Home Life Sciences Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
Article Open Access

Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report

  • Xiujuan Che , Zhiyi He , Tao-Hsin Tung , Han Xia and Zhibao Lu EMAIL logo
Published/Copyright: May 23, 2023

Abstract

Primary amoebic meningoencephalitis (PAM) caused by Naegleria fowleri is a fatal infection with a mortality rate of more than 95%, despite advances in antimicrobial chemotherapy and supportive care. Initial manifestations of PAM are indistinguishable from bacterial meningitis. Prompt diagnosis and antifungal treatment may help decline the overall mortality. Here we present a case of a 38-year-old man transferred to our hospital due to mild headache, which deteriorated quickly. Severe increased intracranial pressure was found. The cerebrospinal fluid (CSF) was yellowish with significantly increased leukocyte and protein. Smear and culture were negative. The patient was first diagnosed with pyogenic meningoencephalitis. However, the symptoms deteriorated. Metagenomic next-generation sequencing (mNGS) of CSF was applied and finally confirmed N. fowleri as the protist pathogen within 24 h. However, due to the time cost of sampling and transportation (2 days), the diagnosis came too late, and the patient passed away 1 day before. In summary, mNGS is a rapid and accurate diagnostic method for clinical practices, especially for rare central nervous system infections. It should be used as quickly as possible for acute infections, such as PAM. All aspects of patient interrogation and prompt identification should be paramount to ensure appropriate treatment and decline the overall mortality.

1 Background

Primary amoebic meningoencephalitis (PAM) caused by Naegleria fowleri is an acute, fulminant, necrotizing, and hemorrhagic meningoencephalitis, characterized by severe headache, stiff neck, fever (38.5–41°C), altered mental status, seizures, and coma [1,2]. However, the absence of specific clinical evidence of PAM may lead to missed diagnosis and lack of timely treatment. As the most severely affected area was the brain stem, increased intracranial pressure and herniation are usually the causes of death. Regardless of the treatment regimen, the mortality rate of PAM remains approximately 98% [1]. Therefore, early diagnosis is very important for the timely intervention and administration of antibiotics in PAM patients. Unfortunately, the diagnosis of PAM is easily overlooked due to its similar manifestations with bacterial meningoencephalitis and the difficulty of culture of the pathogen. Here we describe a rare case of fulminant PAM caused by N. fowleri. The patient was first diagnosed with pyogenic meningoencephalitis, while metagenomic next-generation sequencing (mNGS) finally detected the pathogen.

2 Case presentation

A 38-year-old male was transferred to our hospital on October 23rd, 2019 due to fever and headache for 2 days and disturbance of consciousness for 1 day. On the day before admission, he visited the local hospital with chief complaint of high fever and persistent dull headache with severe vomiting. The patient had no history of exposure to freshwater. According to the computer tomography (CT) scan of the head and the cerebrospinal fluid (CSF) test results of the local hospital (Table 1), bacterial meningitis was first considered. Penicillin and ceftriaxone sodium were given. However, the condition was worse, and lethargy appeared.

Table 1

Investigations of CSF

CSF Appearance Pressure (mmH2O) White blood cell (WBC × 106/L) Protein (mg/L) Glucose (mmol/L) Chloride (mmol/L)
Before admission 150 1,920 1228.6 0.11 111
After admission Cloudy, yellowish >400 104,614 1481.6 1.3 114

On admission, he was conscious but disorientated. The Glasgow score (GCS) was 10. There was pronounced head retraction and opisthotonus with obvious neck rigidity and positive Kernig’s signs. The temperature was 38.0°C. Examination of the nervous system showed no localizing signs. The clinical diagnosis was pyogenic meningitis.

Three hours after admission, he turned to mild coma (GCS 7) with shortness of breath. Then, mechanical ventilation and sedation were given. Five hours after admission, a lumbar puncture was done. CSF showed significantly elevated white blood cells, and the intracranial pressure was high (Table 1). Sixteen hours after admission, CT revealed diffuse edema of the whole brain (Figure 1b and c). Nineteen hours after admission, he turned to deep coma (GCS 3), and his pupils became dilated.

