Home Life Sciences Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
Article Open Access

Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources

  • Wang Yong , Xu Chunbo , Tong Laga , Zhang Xiaoming and Wang Mingjiu EMAIL logo
Published/Copyright: March 21, 2023
Download Article (PDF)
Open Life Sciences
From the journal Open Life Sciences Volume 18 Issue 1

Abstract

In this study, genetic diversity and germplasm identification of 28 alfalfa germplasm cultivars materials were evaluated by analyzing their internal transcribed spacer 2 (ITS2), trnL-F, and psbA-trnH sequences to provide the innovative reference of alfalfa varieties genetic diversity and identify research. The results showed that the fragment average length of ITS2, trnL-F, and psbA-trnH sorting sequences were 455.7 bp, 230.3 bp, and 345.6 bp, respectively. The ITS2 sequence was too conservative to reflect the individual differences between intercultivars and intracultivars in the preliminary experiment. Furthermore, trnL-F and psbA-trnH sequence differences were relatively small between intercultivars but significant between intracultivars. Alfalfa cultivars were divided into four groups by sequence similarity clustering. Alfalfa cultivars trnL-F and psbA-trnH sequences have apparent differences, showing that chloroplast conservative sequences were independent evolution. Compared with trnL-F and psbA-trnH sequences of alfalfa cultivars, psbA-trnH sequence has abundant variation sites and can better reflect the differences between cultivars than the trnL-F sequence. Therefore, the psbA-trnH sequence can identify different alfalfa cultivars and establish the DNA sequence fingerprint.

Keywords: alfalfa varieties; ITS2; trnL-F; psbA-trnH; genetic diversity; group identification

1 Introduction

Alfalfa (Medicago sativa L.) is originated in Asia Minor, the Caucasus, Iran, Turkmenistan, and Central Asia [1] and is one of the most important leguminous forage in the world due to its high yield, high quality, and strong adaptability. M. sativa L. is the main research object of breeding, and the resources of alfalfa varieties are the most important basic production materials for animal husbandry and ecological improvement. By 2020, 113 national-level alfalfa varieties have been approved and registered in China [2]. Alfalfa and hybrid alfalfa are the main varieties formed by breeding. Compared with the developed countries in animal husbandry, such as the United States, Canada, New Zealand, and Australia, the number of varieties formed is small, and the breeding efficiency is low. Genetic research and identification of alfalfa germplasm resources have important theoretical and practical significance for alfalfa breeding and the development of the alfalfa industry.

Genetic diversity is the basis of species diversity and ecosystem diversity. It studies the degree of difference between species at the molecular level and reflects the genetic variation within species and between different populations [3]. Research on alfalfa genetics and genetic diversity in China mainly focuses on population morphology, agronomic traits, resistance and physiological characteristics, molecular markers, and DNA sequence analysis. Genetic diversity and identification of cultivar groups based on conserved sequences, i.e., chloroplast and ribosomal genome sequences, have been reported in alfalfa. The chloroplast genome is a closed double-stranded circular molecular structure, generally 115–210 Kb [4]. Chloroplast genes have relatively conservative characteristics, a small genome, a large amount of DNA information, a large copy number, and a high mutation rate of noncoding regions. The psbA-trnH gene sequence is the gene sequence of the noncoding region of chloroplast RNA, and the noncoding region is the region that cannot be transcribed, which is messenger RNA. The sequence is easy to be amplified and sequenced. It contains a large amount of information and has stable maternal inheritance, which can be efficiently applied to compare differences between different groups within a species. The trnL-trnF (trnL-F) gene sequence is the chloroplast RNA coding gene and the noncoding region gene sequence [5]. Sequence fragments have the advantages of simple sequence, convenient amplification, high evolution rate, little influence on the external environment, and easy mutation and variation of bases between different populations. It is widely used in interspecific and subspecific level genetic evolution phylogeny research. The chloroplast gene trnL-F sequence, psbA-trnH sequence, and nuclear gene internal transcribed spacer (ITS) sequence marker systems are mainly used in plant phylogeny research, species genetic diversity, and medicinal use in China. There are few reports on identifying plant Chinese medicinal materials in the herbage field. For example, datureae plants analysis, Bupleurum marginatum var. analysis based on internal transcribed spacer 2 (ITS2) barcode [6,7], mainly concentrates on forage and the phylogenetic research of Poaceae materials. In relevant studies, phylogenetic analysis has been conducted on the materials of the genus Alkali, the genera Astragali radix, the Medicago, and their relatives [8,9,10,11,12,13]. Ribosomal DNA ITS sequences are a family of genes encoding ribosomal RNA in the nucleus of plant cells and are nuclear gene fragments [6]. The sequence of the ribosome coding region is generally highly conserved, and there are few reports on the study of the conserved ribosome sequence in alfalfa in China. In this study, 28 alfalfa varieties and germplasm materials were taken as the research objects, and their ITS2, trnL-F, and psbA-trnH sequences were analyzed for genetic and germplasm identification. The genetic structure characteristics and genetic diversity of alfalfa variety germplasm resources in different populations were analyzed. The research has a theoretical reference for screening excellent alfalfa germplasm, establishing an alfalfa variety identification system, and exploring and utilizing alfalfa variety germplasm resources. Furthermore, it fills the gap of research on the genetic and variety identification characteristics of alfalfa in China combined with trnL-F, psbA-trnH, and other conserved sequences.

2 Materials and methods

2.1 Experiment material

The test materials are 28 alfalfa varieties (materials) from different countries and regions (Table 1). The seeds of the experimental germplasm resources were obtained from the National Medium-term Forage Germplasm Resource Bank of the Grassland Research Institute, Chinese Academy of Agricultural Sciences. The test material was planted in the Agricultural and Animal Husbandry Interlaced Area Experimental Demonstration Base of the Grassland Research Institute of the Chinese Academy of Agricultural Sciences in 2012 and was planted as a single plant. In 2018, alfalfa was sampled at the branching stage, and 10 fresh and young leaf samples were collected from each material, placed in an ice box, and brought back. Then, samples were stored in a −80°C ultra-low temperature refrigerator in the laboratory for future use.

