Home Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
Article Open Access

Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats

  • Xiaobo Wang , Yili Zhang , Xiuyun Zhou , Xiumei Xia , Weijun Teng , Lin Sheng and Jing Ding EMAIL logo
Published/Copyright: February 10, 2023
Download Article (PDF)
Open Life Sciences
From the journal Open Life Sciences Volume 18 Issue 1

Abstract

Acute lung injury (ALI) followed with severe inflammation and oxidative stress. Anti-inflammatory and antioxidant are the properties of aquaporin 1 (AQP1) and aquaporin 5 (AQP5). The goal of this study was to see if soy isoflavone can diminish lipopolysaccharide (LPS)-induced ALI and the underling mechanism. LPS-induced ALI was given to Sprague–Dawley rats 14 days following oophorectomy. One hour before the LPS challenge, estradiol (1 mg/kg) was administered subcutaneously as positive control and soy isoflavone was intragastric administration for 14 days prior to LPS challenge with different doses. Six hours after LPS challenge, the pulmonary edema, pathophysiology, inflammation, and the oxidative stress in lung tissues of rats were discovered. We found that soy isoflavone can reduce pulmonary edema and the lung pathology in a dose-dependent manner. Furthermore, tumor necrosis factor-alpha, interleukin-1β, and interleukin-6 were decreased in rats treated with soy isoflavone. Meanwhile, soy isoflavone reduced pulmonary oxidative stress by decreasing malondialdehyde levels, while increasing superoxide dismutase levels in lung tissues in a dose-dependent manner. Mechanically, we found that the mRNA and protein level of AQP1 and AOP5 were increased in lung tissues of rats treated with soy isoflavone compared the LPS-treated rats. Thus, soy isoflavone alleviates LPS-induced ALI through inducing AQP1 and AQP5.

Graphical abstract

Keywords: soy isoflavone; aquaporin 1; aquaporin 5; acute lung injury; inflammation

1 Introduction

Acute inflammatory disease associated to oxidative stress is caused by sepsis-induced acute lung injury (ALI) that produces significant morbidity and death [1–3], posing a serious health risk. As a result, finding new mechanisms and therapies for ALI remains difficult.

More and more studies show that natural products possess general health-promoting benefits to human diseases. Amin et al. found that saffron and its main components have an anti-proliferation effect on colon cancer cells [4]. The antioxidant effects of natural products play an important role in treating diseases. Vitamin C and Vitamin E are beneficial to diabetic rats by improving biochemical parameters [5,6]. Amin et al. also found that spirulina has a protective effect on cadmium-induced hepatotoxicity in rats through antioxidant activity [7] and chlorella is good for diabetic rats by restoring the function of pancreatic insulin-secreting cells [8]. Aescinate saponins and diaescinate saponins have protective effects on liver injury in rats [9]. Several studies have shown that soy isoflavone has anti-inflammatory and antioxidation properties that help to regulate the progression of illnesses such as cancer [10], cardiovascular diseases [11], diabetes [12,13], and cerebrovascular disease [14]. To protect against diabetic nephropathy, soy isoflavone can lower the cytokinesis of interleukin-1 (IL-1), interleukin-6 (IL-6), and nicotinamide adenine dinucleotide phosphate (NADPH) oxidase gene expression [12]. The activities of soy isoflavone in ALI, on the other hand, are mostly unknown.

Aquaporins (AQPs) are one of the respiratory system's cell membrane transporters, with AQP1 and AQP5 being the most important [15]. AQPs in lung tissues have been found to eliminate excess fluid from the alveolar space in studies [16,17]. Furthermore, AQP1 and AQP5 are involved in the development of pulmonary edema induced by ALI, hyperoxia, hemorrhagic shock, acute renal injury, and acute pancreatitis [18,19]. After lipopolysaccharide (LPS)-induced diffuse vascularization, AQP5 expression was reduced in pulmonary edema [20,21]. In mice, knocking out AQP1 in the lungs worsened pulmonary edema [20,22]. However, it is unclear if soy isoflavone’s anti-inflammatory and antioxidant effects are mediated through AQPs.

We show that soy isoflavone can decrease oxidative stress and inflammation in a rat model of LPS-induced ALI via dose-dependently activating AQP1 and AQP5. As a result, soy isoflavone may be a new treatment for ALI.

2 Methods

2.1 Drugs

Soy isoflavone was acquired from Shanghai Yuanye Co. Ltd (B25058) and dissolved in dimethyl sulfoxide (sigma, D2650). Estradiol was purchased from Sigma (USA, E8875) and dissolved in ethanol. LPS was purchased from Sigma-Aldrich (USA), which was derived from Escherichia coli O111: B4, and dissolved in saline (Gibco, Grand Island, NY, USA).

2.2 Animals

The National Institutes of Health produced the Guide for the Care and Use of Laboratory Animals, which outlined how animal research should be conducted (National Institutes of Health publication No. 85-23, revised 1985). The Hangzhou Hibio Technology Co. Institutional Ltd Animal Care and Use Committee approved the procedure (IACUC protocol number: HBFM3.68-2015). Shanghai SLAC Laboratory Animal Co. Ltd provided Sprague–Dawley rats (female, oestrum) [23]. Rats were kept in a pathogen-free environment with a 12 h light–dark cycle in the same room at 18–24°C and 40–70% humidity. All rats were treated in accordance with the Institutional Animal Care guidelines.

  1. Ethical approval: The research related to animal use has been complied with all the relevant national regulations and institutional policies for the care and use of animals and has been approved by The Hangzhou Hibio Technology Co. Institutional Ltd Animal Care and Use Committee (IACUC protocol number: HBFM3.68-2015).

2.3 LPS-induced ALI and soy isoflavone or estrogen preconditioning

Oophorectomy was performed on Sprague–Dawley rats (n = 60) as reported in previous studies [24–26]. After removing the hair and disinfecting the surgical site, ovariectomy was performed through bilateral incisions in the skin and small bilateral sections via the muscle layer at the angle between the last rib and vertebral column. The skin was incised together with the dorsal muscles and the peritoneal cavity was accessed. The ovary was identified, surrounded by a variable amount of fat. After vascular ligation, the connection between the fallopian tube and the uterine horn was cut and the ovary was removed. Rats were randomly assigned to one of six groups (n = 10) 14 days after oophorectomy. OVXC: ovariectomy without LPS as a control group; OVXM: ovariectomy with LPS-induced ALI group; L: ovariectomy with LPS-induced ALI and pre-treated with low dose soy isoflavone (5 mg/kg) group; M: ovariectomy with LPS-induced ALI and preprocessed with medium dose soy isoflavone (10 mg/kg) group; H: ovariectomy with LPS-induced ALI and high dosage soy isoflavone (20 mg/kg) preprocessing group; E: ovariectomy with LPS-induced ALI and with estradiol (1 mg/kg) as positive control group. LPS (10 mg/kg) was injected intraperitoneally in rats to induce ALI, and the animals were anaesthetized with ketamine (50 mg/kg) and xylazine (50 mg/kg) intraperitoneally to be fully anaesthetized and sacrificed after 6 h. The goal of this study was to see if soy isoflavone and estradiol may help with LPS-induced ALI. Estradiol (1 mg/kg) was given subcutaneously for 1 h before LPS management, and soy isoflavone was administered intragastrically for 14 days prior to LPS management. The protocol was permitted by the Animal Experimentation Ethics Committee.

