Cloning and expression analysis of VrNAC13 gene in mung bean

Siyu Zhang; Jing Ai; Yaning Guo; Yu Bai; Han Yao; Fugang Wang

doi:10.1515/biol-2022-0627

Article Open Access

Cloning and expression analysis of VrNAC13 gene in mung bean

Siyu Zhang , Jing Ai , Yaning Guo , Yu Bai , Han Yao and Fugang Wang

Published/Copyright: July 6, 2023

Published by

Become an author with De Gruyter Brill

Submit Manuscript Author Information Explore this Subject

From the journal Open Life Sciences Volume 18 Issue 1

Abstract

To explore the role of NAC transcription factors in mung bean (Vigna ratiata), we here comprehensively analyzed VrNAC13 structure and expression patterns in the mung bean cultivar “Yulin No.1”. The nucleotide sequence of VrNAC13 (GenBank accession number xp014518431.1) was determined by cloning and sequencing the gene. A predicted transcriptional activation domain in VrNAC13 was validated with a yeast one-hybrid assay. The composition and functional characteristics of VrNAC13 were analyzed using basic bioinformatics techniques, and the expression characteristics of VrNAC13 were analyzed via quantitative reverse transcription-PCR. The results showed that VrNAC13 was 1,068 bp in length and encoded a product of 355 amino acids. VrNAC13 was predicted to contain a NAM domain and to belong to the NAC transcription factor family. The protein was hydrophilic and contained several threonine phosphorylation sites. Phylogenetic analysis showed that VrNAC13 was highly similar in sequence to two Arabidopsis thaliana NAC proteins; we hypothesize that VrNAC13 may perform functions in mung bean similar to those of the two closely related proteins in Arabidopsis. Promoter analysis of VrNAC13 revealed cis-acting elements predicted to respond to abscisic acid (ABA), gibberellin, auxin, light, drought, low temperature, and other stressors. VrNAC13 was most highly expressed in the leaves and expressed at very low levels in the stem and root. It was experimentally determined to be induced by drought and ABA. Based on these results, VrNAC13 appears to regulate stress resistance in mung bean.

Keywords: mung bean; VrNAC13 ; gene cloning; bioinformatics analysis; qRT-PCR

1 Introduction

The NAC family of transcription factors is a very large family that is found only in plants [1,2]. The family name is derived from those of several family members, namely NAM, ATAF1/2, and CUC1/2. Structurally, NAC transcription factors consist of a conserved N-terminal protein domain and a variable C-terminal transcriptional activation domain. The N-terminal domain contains five subdomains: A, B, C, D, and E. The structures of these subdomains are associated with nuclear localization and with the recognition and binding of downstream target gene sequences. The C-terminal domain is subject to transcriptional activation or inhibition [3]. Numerous studies have found that NAC transcription factors play important roles in plant growth, development, and stress responses and resistance [4,5,6].

Mung bean (Vigna ratiata L.) is an important crop plant in China. It is a popular dual-purpose crop for both food and medicine because it is rich in protein, vitamins, mineral elements, and other nutrients in addition to having medicinal value [7,8]. Mung bean is not only economically valuable and rich in nutrition, but it is also relatively hardy; it is drought resistant, requires minimal nutrient input, fixes nitrogen, and is suitable for intercropping with other plant species [9]. The Yulin mung bean production area has a unique environment with clean soil and air, sufficient light and heat resources, and high temperature variation between day and night; mung bean seeds from this area are large and have good color, strong germination potential, and are thus referred to as “green pearls” [10,11]. The Yulin area is located at the south edge of the Maowusu sandy land, which has less annual rainfall (mainly in July and August) and little rainfall from May to June. As a result, drought during the seedling stage is a key factor limiting the development of the mung bean industry in Yulin [12,13]. It is therefore desirable to cultivate mung bean germplasm with high yield and drought resistance to maintain the development of the mung bean industry. Publication of the mung bean genome [14] laid the foundation for molecular research in mung bean. Many studies have shown that NAC transcription factors have critical roles in plant growth and development, including in leaf and flower senescence [15,16,17], cell wall formation [18,19], fruit ripening [20,21,22], and root growth [23]. However, there have been few studies of NAC transcription factors in mung bean, and their functions in this economically valuable resource remain unexplored. Therefore, it is particularly important to identify important NAC transcription factors in mung bean, not only to enrich our understanding of these key transcription factors but also to lay a strong molecular foundation for the development of drought-resistant mung bean materials.

In this study, the transcriptome data obtained from mung bean were selected to analyze and predict the bioinformatics of the VrNAC13 gene and the transcriptional initiation site and cis-acting element of the promoter of the VrNAC13 gene. We then experimentally validated the transcriptional activation domain. Expression levels of VrNAC13 in major mung bean tissues were measured with quantitative reverse transcription (qRT)-PCR. This study revealed novel information about the function of VrNAC13 in the mung bean stress response and serves as a valuable reference for further study of NAC genes in mung bean.

2 Materials and methods

2.1 Test materials

Mung bean seeds of the cultivar “Yulv No.1” were provided by the Yulin University Agricultural Water Saving Research Group.

