Abstract
Primary amoebic meningoencephalitis (PAM) caused by Naegleria fowleri is a fatal infection with a mortality rate of more than 95%, despite advances in antimicrobial chemotherapy and supportive care. Initial manifestations of PAM are indistinguishable from bacterial meningitis. Prompt diagnosis and antifungal treatment may help decline the overall mortality. Here we present a case of a 38-year-old man transferred to our hospital due to mild headache, which deteriorated quickly. Severe increased intracranial pressure was found. The cerebrospinal fluid (CSF) was yellowish with significantly increased leukocyte and protein. Smear and culture were negative. The patient was first diagnosed with pyogenic meningoencephalitis. However, the symptoms deteriorated. Metagenomic next-generation sequencing (mNGS) of CSF was applied and finally confirmed N. fowleri as the protist pathogen within 24 h. However, due to the time cost of sampling and transportation (2 days), the diagnosis came too late, and the patient passed away 1 day before. In summary, mNGS is a rapid and accurate diagnostic method for clinical practices, especially for rare central nervous system infections. It should be used as quickly as possible for acute infections, such as PAM. All aspects of patient interrogation and prompt identification should be paramount to ensure appropriate treatment and decline the overall mortality.
1 Background
Primary amoebic meningoencephalitis (PAM) caused by Naegleria fowleri is an acute, fulminant, necrotizing, and hemorrhagic meningoencephalitis, characterized by severe headache, stiff neck, fever (38.5–41°C), altered mental status, seizures, and coma [1,2]. However, the absence of specific clinical evidence of PAM may lead to missed diagnosis and lack of timely treatment. As the most severely affected area was the brain stem, increased intracranial pressure and herniation are usually the causes of death. Regardless of the treatment regimen, the mortality rate of PAM remains approximately 98% [1]. Therefore, early diagnosis is very important for the timely intervention and administration of antibiotics in PAM patients. Unfortunately, the diagnosis of PAM is easily overlooked due to its similar manifestations with bacterial meningoencephalitis and the difficulty of culture of the pathogen. Here we describe a rare case of fulminant PAM caused by N. fowleri. The patient was first diagnosed with pyogenic meningoencephalitis, while metagenomic next-generation sequencing (mNGS) finally detected the pathogen.
2 Case presentation
A 38-year-old male was transferred to our hospital on October 23rd, 2019 due to fever and headache for 2 days and disturbance of consciousness for 1 day. On the day before admission, he visited the local hospital with chief complaint of high fever and persistent dull headache with severe vomiting. The patient had no history of exposure to freshwater. According to the computer tomography (CT) scan of the head and the cerebrospinal fluid (CSF) test results of the local hospital (Table 1), bacterial meningitis was first considered. Penicillin and ceftriaxone sodium were given. However, the condition was worse, and lethargy appeared.
Investigations of CSF
| CSF | Appearance | Pressure (mmH2O) | White blood cell (WBC × 106/L) | Protein (mg/L) | Glucose (mmol/L) | Chloride (mmol/L) |
|---|---|---|---|---|---|---|
| Before admission | 150 | 1,920 | 1228.6 | 0.11 | 111 | |
| After admission | Cloudy, yellowish | >400 | 104,614 | 1481.6 | 1.3 | 114 |
On admission, he was conscious but disorientated. The Glasgow score (GCS) was 10. There was pronounced head retraction and opisthotonus with obvious neck rigidity and positive Kernig’s signs. The temperature was 38.0°C. Examination of the nervous system showed no localizing signs. The clinical diagnosis was pyogenic meningitis.
Three hours after admission, he turned to mild coma (GCS 7) with shortness of breath. Then, mechanical ventilation and sedation were given. Five hours after admission, a lumbar puncture was done. CSF showed significantly elevated white blood cells, and the intracranial pressure was high (Table 1). Sixteen hours after admission, CT revealed diffuse edema of the whole brain (Figure 1b and c). Nineteen hours after admission, he turned to deep coma (GCS 3), and his pupils became dilated.