2.4 Lung tissue wet/dry weight ratio

We used the methods in ref. [27] to identify lung edema in rats following LPS-induced ALI, collecting right lung tissues (n = 4) and removing surface blood. The wet weight refers to the weight of the samples, whereas the dry weight refers to the weight of tissue that has been dried at 60°C for 48 h. Each individual rat lung’s pulmonary edema is represented by a wet/dry weight ratio.

2.5 Permeability of lung

The animals were all injected with Evans blue (50 mg/kg) through femoral vein 15 min before the animals were killed. The lungs were removed after thoracectomy, and the surrounding tissues were cut off from the upper lobe of the right lung. The lungs were immersed in formamide solution (20 mg/100 g animal weight) and placed in a temperature chamber of 45–50°C for 72 h, until all the pigments in the tissues were leached, then the tissues were removed and centrifuged. Using spectrophotometer to detect the supernatant at 620 nm with 96-well plate. Optical density value of formamide solution was determined. Evans blue content per gram of wet lung tissue was calculated according to the concentration corresponding to the standard curve.

2.6 Total protein concentration of bronchial lavage fluid (BALF) and cell counts

We followed the methods [27] after 6 h of LPS treatment, BALF samples were obtained (n = 6) by flushing the lungs with 1 mL of 1× PBS (Gibco, Grand Island, NY, USA), and the fluid was centrifuged at 1500 rpm for 5 min at 4°C, the total protein concentration of BALF in supernatant was determined using a BCA protein quantification kit. The sedimented cell pellets were re-suspended in 0.5 mL PBS, then cells were counted using a hemocytometer and Wright-Giemsa staining with a light microscope.

2.7 Histology and immunohistochemistry

Pathological alterations in left lung morphology (n = 4) were assessed in methyl Carnoy's fixed, paraffin-embedded tissue slices (4 μm) with hematoxylin and eosin (HE) staining, according to the methods in ref. [28]. A microwave-based antigen retrieval approach was used to execute immunohistochemistry in paraffin slices. This investigation employed antibodies against AQP1 (Abcam, ab65837) and AQP5 (Abcam, ab78486). Positive cells were counted using a 0.0625 mm2 graticule placed in the eyepiece of the microscope and represented as cells per millimeter square (cells/mm2) or were quantitatively scored using Media Cybernetics’ Image-Pro plus software (Bethesda, USA) as stated in ref. [29].

2.8 Electron microscopy

Fractions of the left lung tissues (n = 4) were pre-fixed in a solution of 2.5% glutaraldehyde and 1% osmium tetroxide, post-fixed in 1% OsO4, dehydrated in an escalating sequence of alcohols, and embedded in epoxy resin, as reported before [30]. Uranyl acetate and lead citrate were used to stain ultrathin sections. A transmission electron microscope (HITACHI H-600, Japan) was used to detect the samples.

2.9 Real-time PCR

Total RNA from lung tissues (n = 6) was isolated using the RNeasy Isolation Kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions. Bio-Rad iQ SYBR Green supermix and the Opticon2 were used for real-time PCR (Bio-Rad, Hercules, CA). Primers for AQP1 are as follows: forward 5′−TCACTTGGCCGAAATGACCTG-3′ and reverse 5′−GTCCCACCCAGAAAATCCAGT−3′. Primers for AQP5 are as follows: forward 5′−TCCAGGACCACACCAGAAAG−3′ and reverse 5′−ATAAAATAGCACTCCGTGAGCC-3′. Primers for β-actin are as follows: forward 5′−ACTGCCGCATCCTCTTCCTC−3′ and reverse 5′−GAACCGCTCATFGCCGATAGTG−3′. Reaction specificity was confirmed by melting curve analysis. As previously disclosed [31,32], the ratios for the AQP1 and AQP5 mRNA were normalized with β-actin and represented as mean ± SEM.

2.10 Western blot

The protein of lung tissues (n = 6) was extracted using RIPA lysis buffer, and western blot analysis was done as reported previously [32]. After blocking with 5% skim milk, membranes were incubated overnight at 4°C with 1:1,000 dilutions of primary antibodies against AQP1 (Sigma, AB2219), AQP5 (Sigma, AB15858), and GAPDH (Abcam, ab8245). Membranes were incubated with goat anti-rabbit (Amyjet Scientific, 111-035-003) for 1 h at room temperature the next day after being rinsed with 1× TBST 5 min for three times. Blots were examined using a chemiluminescent substrate and molecular band intensity was determined by densitometry after being washed with 1× TBST 5 min for three times.

2.11 ELISA

Tumor necrosis factor-alpha (TNF-α; mlbio, ml002859), IL-1 (mlbio, ml003060), and IL-6 (mlbio, ml102828) levels were measured in supernatant of BALF (n = 6) using Quantikine ELISA kits according to the product procedures.

2.12 Determination of malondialdehyde (MDA) and superoxide dismutase (SOD)

Using saline to extract supernatant of lung tissues (n = 6) and analysis was performed following the MDA (Beyotime, S0131) and SOD (Abcam, ab65354) kits’ instruction.

2.13 Statistical analyses

The results of this investigation were given as mean ± SEM. GraphPad Prism 6.0 was used to conduct statistical analyses, which included one-way ANOVA and a Newman–Keuls post-test (Graph Pad Software, San Diego, CA, USA).

3 Results

3.1 LPS-induced acute pulmonary edema is protected by soy isoflavone in a dose-dependent manner

The basic pathogenic mechanism of ALI is acute pulmonary edema. To investigate the effects of soy isoflavone on LPS-induced pulmonary edema, we used Sprague–Dawley rats 14 days after oophorectomy in a LPS-induced ALI paradigm. The preventive effects of soy isoflavone on LPS-induced ALI were next investigated. A wet-to-dry weight ratio, lung permeability, and BALF total protein content were used to assess pulmonary edema. LPS treatment resulted in significant pulmonary edema in rats, with increased wet-to-dry weight ratio, lung permeability, and BALF total protein content. Pre-treatment with soy isoflavone reduced LPS-induced pulmonary edema compared to the rats in OVXM group in a dose-dependent manner. Furthermore, the high-dose soy isoflavone had the same impact as the estradiol pre-treatment (Figure 1).

Figure 1 Soy isoflavone reduces the wet/dry weight ratio, lung permeability, and total protein concentration of BALF in a dose-dependent manner. (a) Quantitative study of wet/dry weight ratio of lung, n = 4. (b) Quantitative analysis of lung permeability, n = 4. (c) Quantitative analysis of total protein concentration of BALF, n = 6. Data represent mean ± SEM for groups of 4–6 rats (## P < 0.01 vs OVXC group; * P < 0.05, ** P < 0.01 vs OVXM group).
Figure 1

Soy isoflavone reduces the wet/dry weight ratio, lung permeability, and total protein concentration of BALF in a dose-dependent manner. (a) Quantitative study of wet/dry weight ratio of lung, n = 4. (b) Quantitative analysis of lung permeability, n = 4. (c) Quantitative analysis of total protein concentration of BALF, n = 6. Data represent mean ± SEM for groups of 4–6 rats (## P < 0.01 vs OVXC group; * P < 0.05, ** P < 0.01 vs OVXM group).

