Home DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
Article Open Access

DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway

  • Xingzhong Liu , Jie Chen EMAIL logo and Lu Liu
Published/Copyright: July 17, 2023

Abstract

One of the most severe side effects of systemic lupus erythematosus (SLE) is lupus nephritis (LN). To search for potential therapeutic targets in SLE is crucial for the progression of SLE. In this study, we selected C57BL/6J mice as controls and MRL/lpr mice as an LN model and obtained dual specificity phosphatase 2 (DUSP2)-overexpressed mice by injecting AAV-DUSP2 plasmid into the tail vein. Then, proteinuria, urea nitrogen, dsDNA and TNF-α, IL-6, and IL-1β levels were measured in each group of mice. In addition, renal histopathological damage was assessed by hematoxylin–eosin. Finally, STAT3 phosphorylation levels were detected by Western blot assay. The results showed that DUSP2 could reduce proteinuria, urea nitrogen, dsDNA and TNF-α, IL-6, and IL-1β levels and improve renal tissue injury in mice with LN. Mechanistically, DUSP2 inhibited STAT3 phosphorylation. These results demonstrated that DUSP2 played a role in ameliorating LN, which provided potential targets for LN research.

Graphical abstract

1 Introduction

Systemic lupus erythematosus (SLE) is an autoimmune disease that is more prevalent in women than in men and usually happens in young adulthood. It is thought to be caused by an over-activation of the autoimmune system attacking its own tissues and organs, with kidney tissue being the most susceptible organ [1]. About 50% of SLE patients have clinical manifestations of kidney damage, called lupus nephritis (LN), which mainly manifests as elevated inflammatory factors, proteinuria, and impaired renal function [2]. Due to the complex pathogenesis of LN, there are no effective drugs to cure LN for the time being. Therefore, it is crucial to find potential therapeutic targets for the treatment of LN.

There are 25 phosphatases in the dual specificity phosphatase (DUSP) family, all of which dephosphorylate their substrates at threonine/serine residues and/or tyrosine residues [3]. DUSP family members are involved in autoimmune disorders. For instance, the expression of DUSP22 is downregulated in SLE, and the downregulation of DUSP22 is associated with poor prognosis of LN patients [4]. Dual specificity phosphatase 2 (DUSP2), a member of the DUSP family, is also known as activated cell phosphatase 1 (PAC-1). DUSP2 has been reported to be involved in human autoimmune diseases, and transcript levels of DUSP2 are reduced in peripheral blood mononuclear cells from patients with ulcerative colitis [5]. Furthermore, previous studies have shown that DUSP2 deficiency exacerbated tubular injury and the progression of acute kidney injury, whereas DUSP2 overexpression prevented acute kidney injury [6].

However, the role of DUSP2 in LN and related mechanisms are not clear. In this study, we determined the expression of DUSP2 in human tissue samples and mice with LN and mice with DUSP2 transfection. We found that DUSP2 could regulate STAT3 phosphorylation to improve LN renal inflammation and renal function. In conclusion, our study provides potential targets for treating LN.

2 Methods

2.1 Clinical samples

For diagnostic purposes, kidney tissue was obtained from 20 LN (category IV) patients. The tumor-adjacent tissues of 10 patients who underwent renal tumor resection were selected as normal tissues. This study was approved by the Ethics Committee of Wuhan Third Hospital. All patients have given informed consent.

  1. Informed consent: Informed consent has been obtained from all individuals included in this study.

  2. Ethical approval: The research related to human use has been complied with all the relevant national regulations, institutional policies and in accordance with the tenets of the Helsinki Declaration, and has been approved by Ethics Committee of Wuhan Third Hospital.

2.2 Animals

MRL/lpr mice and C57BL/6J mice were purchased from Shanghai SLAC Laboratory Animal Co., Ltd. MRL/lpr mice are spontaneous lupus erythematosus mice with similar symptoms to human lupus erythematosus. All animals were housed in a pathogen-free environment. All animal studies were approved by the Ethics Committee of Wuhan Third Hospital and were conducted in accordance with the National Institutes of Health Guidelines for the Care and Use of Animals. The animals were divided into three groups: C57BL/6J normal mice as the control group (n = 6), MRL/lpr mice injected with empty vector via tail vein as the vector group (n = 6), and AAV-DUSP2 plasmid injected mice as the DUSP2 group (n = 6).