Table 1

Alfalfa varieties (materials)

Code Name Species Origin Analysis method
1 Aohan Medicago sativa L. China ITS2
2 Junggar Medicago sativa L. China trnL-F, psbA-trnH
3 Zhaodong Medicago sativa L. China trnL-F, psbA-trnH
4 Tianshui Medicago sativa L. China trnL-F
5 Longdong Medicago sativa L. China psbA-trnH
6 Xinjiang Daye Medicago sativa L. China trnL-F, psbA-trnH
7 Gannong No. 3 Medicago sativa L. China trnL-F, psbA-trnH
8 Zhongmu No. 2 Medicago sativa L. China trnL-F, psbA-trnH
9 Tumu No. 1 Medicago varia Martin. China trnL-F, psbA-trnH
10 Xinmu No. 1 Medicago varia Martin. China trnL-F, psbA-trnH
11 Caoyuan No. 1 Medicago varia Martin. China trnL-F, psbA-trnH
12 Caoyuan No. 2 Medicago varia Martin. China ITS2, trnL-F, psbA-trnH
13 Gannong No. 1 Medicago varia Martin. China trnL-F, psbA-trnH
14 Gannong No. 2 Medicago varia Martin. China trnL-F, psbA-trnH
15 Japan 90 Medicago sativa L. Japan trnL-F
16 Bear No. 1 Medicago sativa L. US psbA-trnH
17 Czech 26-1 Medicago sativa L. Czech trnL-F, psbA-trnH
18 Golden Queen Medicago sativa L. US psbA-trnH
19 Soviet Union 1209 Medicago sativa L. Russia trnL-F, psbA-trnH
20 Soviet Union 6220 Medicago sativa L. Russia trnL-F, psbA-trnH
21 UK Medicago sativa L. UK psbA-trnH
22 AmeriGraze 401Z Medicago sativa L. US trnL-F
23 Apollo supreme Medicago sativa L. US trnL-F, psbA-trnH
24 Rumble Medicago sativa L. Canada trnL-F, psbA-trnH
25 WL-320 Medicago sativa L. US trnL-F
26 WL-323 Medicago sativa L. US trnL-F, psbA-trnH
27 Canada Medicago sativa L. Canada trnL-F, psbA-trnH
28 Medicago falcata Medicago falcata L. China trnL-F, psbA-trnH

There were differences in the number of materials selected for the alfalfa varieties tested by different sequences, and two materials were selected for ITS2 (Table 1). Among them, the ITS2 sequence research was conducted on Medicago sativa L.cv.Aohan and Medicago varia Martin.cv.Caoyuan No. 2, and Aohan and Caoyuan No. 2 are two species, and there should be big differences in gene sequences, but two copies were found in the preliminary identification test. The DNA sequences of the materials showed little difference (Figure 1). Therefore, other corresponding material experiments were not carried out in the follow-up. The ITS2 sequence was unsuitable for analyzing genetic diversity among alfalfa varieties or species. According to the presence or absence of materials in the research process, 24 alfalfa materials were selected for the psbA-trnH sequence, and 23 materials were selected for the trnL-F sequence.

Figure 1 ITS2 sequences of different alfalfa varieties (materials).
Figure 1

ITS2 sequences of different alfalfa varieties (materials).

2.2 DNA extraction

The DNA extraction method of single leaf material was extracted by DNA extraction kit (CTAB Plant genome extraction kit, BLKW, Beijing). DNA concentration and purity were detected by the 1.0% agarose detection method and trace UV/Vis spectrophotometer, respectively.

2.3 Primer and polymerase chain reaction (PCR) amplification procedure

The primers used in the experiment are shown in Table 2. The research results of NCBI number are presented in Table 2 (list first number only). ITS2 sequence PCR amplification system 30 μL includes 10–20 ng template 1 μL, 10 mol L−1 primers 1 μL each, PCR buffer 3 μL, dNTP 1 μL, Mg2+ 2 μL, Taq DNase 1 μL, and ddH2O 20 μL. The amplification program was an annealing temperature of 56°C, pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 1.5 min, 40 cycles, and extension at 72°C for 10 min. trnL-F, psbA-trnH gene interval sequence amplification system 30 μL includes 10–20 ng template 1.5 μL, PCR Mix 15 μL, ddH2O 10.5 μL, primer F 1.5 μL, and primer R 1.5 μL. Program: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 49°C for 30 s, extension at 72°C for 90 s, 30 cycles, and extension at 72°C for 7 min. All PCR amplification products were stored in a refrigerator at 4°C for future use.

Table 2

Primer message

Sequence Primer (5′ to 3′) Temperature (°C) Amplicon size (bp)
ITS2, NCBI:MT610943.1… F: ATGCGATACTTGGTGTGAAT 56 20
R: GACGCTTCTCCAGACTACAAT 21
trnL-F, NCBI:MW271002.1… F: GTTATGCATGAACGTAATGCTC 49 22
R: CGCGCATGGTGGATTCACAATCC 23
psbA-trnH, NCBI:KP174827.1… F: GGTTCAAGTCCCTCTATCCC 49 20
R: ATTTGAACTGGTGACACGAG 21

trnL-F/psbA-trnH sequence PCR 30 μL reaction system includes 1.5 μL diluted DNA solution, 15 μL PCR Mix, 10.5 μL ddH2O, 1.5 μL primer F, and 1.5 μL primer R. They were mixed to form the reaction system and centrifuged for use. The amplification program was optimized for reaction conditions. The amplification is performed as follows: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 49°C for 30 s, and extension at 72°C for 30 cycles for 90 s, and then extended at 72°C for 7 min and stored at 4°C for future use.

The amplified products were subjected to 1.0% agarose gel electrophoresis, stained with nucleic acid dyes, and observed and photographed with a gel imaging system.

2.4 PCR product sequencing

The PCR amplification products were purified and used for the sequencing reaction. The ITS2, trnL-F, and psbA-trnH sequences of all product samples were determined by Shenzhen Huada Gene Technology Co., Ltd. Sequencing was performed by direct sequencing of PCR products, and each sample was sequenced in forward and reverse directions to ensure the sequencing accuracy.

2.5 Data analysis

The DNA sequence fragments obtained by sequencing were used for sequencing quality evaluation. Forward and reverse sequence sequencing results were analyzed by Codoncode Aligner, seqMan, and DNAMan. Furthermore, CLUSTALX 2.0 software was used for sequence alignment. The genetic distances of the aligned sequences were calculated by MEGA 7.0 software, and the molecular phylogenetic tree was established by the kimura method. The confidence of each branch of the phylogenetic tree was tested by bootstrap (1,000 repetitions), and gaps were always treated as missing.