3.2 LPS-induced ALI is protected by soy isoflavone in a dose-dependent manner

Lung histology was assessed using HE staining to investigate the effects of soy isoflavone on LPS-induced ALI. In rats, LPS treatment resulted in severe lung damage, including edema, congestion, and thickening of the pulmonary septum. Pre-treatment with soy isoflavone decreased LPS-induced lung damage more than the rats in the OVXM group in a dose-dependent manner. Furthermore, high-dose soy isoflavone had the same effect as pre-treatment with estrogen (Figure 2a).

Figure 2 Soy isoflavone reduces the pathological changes of lung tissues. (a) Representative HE staining pictures of lung tissues 6 h after LPS injection in rats, scale bar = 100 μm, the yellow arrow shows the injured site of lung tissue. (b) Electron microscope pictures of lung ultrastructure taken 6 h after LPS treatment, scale bar = 1 μm, and the green arrow shows the intercellular space and swallowing vesicles in the cytoplasm of lung tissues. Data represent mean ± SEM for groups of four rats.
Figure 2

Soy isoflavone reduces the pathological changes of lung tissues. (a) Representative HE staining pictures of lung tissues 6 h after LPS injection in rats, scale bar = 100 μm, the yellow arrow shows the injured site of lung tissue. (b) Electron microscope pictures of lung ultrastructure taken 6 h after LPS treatment, scale bar = 1 μm, and the green arrow shows the intercellular space and swallowing vesicles in the cytoplasm of lung tissues. Data represent mean ± SEM for groups of four rats.

Furthermore, electron microscopy of lung sections was used to examine the ultrastructure of the lungs. In rats, LPS treatment resulted in increased intercellular space and swallowing vesicles in the cytoplasm of lung tissues. When compared to the rats in the OVXM group, pre-treatment with soy isoflavone reduced LPS-induced intercellular space and decreased swallowing vesicles in the cytoplasm of lung tissues in a dose-dependent manner. Furthermore, the high-dose soy isoflavone had the same impact as the estradiol pre-treatment (Figure 2b).

3.3 Soy isoflavone has an anti-inflammatory action that is dose-dependent and protects against LPS-induced ALI

In addition, the anti-inflammatory effect of soy isoflavone on LPS-induced lung inflammation was investigated. We discovered that administering LPS to rats resulted in severe lung inflammation with a mass of inflammatory cell infiltration in the BALF. At 6 h after LPS administration, BALF was assessed. After LPS treatment in rats, the amount of white blood cells, neutrophils, lymphocytes, and monocytes increased in BALF. Pre-treatment with soy isoflavones, on the other hand, reduced this rise in a dose-dependent manner. Furthermore, the high-dose soy isoflavone had the same impact as the estradiol pre-treatment (Table 1).

Table 1

Soy isoflavone attenuates inflammatory cells of BALF in rats

White blood cells (109/L) Neutrophils (109/L) Eosinophils (109/L) Lymphocytes (109/L) Monocytes (109/L) Basophilic granulocytes (109/L)
OVXC 0.51 ± 0.07 0.28 ± 0.06 0.00 ± 0.00 0.11 ± 0.02 0.11 ± 0.01 0.00 ± 0.01
OVXM 1.47 ± 0.05 0.89 ± 0.09 0.01 ± 0.01 0.24 ± 0.06 0.34 ± 0.02 0.00 ± 0.01
L 1.24 ± 0.09 0.72 ± 0.10 0.01 ± 0.01 0.22 ± 0.03 0.28 ± 0.02 0.01 ± 0.01
M 1.06 ± 0.02 0.64 ± 0.02 0.01 ± 0.02 0.18 ± 0.01 0.21 ± 0.03 0.01 ± 0.02
H 0.74 ± 0.04 0.42 ± 0.02 0.00 ± 0.00 0.14 ± 0.01 0.17 ± 0.03 0.00 ± 0.01
E 0.82 ± 0.07 0.54 ± 0.05 0.00 ± 0.00 0.13 ± 0.02 0.15 ± 0.04 0.01 ± 0.01

OVXC: ovariectomy without LPS as a control group; OVXM: ovariectomy with LPS-induced ALI group; L: ovariectomy with LPS-induced ALI and pre-treatment with low dose soy isoflavone (5 mg/kg) group; M: ovariectomy with LPS-induced ALI and pre-treatment with medium dose soy isoflavone (10 mg/kg) group; H: ovariectomy with LPS-induced ALI and pre-treatment with high dose soy isoflavone (20 mg/kg) group; E: ovariectomy with LPS-induced ALI and pre-treatment with estrogen (1 mg/kg) as positive control group. Data represent mean ± SEM for groups of six rats.

Endotoxin-induced proinflammatory cytokines such TNF-α, IL-1β, and IL-6 have been linked to the development of ALI [33,34]. In addition, the formation of ALI is caused by the activation of circulating neutrophils and their transmigration into the alveolar airspace. As a result, we looked at the expression of TNF-α, IL-1β, and IL-6 in BALF. The expression of TNF-α, IL-1β, and IL-6 were all considerably decreased by soy isoflavone, as predicted. Furthermore, the high-dose soy isoflavone had the same impact as the estradiol pre-treatment (Figure 3).

Figure 3 Soy isoflavone dose-dependently decreases the TNF-α, IL-1β, and IL-6 of BALF. The quantitative analysis of TNF-α, IL-1β, and IL-6 in BALF. The data represent mean ± SEM for groups of six rats (## P < 0.01 vs OVXC group; * P < 0.05, ** P < 0.01 vs OVXM group).
Figure 3

Soy isoflavone dose-dependently decreases the TNF-α, IL-1β, and IL-6 of BALF. The quantitative analysis of TNF-α, IL-1β, and IL-6 in BALF. The data represent mean ± SEM for groups of six rats (## P < 0.01 vs OVXC group; * P < 0.05, ** P < 0.01 vs OVXM group).

3.4 Soy isoflavone exhibits dose-dependent antioxidant effect to prevent LPS-induced ALI

Lung tissues were assessed 6 h after LPS treatment to determine the effects of soy isoflavone on LPS-induced pulmonary oxidative stress. We discovered that treating rats with LPS caused substantial pulmonary oxidative stress by decreasing MDA levels while increasing SOD levels in lung tissues. Pre-treatment with soy isoflavone decreased LPS-induced MDA while raising lung tissues SOD levels in a dose-dependent manner in rats. Furthermore, the high-dose soy isoflavone had the same impact as the estradiol pre-treatment (Figure 4). These findings point out that soy isoflavone pre-treatment can treat LPS-induced ALI.

Figure 4 Soy isoflavone reduces MDA while increasing SOD in a dose-dependent manner. The quantitative analysis of MDA and SOD in lung tissues. Data represent mean ± SEM for groups of six rats (## P < 0.01 vs OVXC group; * P < 0.05, ** P < 0.01 vs OVXM group).
Figure 4

Soy isoflavone reduces MDA while increasing SOD in a dose-dependent manner. The quantitative analysis of MDA and SOD in lung tissues. Data represent mean ± SEM for groups of six rats (## P < 0.01 vs OVXC group; * P < 0.05, ** P < 0.01 vs OVXM group).

