNAC1 is mainly expressed in roots and flower buds, while GmNAC2 is strongly expressed in leaves, stems, and seeds, and weakly expressed in roots, flower buds, and pods. GmNAC3 is highly expressed in leaves, flower buds, and pods, but relatively low in seed development [43]. VrNAC13 is highly expressed in leaves after drought treatment, and we speculate that this gene may be involved in material transport during plant growth. VrNAC13 showed significant expression changes over time after ABA treatment. Overall, compared to the control sample, VrNAC13 was inhibited in the ABA-treated sample, which is consistent with previous research on tartary buckwheat FtNAC11 [44]. These expression dynamics and the presence of an ABA-responsive cis-element in the VrNAC13 promoter suggested that VrNAC13 regulated the responses of mung bean leaves to drought via the ABA pathway.
At present, northern China is facing increasingly common drought conditions. As a result, there is heightened dependence on molecular biological methods of crop management. It is particularly important to identify and clone drought-resistance genes to allow their transfer into drought-sensitive crops. This will allow researchers to cultivate new drought-resistant transgenic crop varieties that can not only make use of arid soil but also contribute to water-saving efforts and sustainable agricultural development. We here analyzed the basic structure of VrNAC13 at the nucleic acid and protein levels and predicted its function as a drought-response gene. Future experiments should further explore the function of VrNAC13 through exogenous expression in another system (e.g., Arabidopsis) and subsequent observation of transgenic plant responses to a range of stressors. This would allow preliminary verification of VrNAC13 function and ultimately clarify the stress resistance mechanism in which VrNAC13 functions, laying a molecular foundation for stress-resistant mung bean breeding.
5 Conclusion
This study cloned VrNAC13 and analyzed its structure. Based on qRT-PCR, the tissue expression specificity and expression after different treatments were analyzed to elucidate the structural and functional characteristics of the VrNAC13 gene, laying a foundation for drought resistance molecular breeding in mung beans.
-
Funding information: This work was financially supported by the National Natural Science Foundation of China (31960432); General Project in the Agricultural Field of Shaanxi Provincial Department of Science and Technology (2021NY-201).
-
Author contributions: Siyu Zhang carried out the experiment and prepared the draft of the manuscript. Yaning Guo and Fugang Wang conceived and designed the experiments. Jing Ai and Han Yao prepared the material. Yu Bai contributed to data analysis. All authors read and approved the final manuscript.
-
Conflict of interest: Authors state no conflict of interest.
-
Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
References
[1] Aida M, Ishida T, Fukaki H, Fujisawa H, Tasaka M. Genes involved in organ separation in Arabidopsis: an analysis of the cup-shaped cotyledon mutant. Plant Cell. 1997;9(6):841–57. 10.1105/tpc.9.6.841.Search in Google Scholar PubMed PubMed Central
[2] Souer E, van Houwelingen A, Kloos D, Mol J, Koes R. The no apical meristem gene of Petunia is required for pattern formation in embryos and flowers and is expressed at meristem and primordia boundaries. Cell. 1996;85(2):159–70. 10.1016/s0092-8674(00)81093-4.Search in Google Scholar PubMed
[3] Olsen AN, Ernst HA, Leggio LL, Skriver K. NAC transcription factors: structurally distinct, functionally diverse. Trends Plant Sci. 2005;10(2):79–87. 10.1016/j.tplants.2004.12.010.Search in Google Scholar PubMed
[4] Nakashima K, Takasaki H, Mizoi J, Shinozaki K, Yamaguchi-Shinozaki K. NAC transcription factors in plant abiotic stress responses. Biochim Biophys Acta. 2012;1819(2):97–103. 10.1016/j.bbagrm.2011.10.005.Search in Google Scholar PubMed
[5] Xia L, Sun S, Han B, Yang X. NAC domain transcription factor gene GhNAC3 confers drought tolerance in plants. Plant Physiol Biochem. 2023;195:114–23. 10.1016/j.plaphy.2023.01.005.Search in Google Scholar PubMed
[6] Hoang XLT, Nhi DNH, Thu NBA, Thao NP, Tran LP. Transcription Factors and Their Roles in Signal Transduction in Plants under Abiotic Stresses. Curr Genomics. 2017;18(6):483–97. 10.2174/1389202918666170227150057.Search in Google Scholar PubMed PubMed Central
[7] Zhang HJ, Hu ZC, Lv XL, Wang HO, Qiu CT. Overview and development analysis of mung bean processing and utilization in China. Jiangsu Agric Sci. 2014;42:234–6. 10.15889/j.issn.1002-1302.2014.01.050.Search in Google Scholar
[8] Hou D, Yousaf L, Xue Y, Hu J, Wu J, Hu X, et al. Mung bean (Vigna radiata L.): bioactive polyphenols, polysaccharides, peptides, and health benefits. Nutrients. 2019;11(6):1238. 10.3390/nu11061238.Search in Google Scholar PubMed PubMed Central
[9] Luo GL, Huang TF, Cai QS, Chen YH, Li JC. Adaptability test of mung bean varieties. China Seed Ind. 2015;241(4):51–2. 10.19462/j.cnki.1671-895x.2015.04.024.Search in Google Scholar
[10] Hu YY, Zhang X. Experimental and technical key points of mulch bean intercropping cultivation in Yulin city, Shaanxi province. Agric Eng Technol. 2020;40:66–8. 10.16815/j.cnki.11-5436/s.2020.35.038.Search in Google Scholar
[11] Hu YY. Current situation and development countermeasures of mung bean industry in Yulin. Agric Technol. 2014;34:122–5. 10.3969/j.issn.1671-962X.2014.03.098.Search in Google Scholar
[12] Lei JY. Present situation and development countermeasures of mung bean production in Yulin. Agric Sci Technol Newsl. 2013;500(8):44–6. 10.3969/j.issn.1000-6400.2013.08.018.Search in Google Scholar
[13] Ma L. Research on the development status, problems and countermeasures of small grain industry in Yulin. Thesis for M.S., Northwest University of Agriculture and Forestry Science and Technology; 2020. 10.27409/d.cnki.gxbnu.2020.001517.Search in Google Scholar
[14] Kang YJ, Kim SK, Kim MY, Lestari P, Kim KH, Ha BK, et al. Genome sequence of mungbean and insights into evolution within Vigna species. Nat Commun. 2014;5:5443. 10.1038/ncomms6443.Search in Google Scholar PubMed PubMed Central
[15] Luo J, Li R, Xu X, Niu H, Zhang Y, Wang C. SMRT and illumina RNA sequencing and characterization of a Key NAC gene LoNAC29 during the flower senescence in Lilium oriental ‘Siberia’. Genes (Basel). 2021;12(6):869. 10.3390/genes12060869.Search in Google Scholar PubMed PubMed Central