2.1.1 Gene cloning materials

Healthy, plump seeds were sterilized with 5% sodium hypochlorite and then dried for later use. Individual pots were filled with 600 g of nutritious soil. Five seeds were sown in each pot. The soil moisture content was maintained between 70 and 80% by weight. For drought experiments, when the first trifoliate compound leaf was flattened, plants were divided into a control group and a treatment group. The control group had normal water management, whereas water was withheld from the treatment group. When the relative water content of the first trifoliate compound leaf in the treated sample significantly differed from that of the control group, the top leaf in the treatment group was collected and frozen in liquid nitrogen for further analysis.

2.1.2 Gene expression analysis materials

Tissue-specific gene expression analysis

Plants were grown as described above. At the seedling stage, the roots, stems, and leaves were collected separately and frozen in liquid nitrogen for further analysis as described below.
Gene expression analysis in drought-stressed seedlings

Plants were grown as described above. The top 3 leaves of the first three leaves were collected from seedlings at four timepoints as described in Section 3.8.
Gene expression analysis in ABA-treated seedlings

Plants were grown as described above. At the seedling stage, 100 µmol/l ABA was sprayed on the top leaf of the first three leaves compound leaf. Leaves were collected at 0, 2, 4, 8, 12, and 24 h after treatment and flash-frozen in liquid nitrogen prior to further analysis. Samples collected at the 0 h timepoint served as the control.

2.2 VrNAC13 cloning

Frozen mung bean leaves were ground to powder in liquid nitrogen [24]. RNA was extracted using a Transzol Kit (Gold, Beijing). RNA integrity was visualized with 1% agarose gel electrophoresis. cDNA was synthesized with a Transscript All In One First Strand cdnasvtheis Supermax for qPCR (One Step gDNA Removal) Reverse Transcription Kit [25]. oligo7 was used to design 21-bp primers specific for VrNAC13 [26] (Table 1). The primers had no predicted secondary structure, low mismatch rates, and high specificity. Cloning was carried out via PCR using the mung bean cDNA as a template. The reactions were carried out in a 50-µl system containing 5 µl template cDNA (as required), 1 µl of each primers (10 μM), 5 µl buffer, 4 µl dNTPs (0.2 mM), 1 µl DNA polymerase(5units), and 33 µl nuclease-free water. The thermocycling protocol was as follows: pre-denaturation at 94°C for 3 min; 30 cycles of denaturation at 94°C for 15 s, annealing at 56°C for 15 s, and extension at 72°C for 1 min; and then 72°C for 7 min. Ultraviolet gel imager (Bio Rad) was used for imaging. Connect the PCR-amplified VrNAC13 gene with the PMD-19T vector and then transform it into Escherichia coli DH5α. Conduct culture, then select monoclonal cells to propagate in liquid culture medium, use PCR to identify the strains, and after ensuring correct identification, and send them to Shanghai Biotechnology Co., Ltd. for sequencing. Extract plasmids from the correct sequencing bacterial solution and store them at −20°C.

Table 1

Primers used in this study

Primer name	Sequence (5–3′)	Purpose	Product length (bp)
VrNAC13-F	GAAGCTAGAACCGTGACCATC	Gene cloning	1,068
VrNAC13-R	CTAACCCAGTATCCACCCTAT	Gene cloning	1,068
Q-VrNAC13-F	GTTCCTCTTCCTGTCGCCATCATC	qRT-PCR	101
Q-VrNAC13-R	AAGTACCACTCTTGCTCGCCAAAC	qRT-PCR	101
Vigna-actin-F	GTCGCACCACCAGAGAGGAAATAC	Internal reference gene	99
Vigna-actin-R	ATACTCAGCCTTCGCAATCCACATC	Internal reference gene	99
ADfra1-F	CGGAATTCACGGGGGACTCTAGAATGAAT	Yeast transcriptional activation assay	458
ADfra1-R	CGGGATCCCTGCCAACAAGCCGGTACTCG	Yeast transcriptional activation assay	458
ADfra12-F	CGGGATCCGAAGCTGAAACTGTTGCCTCA	Yeast transcriptional activation assay	623
ADfra2-R	CGGAATTCCGAGTACCGGCTTGTTGGCAG	Yeast transcriptional activation assay	623
ADfra3-F	CGGAATTCACGGGGGACTCTAGAATGAAT	Yeast transcriptional activation assay	685
ADfra3-R	CGGGATCCTGGTGTTATTGTTGGCCATTG	Yeast transcriptional activation assay	685
ADfra4-F	CGGAATTCACGGGGGACTCTAGAATGAAT	Yeast transcriptional activation assay	1,060
ADfra4-R	CGGGATCCGAAGCTGAAACTGTTGCCTCA	Yeast transcriptional activation assay	1,060