Figure 1 
               (a) After admission, there showed a cloudy and yellowish CSF. (b and c) Head CT scan showing the decreased density of brain parenchyma, and the narrowed cistern and sulcus, which indicate diffuse swelling of the brain. (d) The physical fragment of N. fowleri was 134 bp. The results were consistent with the electrophoretic bands of the patient (Lane 1), and the negative control (Lane 2) had no bands. It is indicated that Naegleria fowleri exists in this sample. (e) mNGS results show that a total of 23,834 specific reads of N. fowleri were detected in CSF, the coverage was 6.08%.
Figure 1

(a) After admission, there showed a cloudy and yellowish CSF. (b and c) Head CT scan showing the decreased density of brain parenchyma, and the narrowed cistern and sulcus, which indicate diffuse swelling of the brain. (d) The physical fragment of N. fowleri was 134 bp. The results were consistent with the electrophoretic bands of the patient (Lane 1), and the negative control (Lane 2) had no bands. It is indicated that Naegleria fowleri exists in this sample. (e) mNGS results show that a total of 23,834 specific reads of N. fowleri were detected in CSF, the coverage was 6.08%.

Two days after admission (October 25th), he remained comatose, with fixed dilated pupils, complete lack of response to stimuli, and spontaneous breathing. The collected CSF sample (2–3 mL) was then sent for PACEseq mNGS (Hugobiotech, Beijing) to detect the pathogen. DNA was extracted and purified from 200 µL CSF supernatant according to the manufacture’s instruction of TIANGEN DNA Mini kit DP316. The DNA library was constructed using QIAseqTM Ultralow Input Library Kit. The concentration and quality of library was checked using Qubit and agarose gel electrophoresis, and the qualified library was then sequenced on Illumina Miniseq platform. A total of 23,834 specific sequence reads of N. fowleri were detected by mNGS (Figure 1e). The pathogen was then confirmed by PCR (Figure 1d) using the specific primers F (TCTAGAGATCCAACCAATGG) and R (GTCTTTGTGAAAACATCACC). As a result, the patient was diagnosed with PAM caused by N. fowleri. Though mNGS successfully detected the pathogen within 24 h (from October 27th to 28th), too much time had been cost during sampling and transportation (2 days). The patient had passed away on October 26th.

  1. Informed consent: Informed consent has been obtained from all individuals included in this study.

  2. Ethical approval: The research related to human use has been complied with all the relevant national regulations, institutional policies, and in accordance with the tenets of the Helsinki Declaration, and has been approved by the authors’ institutional review board or equivalent committee.

3 Discussion

PAM caused by N. fowleri is an acute, fulminant, necrotizing, and hemorrhagic meningoencephalitis [1]. The protist pathogen, N. fowleri, is a thermophilic free-living amoeba that can be found in warm lakes and rivers, geothermal springs, naturally hot untreated water supplies, and warm water discharge from industrial plants [1,3,4]. Most patients with PAM experience a history of activities in warm, fresh water which can cause contaminated water entering the nasal cavity [5,6]. The pathogen may then invade the nervous system and cause an infection. PAM cases without water activities were few. It is reported that inhalation of cyst-laden dust is also an important mechanism for PAM, accounting for 6.5% of PAM cases [7], which is extremely concerning. The time of clinical symptoms onset of PAM ranges from 1 to 15 days after exposure [4,8]. Initial manifestations of PAM include fever, severe headache, photophobia, confusion, seizures, and coma, which are indistinguishable from bacterial meningitis [9,10]. In addition, CSF of infected patients is often hazy with increased intracranial pressure, hypoglycorrhachia, elevated protein, and significant pleocytosis (especially neutrophilic predominance), which is also similar to bacterial meningoencephalitis. So, misdiagnosis of PAM is common. However, as brain stem is always the most severely affected area, increased intracranial pressure and herniation are usually the cause of death [11]. So, the timely diagnosis of PAM is needed.

