Zum Hauptinhalt springen
Artikel Open Access

Inhibition of TAZ impairs the migration ability of melanoma cells

  • , , , und EMAIL logo
Veröffentlicht/Copyright: 21. Juni 2023

Abstract

Malignant melanoma (MM) is characterized by rapid growth, frequent metastasis, and high mortality. Targeted therapy for MM is still a research hotspot due to the increasing understanding of the hippo pathway. The aim of this study is to investigate the role of transcriptional coactivator with PDZ-binding motif (TAZ) in MM tumorigenesis. Based on the database analysis, we found that the median mRNA expression of TAZ (5.4) was found to be similar to that of YAP (5.5) in 473 human melanoma specimens. However, in 63 MM cell lines, the median expression of TAZ (10.8) was expressed at a higher level than that of YAP (9.5), which was then validated in A375. TAZ down-regulation by siRNA decreased the migration (72%) and invasion (74%) abilities of A375. Furthermore, the down-regulation of TAZ inhibited the proliferation of A375 without affecting apoptosis. We subsequently blocked hippo signaling with verteporfin and found that verteporfin application decreased the number of migrating (63%) and invading (69%) cells, respectively. We further found that Cyr61 declined following TAZ down-regulation. Moreover, TAZ negatively correlates with melanoma patient’s overall survival. Our data proved that TAZ contributed to MM metastasis, which might be a potential therapeutic target in the future.

1 Introduction

Malignant melanoma (MM) is a tumor originating from neural crest melanocytes and is characterized by rapid progression, high invasiveness, and is prone to distant metastasis [1]. Approximately 3% of MM patients lack an identifiable primary, which is also named melanoma of unknown primary (MUP). This rare MM remains biologically ill defined. Recent studies have shown that MUP patients appear to have a better prognosis than melanoma of known primary (MKP) patients, which is possibly due to higher immunogenicity as reflected in the immunologically mediated primary site regression [2]. Tumor metastasis is a significant contributing factor to the high mortality rate and the poor quality of life of advanced MM patients [3]. In China, the incidence of melanoma is increasing, with more than 10,000 new cases each year. Terminal MM patients have a poor prognosis with a median survival of only 6 months and a 5-year survival rate of less than 15%, which is due to the high metastasis rates of MM [4]. Thus, the lack of understanding of the mechanism underlying melanoma metastasis has hindered treatment for many years. With the development of molecular biology technology and MM-related molecular biology research, targeted therapies (BRAF inhibitors, KIT inhibitors, bevacizumab, and MEK inhibitors) have been slowly implemented in clinical trials, which have been approved by the US Food and Drug Administration (FDA) for the treatment of MM. However, there is still no drug targeting hippo signaling pathway.

The hippo signaling pathway is a series of evolutionarily conserved protein kinase cascades. It was first discovered in Drosophila melanogaster and has a similar signal transduction pathway in human cells [5]. The human homologous proteins are MST1/2, WW45, Lats, Mob1, Yes-associated protein (YAP), and its paralog, transcriptional coactivator with PDZ-binding motif (TAZ). In the hippo signaling pathway, MST1/2 binds to WW45 and phosphorylates Lats. Then, Lats binds to Mob1 and co-phosphorylates YAP/TAZ, which is inactivated after phosphorylation and inhibits the expression of downstream factors such as CTGF, Birc5, and Cyr61. Otherwise, YAP/TAZ translocates to the nucleus from the cytoplasm, where it binds the transcriptional co-activator TEADs, resulting in the corresponding biological effects [6]. The hippo signaling pathway plays an essential role in the regulation of cell growth, apoptosis, and tissue size. YAP/TAZ is the key downstream effector of the hippo signaling pathway. Abnormal expression of the core element of the hippo signaling pathway is closely related to the occurrence and development of tumors, which can cause a series of malignant biological behaviors such as proliferation, invasion, metastasis, and apoptosis escape of tumor cells [7,8]. The abnormal expression of YAP/TAZ exists in a variety of tumors, such as gastric cancer, prostate cancer, glioma, and melanoma [7,911]. Particularly, YAP has been proven to be an oncogene in MM. In 2020, Zhang et al. proved that YAP promoted the invasion of melanoma cells by targeting AXL, THBS1, and Cyr61 [12].

Few systematic research has been performed on TAZ, also called WW Domain Containing Transcription Regulator 1 (WWTR1) in MM, which is the paralog of YAP in the hippo signaling pathway. In recent years, TAZ has increasingly been recognized as an important transcription factor in human tumors. High TAZ expression has been found in a variety of human solid tumors, such as breast cancer, liver carcinomas, and glioma [9,13,14]. However, the role of TAZ in human MM has not been fully elucidated. Therefore, exploring the specific mechanism of TAZ in MM is of great significance for the molecular targeted therapy of MM. This article introduces TAZ and its role in MM tumorigenesis.