(a) After admission, there showed a cloudy and yellowish CSF. (b and c) Head CT scan showing the decreased density of brain parenchyma, and the narrowed cistern and sulcus, which indicate diffuse swelling of the brain. (d) The physical fragment of N. fowleri was 134 bp. The results were consistent with the electrophoretic bands of the patient (Lane 1), and the negative control (Lane 2) had no bands. It is indicated that Naegleria fowleri exists in this sample. (e) mNGS results show that a total of 23,834 specific reads of N. fowleri were detected in CSF, the coverage was 6.08%.
Two days after admission (October 25th), he remained comatose, with fixed dilated pupils, complete lack of response to stimuli, and spontaneous breathing. The collected CSF sample (2–3 mL) was then sent for PACEseq mNGS (Hugobiotech, Beijing) to detect the pathogen. DNA was extracted and purified from 200 µL CSF supernatant according to the manufacture’s instruction of TIANGEN DNA Mini kit DP316. The DNA library was constructed using QIAseqTM Ultralow Input Library Kit. The concentration and quality of library was checked using Qubit and agarose gel electrophoresis, and the qualified library was then sequenced on Illumina Miniseq platform. A total of 23,834 specific sequence reads of N. fowleri were detected by mNGS (Figure 1e). The pathogen was then confirmed by PCR (Figure 1d) using the specific primers F (TCTAGAGATCCAACCAATGG) and R (GTCTTTGTGAAAACATCACC). As a result, the patient was diagnosed with PAM caused by N. fowleri. Though mNGS successfully detected the pathogen within 24 h (from October 27th to 28th), too much time had been cost during sampling and transportation (2 days). The patient had passed away on October 26th.
-
Informed consent: Informed consent has been obtained from all individuals included in this study.
-
Ethical approval: The research related to human use has been complied with all the relevant national regulations, institutional policies, and in accordance with the tenets of the Helsinki Declaration, and has been approved by the authors’ institutional review board or equivalent committee.
3 Discussion
PAM caused by N. fowleri is an acute, fulminant, necrotizing, and hemorrhagic meningoencephalitis [1]. The protist pathogen, N. fowleri, is a thermophilic free-living amoeba that can be found in warm lakes and rivers, geothermal springs, naturally hot untreated water supplies, and warm water discharge from industrial plants [1,3,4]. Most patients with PAM experience a history of activities in warm, fresh water which can cause contaminated water entering the nasal cavity [5,6]. The pathogen may then invade the nervous system and cause an infection. PAM cases without water activities were few. It is reported that inhalation of cyst-laden dust is also an important mechanism for PAM, accounting for 6.5% of PAM cases [7], which is extremely concerning. The time of clinical symptoms onset of PAM ranges from 1 to 15 days after exposure [4,8]. Initial manifestations of PAM include fever, severe headache, photophobia, confusion, seizures, and coma, which are indistinguishable from bacterial meningitis [9,10]. In addition, CSF of infected patients is often hazy with increased intracranial pressure, hypoglycorrhachia, elevated protein, and significant pleocytosis (especially neutrophilic predominance), which is also similar to bacterial meningoencephalitis. So, misdiagnosis of PAM is common. However, as brain stem is always the most severely affected area, increased intracranial pressure and herniation are usually the cause of death [11]. So, the timely diagnosis of PAM is needed.
In our case, the patient was presented with milder headache at first, which then aggravated in a very short time. CSF results showed that glucose, protein, and WBC increased significantly, especially WBC. Severe increased intracranial pressure was found in the patient. CSF smear and culture failed to identify the pathogen. Purulent meningoencephalitis was first considered. Despite antibiotics treatment, the disease deteriorated. Considering the poor prognosis, mNGS was applied and the pathogen was detected successfully, indicating PAM. The patient denied a history of swimming outside or any other nasal irrigation, which was different from most reported cases. The patient might be infected by inhaling dust that contained N. fowleri, but there is a lack of clear evidence. Further studies are needed to explore the risk factors of PAM.