2.3 Bioinformatics analysis

DNAMAN was used to analyze the nucleic acid composition and to translate the nucleic acid sequence to an aa sequence. The basic physical and chemical properties of VrNAC13 were analyzed with DNAMAN software. The secondary protein structure was predicted with SOPMA (http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=npsa_sopma.html, accessed on 14 May 2022). The tertiary protein structure was predicted with Phyre2 (http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index, accessed on 14 May 2022). Protein domain analysis was conducted on the NCBI website using the Conserved Domains Database (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi, accessed on 14 May 2022). Phosphorylation sites were predicted with NetPhos3.1 (http://www.cbs.dtu.dk/services/NetPhos/, accessed on 14 May 2022). All known NAC sequences in Arabidopsis were downloaded from The Arabidopsis Information Resource (https://www.arabidopsis.org/index.jsp, accessed on 14 May 2022). A phylogenetic tree was constructed in MEGA5.10 using the Arabidopsis sequences and VrNAC13. BDGP (https://www.fruitfly.org/seq_tools/promoter.html, accessed on 14 May 2022) was used to predict the transcription initiation site and putative core promoter regions in VrNAC13. Cis-acting elements in the promoter region of VrNAC13 were predicted with PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/, accessed on 14 may 2022) [27,28,29].

2.4 Verification of VrNAC13 transcriptional activity

Based on the structural characteristics of VrNAC13, the gene was divided into four parts (fra1, fra2, fra3, and fra4). Primers were designed for each of these fragments (ADfra1, ADfra2, ADfra3, and ADfra4, respectively) (Table 1). Each of the corresponding target fragments was amplified using these primers, and then they were inserted into the pGBKT7-BD vector (linearized with EcoRI and BamHI). The resulting recombinant vectors were named pGBKT7-fra1, pGBKT7-fra2, pGBKT7-fra3, and pGBKT7-fra4, respectively. E. coli was transformed with each vector separately to generate four strains, each containing a plasmid with one fragment. Transformants were screened with kanamycin, positive colonies were selected, and the target plasmid was extracted. The target plasmids were each transferred into competent yeast cells (Clontech) following the manufacturer’s instructions. The strains containing the pGBKT7-p53 + pGADT7-largeT and the pGBKT7-LamC + pGADT7-largeT vectors were used as the positive and negative controls, respectively. Transformed yeast cells were grown on solid SD/-Trp/+ 5Mm3-AT medium for three days. After colonies had grown, X-Gal was added and interactions were determined based on colony color.

2.5 VrNAC13 expression analysis

To determine tissue-specific VrNAC13 expression, the top leaves of the first three compound leaves and the roots and stems were collected from untreated plants. For abiotic stress experiments, samples were collected as described above. For all samples, RNA was extracted and cDNA was generated as described above. qRT-PCR was conducted on a CFX96 Real-Time System (Bio-Rad) using VrNAC13-specific primers (Table 1). The mung bean ACTIN gene served as the internal reference for gene expression normalization. VrNAC13 expression levels were normalized using the 2^−ΔΔCt method [30].

3 Results

3.1 Cloning and sequence analysis of VrNAC13

VrNAC13 was sequenced and determined to be 1,068 bp in length (Figure 1a). The start codon was ATG and the stop codon was TAG. The nucleotide content was 28.1% A, 25.9% T, 23.7% C, and 22.3% G. There were no unresolved nucleotides in the sequence (Figure 1b).

Figure 1

Analysis of VrNAC13 structure and content. (a) Visualization of amplified VrNAC13 with 1% agarose gel electrophoresis. M, Trans2K Plus DNA Marker. (b) Nucleotide content of VrNAC13 as determined by sequencing.

3.2 Physical and chemical properties of VrNAC13

The amino acid sequence of VrNAC13 was next analyzed (Figure 2). A NAM domain was predicted, comprising residues 19–145 (Figure 2a). VrNAC13 was 355 amino acids (aa) in length (Figure 2b) with a molecular weight of 39.9 KDa and an isoelectric point of 9.51. Ser was the most abundant residue at 13.52%, whereas Cys was the least abundant (0.56%). The protein contained 39 positively or negatively charged residues (Arg or Lys and Asp or Glu, respectively). ProtScale was used to analyze the hydrophilic and hydrophobic properties of VrNAC13 (Figure 2c). The lower the score, the stronger the hydrophilicity; the higher the score, the stronger the hydrophobicity. The protein encoded by VrNAC13 is in the region with score <0, which is significantly more than that with score >0. It is predicted that VrNAC13 is a hydrophilic protein.

Figure 2

Physical and chemical properties of VrNAC13. Predictions of the conserved domains (a), amino acid composition (b), and hydrophobicity of each region (c) in VrNAC13.

3.3 Prediction and analysis of phosphorylation sites in VrNAC13

Phosphorylation sites in VrNAC13 were predicted with NetPhos3.1. The protein was predicted to contain 11 threonine phosphorylation sites (Figure 3).

Figure 3

Predicted phosphorylation sites within VrNAC13.

3.4 Predicted secondary and tertiary structures of VrNAC13

SOPMA and Phyre2 were used to predict the structure of VrNAC13 at the secondary and tertiary levels (Figure 4). The secondary structure of VrNAC13 was predicted to be 14.08% α-helixes (50 aa), 67.04% random coils (238 aa), 16.06% extended chains (57 aa), and 2.82% β-turns (10 aa) (Figure 4a). The main spatial structure of VrNAC13 protein is composed of α-Helix and irregular curl constitute, which is consistent with the secondary structure prediction analysis.