2 Materials and methods

2.1 Genomics analysis

Gene expression and overall survival (OS) analysis was performed on the R2 Microarray Analysis and Visualization platform (http://r2.amc.nl). Data on cutaneous melanoma and uveal melanoma were obtained from The Cancer Genome Atlas (TCGA). Melanoma cell lines were hybridized to Affymetrix Hu133_Plus 2 oligo arrays [15]. The cutoff values for the Kaplan–Meier analysis were determined using the online R2 microarray platform algorithm and were used to separate the high and low expression groups of genes. The expression cutoff for cutaneous melanoma was 434.5735 and that of uveal melanoma was 5.32. Informed consent has been obtained from all individuals included in this study according to the R2 Microarray Analysis and Visualization platform.

2.2 Cell culture

Human melanoma cell line A375 was provided by The Comprehensive Cancer Centre of Drum Tower Hospital. A375 cells were cultured in Dulbecco’s modified Eagle’s medium (Dulbecco’s modified eagle medium [DMEM], Life Technologies, Canada) supplemented with 10% fetal bovine serum (FBS, PAA Laboratories, Canada) and grown under 37°C, 5% CO2, and saturated humidity. When the culture reached the logarithmic growth phase and covered 90% of the flask bottom, the cells were passaged once. Subsequently, cells were transfected with non-targeting control or gene-specific siRNA using lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s instructions for small-interfering RNA (siRNA)-mediated downregulation. Three distinct, non-overlapping siRNA oligonucleotides targeting TAZ were as below (Control siRNA: AATTGTCCGAACGTGTCACGT; siTAZ: GGAUACAGGAGAAAACGCA; siTAZ2: AAACACCCAUGAACAUCAA; siTAZ3: AGGUACUUCCUCAAUCACA) [16,17].

2.3 Quantitative PCR (qPCR)

A375 cells were pretreated with siControl or siTAZ as described before. RNA was extracted from A375 melanoma cells using TRIzol reagent (Invitrogen, Carlsbad, CA) based on the protocol provided by the manufacturer. The cDNA library was generated by using a First-strand cDNA Kit (Roche Diagnostics). FastStart Universal SYBR Green Master was procured from Roche Diagnostics. After preparing the qPCR reaction solution, a real-time quantitative PCR machine (Applied Biosystems, USA) was used for amplification. The primers for human samples were: YAP-forward (F) 5′-cacagctcagcatcttcgac-3′, YAP-reverse (R) 5′-tattctgctgcactggtgga-3′; TAZ-forward (F) 5′-ggctgggagatgaccttcac-3′, TAZ-reverse (R) 5′-ctgagtggggtggttctgct-3′; GAPDH-forward (F): 5′-tgggtgtgaaccatgagaagtatg-3′, GAPDH-reverse (R), 5′-ggtgcaggaggcattgct-3′. The data were processed by the 2−△△Ct method and normalized based on the expression of GAPDH.

2.4 Western blotting

A375 cells were pretreated with siControl or siTAZ as previously described. Protein lysates of A375 cells were quantified using the BCA Protein Assay Kit (Keygen) and an equal amount of protein samples (100 μg) was separated by SDS polyacrylamide gel electrophoresis SDS-PAGE (10%) and transferred to polyvinylidene difluoride membrane (Bio-Rad, USA) at 100 V constant pressure. The primary antibodies were added and incubated overnight at 4°C (<16 h). The following antibodies were used: mouse monoclonal anti-TAZ (Santa Cruz, TX, USA), rabbit monoclonal antiYAP (Abcam, Cambridge, MA, USA), mouse monoclonal anti-Cyr61 (Santa Cruz, TX, USA), mouse monoclonal anti-CTGF (Santa Cruz, TX, USA), mouse monoclonal anti-Birc5 (Santa Cruz, TX, USA), and anti-GAPDH (Cell Signaling, MA, USA). After incubation with horseradish peroxidase (HRP)-conjugated anti-rabbit or anti-mouse secondary antibodies (Abcam, Cambridge, MA, USA), the blot was developed with ECL substrate ECL reagent (Millipore, USA). The expression of the target protein was quantified by analyzing the density of the target band using Image-Pro Plus Software (Media Cybernetics, Inc, Rockville, MD, USA). All values were normalized to GAPDH.