3 Results and analysis

3.1 ITS2 sequence polymorphism analysis of alfalfa

Aohan and Caoyuan No. 2 were selected as research materials, and 18 forward and reverse ITS2 sequences were obtained by PCR amplification, recovery, and sequencing. The sequencing results of the nine genotypes ITS2 with unidirectional sequences are shown in Figure 1. The results showed that the effective sequence was 454–457 bp in full length, with an average of 455.7 bp. The nucleic acid bases of the two alfalfa populations differed very little. The contents of T, C, A, and G were 26.0, 22.3, 24.2, and 27.5%, with variations ranging from 25.9∼26.2, 22.1∼22.7, 23.8∼24.5, and 27.2∼27.9%, respectively. The average content of A and T is 50.2%, which is slightly larger than that of G and C. It can be seen from the unidirectional sequence of ITS2 that the corresponding sequences of Aohan and Caoyan No. 2 have basically no sequence differences between populations and local populations after removing the primer sequences and irregular sequences at the initial stage of sequencing. This result indicated that ITS2 was too conservative for alfalfa resources. In addition, no insertion and deletion variation was found between the corresponding sequences, and the corresponding ITS2 sequences were not suitable for application as genetic diversity markers. Aohan and Caoyuan No. 2 are M. sativa L. and Medicago varia Martin, which are different alfalfa species. The ITS2 sequences show identical sequences among species, i.e., no difference between species. In the selected five Aohan and four Caoyuan No. 2, the intraspecific sequences are also the same, i.e., no intraspecific difference. There is no polymorphism in applying the ITS2 sequence in alfalfa to study interspecific and intraspecific genetic diversity.

3.2 trnL-F sequence polymorphism analysis of alfalfa

A total of 115 forward and reverse trnL-F sequences were obtained by PCR amplification, recovery, and sequencing of 23 alfalfa germplasm materials. After removing primer sequences, hybrid and repetitive sequence fragments, 23 alfalfa materials (genotypes), and trnL-F unidirectional sequences were sorted out. The results are shown in Figure 2. The effective sequence length is about 240 bp, averaging 230.3 bp. Nucleic acid bases of alfalfa materials are different. The average content of G + C is 32.4%, and the variation is within 30.6–34.6%. The average ambiguous site rate in the spliced sequences is 1.59%. The polymorphism analysis of trnL-F sequences of 23 alfalfa germplasm materials showed that the total number of sequence loci is 242, the haplotype diversity (Hd) is 0.478, and the nucleotide polymorphism (Pi) is 0.322, with an average number of nucleotide differences (k) of 1.974.

Figure 2 TrnL-F sequences of different alfalfa varieties (materials).
Figure 2

TrnL-F sequences of different alfalfa varieties (materials).

3.3 psbA-trnH sequence polymorphism analysis of alfalfa

A total of 120 forward and reverse psbA-trnH sequences were obtained by PCR amplification, recovery, and sequencing of psbA-trnH sequences of 24 alfalfa germplasm materials. After removing primer sequences, hybrid and repetitive fragments, 24 unidirectional sequences of psbA-trnH sequences of materials (genotypes) were sorted out. The results are shown in Figure 3. The effective sequence length is about 345 bp, with an average of 345.6 bp. The average content of G + C in the alfalfa psbA-trnH sequence is 18.27%, and the variation is within 21.4–17.6%. The average ambiguous site rate in the spliced sequences is 8.96%. The polymorphism analysis of psbA-trnH sequences of 24 alfalfa germplasm materials showed that the total number of loci is 352 bp, the haplotype diversity (Hd) is 0.582, and the nucleotide polymorphism (Pi) is 0.457, with an average number of nucleotide differences (k) of 2.682. The total number of variation sites (Vs) in the psbA-trnH sequence of each material is 86, accounting for 25.13% of the total number of sites. There are 44 single nucleotide variation sites (Ss) and 13 parsimony informative sites (Ps). Among the 84 single-nucleotide variation sites, 17 are two-base variations. The type of sequence base variation is mainly substitution variation, including T-C, G-A transition, T-A, G-T, C-A transversion, and 2–4 bp insertion and deletion variation.

Figure 3 PsbA-trnH sequences of different alfalfa varieties (materials).
Figure 3

PsbA-trnH sequences of different alfalfa varieties (materials).

3.4 Cluster analysis of trnL-F and psbA-trnH sequence in alfalfa

The similarity of trnL-F sequences of 23 alfalfa germplasms was clustered (Figure 4). Analysis showed that the trnL-F sequence homology similarity between Japan 90 and Xinjiang Daye as well as Zhaodong and Zhongmu No. 2 is the largest, both of which are 100%. Tumu No. 1 and other alfalfa varieties have the lowest sequence homology similarity of trnL-F, with a similarity of 94%. The trnL-F sequence homology of M. falcata and most materials is low, ranging from 94 to 95%.

Figure 4 Alfalfa similarity clustering of trnL-F sequences.
Figure 4

Alfalfa similarity clustering of trnL-F sequences.

The test materials were clustered using the trnL-F sequence homology similarity of 96% as the classification standard. Among them, the materials (varieties) such as Junggar, M. falcata, Tumu No. 1, Gannong No. 3, and Soviet Union 6220 were grouped into one category, and other varieties were grouped into one category.

The clustering results of trnL-F sequence homology similarity between M. falcata and other test materials did not reach the outgroup (homogeneity) level with the highest sequence similarity. This result reflects that the trnL-F sequence is relatively conserved in alfalfa species such as M. falcata L. and M. sativa L. Comparison of M. falcata trnL-F sequence with other trnL-F sequences showed that ATTT at the 100 bp site and AT at the 116–117 bp site are specific bases and can be used as the basis for the identification of M. falcata L. and M. sativa L. resources.

Figure 5 shows that the similarity of psbA-trnH sequences of 24 alfalfa germplasms was clustered. Analysis suggested that the homology among the alfalfa varieties Bear No. 1, Caoyuan No. 1, Caoyuan No. 2, Gannong No. 1, Gannong No. 2, M. falcata, Longdong, Rumble, Soviet Union 1209, Tumu No. 1, and WL-323, Apollo supreme, Canadian alfalfa and Zhaodong alfalfa, Gannong No. 3, and Soviet Union 6220 alfalfa groups are the highest, all of which are 100%. The psbA-trnH sequence homology similarity between Junggar alfalfa and other alfalfa is 95%. With the psbA-trnH sequence homology similarity of 96% as the classification criterion, the test materials can be grouped into one category except for Junggar alfalfa. The psbA-trnH sequence homology of alfalfa and most alfalfa materials can reach 100%. The average length of the psbA-trnH sequence is 345.6 bp. The sequence is rich in polymorphisms such as single-nucleotide variation sites, parsimony information sites, and insertion and deletion fragments. The psbA-trnH sequencing results can better identify alfalfa variety resources and can be applied to alfalfa variety identification.