It is difficult to diagnose PAM using conventional clinical methods. The pathogen is hard to be cultivated and is similar to polymorphs or lymphocytes. PCR-based molecular methods and in vitro or in vivo animal models are useful methods for the diagnosis [12]. However, there are also limitations. For example, the animal models are always time consuming. PCR is fast with a relatively high sensitivity and specificity, but it needs a prior hypothesis of the target, which is difficult for PAM due to the less typical clinical symptoms.
In recent years, mNGS is increasingly applied for the diagnosis of multiple microbial infectious diseases, especially for rare central nervous system infections, such as leptospirosis and special virus infections [13,14]. It can identify almost all microbial pathogens rapidly and accurately, including bacteria, fungi, mycoplasma, chlamydia, rickettsia, helix, and viruses. Compared with conventional clinical methods, mNGS often has a higher sensitivity and specificity [15]. In this case report, mNGS also successfully detected N. fowleri that smear and culture methods failed to identify, indicating its advantage in diagnosing PAM.
Current treatment methods are based on case reports or in vitro studies, with limited treatment methods. The therapeutic drugs include amphotericin B, rifampicin, azole (fluconazole), azithromycin, and miltefosine [12]. Dexamethasone, mannitol, and 3% sodium chloride solution or even ventricular drainage may be useful for the severe condition. However, none of these treatments was demonstrated to be effective due to the limited number of survivors. Only about 27% of the cases can be diagnosed before the patient dies. Regardless of the treatment regimen, the mortality rate of PAM remains approximately 98% [1]. The median time from onset to death is 5 days [16].
In our case, CSF smear and culture failed to identify the pathogen. While mNGS rapidly detected the pathogen as N. fowleri, which helped in the diagnosis of the patient. mNGS may bring new insight for the rapid diagnosis and help in the timely treatment of PAM patients in the future.
Acknowledgements
We thank the patient and his family for taking part in the study, and all the staff members in the participating hospital who contributed to the study.
-
Funding information: Authors state no funding involved.
-
Author contributions: Chen X. J., He Z. Y., Tung Z. H., and Lu Z. B. were involved in the collection of data, drafting, and editing of the manuscript. Xia H. performed the mNGS. All authors have read and approved the manuscript.
-
Conflict of interest: Authors state no conflict of interest.
-
Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
References
[1] Guemez A, Garcia E. Primary amoebic meningoencephalitis by Naegleria fowleri: Pathogenesis and treatments. Biomolecules. 2021;11(9):1320. 10.3390/biom11091320. PubMed PMID: 34572533; PubMed Central PMCID: PMCPMC8469197; Epub 2021/09/29.Search in Google Scholar PubMed PubMed Central
[2] Jahangeer M, Mahmood Z, Munir N, Waraich UE, Tahir IM, Akram M, et al. Naegleria fowleri: Sources of infection, pathophysiology, diagnosis, and management; a review. Clin Exp Pharmacol Physiol. 2020;47(2):199–212. Epub 2019/10/16. 10.1111/1440-1681.13192. PubMed PMID: 31612525.Search in Google Scholar
[3] Kofman A, Guarner J. Infections caused by free-living amoebae. J Clin Microbiol. 2022;60(1):e0022821. Epub 2021/06/17. 10.1128/JCM.00228-21. PubMed PMID: 34133896; PubMed Central PMCID: PMCPMC8769735.Search in Google Scholar
[4] Krol-Turminska K, Olender A. Human infections caused by free-living amoebae. Ann Agric Env Med. 2017;24(2):254–60. Epub 2017/07/01. 10.5604/12321966.1233568. PubMed PMID: 28664704.Search in Google Scholar
[5] Cooper AM, Aouthmany S, Shah K, Rega PP. Killer amoebas: Primary amoebic meningoencephalitis in a changing climate. JAAPA. 2019;32(6):30–5. Epub 2019/05/29. 10.1097/01.JAA.0000558238.99250.4a. PubMed PMID: 31136398.Search in Google Scholar
[6] Siddiqui R, Ali IKM, Cope JR, Khan NA. Biology and pathogenesis of Naegleria fowleri. Acta Trop. 2016;164:375–94. Epub 2016/10/30. 10.1016/j.actatropica.2016.09.009. PubMed PMID: 27616699.Search in Google Scholar
[7] Maciver SK, Pinero JE, Lorenzo-Morales J. Is Naegleria fowleri an emerging parasite? Trends Parasitol. 2020;36(1):19–28. Epub 2019/11/21. 10.1016/j.pt.2019.10.008. PubMed PMID: 31744676.Search in Google Scholar
[8] Zaongo SD, Shaio MF, Ji DD. Effects of culture media on Naegleria fowleri growth at different temperatures. J Parasitol. 2018;104(5):451–6. Epub 2018/06/06. 10.1645/18-6. PubMed PMID: 29869929.Search in Google Scholar
[9] Cope JR, Ali IK. Primary amebic meningoencephalitis: What have we learned in the last 5 years? Curr Infect Dis Rep. 2016;18(10):31. Epub 2016/09/12. 10.1007/s11908-016-0539-4. PubMed PMID: 27614893; PubMed Central PMCID: PMCPMC5100007.Search in Google Scholar
[10] Capewell LG, Harris AM, Yoder JS, Cope JR, Eddy BA, Roy SL, et al. Diagnosis, clinical course, and treatment of primary amoebic meningoencephalitis in the United States, 1937–2013. J Pediatr Infect Dis Soc. 2015;4(4):e68–75. Epub 2015/11/20. 10.1093/jpids/piu103. PubMed PMID: 26582886.Search in Google Scholar
[11] Rice CA, Colon BL, Chen E, Hull MV, Kyle DE. Discovery of repurposing drug candidates for the treatment of diseases caused by pathogenic free-living amoebae. PLoS Negl Trop Dis. 2020;14(9):e0008353. Epub 2020/09/25. 10.1371/journal.pntd.0008353. PubMed PMID: 32970675; PubMed Central PMCID: PMCPMC7546510.Search in Google Scholar
[12] Bellini NK, Santos TM, da Silva MTA, Thiemann OH. The therapeutic strategies against Naegleria fowleri. Exp Parasitol. 2018;187:1–11. Epub 2018/03/05. 10.1016/j.exppara.2018.02.010. PubMed PMID: 29501696.Search in Google Scholar
[13] Gu W, Miller S, Chiu CY. Clinical metagenomic next-generation sequencing for pathogen detection. Annu Rev Pathol. 2019;14:319–38. Epub 2018/10/26. 10.1146/annurev-pathmechdis-012418-012751. PubMed PMID: 30355154; PubMed Central PMCID: PMCPMC6345613.Search in Google Scholar
[14] Wilson MR, Sample HA, Zorn KC, Arevalo S, Yu G, Neuhaus J, et al. Clinical metagenomic sequencing for diagnosis of meningitis and encephalitis. N Engl J Med. 2019;380(24):2327–40. Epub 2019/06/13. 10.1056/NEJMoa1803396. PubMed PMID: 31189036; PubMed Central PMCID: PMCPMC6764751.Search in Google Scholar
[15] Yu L, Zhang Y, Zhou J, Zhang Y, Qi X, Bai K, et al. Metagenomic next-generation sequencing of cell-free and whole-cell DNA in diagnosing central nervous system infections. Front Cell Infect Microbiol. 2022;12:951703. Epub 2022/10/15. 10.3389/fcimb.2022.951703. PubMed PMID: 36237422; PubMed Central PMCID: PMCPMC9551220.Search in Google Scholar
[16] Debnath A, Nelson AT, Silva-Olivares A, Shibayama M, Siegel D, McKerrow JH. In Vitro efficacy of ebselen and BAY 11-7082 against Naegleria fowleri. Front Microbiol. 2018;9:414. Epub 2018/03/22. 10.3389/fmicb.2018.00414. PubMed PMID: 29559968; PubMed Central PMCID: PMCPMC5845744.Search in Google Scholar
© 2023 the author(s), published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Articles in the same Issue
- Biomedical Sciences
- Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
- Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
- Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
- Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
- A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
- Neutrophilia with subclinical Cushing’s disease: A case report and literature review
- Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
- Immunoregulation of synovial macrophages for the treatment of osteoarthritis
- Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
- Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
- Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
- High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
- Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
- Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
- Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
- Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
- Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
- Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
- Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
- Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
- Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
- Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
- Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
- 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
- Experimental study on the optimization of ANM33 release in foam cells
- Primary retroperitoneal angiosarcoma: A case report
- Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
- Malignant pleural effusion diagnosis and therapy
- Effect of spaceflight on the phenotype and proteome of Escherichia coli
- Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
- Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
- Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
- The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
- Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
- mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
- The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
- Radiotherapy for primary thyroid adenoid cystic carcinoma
- Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
- Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
- Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
- Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
- PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
- The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
- Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
- Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
- NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
- Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
- Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
- Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
- Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
- Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
- Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
- Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
- Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
- Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
- Gemella morbillorum infective endocarditis: A case report and literature review
- An unusual ectopic thymoma clonal evolution analysis: A case report
- Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
- Detection of V. vulnificus septic shock with ARDS using mNGS
- Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
- The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
- Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
- ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
- Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
- Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
- Collagen changes in rabbit conjunctiva after conjunctival crosslinking
- Effects of NM23 transfection of human gastric carcinoma cells in mice
- Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
- Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
- Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
- Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
- Giant duplication of the transverse colon in an adult: A case report and literature review
- Ectopic thyroid tissue in the breast: A case report
- SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
- Vaginal metastasis from breast cancer: A case report
- Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
- Inhibition of TAZ impairs the migration ability of melanoma cells
- Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
- Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
- Identification of winter wheat pests and diseases based on improved convolutional neural network
- Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
- Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
- Immune checkpoint inhibitors in cancer patients with COVID-19
- Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
- Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
- Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
- DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
- Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
- Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
- Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
- Studying infant mortality: A demographic analysis based on data mining models
- Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
- Protein Z modulates the metastasis of lung adenocarcinoma cells
- Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
- TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
- Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
- Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
- Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
- Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
- Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
- HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
- Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
- Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
- Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
- Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
- Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
- Research progress on gas signal molecular therapy for Parkinson’s disease
- Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
- The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
- α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
- CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
- Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
- Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
- Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
- Research progress of AMP-activated protein kinase and cardiac aging
- TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
- Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
- Metastasis from small cell lung cancer to ovary: A case report
- The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
- The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
- Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
- Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
- Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
- Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
- Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
- Traumatic brain injury and rTMS-ERPs: Case report and literature review
- Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
- Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
- The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
- Inflammation-related signaling pathways in tendinopathy
- CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
- Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
- Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
- Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
- Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
- Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
- Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
- TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
- Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
- Ferroptosis: A potential target of macrophages in plaque vulnerability
- Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
- Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
- HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
- IL-17 in osteoarthritis: A narrative review
- Circadian cycle and neuroinflammation
- Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
- Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
- SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
- Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
- PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
- Pancreatic ectopic thyroid tissue: A case report and analysis of literature
- The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
- Report on a case of liver-originating malignant melanoma of unknown primary
- Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
- The fibroblast growth factor–Klotho axis at molecular level
- Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
- A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
- Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
- Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
- Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
- Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
- Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
- Case report of atypical undernutrition of hypoproteinemia type
- Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
- Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
- Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
- Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
- Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
- Precisional detection of lymph node metastasis using tFCM in colorectal cancer
- Advances in diagnosis and treatment of perimenopausal syndrome
- A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
- Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
- Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
- Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
- Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
- Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
- Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
- An online diagnosis method for cancer lesions based on intelligent imaging analysis
- Medical imaging in rheumatoid arthritis: A review on deep learning approach
- Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
- Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
- A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
- TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
- Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
- Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
- Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
- Hepatobiliary surgery based on intelligent image segmentation technology
- Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
- Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
- Early diagnosis for the onset of peri-implantitis based on artificial neural network
- Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
- Forecast of pain degree of lumbar disc herniation based on back propagation neural network
- SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
- Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
- Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
- A novel approach for minimising anti-aliasing effects in EEG data acquisition
- ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
- Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
- Lung nodule segmentation via semi-residual multi-resolution neural networks
- Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
- A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
- Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
- Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
- Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
- Monitoring and evaluation of anesthesia depth status data based on neuroscience
- Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
- Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
- Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
- Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
- Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
- From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
- Ecology and Environmental Science
- Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
- Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
- Effects of cadmium stress on fruits germination and growth of two herbage species
- Bamboo charcoal affects soil properties and bacterial community in tea plantations
- Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
- Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
- Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
- Food Science
- Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
- Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
- Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
- Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
- Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
- Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
- Microbiological transglutaminase: Biotechnological application in the food industry
- Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
- Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
- The potential for the use of leghemoglobin and plant ferritin as sources of iron
- Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
- Bioengineering and Biotechnology
- Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
- Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
- Agriculture
- Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
- On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
- Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
- A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
- Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
- Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
- Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
- Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
- Animal Sciences
- Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
- Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
- Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
- Tracking behavioral changes of confined sows from the first mating to the third parity
- The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
- Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
- Plant Sciences
- Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
- Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
- Tissue culture and rapid propagation technology for Gentiana rhodantha
- Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
- Cloning and expression analysis of VrNAC13 gene in mung bean
- Chlorate-induced molecular floral transition revealed by transcriptomes
- Effects of warming and drought on growth and development of soybean in Hailun region
- Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
- Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
- Distinguish Dianthus species or varieties based on chloroplast genomes
- Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
- Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
- An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
- Erratum
- Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
- Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
- Retraction
- Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
Articles in the same Issue
- Biomedical Sciences
- Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
- Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
- Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
- Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