[16] Sakuraba Y, Kim D, Han SH, Kim SH, Piao W, Yanagisawa S, et al. Multilayered regulation of membrane-bound ONAC054 Is essential for abscisic acid-induced leaf senescence in rice. Plant Cell. 2020;32(3):630–49. 10.1105/tpc.19.00569.Search in Google Scholar PubMed PubMed Central
[17] Cao S, Zhang Z, Wang C, Li X, Guo C, Yang L, et al. Identification of a novel melon transcription factor CmNAC60 as a potential regulator of leaf senescence. Genes (Basel). 2019;10(8):584. 10.3390/genes10080584.Search in Google Scholar PubMed PubMed Central
[18] Hurtado FMM, Pinto MS, Oliveira PN, Riaño-Pachón DM, Inocente LB, Carrer H. Analysis of NAC domain transcription factor genes of tectona grandis L.f. involved in secondary cell wall deposition. Genes (Basel). 2019;11(1):20. 10.3390/genes11010020.Search in Google Scholar PubMed PubMed Central
[19] Ye Y, Wu K, Chen J, Liu Q, Wu Y, Liu B, et al. OsSND2, a NAC family transcription factor, is involved in secondary cell wall biosynthesis through regulating MYBs expression inrice. Rice (N Y). 2018;11(1):36. 10.1186/s12284-018-0228-z.Search in Google Scholar PubMed PubMed Central
[20] Li B, Fan R, Yang Q, Hu C, Sheng O, Deng G, et al. Genome-wide identification and characterization of the NAC transcription factor family in musa acuminata and expression analysis during fruit ripening. Int J Mol Sci. 2020;21(2):634. 10.3390/ijms21020634.Search in Google Scholar PubMed PubMed Central
[21] Li X, Cai K, Pei X, Li Y, Hu Y, Meng F, et al. Genome-wide identification of nac transcription factor family in juglans mandshurica and their expression analysis during the fruit development and ripening. Int J Mol Sci. 2021;22(22):12414. 10.3390/ijms222212414.Search in Google Scholar PubMed PubMed Central
[22] Yang S, Zhou J, Watkins CB, Wu C, Feng Y, Zhao X, et al. NAC transcription factors SNAC4 and SNAC9 synergistically regulate tomato fruit ripening by affecting expression of genes involved in ethylene and abscisic acid metabolism and signal transduction. Postharvest Biol Technol. 2021;178:111555. 10.1016/j.postharvbio.2021.111555.Search in Google Scholar
[23] Shalby N, Mohamed IAA, Xiong J, Hu K, Yang Y, Nishawy E, et al. Overdominance at the gene expression level plays a critical role in the hybrid root growth of brassica napus. Int J Mol Sci. 2021;22(17):9246. 10.3390/ijms22179246.Search in Google Scholar PubMed PubMed Central
[24] Guo YN, Zhang PP, Luo Y, Chen RF, Zhang X. Identification and bioinformatics analysis of mung bean vrnac transcription factors. Shaanxi Agric Sci. 2021;67(4):29–34. 10.3969/j.issn.0488-5368.2021.04.006.Search in Google Scholar
[25] Yao HX, Li ZL, Zhao YR, Cheng LJ, Yang HN, Wang YY. Cloning and bioinformatics analysis of ccmyb8 gene from YeYilan. North Horticulture. 2021;489(18):75–80. 10.11937/bfyy.20210492.Search in Google Scholar
[26] Rychlik W. OLIGO 7 primer analysis software. Methods Mol Biol. 2007;402:35–60. 10.1007/978-1-59745-528-2_2.Search in Google Scholar PubMed
[27] Jalal A, Ali Q, Manghwar H, Zhu D. Identification, phylogeny, divergence, structure, and expression analysis of A20/AN1 zinc finger domain containing stress-associated proteins (SAPs) genes in jatropha curcas l. Genes (Basel). 2022;13(10):1766. 10.3390/genes13101766.Search in Google Scholar PubMed PubMed Central
[28] Jalal A, Sun J, Chen Y, Fan C, Liu J, Wang C. Evolutionary analysis and functional identification of clock-associated PSEUDO-RESPONSE REGULATOR (PRRs) genes in the flowering regulation of Roses. Int J Mol Sci. 2022;23(13):7335. 10.3390/ijms23137335.Search in Google Scholar PubMed PubMed Central
[29] Liu J, Wu S, Sun J, Sun J, Wang H, Cao X, et al. Genome-wide analysis reveals widespread roles for RcREM genes in floral organ development in Rosa chinensis. Genomics. 2021;113(6):3881–94. 10.1016/j.ygeno.2021.09.017.Search in Google Scholar PubMed
[30] Jing LF, Zhang PP, Miao YP, Chen T, Liu Y, Yang DL. Cloning and expression analysis of TaSPP gene in sss wheat. North China J Agric Sci. 2022;37:28–34. 10.7668/hbnxb.20192653.Search in Google Scholar
[31] Wani SH, Anand S, Singh B, Bohra A, Joshi R. WRKY transcription factors and plant defense responses: latest discoveries and future prospects. Plant Cell Rep. 2021;40(7):1071–85. 10.1007/s00299-021-02691-8.Search in Google Scholar PubMed
[32] Li P, Xia E, Fu J, Xu Y, Zhao X, Tong W, et al. Diverse roles of MYB transcription factors in regulating secondary metabolite biosynthesis, shoot development, and stress responses in tea plants (Camellia sinensis). Plant J. 2022;110(4):1144–65. 10.1111/tpj.15729.Search in Google Scholar PubMed
[33] Goossens J, Mertens J, Goossens A. Role and functioning of bHLH transcription factors in jasmonate signalling. J Exp Bot. 2017;68(6):1333–47. 10.1093/jxb/erw440.Search in Google Scholar PubMed
[34] Diao P, Chen C, Zhang Y, Meng Q, Lv W, Ma N. The role of NAC transcription factor in plant cold response. Plant Signal Behav. 2020;15(9):1785668. 10.1080/15592324.2020.1785668.Search in Google Scholar PubMed PubMed Central
[35] Thirumalaikumar VP, Devkar V, Mehterov N, Ali S, Ozgur R, Turkan I, et al. NAC transcription factor JUNGBRUNNEN1 enhances drought tolerance in tomato. Plant Biotechnol J. 2018;16(2):354–66. 10.1111/pbi.12776.Search in Google Scholar PubMed PubMed Central
[36] Yuan X, Wang H, Cai J, Bi Y, Li D, Song F. Rice NAC transcription factor ONAC066 functions as a positive regulator of drought and oxidative stress response. BMC Plant Biol. 2019;19(1):278. 10.1186/s12870-019-1883-y.Search in Google Scholar PubMed PubMed Central
[37] Wang Q, Guo C, Li Z, Sun J, Deng Z, Wen L, et al. Potato NAC transcription factor StNAC053 enhances salt and drought tolerance in transgenic arabidopsis. Int J Mol Sci. 2021;22(5):2568. 10.3390/ijms22052568.Search in Google Scholar PubMed PubMed Central
[38] Mao H, Li S, Chen B, Jian C, Mei F, Zhang Y, et al. Variation in cis-regulation of a NAC transcription factor contributes to drought tolerance in wheat. Mol Plant. 2022;15(2):276–92. 10.1016/j.molp.2021.11.007.Search in Google Scholar PubMed
[39] Peng H, Yu X, Cheng H, Shi Q, Zhang H, Li J, et al. Cloning and characterization of a novel NAC family gene CarNAC1 from chickpea (Cicer arietinum L.). Mol Biotechnol. 2010 Jan;44(1):30–40. 10.1007/s12033-009-9202-8.Search in Google Scholar PubMed
[40] Li M, Chen R, Jiang Q, Sun X, Zhang H, Hu Z. GmNAC06, a NAC domain transcription factor enhances salt stress tolerance in soybean. Plant Mol Biol. 2021;105(3):333–45. 10.1007/s11103-020-01091-y.Search in Google Scholar PubMed PubMed Central