Figure 5 Alfalfa similarity clustering of psbA-trnH sequences.
Figure 5

Alfalfa similarity clustering of psbA-trnH sequences.

3.5 Sequence comparison of trnL-F and psbA-trnH in alfalfa and DNA barcode formation analysis

The trnL-F sequences of 24 alfalfa varieties (materials) and the psbA-trnH sequences of 23 alfalfa varieties (materials) show sequence differences. The corresponding sequences can form DNA sequence barcodes to identify alfalfa varieties. According to Figures 2 and 3, the psbA-trnH sequence variation sites are abundant for all sequenced alfalfa materials. The trnL-F sequence forms 67 variation sites and 84 psbA-trnH sequences, according to statistics. Table 3 shows that the sequencing fragments are sorted and aligned within a single variety, and the psbA-trnH variation sites of the materials within varieties range from 0 to 5, with an average of 0.79. The trnL-F variant sites range from 0 to 14, averaging 5.09. Among the variation rates of trnL-F and psbA-trnH sequences within varieties, the average content of G + C fragments of trnL-F sequences in each variety is 32.4%. The highest single nucleotide variation rates among varieties are shown in Zhongmu No. 2 and Canadian alfalfa, both with 1.46%. The average G + C content of the psbA-trnH sequence fragment is 18.3%. The highest intravariety variation rate is Czech 26-1 alfalfa, with a variation rate of 4.78%. Based on the comparison results of alfalfa DNA sequences between and within varieties, the DNA identification barcodes of alfalfa psbA-trnH sequences are more abundant in polymorphisms between varieties. In addition, the variation rate within varieties is relatively low, and the identification of alfalfa varieties has formed a clearer DNA barcode sequence.

Table 3

Basic information of alfalfa varieties psbA-trnH and trnL-F sequences

Name psbA-trnH trnL-F
Fragment G + C Mutation Mutation rate Fragment G + C Mutation Mutation rate
Golden Queen 341 16.72 0 0 — — — —
Caoyuan No. 1 341 17.01 0 0 233 32.62 10 4.29
Caoyuan No. 2 341 17.01 0 0 233 32.62 10 4.29
Apollo supreme 341 19.06 0 0 232 30.6 8 3.45
Gannong No. 1 341 17.01 1 0.29 231 32.47 4 1.73
Gannong No. 2 341 17.01 2 0.59 231 33.33 2 0.87
Gannong No. 3 341 19.06 0 0 230 33.04 2 0.87
Medicago falcata 349 16.91 5 1.43 231 33.33 1 0.43
Canada alfalfa 341 17.6 5 1.46 230 33.04 5 2.17
Czech 26-1 345 18.26 0 0 230 31.74 11 4.78
Rumble 341 21.11 0 0 230 32.17 1 0.43
Soviet Union 1209 341 21.41 0 0 229 33.19 3 1.31
Soviet Union 6220 341 19.35 0 0 230 33.04 3 1.3
Tumu No. 1 341 21.41 0 0 231 31.6 4 1.73
Xinjiang Daye 345 19.71 2 0.58 229 32.31 5 2.18
Xinmu No. 1 343 20.99 0 0 231 32.03 9 3.9
Zhaodong 341 18.77 0 0 229 34.06 3 1.31
Zhongmu No. 2 341 20.53 4 1.46 230 32.17 4 1.74
Junggar 345 18.84 0 0 233 33.05 0 0
AmeriGraze 341 21.41 0 0 231 32.03 1 0.43
BEAR 342 21.05 0 0 — — — —
WL323 341 17.3 0 0 232 32.76 4 1.72
Longdong 341 19.94 0 0 — — — —
UK 344 21.22 0 0 — — — —
WL320 — — — — 222 32.88 9 4.05
Japan 90 — — — — 228 30.7 14 6.14
Tianshui — — — — 229 32.31 4 1.75

4 Discussion

With the innovation and progress of identification technology, fingerprints and DNA barcoding have become the core research fields of identification technology. They are widely used in biological research and are considered the most efficient and accurate technical system for identifying biogenetic characteristics from root genes and biological functional tissues. The quality of alfalfa cultivar resources determines the yield potential and resistance to a large extent. Research on the development of an accurate, reliable, rapid, and simple variety identification method is important for identifying the authenticity of alfalfa varieties, strengthening the construction of the seed quality standard system, and improving the quality of alfalfa seeds. Currently, the identification of alfalfa varieties mainly relies on conventional identification methods. The corresponding fingerprint technology is affected by factors such as the detection object, technology, and equipment, and few standardized detection procedures have been established. Standardized test procedures need to be strengthened. Fingerprints and DNA barcoding have the advantages of rapidity, accuracy, and little impact on environmental pressures in identifying the genetic variation and genetic composition of alfalfa varieties.

Although many scientists have done a lot of research on DNA fingerprints, the identification of alfalfa varieties is still a difficult problem. This article mainly explored the use of ITS2, trnL-F, and psbA-trnH markers to identify alfalfa varieties. We use only 28 genotypes, but the technology we have established can group these alfalfa varieties well. The preliminary verification of these technologies shows that this is of great value for the identification of alfalfa varieties and is worth promoting and exploring.

Ribosomal DNA ITS is a family of genes encoding ribosomal RNA in the nucleus of plant cells [14]. Ribosomal coding region sequences are generally highly conserved, similar to chloroplast-conserved sequences. The corresponding spacer sequence is characterized by a large amount of mutation information, rapid mutation, simple sequences, convenient amplification, high evolution rates, less influence by the external environment, and no functional restrictions. Currently, it is widely used in the study of genetic evolutionary phylogeny at the interspecific and subspecific levels. In reference [15], six Leguminosae forages were tested, and ITS cannot be used as DNA barcoding candidate sequences due to low amplification efficiency. In reference [16], 156 alfalfa populations were tested. The ITS fragments of other species, except for a few relatives, also showed a high ability of species to define. The results of the former are preferred. Comparing the results of different studies revealed that the selected primer fragments differ, showing different results. The screening and identification of primers are critical. Comprehensive analysis showed that the ITS2 primer used in this research needs to be further optimized, and screening should be performed in many species, i.e., to distinguish the DNA barcoding potential of different alfalfa varieties.