Figure 4

Predicted secondary (a) and tertiary (b) structures of VrNAC13.

3.5 Phylogenetic analysis of VrNAC13

Amino acid sequences of all predicted NAC proteins in Arabidopsis were collected, totaling 241 proteins. These sequences and VrNAC13 were used to construct a phylogenetic tree in MEGA5.10 using the maximum likelihood method. The 242 proteins were grouped into 10 categories (labeled I–X) (Figure 5). VrNAC13 and 31 Arabidopsis NAC proteins clustered together in subclass Ⅹ. The genes in each subclass had similar predicted functions, and we therefore hypothesized that VrNAC13 was similar in function to the proteins encoded by AT1G60380.1 and AT5G50820.1, which had the highest similarity scores with VrNAC13.

Figure 5

Phylogenetic analysis of VrNAC13 and Arabidopsis thaliana NAC proteins.

3.6 Verification of transcriptional activation in VrNAC13

Conserved domain analysis indicated that VrNAC13 was divided into four parts: the first, from nucleotides 1 to 458, encoded the NAM domain. The second spanned positions 437–1,060 and was the sequence from which the NAM domain was removed. The third component was from positions 1 to 685 and contained C-terminal sequences on the basis of the NAM domain. The fourth part, from position 1 to position 1060, comprised the entire ORF. The positive control was blue when grown on SD/-Trp/X-α-gal + 5 mM 3-AT medium. Yeast transformed with the pGBKT7-fra2 or pGBKT7-fra4 vectors was also blue, indicating that VrNAC13 had an active domain with transcriptional activation activity (Figure 6).

Figure 6

Analysis of the transcriptional activation activity of VrNAC13. Yeast was transformed with the recombinant vectors pGBKT7-fra1, pGBKT7-fra2, pGBKT7-fra3, and pGBKT7-fra4. pGBKT7-53 + pGADT7-largeT (P) was the positive control and pGBKT7 -LamC + pGADT7-largeT (N) was the negative control.

3.7 Sequence analysis of the VrNAC13 promoter

BDGP was used to predict the transcription initiation site of VrNAC13. This analysis revealed three potential core promoter regions, located from −955 to −905 bp, from −875 to −825 bp, and from −137 to −87 bp. The associated scores were 0.89, 0.87, and 0.92, respectively, and the possible transcription initiation sites were A, G, and A, respectively, the higher the score, the greater the possibility that the region is the core promoter region. The region from −137 to −87 bp had the highest score in addition to a TATA box ∼20–30 bp upstream and a CAAT box ∼70–80 bp upstream, indicating that that region was the most likely core promoter region of the gene; the transcription initiation site was at 2,362 bp. The cis-acting element prediction tool PlantCARE was used to analyze VrNAC13, and this analysis showed that the promoter contained not only core elements (such as the CAAT-box and the TATA-box) but also response elements for hormones such as abscisic acid (ABRE element) and gibberellin (GAREmotif). Predicted cis-acting elements, including stress response elements (LTRs) and light response elements (AREs), are shown in Table 2.

Table 2

Analysis of predicted cis-acting elements in the VrNAC13 promoter

Element type	Element name	Copy number	Motif sequence	Function
Basal element	TATA-box	2	TATA/ATATAA/TATACA	Core promoter element
Basal element	CAAT-box	16	CAATT/CAAT/CCAAT	Common cis-acting element in promoter and enhancer regions
Phytohormone response	ABRE	1	ACGTG	Cis-acting elements involved in abscisic acid reaction
	CGTCA-motif	1	CGTCA	Cis-acting regulatory element involved in methyl jasmonate (MeJA) responsiveness
	TGACG-motif	1	TGACG	Cis-acting regulatory element involved in the MeJA-responsiveness
Light response	G-box	1	TACGTG	Cis-acting regulatory element involved in light responsiveness
	AE-box	1	AGAAACTT	Component of light response module
	GATA-motif	1	GATAGGA	Component of light-responsive element
	GT1-motif	1	GGTTAA	Light-responsive element
	CAG-motif	1	GAAAGGCAGAC	Component of light-response element
Stress response	LTR	1	CCGAAA	Cis-acting element involved in low-temperature responsiveness
Stress response	ARE	1	AAACCA	Cis-acting regulatory element essential for anaerobic induction
Other	ABRE3a	1	TACGTG
	WRE3	2	CCACCT
	ABRE4	1	CACGTA
	W box	1	TTGACC
	as-1	1	TGACG
	box S	1	AGCCACC

3.8 Response of VrNAC13 to drought and ABA stress

To clarify the function of VrNAC13, expression levels of this gene in three different tissues and in response to stress conditions were analyzed with qRT-PCR (Figure 7). VrNAC13 was found to be specifically expressed in the leaves, with relatively low expression in the roots and stems. Drought stress was carried out and analyzed at several stages: T1, the stage in which there were clear differences in stomatal conductance between the leaves of the drought-stressed group and the control group; T2, the stage in which there were clear differences in relative leaf water content between the drought-stressed group and the control; T3, the stage in which mung bean leaves were visibly wilted; and T4, the stage in which plants were re-hydrated. Drought stress was found to significantly promote VrNAC13 expression in the leaves, with relative expression levels peaking at T3. There were no significant differences in VrNAC13 levels between the control and T4 plants. Expression levels were also assessed at several timepoints after treatment with ABA, an important stress hormone that regulates plant physiological processes and drought responses. There were significant differences in VrNAC13 expression between timepoints after ABA treatment; VrNAC13 levels first decreased and then increased again, peaking at 8 h at a level below that of the untreated control. This indicated that VrNAC13 was induced by drought and inhibited by ABA treatment (Figure 7).