[41] Jin H, Xing M, Cai C, Li S. B-box proteins in arachis duranensis: genome-wide characterization and expression profiles analysis. Agronomy. 2020;10:1–23. 10.3390/agronomy10010023.Search in Google Scholar
[42] Chen K, Li GJ, Bressan RA, Song CP, Zhu JK, Zhao Y. Abscisic acid dynamics, signaling, and functions in plants. J Integr Plant Biol. 2020;62(1):25–54. 10.1111/jipb.12899.Search in Google Scholar PubMed
[43] Meng Q, Zhang C, Gai J, Yu D. Molecular cloning, sequence characterization and tissue-specific expression of six NAC-like genes in soybean (Glycine max (L.) Merr.). J Plant Physiol. 2007;164(8):1002–12. 10.1016/j.jplph.2006.05.019.Search in Google Scholar PubMed
[44] Wang J, Ma Z, Tang B, Yu H, Tang Z, Bu T, et al. Tartary buckwheat (Fagopyrum tataricum) NAC transcription factors FtNAC16 negatively regulates of pod cracking and salinity tolerant in arabidopsis. Int J Mol Sci. 2021;22(6):3197. 10.3390/ijms22063197.Search in Google Scholar PubMed PubMed Central
© 2023 the author(s), published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Articles in the same Issue
- Biomedical Sciences
- Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
- Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
- Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
- Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
- A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
- Neutrophilia with subclinical Cushing’s disease: A case report and literature review
- Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
- Immunoregulation of synovial macrophages for the treatment of osteoarthritis
- Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
- Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
- Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
- High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
- Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
- Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
- Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
- Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
- Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
- Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
- Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
- Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
- Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
- Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
- Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
- 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
- Experimental study on the optimization of ANM33 release in foam cells
- Primary retroperitoneal angiosarcoma: A case report
- Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
- Malignant pleural effusion diagnosis and therapy
- Effect of spaceflight on the phenotype and proteome of Escherichia coli
- Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
- Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
- Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
- The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
- Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
- mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
- The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
- Radiotherapy for primary thyroid adenoid cystic carcinoma
- Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
- Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
- Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
- Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
- PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
- The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
- Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
- Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
- NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
- Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
- Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
- Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
- Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
- Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
- Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
- Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
- Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
- Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
- Gemella morbillorum infective endocarditis: A case report and literature review
- An unusual ectopic thymoma clonal evolution analysis: A case report
- Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
- Detection of V. vulnificus septic shock with ARDS using mNGS
- Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
- The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
- Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
- ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
- Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
- Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
- Collagen changes in rabbit conjunctiva after conjunctival crosslinking
- Effects of NM23 transfection of human gastric carcinoma cells in mice
- Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
- Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
- Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
- Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
- Giant duplication of the transverse colon in an adult: A case report and literature review
- Ectopic thyroid tissue in the breast: A case report
- SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
- Vaginal metastasis from breast cancer: A case report
- Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
- Inhibition of TAZ impairs the migration ability of melanoma cells
- Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
- Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
- Identification of winter wheat pests and diseases based on improved convolutional neural network
- Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
- Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
- Immune checkpoint inhibitors in cancer patients with COVID-19
- Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
- Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
- Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
- DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
- Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
- Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
- Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