In our case, the patient was presented with milder headache at first, which then aggravated in a very short time. CSF results showed that glucose, protein, and WBC increased significantly, especially WBC. Severe increased intracranial pressure was found in the patient. CSF smear and culture failed to identify the pathogen. Purulent meningoencephalitis was first considered. Despite antibiotics treatment, the disease deteriorated. Considering the poor prognosis, mNGS was applied and the pathogen was detected successfully, indicating PAM. The patient denied a history of swimming outside or any other nasal irrigation, which was different from most reported cases. The patient might be infected by inhaling dust that contained N. fowleri, but there is a lack of clear evidence. Further studies are needed to explore the risk factors of PAM.

It is difficult to diagnose PAM using conventional clinical methods. The pathogen is hard to be cultivated and is similar to polymorphs or lymphocytes. PCR-based molecular methods and in vitro or in vivo animal models are useful methods for the diagnosis [12]. However, there are also limitations. For example, the animal models are always time consuming. PCR is fast with a relatively high sensitivity and specificity, but it needs a prior hypothesis of the target, which is difficult for PAM due to the less typical clinical symptoms.

In recent years, mNGS is increasingly applied for the diagnosis of multiple microbial infectious diseases, especially for rare central nervous system infections, such as leptospirosis and special virus infections [13,14]. It can identify almost all microbial pathogens rapidly and accurately, including bacteria, fungi, mycoplasma, chlamydia, rickettsia, helix, and viruses. Compared with conventional clinical methods, mNGS often has a higher sensitivity and specificity [15]. In this case report, mNGS also successfully detected N. fowleri that smear and culture methods failed to identify, indicating its advantage in diagnosing PAM.

Current treatment methods are based on case reports or in vitro studies, with limited treatment methods. The therapeutic drugs include amphotericin B, rifampicin, azole (fluconazole), azithromycin, and miltefosine [12]. Dexamethasone, mannitol, and 3% sodium chloride solution or even ventricular drainage may be useful for the severe condition. However, none of these treatments was demonstrated to be effective due to the limited number of survivors. Only about 27% of the cases can be diagnosed before the patient dies. Regardless of the treatment regimen, the mortality rate of PAM remains approximately 98% [1]. The median time from onset to death is 5 days [16].

In our case, CSF smear and culture failed to identify the pathogen. While mNGS rapidly detected the pathogen as N. fowleri, which helped in the diagnosis of the patient. mNGS may bring new insight for the rapid diagnosis and help in the timely treatment of PAM patients in the future.


tel: +86-18666818875

Acknowledgements

We thank the patient and his family for taking part in the study, and all the staff members in the participating hospital who contributed to the study.

  1. Funding information: Authors state no funding involved.

  2. Author contributions: Chen X. J., He Z. Y., Tung Z. H., and Lu Z. B. were involved in the collection of data, drafting, and editing of the manuscript. Xia H. performed the mNGS. All authors have read and approved the manuscript.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Guemez A, Garcia E. Primary amoebic meningoencephalitis by Naegleria fowleri: Pathogenesis and treatments. Biomolecules. 2021;11(9):1320. 10.3390/biom11091320. PubMed PMID: 34572533; PubMed Central PMCID: PMCPMC8469197; Epub 2021/09/29.Search in Google Scholar PubMed PubMed Central

[2] Jahangeer M, Mahmood Z, Munir N, Waraich UE, Tahir IM, Akram M, et al. Naegleria fowleri: Sources of infection, pathophysiology, diagnosis, and management; a review. Clin Exp Pharmacol Physiol. 2020;47(2):199–212. Epub 2019/10/16. 10.1111/1440-1681.13192. PubMed PMID: 31612525.Search in Google Scholar