  1. Ethical approval: The research related to animal use has been complied with all the relevant national regulations and institutional policies for the careand use of animals, and has been approved by the Ethics Committee of Wuhan Third Hospital.

2.3 Assessment of proteinuria level

Mice were placed in metabolic cages at 12 weeks and 24 h urine was collected every 2 weeks, and proteinuria was measured by Multistix 10SG reagent strips (Bayer Healthcare, IN, USA) [7]. The proteinuria scores were calculated as described previously [8].

2.4 Assessment of urea nitrogen and dsDNA levels

To collect blood from mice, the clot was kept naturally at room temperature for 30 min and then centrifuged at 1,000 × g for about 15 min. At last, the supernatant was collected, and the serum BUN content was measured by a BUN assay kit (Qindao Jisskang Biotechnology Co., Ltd.). Mouse serum dsDNA levels were measured using an anti-mouse dsDNA ELISA kit (Shanghai Fusheng Industrial Co., Ltd.).

2.5 Assessment of serum inflammatory cytokine levels

The serum of mice was collected, and the serum TNF-α, IL-6, and IL-1β (Shanghai Enzyme-linked Biotechnology Co., Ltd.) levels were measured according to the manufacturer’s instructions.

2.6 Kidney histopathological evaluation

The mice in each group were euthanized, and kidney tissues were obtained and fixed in 10% formaldehyde solution and then processed by dehydration and transparency steps. Finally, the kidney tissues were embedded in paraffin blocks and stained with eosin–hematoxylin staining solution [9].

2.7 qRT-PCR

Total RNA was extracted from kidney tissue using the TRIzol reagent (Invitrogen, USA). Total RNA was reversely transcribed into cDNA using SuperScript II (Invitrogen) reverse transcriptase [10]. qRT-PCR analysis was performed using the SYBR green method. Relative expression of target mRNA was calculated by the 2−ΔΔCt method. The primer sequences are as follows: IL-6: forward primer AGATCTACTCGGCAAACC, reverse primer CGTAGAGAACAACATAAGTCAG; IL-1β: forward primer TGACCTGGGCTGTCCTGATG, reverse primer GGTGCTCATGTCCCTCATCCTG; and TNF-α: forward primer AGGCTGCCCCGACTACGT, reverse primer GACTTTCTCTGGTATGAGATAGCAAA.

2.8 Western bolt

Kidney tissues were cut into small pieces and ground into powder by adding liquid nitrogen. Then, RIPA lysis solution was added and lysed thoroughly on ice, and protein concentration was determined by BCA kit. Different groups of samples containing equal amounts of proteins were electrophoresed by 10% SDS-PAGE, and the protein bands were transferred to PVDF membranes. The membrane was blocked by 5% skim milk and incubated with DUSP2 (Solarbio, K009050P, 1:1,000, China), p-STAT3 (Beyotime, AF5941, 1:1,000, China), STAT3 (Beyotime, AF1492, 1:1,000), COX2 (GeneTex, GTX60935, 1:1,000, USA), and GAPDH (GeneTex, GTX100118, 1:5,000) antibodies overnight at 4°C in a refrigerator. The next day, the PVDF membrane was washed with TBST and incubated with HRP-labeled IgG (Abcam, ab205718, 1:10,000, UK).

2.9 Statistical analysis

Data were analyzed using SPSS version 20.0, and all data were expressed as mean ± standard deviation. Student’s t-test was used for comparison between two groups, and one-way ANOVA was used for comparison among multiple groups. P < 0.05 was considered to indicate a statistically significant difference.

3 Results

3.1 Low expression of DUSP2 in LN

We first analyzed the expression of DUSP2 in LN and normal kidneys from the GSE112943 expression profile and found that the expression of DUSP2 was significantly lower in kidney samples from patients with LN than in normal kidney tissue (Figure 1a). In addition, we examined the expression of DUSP2 in the renal tissues of patients with LN from our hospital and found that both mRNA (Figure 1b) and protein (Figure 1c) expression of DUSP2 were significantly decreased in the renal tissues of LN patients.