- Studying infant mortality: A demographic analysis based on data mining models
- Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
- Protein Z modulates the metastasis of lung adenocarcinoma cells
- Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
- TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
- Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
- Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
- Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
- Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
- Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
- HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
- Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
- Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
- Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
- Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
- Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
- Research progress on gas signal molecular therapy for Parkinson’s disease
- Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
- The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
- α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
- CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
- Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
- Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
- Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
- Research progress of AMP-activated protein kinase and cardiac aging
- TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
- Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
- Metastasis from small cell lung cancer to ovary: A case report
- The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
- The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
- Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
- Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
- Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
- Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
- Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
- Traumatic brain injury and rTMS-ERPs: Case report and literature review
- Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
- Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
- The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
- Inflammation-related signaling pathways in tendinopathy
- CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
- Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
- Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
- Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
- Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
- Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
- Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
- TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
- Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
- Ferroptosis: A potential target of macrophages in plaque vulnerability
- Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
- Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
- HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
- IL-17 in osteoarthritis: A narrative review
- Circadian cycle and neuroinflammation
- Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
- Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
- SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
- Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
- PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
- Pancreatic ectopic thyroid tissue: A case report and analysis of literature
- The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
- Report on a case of liver-originating malignant melanoma of unknown primary
- Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
- The fibroblast growth factor–Klotho axis at molecular level
- Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
- A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
- Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
- Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
- Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
- Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
- Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
- Case report of atypical undernutrition of hypoproteinemia type
- Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
- Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
- Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
- Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
- Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
- Precisional detection of lymph node metastasis using tFCM in colorectal cancer
- Advances in diagnosis and treatment of perimenopausal syndrome
- A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
- Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
- Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
- Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
- Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
- Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
- Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
- An online diagnosis method for cancer lesions based on intelligent imaging analysis
- Medical imaging in rheumatoid arthritis: A review on deep learning approach
- Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
- Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
- A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
- TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
- Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
- Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
- Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
- Hepatobiliary surgery based on intelligent image segmentation technology
- Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
- Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
- Early diagnosis for the onset of peri-implantitis based on artificial neural network
- Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
- Forecast of pain degree of lumbar disc herniation based on back propagation neural network
- SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
- Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
- Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
- A novel approach for minimising anti-aliasing effects in EEG data acquisition
- ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
- Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
- Lung nodule segmentation via semi-residual multi-resolution neural networks
- Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