3.5 AQP1 and AOP5 mRNA and protein expression are increased by soy isoflavone

According to studies, AQP1 and AQP5 are involved in the development of pulmonary edema caused by ALI [19]. Following that, we looked at the expression of AQP1 and AQP5 in lung tissues. We discovered that when rats were given LPS, the mRNA level of AQP1 and AQP5 were significantly decreased in lung tissues compared with OVXC group. Interestingly, pre-treatment with soy isoflavone up-regulated the mRNA expression of AQP1 and AQP5 in rats more than the OVXM group in a dose-dependent manner. Furthermore, the high-dose soy isoflavone had the same impact as the estradiol pre-treatment (Figure 5a). Moreover, we found that AQP1 and AQP5 protein expression was elevated dose-dependently in rats pre-treatment with soy isoflavone more than that in OVXM group by immunohistochemistry and western blot. Furthermore, the high-dose soy isoflavone had the same impact as the estradiol pre-treatment (Figure 5b). These findings point out that soy isoflavone pre-treatment can exhibit therapeutic effects in LPS-induced ALI.

Figure 5 Soy isoflavone increases the mRNA and protein of AQP1 and AQP5 of lung tissues in a dose-dependent manner. (a) Quantitative analysis of AQP1 and AQP5 in lung tissues, n = 6. (b) Representative pictures and quantitative analysis of AQP1 in lung tissues by immunohistochemistry, n = 4, the red arrow shows the expression of AQP1 in lung tissue. (c) Representative pictures and quantitative analysis of AQP5 in lung tissues by immunohistochemistry, n = 4, the red arrow shows the expression of AQP5 in lung tissue. (d) Representative images and quantitative analysis of AQP1 and AQP5 in lung tissues by western blot, n = 6. Data represent mean ± SEM for groups of 4–6 rats, scale bar = 50 μm (# P < 0.05, ## P < 0.01 vs OVXC group; * P < 0.05, ** P < 0.01 vs OVXM group).
Figure 5

Soy isoflavone increases the mRNA and protein of AQP1 and AQP5 of lung tissues in a dose-dependent manner. (a) Quantitative analysis of AQP1 and AQP5 in lung tissues, n = 6. (b) Representative pictures and quantitative analysis of AQP1 in lung tissues by immunohistochemistry, n = 4, the red arrow shows the expression of AQP1 in lung tissue. (c) Representative pictures and quantitative analysis of AQP5 in lung tissues by immunohistochemistry, n = 4, the red arrow shows the expression of AQP5 in lung tissue. (d) Representative images and quantitative analysis of AQP1 and AQP5 in lung tissues by western blot, n = 6. Data represent mean ± SEM for groups of 4–6 rats, scale bar = 50 μm (# P < 0.05, ## P < 0.01 vs OVXC group; * P < 0.05, ** P < 0.01 vs OVXM group).

4 Discussion

We employed soy isoflavone to treat ALI in rat model in this work. We discovered that soy isoflavone was protective in a dose-dependent manner and offered therapeutic promise for LPS-induced ALI. The results of a pre-treated trial with soy isoflavone showed that rats given LPS had severe ALI with lung edema, inflammation, and oxidative stress damage, which was inhibited by a pre-treated research with soy isoflavone. Importantly, we discovered that high-dose soy isoflavone had the same impact as pre-treatment with estrogen. As a consequence of the findings of this investigation, soy isoflavone is helpful and may have therapeutic potential for ALI.

Reduced inflammatory and erythrocyte infiltration in lung tissues can alleviate ALI mice considerably [35]. Soy isoflavone has anti-inflammatory and antioxidant properties, and is used to treat cancer [10], cardiovascular diseases [11], diabetes [12,13], and cerebrovascular disease [14]. In rats, soy isoflavone treatment can reduce alcoholic liver injury, ischemia/reperfusion injury, and radiation-induced lung injury [36,37], as well as radiation-induced lung injury in mice [38]. As a result, soy isoflavone may be beneficial to wounded tissues. We wanted to see if there was a new therapeutic effect of soy isoflavone in LPS-induced ALI. We pre-treated rats with soy isoflavone 14 days before administering LPS to examine the therapeutic impact of soy isoflavone on LPS-induced ALI. The therapeutic functions of soy isoflavone were obvious in rats after 6 h of LPS stimulation, with the therapeutic effects of soy isoflavone effectively attenuating pathological alterations in lung tissues (Figures 1 and 2). These findings clearly show that soy isoflavone has both preventative and therapeutic effects on LPS-induced ALI.

A range of respiratory inflammatory disorders, including acute respiratory distress syndrome, asthma, cystic fibrosis, and chronic obstructive pulmonary disease (COPD), have been related to the pathogenesis of redundant reactive oxygen species (ROS) [39]. ROS can cause inflammation in the airways and lungs by activating redox-sensitive transcription factors such activator protein 1 (AP1), hypoxia-inducible factor 1 (HIF-1) 1, and nuclear factor kappa-B (NF-κB) [40]. In ALI, oxidative stress is critical [41,42]. The current findings revealed that soy isoflavone not only had anti-inflammatory effect on lung injury, as evidenced by lower inflammatory cell infiltration, TNF-α, IL-1β, and IL-6 in BALF (Table 1, Figure 3), but also had an antioxidant impact on lung injuries, as evidenced by lower MDA levels and increased SOD levels (Figure 4).

AQP1 and AQP5 can attenuate lung edema by exerting antioxidant and anti-inflammatory functions in lung injury [18,20]. However, it is yet uncertain if soy isoflavones may protect against LPS-induced ALI by upregulating AQP1 and AQP5.

In this study, we proved that the AQP1 and AQP5 were decreased in the LPS-induced ALI model of rats. In rats, pre-treatment with soy isoflavones increased the expression of AQP1 and AQP5 in lung tissues in a dose-dependent manner (Figure 5). These findings imply that soy isoflavone has anti-inflammatory and antioxidant effects in LPS-induced ALI by inducing AQP1 and AOP5.

At present, many natural products have been studied to play a protective role through different mechanisms. Abdalla et al. found that safranal inhibits angiogenesis via targeting HIF-1α/VEGF machinery and exhibits anti-cancer property [43]. H2S displayed a hepatoprotective effect against cyclophosphamide-induced hepatotoxicity mediated by TLRs-JNK/NF-κB pathways to anti-inflammatory and antiapoptotic effects, reducing hepatic level TNF-α and caspase-3 expression [44]. Hawthorn herbal preparation from Crataegus oxyacantha attenuates carbon tetrachloride-induced hepatic fibrosis via modulating oxidative stress and inflammation in animals [45]. Similar to cyclophosphamide-induced liver injury, LPS-induced ALI also results in severe inflammation, oxidative stress, and apoptosis. A recent study found that isoflavones contributed to protecting from ALI via inhibiting toll-like receptor 4 (TLR4)/Myd88/NF-κB pathway and play anti-inflammation role [46]. Despite the fact that our findings imply that soy isoflavone via increasing AQP1 and AQP5 expression to reduce inflammation and oxidative stress, the exact mechanism needs to be researched further, especially the antioxidant. For example, NF-κB-mediated inflammation [35], coagulation/fibrinolysis system imbalance, cell apoptosis, autophagy and pyrosis of cells, ENaC, Na, K-ATPase, chloride ion channel, and other factors may influence pulmonary edema, and we should investigate them more.

5 Conclusion

Our findings reveal that soy isoflavone functions as anti-inflammatory and antioxidant through activating the AQP1 and AQP5 in LPS-induced ALI. Although these findings show soy isoflavones may protect against ALI by inducing AQP1 and AQP5, molecular alterations in ALI could nullify the effectiveness of such soy flavones. The molecular mechanism of natural plant-derived substances may be complex, and the present study only involves the change of AQP1 and AQP5 expression level. Further studies and study models are needed to demonstrate the therapeutic potential of soy flavones in ALI.