Chloroplast gene trnL-F and psbA-trnH sequences are chloroplast spacer gene fragments with high amplification success rate and short purpose fragment length [17]. The chloroplast gene trnL-F and psbA-trnH sequence and nuclear gene ITS sequence marker systems are mainly used in plant phylogeny research, species genetic diversity, and identification of medicinal plants in china. Among them, the systematic classification of medicinal plants and the identification of Chinese medicinal materials are the most widely used, and the corresponding technology tends to be mature. Currently, Rosaceae, Rutaceae, Honeysuckle, Ginseng, Cistanche, Euphorbia, Shegan, Chonglou, and other families, genera, and species have initially established DNA barcodes and fingerprints based on conserved chloroplast sequences [18,19,20,21,22,23,24]. The genetic diversity and molecular phylogenetic classification of medicinal plant germplasm resources are mainly carried out in the families, genera, and species of sage, Schisandra, Trillium, Ophiopogon japonicus, Crow garlic, tulip, and onion [25,26,27,28]. The chloroplast gene trnL-F, psbA-trnH sequence, and the nuclear gene ITS sequence marker systems are rarely reported in forages in China, mainly in Sichuan Agricultural University and Lanzhou University, with more phylogenetic studies in gramineae materials. In reference [7], ITS sequences and psbA-trnH sequences were used for phylogenetic analysis on 37 materials of 6 genera, including Elymus. In reference [8], the psbA-trnH sequence was used to study the genetic diversity of 87 populations of M. japonica. In reference [9], ndhF, psbA-trnH, and trnL-F gene sequences were adopted to study the developmental phylogeny of 67 materials of the genus Gossypium and its relatives. In reference [6], ITS sequences were used to conduct phylogenetic analysis on 41 materials of the genus Laysporium and its relatives. The application of legume and alfalfa mainly includes the classification of pathogen populations, the legume phylogenetic relationships, and species delimitation [29,30,31]. In reference [16], samples representing 21 naturally distributed species in China were collected, and the chloroplast genomes of 75 individuals representing 20 species were assembled. The results showed that 18 species are well delimited except for Medicago sativa, Medicago falcata, and Melilotus officinalis. The primers used in this study verified the feasibility of identifying alfalfa species as DNA barcoding and formed alfalfa variety identification barcoding using psbA-trnH and trnL-F. Compared with the 23 materials used in the study, psbA-trnH sequence identification was clearer and more accurate, and the effect of distinguishing different alfalfa varieties was better. The studies on genetic diversity and variety identification of alfalfa have a one-sided analysis regarding morphological characteristics, agronomic traits, functional proteins, isozymes, and molecular markers. Conservative gene sequences can effectively complement their research shortcomings. To study the new and effective methods of alfalfa genetic diversity, further in-depth related research can be conducted to make the research methods and technical means more suitable for the research of alfalfa genetic diversity and variety identification.

5 Conclusion

In this study, the widely used sequences of ribosomal ITS2 and chloroplast trnL-F and psbA-trnH were used to analyze the genetic diversity and variety identification of alfalfa varieties. The alfalfa ITS2, trnL-F, and psbA-trnH sequences were sequenced to obtain the sequenced fragments with average lengths of 455.7 bp, 230.3 bp, and 345.6 bp, respectively. Among them, the alternative fragments of the ITS2 sequence showed high conservation both within and among varieties. The trnL-F and psbA-trnH sequences differed little within varieties but had obvious differences among varieties. According to the alfalfa similarity clustering of trnL-F and psbA-trnH sequences, the tested alfalfa varieties were clustered into four categories. The similarities of trnL-F and psbA-trnH sequences were different among alfalfa varieties, and the differences were large, indicating that the conserved chloroplast sequences in each variety population were independently evolved. The comparison of the trnL-F and psbA-trnH sequences of alfalfa varieties showed that the psbA-trnH sequence had more variant sites and richer sequence polymorphisms. Thus, the sequence is more suitable for forming clear DNA barcoding for alfalfa variety identification. During alfalfa variety identification and genetic diversity analysis, the ITS2 sequence was too conservative. The initial sequencing results in the previous experiment could not reflect the differences between varieties and individuals within varieties. The corresponding polymorphisms of the chloroplast gene sequences are abundant, which can better reflect the differences between varieties and are more suitable for identifying different alfalfa varieties.

tel: +86-13488544321

  1. Funding information: This work was supported by the Inner Mongolia autonomous region seed industry demonstration projects of major science and technology innovation (high quality alfalfa varieties breeding and industrial demonstration 2022JBGS0020).

  2. Author contributions: Wang Y. and Wang M.J. conceived and designed the research. Xu C.B. and Tong L.G. conducted experiments. Zhang X.M. analyzed the data. Wang Y. wrote the paper. All authors read and approve of the manuscript.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Ahlgren GH. Forage crops. New York: McGraw-Hill; 1949.Search in Google Scholar

[2] Wang XL. Identification of cold tolerance and screening of cold tolerant germplasm of alfalfa [Doctoral dissertation]. Huhoot: Inner Mongolia Agricultural University; 2021. Chinese.Search in Google Scholar

[3] Xue DY. Status and protection of biological genetic resources in China. Beijing: China Environmental Science Press; 2005. Chinese.Search in Google Scholar

[4] Zhang YJ, Li DZ. Advances in phylogenomics based on complete chloroplast genomes. Plant Diversity Resour. 2011;33(4):365–75. Chinese.Search in Google Scholar

[5] Taberlet P, Gielly L, Pautou G. Universal primers for amplification of three non-codingregions of chloroplast DNA. Plant Mol Biol. 1991;17(5):1105–9.10.1007/BF00037152Search in Google Scholar PubMed

[6] Ding XX, Su HL, Bao S, Tu JJ, Qiu XH, Huang ZH. Molecular identification of datureae plants based on DNA barcoding. Mol Plant Breed 1–14. [2022-12-16]. https://kns.cnki.net/kcms/detail/46.1068.S.20221104.1617.011.html. Chinese.Search in Google Scholar

[7] Xia ZD, LiuX, Feng ML, Xi XH, Tong LG. Chinese traditional and herbal drugs. 2020;51(2):6062–69. Chinese.Search in Google Scholar

[8] Sha LN. Studies on morphology, cytology and molecular phylogenetics in the genus of Leymus [Doctoral dissertation]. Yaan: Sichuan Agricultural University; 2008. Chinese.Search in Google Scholar

[9] Gao G. Phylogenetic and evolution analysis of Elymus in China [Doctoral dissertation]. Yaan: Sichuan Agricultural University; 2015. Chinese.Search in Google Scholar