- A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
- Neutrophilia with subclinical Cushing’s disease: A case report and literature review
- Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
- Immunoregulation of synovial macrophages for the treatment of osteoarthritis
- Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
- Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
- Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
- High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
- Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
- Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
- Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
- Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
- Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
- Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
- Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
- Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
- Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
- Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
- Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
- 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
- Experimental study on the optimization of ANM33 release in foam cells
- Primary retroperitoneal angiosarcoma: A case report
- Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
- Malignant pleural effusion diagnosis and therapy
- Effect of spaceflight on the phenotype and proteome of Escherichia coli
- Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
- Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
- Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
- The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
- Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
- mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
- The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
- Radiotherapy for primary thyroid adenoid cystic carcinoma
- Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
- Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
- Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
- Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
- PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
- The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
- Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
- Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
- NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
- Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
- Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
- Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
- Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
- Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
- Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
- Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
- Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
- Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
- Gemella morbillorum infective endocarditis: A case report and literature review
- An unusual ectopic thymoma clonal evolution analysis: A case report
- Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
- Detection of V. vulnificus septic shock with ARDS using mNGS
- Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
- The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
- Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
- ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
- Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
- Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
- Collagen changes in rabbit conjunctiva after conjunctival crosslinking
- Effects of NM23 transfection of human gastric carcinoma cells in mice
- Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
- Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
- Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
- Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
- Giant duplication of the transverse colon in an adult: A case report and literature review
- Ectopic thyroid tissue in the breast: A case report
- SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
- Vaginal metastasis from breast cancer: A case report
- Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
- Inhibition of TAZ impairs the migration ability of melanoma cells
- Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
- Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
- Identification of winter wheat pests and diseases based on improved convolutional neural network
- Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
- Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
- Immune checkpoint inhibitors in cancer patients with COVID-19
- Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
- Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
- Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
- DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
- Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
- Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
- Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
- Studying infant mortality: A demographic analysis based on data mining models
- Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
- Protein Z modulates the metastasis of lung adenocarcinoma cells
- Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
- TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
- Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
- Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
- Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
- Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
- Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
- HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
- Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
- Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
- Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
- Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
- Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
- Research progress on gas signal molecular therapy for Parkinson’s disease
- Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
- The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
- α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
- CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
- Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
- Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
- Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
- Research progress of AMP-activated protein kinase and cardiac aging
- TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
- Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
- Metastasis from small cell lung cancer to ovary: A case report
- The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
- The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
- Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
- Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
- Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
- Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
- Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
- Traumatic brain injury and rTMS-ERPs: Case report and literature review
- Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
- Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
- The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
- Inflammation-related signaling pathways in tendinopathy
- CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
- Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
- Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
- Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
- Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
- Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
- Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
- TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
- Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
- Ferroptosis: A potential target of macrophages in plaque vulnerability
- Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
- Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
- HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
- IL-17 in osteoarthritis: A narrative review
- Circadian cycle and neuroinflammation
- Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
- Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
- SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
- Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
- PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
- Pancreatic ectopic thyroid tissue: A case report and analysis of literature
- The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
- Report on a case of liver-originating malignant melanoma of unknown primary
- Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
- The fibroblast growth factor–Klotho axis at molecular level
- Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
- A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
- Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
- Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
- Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
- Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
- Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
- Case report of atypical undernutrition of hypoproteinemia type
- Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
- Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
- Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
- Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
- Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
- Precisional detection of lymph node metastasis using tFCM in colorectal cancer
- Advances in diagnosis and treatment of perimenopausal syndrome
- A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
- Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
- Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
- Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
- Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
- Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
- Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
- An online diagnosis method for cancer lesions based on intelligent imaging analysis
- Medical imaging in rheumatoid arthritis: A review on deep learning approach
- Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
- Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
- A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
- TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
- Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
- Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
- Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
- Hepatobiliary surgery based on intelligent image segmentation technology
- Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
- Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
- Early diagnosis for the onset of peri-implantitis based on artificial neural network
- Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
- Forecast of pain degree of lumbar disc herniation based on back propagation neural network
- SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
- Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
- Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
- A novel approach for minimising anti-aliasing effects in EEG data acquisition
- ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
- Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
- Lung nodule segmentation via semi-residual multi-resolution neural networks
- Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
- A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
- Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
- Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
- Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
- Monitoring and evaluation of anesthesia depth status data based on neuroscience
- Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
- Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
- Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
- Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
- Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
- From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
- Ecology and Environmental Science
- Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
- Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
- Effects of cadmium stress on fruits germination and growth of two herbage species
- Bamboo charcoal affects soil properties and bacterial community in tea plantations
- Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
- Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
- Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
- Food Science
- Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
- Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
- Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
- Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
- Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
- Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
- Microbiological transglutaminase: Biotechnological application in the food industry
- Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
- Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
- The potential for the use of leghemoglobin and plant ferritin as sources of iron
- Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
- Bioengineering and Biotechnology
- Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
- Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
- Agriculture
- Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
- On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
- Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
- A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
- Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
- Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
- Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
- Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
- Animal Sciences
- Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
- Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
- Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
- Tracking behavioral changes of confined sows from the first mating to the third parity
- The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
- Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
- Plant Sciences
- Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
- Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
- Tissue culture and rapid propagation technology for Gentiana rhodantha
- Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
- Cloning and expression analysis of VrNAC13 gene in mung bean
- Chlorate-induced molecular floral transition revealed by transcriptomes
- Effects of warming and drought on growth and development of soybean in Hailun region
- Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
- Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
- Distinguish Dianthus species or varieties based on chloroplast genomes
- Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
- Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
- An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
- Erratum
- Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
- Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
- Retraction
- Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”