Figure 7

Expression levels of VrNAC13 in multiple tissues and after treatment with abiotic stressors. (a) VrNAC13 expression in three mung bean tissues. (b) VrNAC13 expression in response to drought. CK, control (untreated). T1, the stage in which there were clear differences in stomatal conductance between the leaves of the drought-stressed group and the control group. T2, the stage in which there were clear differences in relative leaf water content between the drought-stressed group and the control. T3, the stage in which mung bean leaves were visibly wilted. T4, the stage after rehydration treatment. (c) VrNAC13 expression in response to exogenous treatment with 100 µmol/l abscisic acid (ABA). Lowercase and uppercase letters indicate statistical significance groups at p < 0.05 and p < 0.01, respectively.

4 Discussion

Non-biotic stress triggers a wide range of plant responses, including gene expression, cell metabolism, plant growth and development, and crop yield. In recent years, multiple transcription factors have been confirmed to participate in the regulation of growth and development, defense regulation, and stress response in different types of plants [31,32,33,34]. As one of the largest TF families in plants, NAC has been proven to play an important role in drought stress [35,36,37,38].

Members of the NAC transcription factor family have important roles in numerous plant processes. Studies have shown that these genes play key roles in plant growth, development, stress responses, and specialized metabolite biosynthesis. It is of great significance to study the roles of NAC genes in plant growth and development and in responses to biotic and abiotic stresses, ultimately to develop plants that can more effectively resist drought. In the present study, VrNAC13 was cloned from mung bean. Sequence analysis showed that VrNAC13 was 1,068 bp in length and contained 28.1% A, 25.9% T, 23.7% C, and 22.3% G content. There were no unresolved nucleotides from the sequencing process. The gene encodes 355 amino acids, and conserved domain analysis revealed the presence of a conserved NAM domain and an AD transcriptional activation domain at the C-terminal (from nucleotide positions 437–1,060). The latter was validated with a yeast transcriptional activation experiment. This is consistent with previous research on NAC transcription factors such as Chickpea (Cicer arietinum L.) [39] and Soybean (Glycine max) [40] and conforms to the structural characteristics of NAC transcription factors. VrNAC13 was predicted to have 11 threonine phosphorylation sites, suggesting that this protein may be modified and regulated through phosphorylation. Phylogenetic analysis of VrNAC13 and Arabidopsis NAC VrNAC13 shared the highest levels of similarity with AT1G60380.1 and AT5G50820.1, and these two Arabidopsis proteins are primarily involved in transcriptional regulation, indicating that VrNAC13 may have a similar function in mung bean.

The promoter region is an important component in gene expression regulation. Cis-acting elements are specific sequences in the promoter that are bound by transcription factors. The type, number, sequence, and distance to other cis-elements affect their efficiency and strength in modulating the gene expression [41]. Analysis of the VrNAC13 promoter region revealed the presence of numerous cis-acting elements related to abiotic stress and responses to hormones, including ABA and methyl jasmonate (MeJA). Changes in ABA levels activate many stress-response genes that function to induce stomatal closure, thus reducing transpiration and maintaining internal water levels [42]. Numerous studies have shown that there are certain differences in the expression patterns of NAC transcription factor genes in different plants. For example, soybean GmNAC1 is mainly expressed in roots and flower buds, while GmNAC2 is strongly expressed in leaves, stems, and seeds, and weakly expressed in roots, flower buds, and pods. GmNAC3 is highly expressed in leaves, flower buds, and pods, but relatively low in seed development [43]. VrNAC13 is highly expressed in leaves after drought treatment, and we speculate that this gene may be involved in material transport during plant growth. VrNAC13 showed significant expression changes over time after ABA treatment. Overall, compared to the control sample, VrNAC13 was inhibited in the ABA-treated sample, which is consistent with previous research on tartary buckwheat FtNAC11 [44]. These expression dynamics and the presence of an ABA-responsive cis-element in the VrNAC13 promoter suggested that VrNAC13 regulated the responses of mung bean leaves to drought via the ABA pathway.