[10] Xin YR. Genetic diversity analysis of Elymus sibiricus. L based on chloroplast trnL-F and psbA-trnH sequences [Master dissertation]. Yaan: Sichuan Agricultural University; 2018. Chinese.Search in Google Scholar

[11] Lei YX. Phylogenetic and evolution analysis of Roegheria and its related genera (Triticeae; Poaceae) [Master dissertation]. Yaan: Sichuan Agricultural University; 2018. Chinese.Search in Google Scholar

[12] Geng YP, Ma YZ, Wang F, Xie XD, Zhang PF, Liu YL. Identification of Astragali Radix and its adulterants based on psbA-trnH sequence. J Shanxi Agric Sci. 2020;48(5):664–8. Chinese.Search in Google Scholar

[13] Mu ZJ, Zhang YP, Du XL, Huang CS, Yu LL, Wang XY. Identification of leguminous ethnic medicine and its mixed falsify based on the ITS2 sequence. J Chin Med Mater. 2022;45(5):1093–8. Chinese.Search in Google Scholar

[14] Hamby RK, Zimmer EA. Ribosomal RNA as a phylogenetic tool in plant systematics. Molecular systematics of plants. New York: Chapman & Hall; 1992. p. 50–9110.1007/978-1-4615-3276-7_4Search in Google Scholar

[15] Li YQ. Screening of universal DNA barcodes for common forages and establishment of database [Master dissertation]. Lanzhou: Gansu Agricultural University; 2017. Chinese.Search in Google Scholar

[16] Chen JY. Phylogenetic analysis and taxonomic study of Medicago sensu lato in China [Master dissertation]. Lanzhou: Lanzhou University; 2021. Chinese.Search in Google Scholar

[17] Wang CZ, Li P, Ding JY, Peng X, Yuan CS. Simultaneous identification of Bulbus Fritillariae cirrhosae using PCR-RFLP analysis. Phytomedicine. 2007;14:628–32.10.1016/j.phymed.2006.09.008Search in Google Scholar PubMed

[18] Wang CZ, Li P, Ding JY, Yuan CS. Identification of Fritillaria pallidiflora using diagnostic PCR and PCR-RFLP based on nuclear ribosomal DNA internal transcribed spacer sequences. Planta Med. 2005;71(4):384–6.10.1055/s-2005-864112Search in Google Scholar PubMed

[19] Gao T, Yao H, Song JY, Zhu YJ, Liu C, Chen SL. Evaluating the feasibility of using candidate DNA barcodes in discriminating species of the large Asteraceae family. BMC Evolut Biol. 2010;10:324.10.1186/1471-2148-10-324Search in Google Scholar PubMed PubMed Central

[20] Qin MJ, Huang Y, Yang G. RbcL sequence analysis of Belamcahda chihehsis and related medicinal plants of Iris. Acta Pharm Sin. 2003;38(2):147–52. Chinese.Search in Google Scholar

[21] Zhu YJ, Chen SL, Yao H. DNA barcoding the medicinal plants of the genus paris. Acta Pharm Sin. 2010;45(3):376–82. Chinese.Search in Google Scholar

[22] Luo K, Chen SL, Chen KL. Study on plant universal DNA barcode based on Rutaceae. Sci Sin Vitae. 2010;40(4):342–51. Chinese.Search in Google Scholar

[23] Pang XH, Song JY, Zhu YJ. Applying plant DNA barcodes for Rosaceae species identification. Cladistics. 2011;27:165–70.10.1111/j.1096-0031.2010.00328.xSearch in Google Scholar PubMed

[24] Gao T, Yao H, Song JY, Liu C, Zhu YJ, Ma XY, et al. Identification of medicinal plants in the family Fabaceae using a potential DNA barcode ITS2. Ethnopharmacol. 2010;130:116–21.10.1016/j.jep.2010.04.026Search in Google Scholar PubMed

[25] Wang Y, Li DH, Zhang YT. Analys is of ITS sequences of some med icinal plants and their related species in Salvia. Acta Pharm Sin. 2007;12:1309–13. Chinese.Search in Google Scholar

[26] Wang YH, Zhang SZ, Gao JP. Phylogeny of schisandraceae based on the cpDNA rbcL sequences. J Fudan Univ (Nat Sci). 2003;42(4):550–4. Chinese.Search in Google Scholar

[27] He TH, Rao GY, You RL, Ge S, Zhang DM. Genetic structure and heterozygosity variation between generations of ophiopogon xylorrhizus (Liliaceae s.l.), an endemic species in Yunnan, Southwest China. Biochem Genet. 2001;39(3–4):93–8.Search in Google Scholar

[28] Nguyen NH, Driscoll HE, Specht CD. A molecular phylogeny of the wild onions (Allium; Alliaceae) with a focus on the western North American center of diversity. Mol Phylogenet Evol. 2008;47:1157–72.10.1016/j.ympev.2007.12.006Search in Google Scholar PubMed

[29] Wang XJ, Dong WP, Zhou SL. Analysis alfalfa plant evolution path based on the chloroplast genome in china. Acta Ecol Sin. 2022;42(15):6125–36. Chinese.Search in Google Scholar

[30] Igbari AD, Ogundipe OT. Phylogenetic patterns in the tribe Acacieae (Caesalpinioideae: Fabaceae) based on rbcL, matK, trnL-F and ITS sequence data. Asia Pac J Mol Biol Biotechnol. 2019;27(2):103–15. 10.35118/apjmbb.2019.027.2.13.Search in Google Scholar

[31] Tao XL. The study on the complete chloroplast genome of Medicago sativa and Vicia sativa [Master dissertation]. Lanzhou: Lanzhou University; 2017. Chinese.Search in Google Scholar
Received: 2022-11-14
Revised: 2023-02-13
Accepted: 2023-02-15
Published Online: 2023-03-21