Figure 1 
                  Low expression of DUSP2 in LN. (a) Expression of DUSP2 in normal and LN kidney tissues obtained from GSE112943 expression profile. (b) The mRNA expression levels of DUSP2 in normal and LN kidney tissues. (c) Protein expression levels of DUSP2 in normal and LN renal tissues. ***
                     P < 0.001 vs control.
Figure 1

Low expression of DUSP2 in LN. (a) Expression of DUSP2 in normal and LN kidney tissues obtained from GSE112943 expression profile. (b) The mRNA expression levels of DUSP2 in normal and LN kidney tissues. (c) Protein expression levels of DUSP2 in normal and LN renal tissues. *** P < 0.001 vs control.

3.2 DUSP2 ameliorates renal tissue lesions in mice with LN

To investigate whether DUSP2 plays a role in LN, we transfected DUSP2 overexpression plasmids into LN mice and found that DUSP2 expression was significantly increased in kidney tissues of mice transfected with DUSP2 (Figure 2a), indicating a successful transfection effect. We then examined the proteinuria levels in mice and found that the proteinuria levels in vector group mice were gradually increased during 12–20 weeks compared to the control group, while the proteinuria levels in the DUSP2 group were significantly decreased (Figure 2b). We also examined serum urea nitrogen and dsDNA levels in mice and found that serum BUN and dsDNA levels were significantly elevated in the vector group, while BUN (Figure 2c) and dsDNA (Figure 2d) levels were significantly decreased in DUSP2 group. Finally, we performed HE staining on the kidney tissues of mice and found that the kidney tissues of mice in the vector group showed neutrophil infiltration, and other pathological features of kidney disease, and the kidney tissue lesions of mice in the DUSP2 group were improved compared with those in the vector group (Figure 2e).

Figure 2 
                  DUSP2 ameliorates renal tissue lesions in mice with LN. (a) Expression levels of DUSP2 protein in kidney tissues of various groups of mice. (b) Changes in proteinuria levels of mice in each group from 12 to 20 weeks. (c) Serum urea nitrogen levels in all groups of mice. (d) Serum dsDNA levels in each group of mice. (e) Renal histopathology of mice in each group ***
                     P < 0.001 vs vector.
Figure 2

DUSP2 ameliorates renal tissue lesions in mice with LN. (a) Expression levels of DUSP2 protein in kidney tissues of various groups of mice. (b) Changes in proteinuria levels of mice in each group from 12 to 20 weeks. (c) Serum urea nitrogen levels in all groups of mice. (d) Serum dsDNA levels in each group of mice. (e) Renal histopathology of mice in each group *** P < 0.001 vs vector.

3.3 DUSP2 alleviates kidney tissue inflammation in mice with LN

To test whether DUSP2 reduces the inflammatory response in LN mice, we measured the levels of TNF-α, IL-6, and IL-1β in serum and kidney tissues by ELISA and PCR. The result revealed that the levels of TNF-α, IL-6, and IL-1β in serum (Figure 3a) and kidney tissues (Figure 3b) of mice in the vector group were increased, while the levels of the above inflammatory factors were significantly decreased after transfection of DUSP2.

Figure 3 
                  DUSP2 reduces kidney tissue inflammation in mice with LN. (a) Serum TNF-α, IL-6, IL-1β content of mice in each group. (b) Expression of TNF-α, IL-6, IL-1β mRNA in kidney tissue of mice in each group. ***
                     P < 0.001 vs vector.
Figure 3

DUSP2 reduces kidney tissue inflammation in mice with LN. (a) Serum TNF-α, IL-6, IL-1β content of mice in each group. (b) Expression of TNF-α, IL-6, IL-1β mRNA in kidney tissue of mice in each group. *** P < 0.001 vs vector.

3.4 DUSP2 inhibits STAT3 activation

We examined the phosphorylation level of STAT3 and the expression of COX2, the downstream target of STAT3, in the kidney tissues of LN mice by western blot assay. We found that the expression of p-STAT3 and COX2 was increased in the kidney tissues of mice in the vector group, while the levels of p-STAT3 and COX2 were decreased in the kidney tissues of mice in the DUSP2 group (Figure 4). This indicated that DUSP2 inhibited the activation of STAT3.

Figure 4 
                  DUSP2 inhibits STAT3 activation. Expression of p-STAT3 and COX2 protein in kidney tissue of mice in each group. ***
                     P < 0.001 vs vector.
Figure 4

DUSP2 inhibits STAT3 activation. Expression of p-STAT3 and COX2 protein in kidney tissue of mice in each group. *** P < 0.001 vs vector.