[3] Kofman A, Guarner J. Infections caused by free-living amoebae. J Clin Microbiol. 2022;60(1):e0022821. Epub 2021/06/17. 10.1128/JCM.00228-21. PubMed PMID: 34133896; PubMed Central PMCID: PMCPMC8769735.Search in Google Scholar

[4] Krol-Turminska K, Olender A. Human infections caused by free-living amoebae. Ann Agric Env Med. 2017;24(2):254–60. Epub 2017/07/01. 10.5604/12321966.1233568. PubMed PMID: 28664704.Search in Google Scholar

[5] Cooper AM, Aouthmany S, Shah K, Rega PP. Killer amoebas: Primary amoebic meningoencephalitis in a changing climate. JAAPA. 2019;32(6):30–5. Epub 2019/05/29. 10.1097/01.JAA.0000558238.99250.4a. PubMed PMID: 31136398.Search in Google Scholar

[6] Siddiqui R, Ali IKM, Cope JR, Khan NA. Biology and pathogenesis of Naegleria fowleri. Acta Trop. 2016;164:375–94. Epub 2016/10/30. 10.1016/j.actatropica.2016.09.009. PubMed PMID: 27616699.Search in Google Scholar

[7] Maciver SK, Pinero JE, Lorenzo-Morales J. Is Naegleria fowleri an emerging parasite? Trends Parasitol. 2020;36(1):19–28. Epub 2019/11/21. 10.1016/j.pt.2019.10.008. PubMed PMID: 31744676.Search in Google Scholar

[8] Zaongo SD, Shaio MF, Ji DD. Effects of culture media on Naegleria fowleri growth at different temperatures. J Parasitol. 2018;104(5):451–6. Epub 2018/06/06. 10.1645/18-6. PubMed PMID: 29869929.Search in Google Scholar

[9] Cope JR, Ali IK. Primary amebic meningoencephalitis: What have we learned in the last 5 years? Curr Infect Dis Rep. 2016;18(10):31. Epub 2016/09/12. 10.1007/s11908-016-0539-4. PubMed PMID: 27614893; PubMed Central PMCID: PMCPMC5100007.Search in Google Scholar

[10] Capewell LG, Harris AM, Yoder JS, Cope JR, Eddy BA, Roy SL, et al. Diagnosis, clinical course, and treatment of primary amoebic meningoencephalitis in the United States, 1937–2013. J Pediatr Infect Dis Soc. 2015;4(4):e68–75. Epub 2015/11/20. 10.1093/jpids/piu103. PubMed PMID: 26582886.Search in Google Scholar

[11] Rice CA, Colon BL, Chen E, Hull MV, Kyle DE. Discovery of repurposing drug candidates for the treatment of diseases caused by pathogenic free-living amoebae. PLoS Negl Trop Dis. 2020;14(9):e0008353. Epub 2020/09/25. 10.1371/journal.pntd.0008353. PubMed PMID: 32970675; PubMed Central PMCID: PMCPMC7546510.Search in Google Scholar

[12] Bellini NK, Santos TM, da Silva MTA, Thiemann OH. The therapeutic strategies against Naegleria fowleri. Exp Parasitol. 2018;187:1–11. Epub 2018/03/05. 10.1016/j.exppara.2018.02.010. PubMed PMID: 29501696.Search in Google Scholar

[13] Gu W, Miller S, Chiu CY. Clinical metagenomic next-generation sequencing for pathogen detection. Annu Rev Pathol. 2019;14:319–38. Epub 2018/10/26. 10.1146/annurev-pathmechdis-012418-012751. PubMed PMID: 30355154; PubMed Central PMCID: PMCPMC6345613.Search in Google Scholar

[14] Wilson MR, Sample HA, Zorn KC, Arevalo S, Yu G, Neuhaus J, et al. Clinical metagenomic sequencing for diagnosis of meningitis and encephalitis. N Engl J Med. 2019;380(24):2327–40. Epub 2019/06/13. 10.1056/NEJMoa1803396. PubMed PMID: 31189036; PubMed Central PMCID: PMCPMC6764751.Search in Google Scholar