# These authors contributed equally to this work.

  1. Funding information: This work was supported by the Key Project of Social Development of Jinhua Science and Technology Bureau of Zhejiang Province (No. 2017-3-012) and the Public Welfare Project of Science and Technology Department of Zhejiang Province (No. LGD19H150001).

  2. Author contributions: Xiaobo Wang and Yili Zhang performed the experiments, analyzed the data, and wrote the manuscript. Xiuyun Zhou, Xiumei Xia, Weijun Teng, and Lin Sheng performed animal model, data collection, and analysis. Jing Ding designed and supervised the study and revised the manuscript.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Mokra D. Acute lung injury – from pathophysiology to treatment. Physiol Res. 2020 Dec 31;69(Suppl 3):S353–66.10.33549/physiolres.934602Search in Google Scholar PubMed PubMed Central

[2] Mowery NT, Terzian WTH, Nelson AC. Acute lung injury. Curr Probl Surg. 2020 May;57(5):100777.10.1016/j.cpsurg.2020.100777Search in Google Scholar PubMed

[3] Zhou Z, Zhu Y, Gao G, Zhang Y. Long noncoding RNA SNHG16 targets miR-146a-5p/CCL5 to regulate LPS-induced WI-38 cell apoptosis and inflammation in acute pneumonia. Life Sci. 2019 Jul 1;228:189–97.10.1016/j.lfs.2019.05.008Search in Google Scholar PubMed

[4] Amin A, Aaminah F, Chandraprabha M, Akbar S, Francoise P, Grazia G, et al. Saffron and its major ingredients' effect on colon cancer cells with mismatch repair deficiency and microsatellite instability. Molecules. 2021 Jun 24;26(13):3855.10.3390/molecules26133855Search in Google Scholar PubMed PubMed Central

[5] Mariam A-S, Amin A, Ernest A. Effect of vitamin C on liver and kidney functions in normal and diabetic rats. Ann N Y Acad Sci. 2006 Nov;1084:371–90.10.1196/annals.1372.031Search in Google Scholar PubMed

[6] Al-Shamsi M, Amin A, Adeghate E. Vitamin E ameliorates some biochemical parameters in normal and diabetic rats. Ann N Y Acad Sci. 2006 Nov;1084:411–31.10.1196/annals.1372.033Search in Google Scholar PubMed

[7] Amin A, Hamza AA, Daoud S, Hamza W. Spirulina protects against cadmium-induced hepatotoxicity in rats. Am J Pharmacol Toxicol. 2006;1(2):21–5.10.3844/ajptsp.2006.21.25Search in Google Scholar

[8] Amin A, Lotfy M, Doaa MG, Ernest A, Mohamed AA, Maryam A, et al. Pancreas-protective effects of chlorella in STZ-induced diabetic animal model: insights into the mechanism. J Diabetes. 2011;1(3):36–45.10.4236/jdm.2011.13006Search in Google Scholar

[9] El-Dakhly SM, Salama AAA, Hassanin SOM, Yassen NN, Hamaza AA, Amin A. Aescin and diosmin each alone or in low dose-combination ameliorate liver damage induced by carbon tetrachloride in rats. BMC Res Notes. 2020 May 27;13(1):259.10.1186/s13104-020-05094-2Search in Google Scholar PubMed PubMed Central

[10] Sahin I, Bilir B, Ali S, Sahin K, Kucuk O. Soy isoflavones in integrative oncology: increased efficacy and decreased toxicity of cancer therapy. Integr Cancer Ther. 2019 Jan–Dec;18:1534735419835310.10.1177/1534735419835310Search in Google Scholar PubMed PubMed Central

[11] Yamagata K. Soy isoflavones inhibit endothelial cell dysfunction and prevent cardiovascular disease. J Cardiovasc Pharmacol. 2019 Sep;74(3):201–9.10.1097/FJC.0000000000000708Search in Google Scholar PubMed

[12] Jheng HF, Hayashi K, Matsumura Y, Kawada T, Seno S, Matsuda H, et al. Anti-inflammatory and antioxidative properties of isoflavones provide renal protective effects distinct from those of dietary soy proteins against diabetic nephropathy. Mol Nutr Food Res. 2020 May;64(10):e2000015.10.1002/mnfr.202000015Search in Google Scholar PubMed

[13] Valsecchi AE, Franchi S, Panerai AE, Rossi A, Sacerdote P, Colleoni M. The soy isoflavone genistein reverses oxidative and inflammatory state, neuropathic pain, neurotrophic and vasculature deficits in diabetes mouse model. Eur J Pharmacol. 2011 Jan 15;650(2–3):694–702.10.1016/j.ejphar.2010.10.060Search in Google Scholar PubMed

[14] Ding J, Yu HL, Ma WW, Xi Y, Zhao X, Yuan LH, et al. Soy isoflavone attenuates brain mitochondrial oxidative stress induced by β-amyloid peptides 1-42 injection in lateral cerebral ventricle. J Neurosci Res. 2013 Apr;91(4):562–7.10.1002/jnr.23163Search in Google Scholar PubMed

[15] Faize M, Fumanal B, Luque F, Ramírez-Tejero JA, Zou Z, Qiao X, et al. Genome wild analysis and molecular understanding of the aquaporin diversity in olive trees (Olea europaea L.). Int J Mol Sci. 2020 Jun 11;21(11):4183.10.3390/ijms21114183Search in Google Scholar PubMed PubMed Central

[16] Yadav E, Yadav N, Hus A, Yadav JS. Aquaporins in lung health and disease: emerging roles, regulation, and clinical implications. Respir Med. 2020 Nov–Dec;174:106193.10.1016/j.rmed.2020.106193Search in Google Scholar PubMed PubMed Central

[17] Pitkänen OM. Lung liquid transport components in human perinatal respiratory distress. Acta Paediatr. 2009 Nov;98(11):1709–11.10.1111/j.1651-2227.2009.01521.xSearch in Google Scholar PubMed

[18] Inoue KI, Takano H, Yanagisawa R, Sakurai M, Shimada A, Sato H, et al. Antioxidative role of urinary trypsin inhibitor in acute lung injury induced by lipopolysaccharide. Int J Mol Med. 2005 Dec;16(6):1029–33.10.3892/ijmm.16.6.1029Search in Google Scholar

[19] Li J, Xu M, Fan Q, Xie X, Zhang Y, Mu D, et al. Tanshinone IIA ameliorates seawater exposure-induced lung injury by inhibiting aquaporins (AQP) 1 and AQP5 expression in lung. Respir Physiol Neurobiol. 2011 Apr 30;176(1–2):39–49.10.1016/j.resp.2011.01.005Search in Google Scholar PubMed

[20] Wang F, Huang H, Lu F, Chen Y. Acute lung injury and change in expression of aquaporins 1 and 5 in a rat model of acute pancreatitis. Hepatogastroenterology. 2010 Nov–Dec;57(104):1553–62.Search in Google Scholar

[21] Jin Y, Yu G, Peng P, Zhang Y, Xin X. Down-regulated expression of AQP5 on lung in rat DIC model induced by LPS and its effect on the development of pulmonary edema. Pulm Pharmacol Ther. 2013 Dec;26(6):661–5.10.1016/j.pupt.2013.03.013Search in Google Scholar PubMed