- A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
- Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
- Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
- Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
- Monitoring and evaluation of anesthesia depth status data based on neuroscience
- Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
- Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
- Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
- Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
- Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
- From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
- Ecology and Environmental Science
- Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
- Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
- Effects of cadmium stress on fruits germination and growth of two herbage species
- Bamboo charcoal affects soil properties and bacterial community in tea plantations
- Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
- Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
- Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
- Food Science
- Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
- Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
- Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
- Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
- Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
- Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
- Microbiological transglutaminase: Biotechnological application in the food industry
- Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
- Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
- The potential for the use of leghemoglobin and plant ferritin as sources of iron
- Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
- Bioengineering and Biotechnology
- Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
- Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
- Agriculture
- Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
- On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
- Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
- A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
- Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
- Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
- Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
- Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
- Animal Sciences
- Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
- Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
- Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
- Tracking behavioral changes of confined sows from the first mating to the third parity
- The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
- Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
- Plant Sciences
- Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
- Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
- Tissue culture and rapid propagation technology for Gentiana rhodantha
- Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
- Cloning and expression analysis of VrNAC13 gene in mung bean
- Chlorate-induced molecular floral transition revealed by transcriptomes
- Effects of warming and drought on growth and development of soybean in Hailun region
- Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
- Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
- Distinguish Dianthus species or varieties based on chloroplast genomes
- Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
- Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
- An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
- Erratum
- Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
- Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
- Retraction
- Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
Articles in the same Issue
- Biomedical Sciences
- Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
- Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
- Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
- Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
- A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
- Neutrophilia with subclinical Cushing’s disease: A case report and literature review
- Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
- Immunoregulation of synovial macrophages for the treatment of osteoarthritis
- Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
- Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
- Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
- High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
- Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
- Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
- Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
- Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
- Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
- Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
- Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
- Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
- Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
- Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
- Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
- 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
- Experimental study on the optimization of ANM33 release in foam cells
- Primary retroperitoneal angiosarcoma: A case report
- Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
- Malignant pleural effusion diagnosis and therapy
- Effect of spaceflight on the phenotype and proteome of Escherichia coli
- Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
- Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
- Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
- The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
- Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
- mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
- The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
- Radiotherapy for primary thyroid adenoid cystic carcinoma
- Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
- Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
- Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
- Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
- PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
- The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
- Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
- Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
- NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
- Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
- Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
- Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
- Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
- Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
- Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
- Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
- Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
- Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
- Gemella morbillorum infective endocarditis: A case report and literature review
- An unusual ectopic thymoma clonal evolution analysis: A case report
- Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
- Detection of V. vulnificus septic shock with ARDS using mNGS
- Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
- The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
- Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
- ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
- Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
- Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
- Collagen changes in rabbit conjunctiva after conjunctival crosslinking
- Effects of NM23 transfection of human gastric carcinoma cells in mice
- Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
- Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
- Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
- Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
- Giant duplication of the transverse colon in an adult: A case report and literature review
- Ectopic thyroid tissue in the breast: A case report
- SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
- Vaginal metastasis from breast cancer: A case report
- Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
- Inhibition of TAZ impairs the migration ability of melanoma cells
- Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
- Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
- Identification of winter wheat pests and diseases based on improved convolutional neural network
- Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
- Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
- Immune checkpoint inhibitors in cancer patients with COVID-19
- Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
- Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
- Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
- DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
- Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
- Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
- Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
- Studying infant mortality: A demographic analysis based on data mining models
- Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
- Protein Z modulates the metastasis of lung adenocarcinoma cells
- Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
- TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
- Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
- Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
- Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
- Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
- Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
- HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
- Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
- Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
- Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
- Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
- Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
- Research progress on gas signal molecular therapy for Parkinson’s disease
- Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
- The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
- α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
- CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
- Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
- Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
- Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
- Research progress of AMP-activated protein kinase and cardiac aging
- TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
- Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
- Metastasis from small cell lung cancer to ovary: A case report
- The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
- The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
- Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
- Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
- Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
- Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
- Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
- Traumatic brain injury and rTMS-ERPs: Case report and literature review
- Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
- Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
- The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
- Inflammation-related signaling pathways in tendinopathy
- CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
- Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
- Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
- Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
- Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
- Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
- Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
- TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
- Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
- Ferroptosis: A potential target of macrophages in plaque vulnerability
- Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
- Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
- HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
- IL-17 in osteoarthritis: A narrative review
- Circadian cycle and neuroinflammation
- Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
- Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
- SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
- Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
- PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
- Pancreatic ectopic thyroid tissue: A case report and analysis of literature
- The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
- Report on a case of liver-originating malignant melanoma of unknown primary
- Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
- The fibroblast growth factor–Klotho axis at molecular level
- Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