[15] Yu L, Zhang Y, Zhou J, Zhang Y, Qi X, Bai K, et al. Metagenomic next-generation sequencing of cell-free and whole-cell DNA in diagnosing central nervous system infections. Front Cell Infect Microbiol. 2022;12:951703. Epub 2022/10/15. 10.3389/fcimb.2022.951703. PubMed PMID: 36237422; PubMed Central PMCID: PMCPMC9551220.Search in Google Scholar

[16] Debnath A, Nelson AT, Silva-Olivares A, Shibayama M, Siegel D, McKerrow JH. In Vitro efficacy of ebselen and BAY 11-7082 against Naegleria fowleri. Front Microbiol. 2018;9:414. Epub 2018/03/22. 10.3389/fmicb.2018.00414. PubMed PMID: 29559968; PubMed Central PMCID: PMCPMC5845744.Search in Google Scholar

Received: 2022-11-28
Revised: 2023-02-02
Accepted: 2023-02-08
Published Online: 2023-05-23

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
  3. Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
  4. Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
  5. Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
  6. A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
  7. Neutrophilia with subclinical Cushing’s disease: A case report and literature review
  8. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
  9. Immunoregulation of synovial macrophages for the treatment of osteoarthritis
  10. Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
  11. Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
  12. Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
  13. High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
  14. Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
  15. Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
  16. Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
  17. Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
  18. Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
  19. Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
  20. Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
  21. Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
  22. Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
  23. Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
  24. Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
  25. 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
  26. Experimental study on the optimization of ANM33 release in foam cells
  27. Primary retroperitoneal angiosarcoma: A case report
  28. Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
  29. Malignant pleural effusion diagnosis and therapy
  30. Effect of spaceflight on the phenotype and proteome of Escherichia coli
  31. Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
  32. Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
  33. Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
  34. The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
  35. Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
  36. mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
  37. The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
  38. Radiotherapy for primary thyroid adenoid cystic carcinoma
  39. Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
  40. Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
  41. Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
  42. Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
  43. PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
  44. The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
  45. Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
  46. Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
  47. NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
  48. Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
  49. Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
  50. Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
  51. Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
  52. Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
  53. Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
  54. Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
  55. Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
  56. Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
  57. Gemella morbillorum infective endocarditis: A case report and literature review
  58. An unusual ectopic thymoma clonal evolution analysis: A case report
  59. Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
  60. Detection of V. vulnificus septic shock with ARDS using mNGS
  61. Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
  62. The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
  63. Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
  64. ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
  65. Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
  66. Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
  67. Collagen changes in rabbit conjunctiva after conjunctival crosslinking
  68. Effects of NM23 transfection of human gastric carcinoma cells in mice
  69. Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
  70. Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
  71. Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
  72. Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
  73. Giant duplication of the transverse colon in an adult: A case report and literature review
  74. Ectopic thyroid tissue in the breast: A case report
  75. SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
  76. Vaginal metastasis from breast cancer: A case report
  77. Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
  78. Inhibition of TAZ impairs the migration ability of melanoma cells
  79. Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
  80. Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
  81. Identification of winter wheat pests and diseases based on improved convolutional neural network
  82. Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
  83. Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
  84. Immune checkpoint inhibitors in cancer patients with COVID-19
  85. Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
  86. Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
  87. Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
  88. DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
  89. Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
  90. Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
  91. Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
  92. Studying infant mortality: A demographic analysis based on data mining models
  93. Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
  94. Protein Z modulates the metastasis of lung adenocarcinoma cells
  95. Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
  96. TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
  97. Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
  98. Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
  99. Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
  100. Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
  101. Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
  102. HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
  103. Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
  104. Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
  105. Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
  106. Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
  107. Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
  108. Research progress on gas signal molecular therapy for Parkinson’s disease
  109. Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
  110. The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
  111. α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
  112. CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
  113. Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
  114. Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
  115. Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
  116. Research progress of AMP-activated protein kinase and cardiac aging
  117. TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
  118. Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
  119. Metastasis from small cell lung cancer to ovary: A case report
  120. The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
  121. The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
  122. Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
  123. Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
  124. Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
  125. Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
  126. Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
  127. Traumatic brain injury and rTMS-ERPs: Case report and literature review
  128. Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
  129. Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
  130. The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