4 Discussion

Previous studies have shown a protective effect of DUSP2 against acute kidney injury, but the role of DUSP2 in the autoimmune disease LN is unclear. Here, we chose MRL/lpr mice as a model because MRL/lpr mice exhibit various features such as nephritis, autoantibody production, and splenomegaly, which are similar to those of human lupus erythematosus [11]. In addition, MRL/lpr mice were transfected with DUSP2 overexpression plasmid and the proteinuria level in each group of mice was observed from 12 to 20 weeks and found that DUSP2 could reduce the proteinuria level in MRL/lpr mice.

BUN is one of the clinical indicators used to assess renal function. Kidney disease or failure is related to increased BUN levels [12]. Patients with SLE have a significant release of DNA-containing nucleosomes into their circulatory system, which results in the development of immune complexes including anti-dsDNA autoantibodies. After being deposited in the kidney, immune complexes induced a series of events that leads to renal inflammation and the production of chemokines, cytokines, and complement [13]. dsDNA antibody has a very specific diagnostic value for SLE. If this antibody is elevated, it means that the lupus disease is not fully controlled and needs to be treated actively. As lupus erythematosus disease is controlled, the level of dsDNA will gradually decline. Our findings suggested that DUSP2 restores impaired renal function in lupus mice by reducing BUN levels. Furthermore, DUSP2 also reduced dsDNA levels in MRL/lpr mice.

Immune dysfunction caused by unbalanced cytokine production also mediates tissue inflammation and harms organs. Inflammatory cytokines including IL-1β [14], IL-6 [15], and TNF-α [16] have been recognized as significant contributors to SLE. The severity and activity of glomerulonephritis are correlated with the expression of these cytokines [17]. Our results showed that DUSP2 reduced the levels of IL-1β, IL-6, and TNF-α in serum and renal tissues of MRL/lpr mice, demonstrating that DUSP2 improved the inflammatory response in LN.

Signal transducer and activator of transcription 3 (STAT3) is essential for controlling innate and adaptive immunological responses, as well as inflammation. LN results in abnormal STAT3 activation (phosphorylation). SLE T cells can respond to chemokines and move more quickly in vitro when STAT3 is phosphorylated [18]. The onset of LN has been found to be delayed by STAT3 inhibition [19]. In addition, cyclooxygenase 2 (COX2) expression was upregulated in LN [20], and low-dose COX-2 inhibitor celecoxib has ameliorative effects in lupus mice [21]. COX2 also acted as a downstream target of STAT3. DUSP2 is associated with STAT3 and attenuates its activity by inhibiting STAT3 phosphorylation [5]. Our results showed that DUSP2 decreased STAT3 phosphorylation levels and COX2 levels in kidney tissue of MRL/lpr mice, indicating that DUSP2 inhibited STAT3 phosphorylation in LN.

In conclusion, we demonstrated that the expression level of DUSP2 was decreased in LN for the first time. DUSP2 ameliorated LN and suppressed inflammation by inhibiting STAT3 phosphorylation levels. Our study provides promising potential targets for treating LN.


tel: +86-15172322046

  1. Funding information: This work was supported by Hubei Province Wuhan Medical Research Project (Grant No. WX19Z38).

  2. Author contributions: Xingzhong Liu, Jie Chen, and Lu Liu designed the study and carried them out, supervised the data collection, analyzed the data, interpreted the data, prepared the manuscript for publication, and reviewed the draft of the manuscript. All authors have read and approved the manuscript.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Wang H, Lu M, Zhai S, Wu K, Peng L, Yang J, et al. ALW peptide ameliorates lupus nephritis in MRL/lpr mice. Arthritis Res Ther. 2019;21(1):261.10.1186/s13075-019-2038-0Search in Google Scholar PubMed PubMed Central

[2] Li D, Shi G, Wang J, Zhang D, Pan Y, Dou H, et al. Baicalein ameliorates pristane-induced lupus nephritis via activating Nrf2/HO-1 in myeloid-derived suppressor cells. Arthritis Res Ther. 2019;21(1):105.10.1186/s13075-019-1876-0Search in Google Scholar PubMed PubMed Central