2.5 Cell migration and invasion assays

A375 cells were pretreated with siControl or siTAZ as previously described. For Matrigel invasion assays, the Matrigel was dissolved on ice overnight and then diluted with DMEM medium at a ratio of 1:5. Then, the Matrigel was spread into the chamber at 100 μL/well and solidified at 37°C overnight. Cells in the logarithmic growth phase were collected and seeded in the chambers at a density of 5 × 104 cells/200 μL per well. 500 μL DMEM containing 10% FBS was added to the lower chamber in a 24-well culture plate (Corning, USA). After the cells adhered to the Transwell insert, the upper chamber was replaced with serum-free DMEM. All groups were cultured in triplicate at 37°C, 5% CO2 in a humidified incubator. After 48 h incubation for the migration assay and 72 h incubation for the invasion assay, the chambers were removed and stained with 0.1% crystal violet for 15 min. The samples were washed with phosphate-buffered solution (PBS) and the upper chamber surface was gently wiped with a cotton swab. The invading cells were observed under a microscope (Leica, Germany) with a 20× objective in six random fields. Then, cell counting was performed to compare the migration and invasion index of the two groups of cells. The migration and invasion index was indicated to the number of cells divided by the mean of cells. Experiments were performed at least three times.

2.6 Cell proliferation analysis

A375 cells were pretreated with siControl or siTAZ as previously described. Cells in the logarithmic growth phase were collected and seeded into 96-well plates at a density of 5 × 103 cells/well. After the adhesion of melanoma cells, the culture medium was replaced with serum-free DMEM. The experiments were carried out in triplicate. Subsequently, the plate was cultured in an incubator at 37°C and 5% CO2. 10 μL CCK8 working solution was added to each well before evaluation at 24, 48, and 72 h. After 2 h incubation, the absorbance value of each well was measured at a wavelength of 450 nm by the microplate reader. The standard curve was generated according to the manufacturer’s instructions (Beyotime Biotechnology).

2.7 Cell apoptosis

A375 cells were pretreated with siControl or siTAZ as described before. Cells in the logarithmic growth phase were collected and seeded into six-well plates at 15 × 105 cells/well. After adhesion of the cells at 37°C, 5% CO2 in a humidified incubator, the culture medium was replaced by serum-free DMEM. The control group underwent the same treatment. After 6 h, the culture medium was replaced with DMEM containing 5% FBS. After 48 h, cells were harvested and gently washed twice with PBS. Annexin V/PI was added to each sample for staining according to the manufacturer’s instructions (BD company apoptosis kit) and then incubated at room temperature for 15 min before detection by using a BD FACS Aria™ II flow cytometer.

2.8 Immunofluorescence

A375 cells were pretreated with siControl or siTAZ as previously described. The cells were fixed with 4% paraformaldehyde diluted in PBS for 15 min at room temperature, perforated with 0.1% Triton X-100 diluted in PBS for 10 min at room temperature, and blocked with 1% bovine serum albumin for 60 min at room temperature. The primary antibodies mouse monoclonal anti-TAZ (Santa Cruz, TX, USA) were added to the slides and incubated at 4°C overnight. The slides were incubated at room temperature for 1 h with the corresponding secondary antibodies (Abcam, Cambridge, MA, USA), followed by DAPI staining. The images were taken under an immunofluorescence microscope (Leica, Germany). Signal intensity and colocalization were analyzed using ImageJ software.

2.9 Statistical analysis

The experimental results were statistically analyzed by SPSS16.0 (SPSS, Inc., Chicago, IL). Data are presented as mean ± standard error of the mean (SEM). The Student’s t-test was used for comparison between groups. The Kaplan–Meier method was used for survival analysis, and the Log-rank test was used to compare the survival time between the two groups. In this study, statistical significance was defined by *P < 0.05, **P < 0.01, ***P < 0.001.

3 Results

3.1 Expression of the hippo signaling pathway in melanoma

To investigate the role of hippo signaling in MM, the mRNA expression of hippo core elements was first analyzed in 473 melanoma tissues and 63 melanoma cell lines on the R2 platform. In human melanoma tissue samples, the median expression of TAZ (5.4) was found to be similar to that of YAP (5.5) (Figure 1a). However, in MM cell lines, a higher median expression of TAZ (10.8) was observed compared to YAP (9.5) (Figure 1b). Subsequently, the A375 cell line was used for further validation. The mRNA and protein expression levels of TAZ were indeed higher than those of YAP in the A375 cell line (Figure 1c and d). Therefore, A375 cells were used to further investigate the role of TAZ in MM.

Figure 1 
                  The expression of hippo signaling pathway in melanoma. (a) and (b) TCGA database shows the mRNA expression of hippo signaling pathway in human MM samples and MM cell lines. (c) and (d) The mRNA and protein expression level of TAZ was detected by qPCR and Western blot in A375 cell line.
Figure 1

The expression of hippo signaling pathway in melanoma. (a) and (b) TCGA database shows the mRNA expression of hippo signaling pathway in human MM samples and MM cell lines. (c) and (d) The mRNA and protein expression level of TAZ was detected by qPCR and Western blot in A375 cell line.