  131. Inflammation-related signaling pathways in tendinopathy
  132. CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
  133. Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
  134. Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
  135. Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
  136. Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
  137. Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
  138. Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
  139. TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
  140. Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
  141. Ferroptosis: A potential target of macrophages in plaque vulnerability
  142. Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
  143. Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
  144. HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
  145. IL-17 in osteoarthritis: A narrative review
  146. Circadian cycle and neuroinflammation
  147. Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
  148. Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
  149. SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
  150. Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
  151. PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
  152. Pancreatic ectopic thyroid tissue: A case report and analysis of literature
  153. The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
  154. Report on a case of liver-originating malignant melanoma of unknown primary
  155. Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
  156. The fibroblast growth factor–Klotho axis at molecular level
  157. Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
  158. A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
  159. Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
  160. Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
  161. Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
  162. Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
  163. Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
  164. Case report of atypical undernutrition of hypoproteinemia type
  165. Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
  166. Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
  167. Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
  168. Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
  169. Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
  170. Precisional detection of lymph node metastasis using tFCM in colorectal cancer
  171. Advances in diagnosis and treatment of perimenopausal syndrome
  172. A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
  173. Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
  174. Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
  175. Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
  176. Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
  177. Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
  178. Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
  179. An online diagnosis method for cancer lesions based on intelligent imaging analysis
  180. Medical imaging in rheumatoid arthritis: A review on deep learning approach
  181. Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
  182. Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
  183. A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
  184. TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
  185. Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
  186. Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
  187. Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
  188. Hepatobiliary surgery based on intelligent image segmentation technology
  189. Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
  190. Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
  191. Early diagnosis for the onset of peri-implantitis based on artificial neural network
  192. Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
  193. Forecast of pain degree of lumbar disc herniation based on back propagation neural network
  194. SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
  195. Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
  196. Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
  197. A novel approach for minimising anti-aliasing effects in EEG data acquisition
  198. ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
  199. Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
  200. Lung nodule segmentation via semi-residual multi-resolution neural networks
  201. Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
  202. A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
  203. Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
  204. Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
  205. Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
  206. Monitoring and evaluation of anesthesia depth status data based on neuroscience
  207. Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
  208. Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
  209. Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
  210. Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
  211. Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
  212. From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
  213. Ecology and Environmental Science
  214. Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
  215. Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
  216. Effects of cadmium stress on fruits germination and growth of two herbage species
  217. Bamboo charcoal affects soil properties and bacterial community in tea plantations
  218. Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
  219. Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
  220. Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
  221. Food Science
  222. Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
  223. Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
  224. Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
  225. Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
  226. Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
  227. Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
  228. Microbiological transglutaminase: Biotechnological application in the food industry
  229. Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
  230. Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
  231. The potential for the use of leghemoglobin and plant ferritin as sources of iron
  232. Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
  233. Bioengineering and Biotechnology
  234. Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
  235. Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
  236. Agriculture
  237. Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
  238. On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
  239. Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
  240. A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
  241. Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
  242. Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
  243. Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
  244. Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
  245. Animal Sciences
  246. Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
  247. Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
  248. Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
  249. Tracking behavioral changes of confined sows from the first mating to the third parity
  250. The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
  251. Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
  252. Plant Sciences
  253. Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
  254. Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
  255. Tissue culture and rapid propagation technology for Gentiana rhodantha
  256. Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
  257. Cloning and expression analysis of VrNAC13 gene in mung bean
  258. Chlorate-induced molecular floral transition revealed by transcriptomes
  259. Effects of warming and drought on growth and development of soybean in Hailun region
  260. Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
  261. Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
  262. Distinguish Dianthus species or varieties based on chloroplast genomes
  263. Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
  264. Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
  265. An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
  266. Erratum
  267. Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
  268. Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
  269. Retraction
  270. Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
Downloaded on 27.1.2026 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0579/html
Scroll to top button