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
  3. Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
  4. Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
  5. Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
  6. A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
  7. Neutrophilia with subclinical Cushing’s disease: A case report and literature review
  8. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
  9. Immunoregulation of synovial macrophages for the treatment of osteoarthritis
  10. Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
  11. Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
  12. Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
  13. High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
  14. Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
  15. Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
  16. Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
  17. Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
  18. Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
  19. Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
  20. Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
  21. Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
  22. Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
  23. Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
  24. Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
  25. 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
  26. Experimental study on the optimization of ANM33 release in foam cells
  27. Primary retroperitoneal angiosarcoma: A case report
  28. Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
  29. Malignant pleural effusion diagnosis and therapy
  30. Effect of spaceflight on the phenotype and proteome of Escherichia coli
  31. Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
  32. Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
  33. Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
  34. The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
  35. Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
  36. mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
  37. The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
  38. Radiotherapy for primary thyroid adenoid cystic carcinoma
  39. Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
  40. Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
  41. Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
  42. Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
  43. PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
  44. The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
  45. Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
  46. Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
  47. NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
  48. Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
  49. Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
  50. Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
  51. Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
  52. Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
  53. Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
  54. Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
  55. Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
  56. Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
  57. Gemella morbillorum infective endocarditis: A case report and literature review
  58. An unusual ectopic thymoma clonal evolution analysis: A case report
  59. Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
  60. Detection of V. vulnificus septic shock with ARDS using mNGS
  61. Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
  62. The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
  63. Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
  64. ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
  65. Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
  66. Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
  67. Collagen changes in rabbit conjunctiva after conjunctival crosslinking
  68. Effects of NM23 transfection of human gastric carcinoma cells in mice
  69. Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
  70. Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
  71. Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
  72. Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
  73. Giant duplication of the transverse colon in an adult: A case report and literature review
  74. Ectopic thyroid tissue in the breast: A case report
  75. SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
  76. Vaginal metastasis from breast cancer: A case report
  77. Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
  78. Inhibition of TAZ impairs the migration ability of melanoma cells
  79. Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
  80. Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
  81. Identification of winter wheat pests and diseases based on improved convolutional neural network
  82. Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
  83. Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
  84. Immune checkpoint inhibitors in cancer patients with COVID-19
  85. Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
  86. Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
  87. Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
  88. DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
  89. Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
  90. Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
  91. Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
  92. Studying infant mortality: A demographic analysis based on data mining models
  93. Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
  94. Protein Z modulates the metastasis of lung adenocarcinoma cells
  95. Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
  96. TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
  97. Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
  98. Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
  99. Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
  100. Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
  101. Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
  102. HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
  103. Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
  104. Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
  105. Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
  106. Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
  107. Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
  108. Research progress on gas signal molecular therapy for Parkinson’s disease
  109. Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
  110. The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
  111. α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
  112. CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
  113. Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
  114. Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
  115. Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
  116. Research progress of AMP-activated protein kinase and cardiac aging
  117. TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
  118. Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
  119. Metastasis from small cell lung cancer to ovary: A case report
  120. The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
  121. The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
  122. Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
  123. Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
  124. Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
  125. Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
  126. Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
  127. Traumatic brain injury and rTMS-ERPs: Case report and literature review
  128. Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
  129. Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
  130. The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
  131. Inflammation-related signaling pathways in tendinopathy
  132. CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
  133. Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
  134. Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
  135. Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
  136. Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
  137. Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
  138. Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
  139. TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
  140. Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
  141. Ferroptosis: A potential target of macrophages in plaque vulnerability
  142. Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
  143. Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
  144. HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
  145. IL-17 in osteoarthritis: A narrative review
  146. Circadian cycle and neuroinflammation
  147. Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
  148. Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
  149. SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
  150. Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
  151. PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
  152. Pancreatic ectopic thyroid tissue: A case report and analysis of literature
  153. The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
  154. Report on a case of liver-originating malignant melanoma of unknown primary
  155. Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
  156. The fibroblast growth factor–Klotho axis at molecular level
  157. Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
  158. A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
  159. Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
  160. Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
  161. Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
  162. Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
  163. Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
  164. Case report of atypical undernutrition of hypoproteinemia type
  165. Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
  166. Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
  167. Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
  168. Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
  169. Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
  170. Precisional detection of lymph node metastasis using tFCM in colorectal cancer
  171. Advances in diagnosis and treatment of perimenopausal syndrome
  172. A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
  173. Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
  174. Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
  175. Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
  176. Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
  177. Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
  178. Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
  179. An online diagnosis method for cancer lesions based on intelligent imaging analysis
  180. Medical imaging in rheumatoid arthritis: A review on deep learning approach
  181. Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
  182. Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
  183. A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
  184. TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
  185. Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
  186. Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
  187. Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
  188. Hepatobiliary surgery based on intelligent image segmentation technology
  189. Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
  190. Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
  191. Early diagnosis for the onset of peri-implantitis based on artificial neural network
  192. Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
  193. Forecast of pain degree of lumbar disc herniation based on back propagation neural network
  194. SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
  195. Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
  196. Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
  197. A novel approach for minimising anti-aliasing effects in EEG data acquisition
  198. ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
  199. Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
  200. Lung nodule segmentation via semi-residual multi-resolution neural networks
  201. Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
  202. A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
  203. Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
  204. Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
  205. Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
  206. Monitoring and evaluation of anesthesia depth status data based on neuroscience
  207. Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
  208. Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
  209. Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
  210. Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
  211. Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
  212. From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
  213. Ecology and Environmental Science
  214. Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
  215. Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
  216. Effects of cadmium stress on fruits germination and growth of two herbage species
  217. Bamboo charcoal affects soil properties and bacterial community in tea plantations
  218. Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
  219. Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
  220. Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
  221. Food Science
  222. Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
  223. Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
  224. Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
  225. Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
  226. Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
  227. Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
  228. Microbiological transglutaminase: Biotechnological application in the food industry
  229. Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
  230. Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
  231. The potential for the use of leghemoglobin and plant ferritin as sources of iron
  232. Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
  233. Bioengineering and Biotechnology
  234. Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
  235. Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
  236. Agriculture
  237. Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
  238. On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
  239. Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
  240. A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
  241. Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
  242. Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
  243. Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
  244. Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
  245. Animal Sciences
  246. Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
  247. Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
  248. Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
  249. Tracking behavioral changes of confined sows from the first mating to the third parity
  250. The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
  251. Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
  252. Plant Sciences
  253. Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
  254. Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
  255. Tissue culture and rapid propagation technology for Gentiana rhodantha
  256. Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
  257. Cloning and expression analysis of VrNAC13 gene in mung bean
  258. Chlorate-induced molecular floral transition revealed by transcriptomes
  259. Effects of warming and drought on growth and development of soybean in Hailun region
  260. Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
  261. Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
  262. Distinguish Dianthus species or varieties based on chloroplast genomes
  263. Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
  264. Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
  265. An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
  266. Erratum
  267. Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
  268. Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
  269. Retraction
  270. Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
https://doi.org/10.1515/biol-2022-0582
Keywords for this article
alfalfa varieties; ITS2; trnL-F; psbA-trnH; genetic diversity; group identification
Creative Commons
BY 4.0