[22] Ma T, Liu Z. Functions of aquaporin 1 and α-epithelial Na+ channel in rat acute lung injury induced by acute ischemic kidney injury. Int Urol Nephrol. 2013 Aug;45(4):1187–96.10.1007/s11255-012-0355-1Search in Google Scholar PubMed

[23] Tan L, Zhang Y, Crowe-White KM, Senkus KE, Erwin ME, Wang H. Vitamin A supplementation during suckling and postweaning periods attenuates the adverse metabolic effects of maternal high-fat diet consumption in Sprague–Dawley rats. Curr Dev Nutr. 2020 Jun 27;4(8), nzaa111.10.1093/cdn/nzaa111Search in Google Scholar PubMed PubMed Central

[24] Brito NMB, Carvalho RD, Matos LT, Lobato RCL, Brito RB. The oophorectomy effect on walker 256 tumor inoculated into the vagina and uterine cervix of female rats. Acta Cir Bras. 2009 Jan–Feb;24(1):26–9.10.1590/S0102-86502009000100006Search in Google Scholar PubMed

[25] Saleh N, Nassef N, Shawky MK, Elshishiny MI, Saleh HA. Novel approach for pathogenesis of osteoporosis in ovariectomized rats as a model of postmenopausal osteoporosis. Exp Gerontol. 2020 Aug;137:110935.10.1016/j.exger.2020.110935Search in Google Scholar PubMed

[26] Xu X, Li X, Liang Y, Ou Y, Huang J, Xiong J, et al. Estrogen modulates cartilage and subchondral bone remodeling in an ovariectomized rat model of postmenopausal osteoarthritis. Med Sci Monit. 2019 Apr 29;25:3146–53.10.12659/MSM.916254Search in Google Scholar PubMed PubMed Central

[27] Park J, Chen Y, Zheng M, Ryu J, Cho GJ, Surh YJ, et al. Pterostilbene 4-β-glucoside attenuates LPS-induced acute lung injury via induction of heme oxygenase-1. Oxid Med Cell Longev. 2018 Oct 23;2018:2747018.10.1155/2018/2747018Search in Google Scholar PubMed PubMed Central

[28] Yeh CW, Wu WJ, Lu CW, Wang SE, Chuang WC, Lee MC, et al. Traditional Chinese Medicine Yang-Gan-Wan alleviated experimental hepatic damage by inhibiting oxidation, inflammation, and apoptosis in cell and mouse models. Evid Based Complement Altern Med. 2021 Oct 5;2021:2556352.10.1155/2021/2556352Search in Google Scholar PubMed PubMed Central

[29] Huang XR, Chung ACK, Yang F, Yue W, Deng C, Lau CP, et al. Smad3 mediates cardiac inflammation and fibrosis in angiotensin II-induced hypertensive cardiac remodeling. Hypertension. 2010 May;55(5):1165–71.10.1161/HYPERTENSIONAHA.109.147611Search in Google Scholar PubMed

[30] Wu X, He L, Chen F, He X, Cai Y, Zhang G, et al. Impaired autophagy contributes to adverse cardiac remodeling in acute myocardial infarction. PLoS One. 2014 Nov 19;9(11):e112891.10.1371/journal.pone.0112891Search in Google Scholar PubMed PubMed Central

[31] Wei LH, Huang XR, Zhang Y, Li YQ, Chen H, Yan BP, et al. Smad7 inhibits angiotensin II-induced hypertensive cardiac remodelling. Cardiovasc Res. 2013 Sep 1;99(4):665–73.10.1093/cvr/cvt151Search in Google Scholar PubMed

[32] Meng J, Qin Y, Chen J, Wei L, Huang XR, Yu X, et al. Treatment of hypertensive heart disease by targeting smad3 signaling in mice. Mol Ther Methods Clin Dev. 2020 Aug 5;18:791–802.10.1016/j.omtm.2020.08.003Search in Google Scholar PubMed PubMed Central

[33] Corrêa TD, Pereira AJ, Brandt S, Vuda M, Djafarzadeh S, Takala J, et al. Time course of blood lactate levels, inflammation, and mitochondrial function in experimental sepsis. Crit Care. 2017 May 12;21(1):105.10.1186/s13054-017-1691-4Search in Google Scholar PubMed PubMed Central

[34] Chin JY, Koh Y, Kim MJ, Kim HS, Kim WS, Kim DS, et al. The effects of hypothermia on endotoxin-primed lung. Anesth Analg. 2007 May;104(5):1171–8.10.1213/01.ane.0000260316.95836.1cSearch in Google Scholar PubMed

[35] Gan DL, Yao Y, Su HW, Huang YY, Shi JF, Liu XB, et al. Volatile oil of Platycladus orientalis (L.) franco leaves exerts strong anti-inflammatory effects via inhibiting the IkappaB/NF-kappaB pathway. Curr Med Sci. 2021 Feb;41(1):180–6.10.1007/s11596-020-2301-2Search in Google Scholar PubMed

[36] Won SB, Kwon YH. Maternal consumption of low-isoflavone soy protein isolate confers the increased predisposition to alcoholic liver injury in adult rat offspring. Nutrients. 2018 Mar 10;10(3):332.10.3390/nu10030332Search in Google Scholar PubMed PubMed Central

[37] Tang Y, Li S, Zhang P, Zhu J, Meng G, Xie L, et al. Soy isoflavone protects myocardial ischemia/reperfusion injury through increasing endothelial nitric oxide synthase and decreasing oxidative stress in ovariectomized rats. Oxid Med Cell Longev. 2016;2016:5057405.10.1155/2016/5057405Search in Google Scholar PubMed PubMed Central

[38] Fountain MD, Mclellan LA, Smith NL, Loughery BF, Rakowski JT, Tse HY, et al. Isoflavone-mediated radioprotection involves regulation of early endothelial cell death and inflammatory signaling in radiation-induced lung injury. Int J Radiat Biol. 2020 Feb;96(2):245–56.10.1080/09553002.2020.1683642Search in Google Scholar PubMed PubMed Central

[39] Huang WC, Liu CY, Shen SC, Chen LC, Yeh KW, Liu SH, et al. Protective effects of licochalcone a improve airway hyper-responsiveness and oxidative stress in a mouse model of asthma. Cells. 2019 Jun 20;8(6):617.10.3390/cells8060617Search in Google Scholar PubMed PubMed Central

[40] Park HS, Kim SR, Lee YC. Impact of oxidative stress on lung diseases. Respirology. 2009 Jan;14(1):27–38.10.1111/j.1440-1843.2008.01447.xSearch in Google Scholar PubMed

[41] Yang H, Lv H, Li H, Ci X, Peng L. Oridonin protects LPS-induced acute lung injury by modulating Nrf2-mediated oxidative stress and Nrf2-independent NLRP3 and NF-κB pathways. Cell Commun Signal. 2019 Jun 11;17(1):62.10.1186/s12964-019-0366-ySearch in Google Scholar PubMed PubMed Central

[42] Lei J, Wei Y, Song P, Li Y, Zhang T, Feng Qet al. Cordycepin inhibits LPS-induced acute lung injury by inhibiting inflammation and oxidative stress. Eur J Pharmacol. 2018 Jan 5;818:110–4.10.1016/j.ejphar.2017.10.029Search in Google Scholar PubMed

[43] Abdalla A, Murali C, Amin A. Safranal inhibits angiogenesis via targeting HIF-1alpha/VEGF machinery: in vitro and ex vivo insights. Front Oncol. 2022 Feb 2;11:789172.10.3389/fonc.2021.789172Search in Google Scholar PubMed PubMed Central