[3] Chuang HC, Tan TH. MAP4K family kinases and DUSP family phosphatases in T-cell signaling and systemic lupus erythematosus. Cells. 2019;8(11):1433.10.3390/cells8111433Search in Google Scholar PubMed PubMed Central

[4] Chuang HC, Chen YM, Hung WT, Li JP, Chen DY, Lan JL, et al. Downregulation of the phosphatase JKAP/DUSP22 in T cells as a potential new biomarker of systemic lupus erythematosus nephritis. Oncotarget. 2016;7(36):57593–605.10.18632/oncotarget.11419Search in Google Scholar PubMed PubMed Central

[5] Lu D, Liu L, Ji X, Gao Y, Chen X, Liu Y, et al. The phosphatase DUSP2 controls the activity of the transcription activator STAT3 and regulates TH17 differentiation. Nat Immunol. 2015;16(12):1263–73.10.1038/ni.3278Search in Google Scholar PubMed

[6] Xiong J, Ran L, Zhu Y, Wang Y, Wang S, Wang Y, et al. DUSP2-mediated inhibition of tubular epithelial cell pyroptosis confers nephroprotection in acute kidney injury. Theranostics. 2022;12(11):5069–85.10.7150/thno.72291Search in Google Scholar PubMed PubMed Central

[7] Wang Q, Sun P, Wang R, Zhao X. Therapeutic effect of dendrobium candidum on lupus nephritis in mice. Pharmacogn Mag. 2017;13(49):129–35.Search in Google Scholar

[8] He J, Sun M, Tian S. Procyanidin B2 prevents lupus nephritis development in mice by inhibiting NLRP3 inflammasome activation. Innate Immun. 2018;24(5):307–15.10.1177/1753425918780985Search in Google Scholar PubMed PubMed Central

[9] Zhang L, Chen S, Liu Y, Xu X, Zhang Q, Shao S, et al. P-selectin blockade ameliorates lupus nephritis in MRL/lpr mice through improving renal hypoxia and evaluation using BOLD-MRI. J Transl Med. 2020;18(1):116.10.1186/s12967-020-02284-1Search in Google Scholar PubMed PubMed Central

[10] Chen HY, Chiang YF, Hong YH, Shieh TM, Huang TC, Ali M, et al. Quercetin ameliorates renal injury and pyroptosis in lupus nephritis through inhibiting IL-33/ST2 pathway in vitro and in vivo. Antioxid (Basel). 2022;11(11):2238.10.3390/antiox11112238Search in Google Scholar PubMed PubMed Central

[11] Li Q, Tan S, Xu K, Fu X, Yu J, Yang H, et al. Curcumin attenuates lupus nephritis in MRL/lpr mice by suppressing macrophage-secreted B cell activating factor (BAFF). Int J Clin Exp Pathol. 2019;12(6):2075–83.Search in Google Scholar

[12] Luo H, Geng CJ, Miao SM, Wang LH, Li Q. Taurine attenuates the damage of lupus nephritis mouse via inactivation of the NF-κB pathway. Ann Palliat Med. 2021;10(1):137–47.10.21037/apm-20-2087Search in Google Scholar PubMed

[13] Han P, Weng W, Chen Y, Cai Y, Wang Y, Wang M, et al. Niclosamide ethanolamine attenuates systemic lupus erythematosus and lupus nephritis in MRL/lpr mice. Am J Transl Res. 2020;12(9):5015–31.Search in Google Scholar

[14] Jing C, Castro-Dopico T, Richoz N, Tuong ZK, Ferdinand JR, Lok LSC, et al. Macrophage metabolic reprogramming presents a therapeutic target in lupus nephritis. Proc Natl Acad Sci U S A. 2020;117(26):15160–71.10.1073/pnas.2000943117Search in Google Scholar PubMed PubMed Central

[15] Marczynski P, Meineck M, Xia N, Li H, Kraus D, Roth W, et al. Vascular inflammation and dysfunction in lupus-prone mice-IL-6 as mediator of disease initiation. Int J Mol Sci. 2021;22(5):2291.10.3390/ijms22052291Search in Google Scholar PubMed PubMed Central

[16] Qing X, Chinenov Y, Redecha P, Madaio M, Roelofs JJ, Farber G, et al. iRhom2 promotes lupus nephritis through TNF-α and EGFR signaling. J Clin Invest. 2018;128(4):1397–412.10.1172/JCI97650Search in Google Scholar PubMed PubMed Central