- A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
- Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
- Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
- Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
- Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
- Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
- Case report of atypical undernutrition of hypoproteinemia type
- Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
- Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
- Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
- Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
- Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
- Precisional detection of lymph node metastasis using tFCM in colorectal cancer
- Advances in diagnosis and treatment of perimenopausal syndrome
- A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
- Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
- Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
- Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
- Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
- Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
- Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
- An online diagnosis method for cancer lesions based on intelligent imaging analysis
- Medical imaging in rheumatoid arthritis: A review on deep learning approach
- Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
- Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
- A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
- TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
- Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
- Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
- Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
- Hepatobiliary surgery based on intelligent image segmentation technology
- Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
- Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
- Early diagnosis for the onset of peri-implantitis based on artificial neural network
- Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
- Forecast of pain degree of lumbar disc herniation based on back propagation neural network
- SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
- Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
- Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
- A novel approach for minimising anti-aliasing effects in EEG data acquisition
- ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
- Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
- Lung nodule segmentation via semi-residual multi-resolution neural networks
- Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
- A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
- Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
- Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
- Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
- Monitoring and evaluation of anesthesia depth status data based on neuroscience
- Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
- Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
- Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
- Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
- Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
- From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
- Ecology and Environmental Science
- Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
- Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
- Effects of cadmium stress on fruits germination and growth of two herbage species
- Bamboo charcoal affects soil properties and bacterial community in tea plantations
- Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
- Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
- Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
- Food Science
- Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
- Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
- Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
- Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
- Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
- Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
- Microbiological transglutaminase: Biotechnological application in the food industry
- Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
- Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
- The potential for the use of leghemoglobin and plant ferritin as sources of iron
- Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
- Bioengineering and Biotechnology
- Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
- Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
- Agriculture
- Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
- On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
- Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
- A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
- Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
- Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
- Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
- Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
- Animal Sciences
- Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
- Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
- Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
- Tracking behavioral changes of confined sows from the first mating to the third parity
- The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
- Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
- Plant Sciences
- Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
- Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
- Tissue culture and rapid propagation technology for Gentiana rhodantha
- Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
- Cloning and expression analysis of VrNAC13 gene in mung bean
- Chlorate-induced molecular floral transition revealed by transcriptomes
- Effects of warming and drought on growth and development of soybean in Hailun region
- Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
- Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
- Distinguish Dianthus species or varieties based on chloroplast genomes
- Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
- Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
- An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
- Erratum
- Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
- Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
- Retraction
- Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”