[44] Abdel-Latif R, Heeba GH, Hassanin SO, Waz S, Amin A. TLRs-JNK/ NF-kappaB pathway underlies the protective effect of the sulfide salt against liver toxicity. Front Pharmacol. 2022 Apr 20;13:850066.10.3389/fphar.2022.850066Search in Google Scholar PubMed PubMed Central

[45] Hamza AA, Lashin FM, Gamel M, Hassanin SO, Abdalla Y, Amin A. Hawthorn herbal preparation from Crataegus oxyacantha attenuates in vivo carbon tetrachloride-induced hepatic fibrosis via modulating oxidative stress and inflammation. Antioxidants (Basel). 2020 Nov 24;9(12):1173.10.3390/antiox9121173Search in Google Scholar PubMed PubMed Central

[46] Aboushanab SA, EI-Far AH, Narala VR, Ragab RF, Kovaleva EG. Potential therapeutic interventions of plant-derived isoflavones against acute lung injury. Int Immunopharmacol. 2021 Dec;101(Pt A):108204.10.1016/j.intimp.2021.108204Search in Google Scholar PubMed

Received: 2022-09-03
Revised: 2022-12-29
Accepted: 2023-01-02
Published Online: 2023-02-10

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
  3. Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
  4. Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
  5. Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
  6. A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
  7. Neutrophilia with subclinical Cushing’s disease: A case report and literature review
  8. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
  9. Immunoregulation of synovial macrophages for the treatment of osteoarthritis
  10. Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
  11. Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
  12. Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
  13. High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
  14. Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
  15. Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
  16. Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
  17. Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
  18. Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
  19. Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
  20. Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
  21. Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
  22. Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
  23. Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
  24. Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
  25. 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
  26. Experimental study on the optimization of ANM33 release in foam cells
  27. Primary retroperitoneal angiosarcoma: A case report
  28. Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
  29. Malignant pleural effusion diagnosis and therapy
  30. Effect of spaceflight on the phenotype and proteome of Escherichia coli
  31. Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
  32. Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
  33. Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
  34. The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
  35. Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
  36. mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
  37. The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
  38. Radiotherapy for primary thyroid adenoid cystic carcinoma
  39. Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
  40. Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
  41. Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
  42. Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
  43. PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
  44. The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
  45. Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
  46. Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
  47. NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
  48. Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
  49. Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
  50. Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
  51. Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
  52. Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
  53. Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
  54. Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
  55. Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
  56. Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
  57. Gemella morbillorum infective endocarditis: A case report and literature review
  58. An unusual ectopic thymoma clonal evolution analysis: A case report
  59. Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
  60. Detection of V. vulnificus septic shock with ARDS using mNGS
  61. Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
  62. The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
  63. Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
  64. ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
  65. Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
  66. Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
  67. Collagen changes in rabbit conjunctiva after conjunctival crosslinking
  68. Effects of NM23 transfection of human gastric carcinoma cells in mice
  69. Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
  70. Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
  71. Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
  72. Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
  73. Giant duplication of the transverse colon in an adult: A case report and literature review
  74. Ectopic thyroid tissue in the breast: A case report
  75. SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
  76. Vaginal metastasis from breast cancer: A case report
  77. Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
  78. Inhibition of TAZ impairs the migration ability of melanoma cells
  79. Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
  80. Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
  81. Identification of winter wheat pests and diseases based on improved convolutional neural network
  82. Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
  83. Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
  84. Immune checkpoint inhibitors in cancer patients with COVID-19
  85. Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
  86. Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
  87. Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
  88. DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
  89. Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
  90. Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
  91. Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
  92. Studying infant mortality: A demographic analysis based on data mining models
  93. Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
  94. Protein Z modulates the metastasis of lung adenocarcinoma cells
  95. Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
  96. TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
  97. Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
  98. Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
  99. Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
  100. Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
  101. Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
  102. HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
  103. Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
  104. Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
  105. Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
  106. Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
  107. Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
  108. Research progress on gas signal molecular therapy for Parkinson’s disease
  109. Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
  110. The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
  111. α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
  112. CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
  113. Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
  114. Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
  115. Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
  116. Research progress of AMP-activated protein kinase and cardiac aging
  117. TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
  118. Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
  119. Metastasis from small cell lung cancer to ovary: A case report
  120. The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
  121. The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
  122. Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
  123. Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
  124. Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
  125. Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
  126. Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
  127. Traumatic brain injury and rTMS-ERPs: Case report and literature review
  128. Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
  129. Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
  130. The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
  131. Inflammation-related signaling pathways in tendinopathy
  132. CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
  133. Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
  134. Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
  135. Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
  136. Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
  137. Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
  138. Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
  139. TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
  140. Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
  141. Ferroptosis: A potential target of macrophages in plaque vulnerability
  142. Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
  143. Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
  144. HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
  145. IL-17 in osteoarthritis: A narrative review
  146. Circadian cycle and neuroinflammation
  147. Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
  148. Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
  149. SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
  150. Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
  151. PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
  152. Pancreatic ectopic thyroid tissue: A case report and analysis of literature
  153. The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
  154. Report on a case of liver-originating malignant melanoma of unknown primary
  155. Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
  156. The fibroblast growth factor–Klotho axis at molecular level
  157. Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
  158. A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
  159. Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
  160. Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
  161. Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
  162. Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
  163. Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
  164. Case report of atypical undernutrition of hypoproteinemia type
  165. Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
  166. Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
  167. Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
  168. Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
  169. Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
  170. Precisional detection of lymph node metastasis using tFCM in colorectal cancer
  171. Advances in diagnosis and treatment of perimenopausal syndrome
  172. A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
  173. Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
  174. Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
  175. Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
  176. Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
  177. Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
  178. Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
  179. An online diagnosis method for cancer lesions based on intelligent imaging analysis
  180. Medical imaging in rheumatoid arthritis: A review on deep learning approach
  181. Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
  182. Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
  183. A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
  184. TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
  185. Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
  186. Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
  187. Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
  188. Hepatobiliary surgery based on intelligent image segmentation technology
  189. Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
  190. Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
  191. Early diagnosis for the onset of peri-implantitis based on artificial neural network
  192. Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
  193. Forecast of pain degree of lumbar disc herniation based on back propagation neural network
  194. SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
  195. Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
  196. Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
  197. A novel approach for minimising anti-aliasing effects in EEG data acquisition
  198. ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
  199. Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
  200. Lung nodule segmentation via semi-residual multi-resolution neural networks
  201. Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
  202. A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
  203. Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
  204. Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
  205. Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
  206. Monitoring and evaluation of anesthesia depth status data based on neuroscience
  207. Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
  208. Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
  209. Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
  210. Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
  211. Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
  212. From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
  213. Ecology and Environmental Science
  214. Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
  215. Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
  216. Effects of cadmium stress on fruits germination and growth of two herbage species
  217. Bamboo charcoal affects soil properties and bacterial community in tea plantations
  218. Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
  219. Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
  220. Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
  221. Food Science
  222. Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
  223. Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
  224. Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
  225. Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
  226. Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
  227. Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
  228. Microbiological transglutaminase: Biotechnological application in the food industry
  229. Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
  230. Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
  231. The potential for the use of leghemoglobin and plant ferritin as sources of iron
  232. Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
  233. Bioengineering and Biotechnology
  234. Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
  235. Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
  236. Agriculture
  237. Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
  238. On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
  239. Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
  240. A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
  241. Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
  242. Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
  243. Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
  244. Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
  245. Animal Sciences
  246. Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
  247. Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
  248. Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
  249. Tracking behavioral changes of confined sows from the first mating to the third parity
  250. The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
  251. Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
  252. Plant Sciences
  253. Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
  254. Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
  255. Tissue culture and rapid propagation technology for Gentiana rhodantha
  256. Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
  257. Cloning and expression analysis of VrNAC13 gene in mung bean
  258. Chlorate-induced molecular floral transition revealed by transcriptomes
  259. Effects of warming and drought on growth and development of soybean in Hailun region
  260. Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
  261. Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
  262. Distinguish Dianthus species or varieties based on chloroplast genomes
  263. Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
  264. Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
  265. An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
  266. Erratum
  267. Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
  268. Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
  269. Retraction
  270. Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
https://doi.org/10.1515/biol-2022-0560
Keywords for this article
soy isoflavone; aquaporin 1; aquaporin 5; acute lung injury; inflammation
Creative Commons
BY 4.0