Articles in the same Issue

  1. Biomedical Sciences
  2. Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
  3. Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
  4. Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
  5. Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
  6. A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
  7. Neutrophilia with subclinical Cushing’s disease: A case report and literature review
  8. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
  9. Immunoregulation of synovial macrophages for the treatment of osteoarthritis
  10. Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
  11. Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
  12. Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
  13. High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
  14. Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
  15. Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
  16. Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
  17. Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
  18. Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
  19. Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
  20. Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
  21. Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
  22. Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
  23. Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
  24. Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
  25. 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
  26. Experimental study on the optimization of ANM33 release in foam cells
  27. Primary retroperitoneal angiosarcoma: A case report
  28. Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
  29. Malignant pleural effusion diagnosis and therapy
  30. Effect of spaceflight on the phenotype and proteome of Escherichia coli
  31. Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
  32. Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
  33. Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
  34. The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
  35. Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
  36. mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
  37. The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
  38. Radiotherapy for primary thyroid adenoid cystic carcinoma
  39. Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
  40. Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
  41. Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
  42. Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
  43. PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
  44. The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
  45. Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
  46. Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
  47. NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
  48. Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
  49. Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
  50. Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
  51. Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
  52. Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
  53. Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
  54. Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
  55. Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
  56. Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
  57. Gemella morbillorum infective endocarditis: A case report and literature review
  58. An unusual ectopic thymoma clonal evolution analysis: A case report
  59. Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
  60. Detection of V. vulnificus septic shock with ARDS using mNGS
  61. Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
  62. The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
  63. Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
  64. ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
  65. Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
  66. Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
  67. Collagen changes in rabbit conjunctiva after conjunctival crosslinking
  68. Effects of NM23 transfection of human gastric carcinoma cells in mice
  69. Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
  70. Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
  71. Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
  72. Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
  73. Giant duplication of the transverse colon in an adult: A case report and literature review
  74. Ectopic thyroid tissue in the breast: A case report
  75. SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
  76. Vaginal metastasis from breast cancer: A case report
  77. Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
  78. Inhibition of TAZ impairs the migration ability of melanoma cells
  79. Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
  80. Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
  81. Identification of winter wheat pests and diseases based on improved convolutional neural network
  82. Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
  83. Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
  84. Immune checkpoint inhibitors in cancer patients with COVID-19
  85. Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
  86. Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
  87. Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
  88. DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
  89. Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
  90. Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
  91. Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
  92. Studying infant mortality: A demographic analysis based on data mining models
  93. Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
  94. Protein Z modulates the metastasis of lung adenocarcinoma cells
  95. Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
  96. TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
  97. Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
  98. Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
  99. Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
  100. Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
  101. Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
  102. HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
  103. Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
  104. Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
  105. Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
  106. Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
  107. Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
  108. Research progress on gas signal molecular therapy for Parkinson’s disease
  109. Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
  110. The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
  111. α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
  112. CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
  113. Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
  114. Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
  115. Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
  116. Research progress of AMP-activated protein kinase and cardiac aging
  117. TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
  118. Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
  119. Metastasis from small cell lung cancer to ovary: A case report
  120. The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
  121. The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
  122. Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
  123. Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
  124. Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
  125. Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
  126. Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
  127. Traumatic brain injury and rTMS-ERPs: Case report and literature review
  128. Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
  129. Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
  130. The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
  131. Inflammation-related signaling pathways in tendinopathy
  132. CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
  133. Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
  134. Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
  135. Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
  136. Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
  137. Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
  138. Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
  139. TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
  140. Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
  141. Ferroptosis: A potential target of macrophages in plaque vulnerability
  142. Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
  143. Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
  144. HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
  145. IL-17 in osteoarthritis: A narrative review
  146. Circadian cycle and neuroinflammation
  147. Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
  148. Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
  149. SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
  150. Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
  151. PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
  152. Pancreatic ectopic thyroid tissue: A case report and analysis of literature
  153. The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
  154. Report on a case of liver-originating malignant melanoma of unknown primary
  155. Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
  156. The fibroblast growth factor–Klotho axis at molecular level
  157. Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
  158. A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
  159. Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
  160. Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
  161. Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
  162. Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
  163. Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
  164. Case report of atypical undernutrition of hypoproteinemia type
  165. Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
  166. Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
  167. Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
  168. Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
  169. Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
  170. Precisional detection of lymph node metastasis using tFCM in colorectal cancer
  171. Advances in diagnosis and treatment of perimenopausal syndrome
  172. A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
  173. Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
  174. Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
  175. Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
  176. Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
  177. Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
  178. Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
  179. An online diagnosis method for cancer lesions based on intelligent imaging analysis
  180. Medical imaging in rheumatoid arthritis: A review on deep learning approach
  181. Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
  182. Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
  183. A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
  184. TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
  185. Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
  186. Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
  187. Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
  188. Hepatobiliary surgery based on intelligent image segmentation technology
  189. Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
  190. Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
  191. Early diagnosis for the onset of peri-implantitis based on artificial neural network
  192. Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
  193. Forecast of pain degree of lumbar disc herniation based on back propagation neural network
  194. SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
  195. Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
  196. Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
  197. A novel approach for minimising anti-aliasing effects in EEG data acquisition
  198. ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
  199. Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
  200. Lung nodule segmentation via semi-residual multi-resolution neural networks
  201. Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
  202. A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
  203. Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
  204. Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
  205. Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
  206. Monitoring and evaluation of anesthesia depth status data based on neuroscience
  207. Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
  208. Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
  209. Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
  210. Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
  211. Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
  212. From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
  213. Ecology and Environmental Science
  214. Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
  215. Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
  216. Effects of cadmium stress on fruits germination and growth of two herbage species
  217. Bamboo charcoal affects soil properties and bacterial community in tea plantations
  218. Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
  219. Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
  220. Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
  221. Food Science
  222. Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
  223. Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
  224. Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
  225. Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
  226. Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
  227. Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
  228. Microbiological transglutaminase: Biotechnological application in the food industry
  229. Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
  230. Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
  231. The potential for the use of leghemoglobin and plant ferritin as sources of iron
  232. Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
  233. Bioengineering and Biotechnology
  234. Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
  235. Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
  236. Agriculture
  237. Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
  238. On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
  239. Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
  240. A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
  241. Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
  242. Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
  243. Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
  244. Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
  245. Animal Sciences
  246. Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
  247. Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
  248. Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
  249. Tracking behavioral changes of confined sows from the first mating to the third parity
  250. The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
  251. Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
  252. Plant Sciences
  253. Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
  254. Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
  255. Tissue culture and rapid propagation technology for Gentiana rhodantha
  256. Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
  257. Cloning and expression analysis of VrNAC13 gene in mung bean
  258. Chlorate-induced molecular floral transition revealed by transcriptomes
  259. Effects of warming and drought on growth and development of soybean in Hailun region
  260. Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
  261. Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
  262. Distinguish Dianthus species or varieties based on chloroplast genomes
  263. Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
  264. Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
  265. An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
  266. Erratum
  267. Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
  268. Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
  269. Retraction
  270. Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2026 De Gruyter Brill
Downloaded on 27.1.2026 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0582/html
Scroll to top button