At present, northern China is facing increasingly common drought conditions. As a result, there is heightened dependence on molecular biological methods of crop management. It is particularly important to identify and clone drought-resistance genes to allow their transfer into drought-sensitive crops. This will allow researchers to cultivate new drought-resistant transgenic crop varieties that can not only make use of arid soil but also contribute to water-saving efforts and sustainable agricultural development. We here analyzed the basic structure of VrNAC13 at the nucleic acid and protein levels and predicted its function as a drought-response gene. Future experiments should further explore the function of VrNAC13 through exogenous expression in another system (e.g., Arabidopsis) and subsequent observation of transgenic plant responses to a range of stressors. This would allow preliminary verification of VrNAC13 function and ultimately clarify the stress resistance mechanism in which VrNAC13 functions, laying a molecular foundation for stress-resistant mung bean breeding.

5 Conclusion

This study cloned VrNAC13 and analyzed its structure. Based on qRT-PCR, the tissue expression specificity and expression after different treatments were analyzed to elucidate the structural and functional characteristics of the VrNAC13 gene, laying a foundation for drought resistance molecular breeding in mung beans.

Funding information: This work was financially supported by the National Natural Science Foundation of China (31960432); General Project in the Agricultural Field of Shaanxi Provincial Department of Science and Technology (2021NY-201).
Author contributions: Siyu Zhang carried out the experiment and prepared the draft of the manuscript. Yaning Guo and Fugang Wang conceived and designed the experiments. Jing Ai and Han Yao prepared the material. Yu Bai contributed to data analysis. All authors read and approved the final manuscript.
Conflict of interest: Authors state no conflict of interest.
Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Aida M, Ishida T, Fukaki H, Fujisawa H, Tasaka M. Genes involved in organ separation in Arabidopsis: an analysis of the cup-shaped cotyledon mutant. Plant Cell. 1997;9(6):841–57. 10.1105/tpc.9.6.841.Search in Google Scholar PubMed PubMed Central

[2] Souer E, van Houwelingen A, Kloos D, Mol J, Koes R. The no apical meristem gene of Petunia is required for pattern formation in embryos and flowers and is expressed at meristem and primordia boundaries. Cell. 1996;85(2):159–70. 10.1016/s0092-8674(00)81093-4.Search in Google Scholar PubMed

[3] Olsen AN, Ernst HA, Leggio LL, Skriver K. NAC transcription factors: structurally distinct, functionally diverse. Trends Plant Sci. 2005;10(2):79–87. 10.1016/j.tplants.2004.12.010.Search in Google Scholar PubMed

[4] Nakashima K, Takasaki H, Mizoi J, Shinozaki K, Yamaguchi-Shinozaki K. NAC transcription factors in plant abiotic stress responses. Biochim Biophys Acta. 2012;1819(2):97–103. 10.1016/j.bbagrm.2011.10.005.Search in Google Scholar PubMed

[5] Xia L, Sun S, Han B, Yang X. NAC domain transcription factor gene GhNAC3 confers drought tolerance in plants. Plant Physiol Biochem. 2023;195:114–23. 10.1016/j.plaphy.2023.01.005.Search in Google Scholar PubMed

[6] Hoang XLT, Nhi DNH, Thu NBA, Thao NP, Tran LP. Transcription Factors and Their Roles in Signal Transduction in Plants under Abiotic Stresses. Curr Genomics. 2017;18(6):483–97. 10.2174/1389202918666170227150057.Search in Google Scholar PubMed PubMed Central

[7] Zhang HJ, Hu ZC, Lv XL, Wang HO, Qiu CT. Overview and development analysis of mung bean processing and utilization in China. Jiangsu Agric Sci. 2014;42:234–6. 10.15889/j.issn.1002-1302.2014.01.050.Search in Google Scholar

[8] Hou D, Yousaf L, Xue Y, Hu J, Wu J, Hu X, et al. Mung bean (Vigna radiata L.): bioactive polyphenols, polysaccharides, peptides, and health benefits. Nutrients. 2019;11(6):1238. 10.3390/nu11061238.Search in Google Scholar PubMed PubMed Central

[9] Luo GL, Huang TF, Cai QS, Chen YH, Li JC. Adaptability test of mung bean varieties. China Seed Ind. 2015;241(4):51–2. 10.19462/j.cnki.1671-895x.2015.04.024.Search in Google Scholar

[10] Hu YY, Zhang X. Experimental and technical key points of mulch bean intercropping cultivation in Yulin city, Shaanxi province. Agric Eng Technol. 2020;40:66–8. 10.16815/j.cnki.11-5436/s.2020.35.038.Search in Google Scholar

[11] Hu YY. Current situation and development countermeasures of mung bean industry in Yulin. Agric Technol. 2014;34:122–5. 10.3969/j.issn.1671-962X.2014.03.098.Search in Google Scholar

[12] Lei JY. Present situation and development countermeasures of mung bean production in Yulin. Agric Sci Technol Newsl. 2013;500(8):44–6. 10.3969/j.issn.1000-6400.2013.08.018.Search in Google Scholar

[13] Ma L. Research on the development status, problems and countermeasures of small grain industry in Yulin. Thesis for M.S., Northwest University of Agriculture and Forestry Science and Technology; 2020. 10.27409/d.cnki.gxbnu.2020.001517.Search in Google Scholar