Articles in the same Issue

  1. Biomedical Sciences
  2. Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
  3. Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
  4. Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
  5. Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
  6. A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
  7. Neutrophilia with subclinical Cushing’s disease: A case report and literature review
  8. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
  9. Immunoregulation of synovial macrophages for the treatment of osteoarthritis
  10. Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
  11. Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
  12. Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
  13. High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
  14. Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
  15. Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
  16. Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
  17. Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
  18. Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
  19. Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
  20. Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
  21. Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
  22. Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
  23. Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
  24. Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
  25. 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
  26. Experimental study on the optimization of ANM33 release in foam cells
  27. Primary retroperitoneal angiosarcoma: A case report
  28. Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
  29. Malignant pleural effusion diagnosis and therapy
  30. Effect of spaceflight on the phenotype and proteome of Escherichia coli
  31. Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
  32. Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
  33. Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
  34. The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
  35. Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
  36. mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
  37. The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
  38. Radiotherapy for primary thyroid adenoid cystic carcinoma
  39. Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
  40. Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
  41. Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
  42. Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
  43. PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
  44. The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
  45. Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
  46. Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
  47. NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
  48. Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
  49. Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
  50. Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
  51. Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
  52. Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
  53. Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
  54. Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
  55. Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
  56. Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
  57. Gemella morbillorum infective endocarditis: A case report and literature review
  58. An unusual ectopic thymoma clonal evolution analysis: A case report
  59. Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
  60. Detection of V. vulnificus septic shock with ARDS using mNGS
  61. Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
  62. The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
  63. Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
  64. ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
  65. Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
  66. Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
  67. Collagen changes in rabbit conjunctiva after conjunctival crosslinking
  68. Effects of NM23 transfection of human gastric carcinoma cells in mice
  69. Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
  70. Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
  71. Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
  72. Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
  73. Giant duplication of the transverse colon in an adult: A case report and literature review
  74. Ectopic thyroid tissue in the breast: A case report
  75. SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
  76. Vaginal metastasis from breast cancer: A case report
  77. Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
  78. Inhibition of TAZ impairs the migration ability of melanoma cells
  79. Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
  80. Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
  81. Identification of winter wheat pests and diseases based on improved convolutional neural network
  82. Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
  83. Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
  84. Immune checkpoint inhibitors in cancer patients with COVID-19
  85. Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
  86. Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
  87. Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
  88. DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
  89. Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
  90. Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
  91. Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
  92. Studying infant mortality: A demographic analysis based on data mining models
  93. Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
  94. Protein Z modulates the metastasis of lung adenocarcinoma cells
  95. Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
  96. TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
  97. Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
  98. Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
  99. Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
  100. Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
  101. Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
  102. HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
  103. Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
  104. Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
  105. Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
  106. Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
  107. Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
  108. Research progress on gas signal molecular therapy for Parkinson’s disease
  109. Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
  110. The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
  111. α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
  112. CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
  113. Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
  114. Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
  115. Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
  116. Research progress of AMP-activated protein kinase and cardiac aging
  117. TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
  118. Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
  119. Metastasis from small cell lung cancer to ovary: A case report
  120. The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
  121. The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
  122. Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
  123. Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
  124. Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
  125. Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
  126. Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
  127. Traumatic brain injury and rTMS-ERPs: Case report and literature review
  128. Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
  129. Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
  130. The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
  131. Inflammation-related signaling pathways in tendinopathy
  132. CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
  133. Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
  134. Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
  135. Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
  136. Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
  137. Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
  138. Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
  139. TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
  140. Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
  141. Ferroptosis: A potential target of macrophages in plaque vulnerability
  142. Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
  143. Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
  144. HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
  145. IL-17 in osteoarthritis: A narrative review
  146. Circadian cycle and neuroinflammation
  147. Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
  148. Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
  149. SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
  150. Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
  151. PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
  152. Pancreatic ectopic thyroid tissue: A case report and analysis of literature
  153. The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
  154. Report on a case of liver-originating malignant melanoma of unknown primary
  155. Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
  156. The fibroblast growth factor–Klotho axis at molecular level
  157. Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
  158. A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
  159. Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
  160. Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
  161. Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
  162. Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
  163. Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
  164. Case report of atypical undernutrition of hypoproteinemia type
  165. Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
  166. Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
  167. Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
  168. Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
  169. Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
  170. Precisional detection of lymph node metastasis using tFCM in colorectal cancer
  171. Advances in diagnosis and treatment of perimenopausal syndrome
  172. A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
  173. Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
  174. Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
  175. Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
  176. Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
  177. Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
  178. Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
  179. An online diagnosis method for cancer lesions based on intelligent imaging analysis
  180. Medical imaging in rheumatoid arthritis: A review on deep learning approach
  181. Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
  182. Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
  183. A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
  184. TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
  185. Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
  186. Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
  187. Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
  188. Hepatobiliary surgery based on intelligent image segmentation technology
  189. Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
  190. Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
  191. Early diagnosis for the onset of peri-implantitis based on artificial neural network
  192. Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
  193. Forecast of pain degree of lumbar disc herniation based on back propagation neural network
  194. SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
  195. Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
  196. Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
  197. A novel approach for minimising anti-aliasing effects in EEG data acquisition
  198. ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
  199. Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
  200. Lung nodule segmentation via semi-residual multi-resolution neural networks
  201. Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
  202. A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
  203. Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
  204. Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
  205. Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
  206. Monitoring and evaluation of anesthesia depth status data based on neuroscience
  207. Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
  208. Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
  209. Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
  210. Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
  211. Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
  212. From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
  213. Ecology and Environmental Science
  214. Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
  215. Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
  216. Effects of cadmium stress on fruits germination and growth of two herbage species
  217. Bamboo charcoal affects soil properties and bacterial community in tea plantations
  218. Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
  219. Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
  220. Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
  221. Food Science
  222. Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
  223. Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
  224. Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
  225. Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
  226. Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
  227. Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
  228. Microbiological transglutaminase: Biotechnological application in the food industry
  229. Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
  230. Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
  231. The potential for the use of leghemoglobin and plant ferritin as sources of iron
  232. Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
  233. Bioengineering and Biotechnology
  234. Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
  235. Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
  236. Agriculture
  237. Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
  238. On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
  239. Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
  240. A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
  241. Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
  242. Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
  243. Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
  244. Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
  245. Animal Sciences
  246. Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
  247. Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
  248. Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
  249. Tracking behavioral changes of confined sows from the first mating to the third parity
  250. The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
  251. Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
  252. Plant Sciences
  253. Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
  254. Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
  255. Tissue culture and rapid propagation technology for Gentiana rhodantha
  256. Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
  257. Cloning and expression analysis of VrNAC13 gene in mung bean
  258. Chlorate-induced molecular floral transition revealed by transcriptomes
  259. Effects of warming and drought on growth and development of soybean in Hailun region
  260. Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
  261. Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
  262. Distinguish Dianthus species or varieties based on chloroplast genomes
  263. Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
  264. Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
  265. An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
  266. Erratum
  267. Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
  268. Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
  269. Retraction
  270. Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 7.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0560/html
Scroll to top button