[17] Henke J, Erkel G, Brochhausen C, Kleinert H, Schwarting A, Menke J, et al. The fungal lactone oxacyclododecindione is a potential new therapeutic substance in the treatment of lupus-associated kidney disease. Kidney Int. 2014;86(4):780–9.10.1038/ki.2014.109Search in Google Scholar PubMed

[18] Yoshida N, He F, Kyttaris VC. T cell-specific STAT3 deficiency abrogates lupus nephritis. Lupus. 2019;28(12):1468–72.10.1177/0961203319877242Search in Google Scholar PubMed PubMed Central

[19] Edwards LJ, Mizui M, Kyttaris V. Signal transducer and activator of transcription (STAT) 3 inhibition delays the onset of lupus nephritis in MRL/lpr mice. Clin Immunol. 2015;158(2):221–30.10.1016/j.clim.2015.04.004Search in Google Scholar PubMed PubMed Central

[20] Tomasoni S, Noris M, Zappella S, Gotti E, Casiraghi F, Bonazzola S, et al. Upregulation of renal and systemic cyclooxygenase-2 in patients with active lupus nephritis. J Am Soc Nephrol. 1998;9(7):1202–12.10.1681/ASN.V971202Search in Google Scholar PubMed

[21] Kang HK, Ecklund D, Liu M, Datta SK. Apigenin, a non-mutagenic dietary flavonoid, suppresses lupus by inhibiting autoantigen presentation for expansion of autoreactive Th1 and Th17 cells. Arthritis Res Ther. 2009;11(2):R59.10.1186/ar2682Search in Google Scholar PubMed PubMed Central

Received: 2023-02-14
Revised: 2023-05-11
Accepted: 2023-05-31
Published Online: 2023-07-17