[14] Kang YJ, Kim SK, Kim MY, Lestari P, Kim KH, Ha BK, et al. Genome sequence of mungbean and insights into evolution within Vigna species. Nat Commun. 2014;5:5443. 10.1038/ncomms6443.Search in Google Scholar PubMed PubMed Central

[15] Luo J, Li R, Xu X, Niu H, Zhang Y, Wang C. SMRT and illumina RNA sequencing and characterization of a Key NAC gene LoNAC29 during the flower senescence in Lilium oriental ‘Siberia’. Genes (Basel). 2021;12(6):869. 10.3390/genes12060869.Search in Google Scholar PubMed PubMed Central

[16] Sakuraba Y, Kim D, Han SH, Kim SH, Piao W, Yanagisawa S, et al. Multilayered regulation of membrane-bound ONAC054 Is essential for abscisic acid-induced leaf senescence in rice. Plant Cell. 2020;32(3):630–49. 10.1105/tpc.19.00569.Search in Google Scholar PubMed PubMed Central

[17] Cao S, Zhang Z, Wang C, Li X, Guo C, Yang L, et al. Identification of a novel melon transcription factor CmNAC60 as a potential regulator of leaf senescence. Genes (Basel). 2019;10(8):584. 10.3390/genes10080584.Search in Google Scholar PubMed PubMed Central

[18] Hurtado FMM, Pinto MS, Oliveira PN, Riaño-Pachón DM, Inocente LB, Carrer H. Analysis of NAC domain transcription factor genes of tectona grandis L.f. involved in secondary cell wall deposition. Genes (Basel). 2019;11(1):20. 10.3390/genes11010020.Search in Google Scholar PubMed PubMed Central

[19] Ye Y, Wu K, Chen J, Liu Q, Wu Y, Liu B, et al. OsSND2, a NAC family transcription factor, is involved in secondary cell wall biosynthesis through regulating MYBs expression inrice. Rice (N Y). 2018;11(1):36. 10.1186/s12284-018-0228-z.Search in Google Scholar PubMed PubMed Central

[20] Li B, Fan R, Yang Q, Hu C, Sheng O, Deng G, et al. Genome-wide identification and characterization of the NAC transcription factor family in musa acuminata and expression analysis during fruit ripening. Int J Mol Sci. 2020;21(2):634. 10.3390/ijms21020634.Search in Google Scholar PubMed PubMed Central

[21] Li X, Cai K, Pei X, Li Y, Hu Y, Meng F, et al. Genome-wide identification of nac transcription factor family in juglans mandshurica and their expression analysis during the fruit development and ripening. Int J Mol Sci. 2021;22(22):12414. 10.3390/ijms222212414.Search in Google Scholar PubMed PubMed Central

[22] Yang S, Zhou J, Watkins CB, Wu C, Feng Y, Zhao X, et al. NAC transcription factors SNAC4 and SNAC9 synergistically regulate tomato fruit ripening by affecting expression of genes involved in ethylene and abscisic acid metabolism and signal transduction. Postharvest Biol Technol. 2021;178:111555. 10.1016/j.postharvbio.2021.111555.Search in Google Scholar

[23] Shalby N, Mohamed IAA, Xiong J, Hu K, Yang Y, Nishawy E, et al. Overdominance at the gene expression level plays a critical role in the hybrid root growth of brassica napus. Int J Mol Sci. 2021;22(17):9246. 10.3390/ijms22179246.Search in Google Scholar PubMed PubMed Central

[24] Guo YN, Zhang PP, Luo Y, Chen RF, Zhang X. Identification and bioinformatics analysis of mung bean vrnac transcription factors. Shaanxi Agric Sci. 2021;67(4):29–34. 10.3969/j.issn.0488-5368.2021.04.006.Search in Google Scholar

[25] Yao HX, Li ZL, Zhao YR, Cheng LJ, Yang HN, Wang YY. Cloning and bioinformatics analysis of ccmyb8 gene from YeYilan. North Horticulture. 2021;489(18):75–80. 10.11937/bfyy.20210492.Search in Google Scholar

[26] Rychlik W. OLIGO 7 primer analysis software. Methods Mol Biol. 2007;402:35–60. 10.1007/978-1-59745-528-2_2.Search in Google Scholar PubMed

[27] Jalal A, Ali Q, Manghwar H, Zhu D. Identification, phylogeny, divergence, structure, and expression analysis of A20/AN1 zinc finger domain containing stress-associated proteins (SAPs) genes in jatropha curcas l. Genes (Basel). 2022;13(10):1766. 10.3390/genes13101766.Search in Google Scholar PubMed PubMed Central

[28] Jalal A, Sun J, Chen Y, Fan C, Liu J, Wang C. Evolutionary analysis and functional identification of clock-associated PSEUDO-RESPONSE REGULATOR (PRRs) genes in the flowering regulation of Roses. Int J Mol Sci. 2022;23(13):7335. 10.3390/ijms23137335.Search in Google Scholar PubMed PubMed Central

[29] Liu J, Wu S, Sun J, Sun J, Wang H, Cao X, et al. Genome-wide analysis reveals widespread roles for RcREM genes in floral organ development in Rosa chinensis. Genomics. 2021;113(6):3881–94. 10.1016/j.ygeno.2021.09.017.Search in Google Scholar PubMed

[30] Jing LF, Zhang PP, Miao YP, Chen T, Liu Y, Yang DL. Cloning and expression analysis of TaSPP gene in sss wheat. North China J Agric Sci. 2022;37:28–34. 10.7668/hbnxb.20192653.Search in Google Scholar

[31] Wani SH, Anand S, Singh B, Bohra A, Joshi R. WRKY transcription factors and plant defense responses: latest discoveries and future prospects. Plant Cell Rep. 2021;40(7):1071–85. 10.1007/s00299-021-02691-8.Search in Google Scholar PubMed

[32] Li P, Xia E, Fu J, Xu Y, Zhao X, Tong W, et al. Diverse roles of MYB transcription factors in regulating secondary metabolite biosynthesis, shoot development, and stress responses in tea plants (Camellia sinensis). Plant J. 2022;110(4):1144–65. 10.1111/tpj.15729.Search in Google Scholar PubMed

[33] Goossens J, Mertens J, Goossens A. Role and functioning of bHLH transcription factors in jasmonate signalling. J Exp Bot. 2017;68(6):1333–47. 10.1093/jxb/erw440.Search in Google Scholar PubMed

[34] Diao P, Chen C, Zhang Y, Meng Q, Lv W, Ma N. The role of NAC transcription factor in plant cold response. Plant Signal Behav. 2020;15(9):1785668. 10.1080/15592324.2020.1785668.Search in Google Scholar PubMed PubMed Central

[35] Thirumalaikumar VP, Devkar V, Mehterov N, Ali S, Ozgur R, Turkan I, et al. NAC transcription factor JUNGBRUNNEN1 enhances drought tolerance in tomato. Plant Biotechnol J. 2018;16(2):354–66. 10.1111/pbi.12776.Search in Google Scholar PubMed PubMed Central

[36] Yuan X, Wang H, Cai J, Bi Y, Li D, Song F. Rice NAC transcription factor ONAC066 functions as a positive regulator of drought and oxidative stress response. BMC Plant Biol. 2019;19(1):278. 10.1186/s12870-019-1883-y.Search in Google Scholar PubMed PubMed Central

[37] Wang Q, Guo C, Li Z, Sun J, Deng Z, Wen L, et al. Potato NAC transcription factor StNAC053 enhances salt and drought tolerance in transgenic arabidopsis. Int J Mol Sci. 2021;22(5):2568. 10.3390/ijms22052568.Search in Google Scholar PubMed PubMed Central

[38] Mao H, Li S, Chen B, Jian C, Mei F, Zhang Y, et al. Variation in cis-regulation of a NAC transcription factor contributes to drought tolerance in wheat. Mol Plant. 2022;15(2):276–92. 10.1016/j.molp.2021.11.007.Search in Google Scholar PubMed

[39] Peng H, Yu X, Cheng H, Shi Q, Zhang H, Li J, et al. Cloning and characterization of a novel NAC family gene CarNAC1 from chickpea (Cicer arietinum L.). Mol Biotechnol. 2010 Jan;44(1):30–40. 10.1007/s12033-009-9202-8.Search in Google Scholar PubMed

[40] Li M, Chen R, Jiang Q, Sun X, Zhang H, Hu Z. GmNAC06, a NAC domain transcription factor enhances salt stress tolerance in soybean. Plant Mol Biol. 2021;105(3):333–45. 10.1007/s11103-020-01091-y.Search in Google Scholar PubMed PubMed Central

[41] Jin H, Xing M, Cai C, Li S. B-box proteins in arachis duranensis: genome-wide characterization and expression profiles analysis. Agronomy. 2020;10:1–23. 10.3390/agronomy10010023.Search in Google Scholar

[42] Chen K, Li GJ, Bressan RA, Song CP, Zhu JK, Zhao Y. Abscisic acid dynamics, signaling, and functions in plants. J Integr Plant Biol. 2020;62(1):25–54. 10.1111/jipb.12899.Search in Google Scholar PubMed

[43] Meng Q, Zhang C, Gai J, Yu D. Molecular cloning, sequence characterization and tissue-specific expression of six NAC-like genes in soybean (Glycine max (L.) Merr.). J Plant Physiol. 2007;164(8):1002–12. 10.1016/j.jplph.2006.05.019.Search in Google Scholar PubMed

[44] Wang J, Ma Z, Tang B, Yu H, Tang Z, Bu T, et al. Tartary buckwheat (Fagopyrum tataricum) NAC transcription factors FtNAC16 negatively regulates of pod cracking and salinity tolerant in arabidopsis. Int J Mol Sci. 2021;22(6):3197. 10.3390/ijms22063197.Search in Google Scholar PubMed PubMed Central

Received: 2023-02-09

Revised: 2023-04-20

Accepted: 2023-05-15

Published Online: 2023-07-06

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

https://doi.org/10.1515/biol-2022-0627

Keywords for this article

mung bean; VrNAC13; gene cloning; bioinformatics analysis; qRT-PCR

Creative Commons

BY 4.0