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Biomedical Sciences
  2. Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
  3. Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
  4. Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
  5. Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
  6. A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
  7. Neutrophilia with subclinical Cushing’s disease: A case report and literature review
  8. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
  9. Immunoregulation of synovial macrophages for the treatment of osteoarthritis
  10. Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
  11. Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
  12. Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
  13. High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
  14. Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
  15. Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
  16. Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
  17. Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
  18. Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
  19. Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
  20. Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
  21. Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
  22. Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
  23. Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
  24. Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
  25. 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
  26. Experimental study on the optimization of ANM33 release in foam cells
  27. Primary retroperitoneal angiosarcoma: A case report
  28. Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
  29. Malignant pleural effusion diagnosis and therapy
  30. Effect of spaceflight on the phenotype and proteome of Escherichia coli
  31. Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
  32. Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
  33. Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
  34. The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
  35. Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
  36. mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
  37. The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
  38. Radiotherapy for primary thyroid adenoid cystic carcinoma
  39. Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
  40. Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
  41. Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
  42. Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
  43. PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
  44. The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
  45. Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
  46. Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
  47. NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
  48. Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
  49. Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
  50. Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
  51. Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
  52. Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
  53. Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
  54. Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
  55. Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
  56. Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
  57. Gemella morbillorum infective endocarditis: A case report and literature review
  58. An unusual ectopic thymoma clonal evolution analysis: A case report
  59. Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
  60. Detection of V. vulnificus septic shock with ARDS using mNGS
  61. Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
  62. The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
  63. Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
  64. ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
  65. Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
  66. Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
  67. Collagen changes in rabbit conjunctiva after conjunctival crosslinking
  68. Effects of NM23 transfection of human gastric carcinoma cells in mice
  69. Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
  70. Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
  71. Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
  72. Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
  73. Giant duplication of the transverse colon in an adult: A case report and literature review
  74. Ectopic thyroid tissue in the breast: A case report
  75. SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
  76. Vaginal metastasis from breast cancer: A case report
  77. Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
  78. Inhibition of TAZ impairs the migration ability of melanoma cells
  79. Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
  80. Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
  81. Identification of winter wheat pests and diseases based on improved convolutional neural network
  82. Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
  83. Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
  84. Immune checkpoint inhibitors in cancer patients with COVID-19
  85. Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
  86. Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
  87. Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
  88. DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
  89. Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
  90. Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
  91. Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
  92. Studying infant mortality: A demographic analysis based on data mining models
  93. Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
  94. Protein Z modulates the metastasis of lung adenocarcinoma cells
  95. Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
  96. TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
  97. Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
  98. Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
  99. Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
  100. Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
  101. Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
  102. HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
  103. Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
  104. Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
  105. Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
  106. Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
  107. Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
  108. Research progress on gas signal molecular therapy for Parkinson’s disease
  109. Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
  110. The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
  111. α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
  112. CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
  113. Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
  114. Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
  115. Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
  116. Research progress of AMP-activated protein kinase and cardiac aging
  117. TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
  118. Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
  119. Metastasis from small cell lung cancer to ovary: A case report
  120. The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
  121. The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
  122. Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
  123. Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
  124. Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
  125. Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
  126. Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
  127. Traumatic brain injury and rTMS-ERPs: Case report and literature review
  128. Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
  129. Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
  130. The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
  131. Inflammation-related signaling pathways in tendinopathy
  132. CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
  133. Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
  134. Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
  135. Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
  136. Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
  137. Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
  138. Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
  139. TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
  140. Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
  141. Ferroptosis: A potential target of macrophages in plaque vulnerability
  142. Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
  143. Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
  144. HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
  145. IL-17 in osteoarthritis: A narrative review
  146. Circadian cycle and neuroinflammation
  147. Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
  148. Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
  149. SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
  150. Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
  151. PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
  152. Pancreatic ectopic thyroid tissue: A case report and analysis of literature
  153. The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
  154. Report on a case of liver-originating malignant melanoma of unknown primary
  155. Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
  156. The fibroblast growth factor–Klotho axis at molecular level
  157. Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
  158. A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
  159. Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
  160. Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
  161. Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
  162. Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
  163. Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
  164. Case report of atypical undernutrition of hypoproteinemia type
  165. Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
  166. Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
  167. Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
  168. Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
  169. Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
  170. Precisional detection of lymph node metastasis using tFCM in colorectal cancer
  171. Advances in diagnosis and treatment of perimenopausal syndrome
  172. A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
  173. Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
  174. Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
  175. Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
  176. Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
  177. Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
  178. Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
  179. An online diagnosis method for cancer lesions based on intelligent imaging analysis
  180. Medical imaging in rheumatoid arthritis: A review on deep learning approach
  181. Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
  182. Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
  183. A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
  184. TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
  185. Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
  186. Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
  187. Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
  188. Hepatobiliary surgery based on intelligent image segmentation technology
  189. Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
  190. Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
  191. Early diagnosis for the onset of peri-implantitis based on artificial neural network
  192. Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
  193. Forecast of pain degree of lumbar disc herniation based on back propagation neural network
  194. SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
  195. Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
  196. Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
  197. A novel approach for minimising anti-aliasing effects in EEG data acquisition
  198. ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
  199. Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
  200. Lung nodule segmentation via semi-residual multi-resolution neural networks
  201. Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
  202. A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
  203. Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
  204. Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
  205. Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
  206. Monitoring and evaluation of anesthesia depth status data based on neuroscience
  207. Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
  208. Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
  209. Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
  210. Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
  211. Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
  212. From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
  213. Ecology and Environmental Science
  214. Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
  215. Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
  216. Effects of cadmium stress on fruits germination and growth of two herbage species
  217. Bamboo charcoal affects soil properties and bacterial community in tea plantations
  218. Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
  219. Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
  220. Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
  221. Food Science
  222. Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
  223. Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
  224. Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
  225. Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
  226. Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
  227. Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
  228. Microbiological transglutaminase: Biotechnological application in the food industry
  229. Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
  230. Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
  231. The potential for the use of leghemoglobin and plant ferritin as sources of iron
  232. Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
  233. Bioengineering and Biotechnology
  234. Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
  235. Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
  236. Agriculture
  237. Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
  238. On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
  239. Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
  240. A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
  241. Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
  242. Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
  243. Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
  244. Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
  245. Animal Sciences
  246. Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
  247. Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
  248. Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
  249. Tracking behavioral changes of confined sows from the first mating to the third parity
  250. The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
  251. Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
  252. Plant Sciences
  253. Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
  254. Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
  255. Tissue culture and rapid propagation technology for Gentiana rhodantha
  256. Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
  257. Cloning and expression analysis of VrNAC13 gene in mung bean
  258. Chlorate-induced molecular floral transition revealed by transcriptomes
  259. Effects of warming and drought on growth and development of soybean in Hailun region
  260. Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
  261. Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
  262. Distinguish Dianthus species or varieties based on chloroplast genomes
  263. Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
  264. Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
  265. An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
  266. Erratum
  267. Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
  268. Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
  269. Retraction
  270. Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
Downloaded on 7.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0649/html
Scroll to top button