3.2 The role of TAZ in melanoma

siRNA was used to down-regulate the expression of TAZ to investigate the role of TAZ in melanoma. The qPCR results showed that siTAZ significantly suppressed the mRNA expression of TAZ (P < 0.05) in melanoma A375 cells (Figure 2a). Therefore, siTAZ was selected for subsequent experiments. Western blot analysis showed that SiTAZ treatment resulted in a significant decline in TAZ protein expression (43%, P < 0.05) (Figure 2b). Furthermore, the metastatic effect of TAZ was investigated by migration and invasion assays in A375 cells. The Transwell assay revealed a 70% decrease in the number of migration cells in the TAZ down-regulated group compared with the control group (P < 0.001) (Figure 2c). We also found a 74% decrease in the number of invasion cells in the TAZ down-regulation group compared with the control group (P < 0.01) (Figure 2d). Moreover, down-regulation of TAZ inhibited the proliferation of melanoma cells in the proliferation assay (P < 0.01) (Figure 2e). However, no significant change in cell apoptosis was observed after TAZ down-regulation (Figure 2f). These experiments all indicated that TAZ plays a vital role in melanoma tumorigenesis, especially metastasis.

Figure 2 
                  Down-regulation of TAZ inhibited the migration, invasion, and proliferation of melanoma cells. (a) The mRNA expression of TAZ in the group of control (Control siRNA), siTAZ, siTAZ2, and siTAZ3. (b) The protein expression of TAZ in the group of control and siTAZ. (c) After the down-regulation of TAZ, the number of migration cells was decreased compared with the control group (**P < 0.001). (d) After the down-regulation of TAZ, the number of invasion cells was decreased compared with the control group (**P < 0.01). (e) In the proliferation assay, cell proliferation was inhibited in the TAZ knockdown group compared with the control group at 72 h (**P < 0.01). (f) There was no significant difference in apoptosis between the siTAZ group and the control group.
Figure 2

Down-regulation of TAZ inhibited the migration, invasion, and proliferation of melanoma cells. (a) The mRNA expression of TAZ in the group of control (Control siRNA), siTAZ, siTAZ2, and siTAZ3. (b) The protein expression of TAZ in the group of control and siTAZ. (c) After the down-regulation of TAZ, the number of migration cells was decreased compared with the control group (**P < 0.001). (d) After the down-regulation of TAZ, the number of invasion cells was decreased compared with the control group (**P < 0.01). (e) In the proliferation assay, cell proliferation was inhibited in the TAZ knockdown group compared with the control group at 72 h (**P < 0.01). (f) There was no significant difference in apoptosis between the siTAZ group and the control group.

To further investigate the mechanism of TAZ underlying melanoma cell metastasis, IF was first used to examine the localization of TAZ. We found that TAZ in cytoplasm and nucleus showed no big difference after TAZ down-regulation (Figure 3a). Verteporfin (VP), a YAP/TAZ inhibitor, effectively disrupted the YAP-TEAD interaction. Subsequently, the hippo signaling pathway was blocked with VP, and the results showed that VP treatment decreased the number of migrating A375 cells (63%, P < 0.01) (Figure 3b and c) and invading A375 cells (69%, P < 0.01) (Figure 3d and e). In the VP + siTAZ group, the number of migration and invasion cells decreased by 67% and 68%, respectively (Figure 3b–e). Compared with the siTAZ group, the VP + siTAZ group had no significant effect on cell metastasis (Figure 3b–e). In addition, the representative target genes of TAZ were examined after down-regulation in A375, revealing declined protein levels of Cyr61 (Figure 3f), which indicated that down-regulation of TAZ might inhibit tumor cell invasion and migration through Cyr61.

Figure 3 
                  TAZ regulates melanoma metastasis through its downstream target gene. (a) IF was used to detect TAZ localization in A375 cells. (b and c) The number of migration cells was presented in the group of control, siTAZ, VP, and siTAZ + VP. (d and e) The number of invasion cells was presented in the group of control, siTAZ, VP, and siTAZ + VP. (f) The protein expression of Cyr61, CTGF, and Birc5 in the group of control and siTAZ.
Figure 3

TAZ regulates melanoma metastasis through its downstream target gene. (a) IF was used to detect TAZ localization in A375 cells. (b and c) The number of migration cells was presented in the group of control, siTAZ, VP, and siTAZ + VP. (d and e) The number of invasion cells was presented in the group of control, siTAZ, VP, and siTAZ + VP. (f) The protein expression of Cyr61, CTGF, and Birc5 in the group of control and siTAZ.

Both cutaneous melanoma and uveal melanoma originate from human melanocytes. Uveal melanoma is the most common primary intraocular malignant tumor in adults, accounting for 85% of all ocular melanomas. This disease is consistent with cutaneous melanoma in its high metastatic, refractory, and low survival rates. Therefore, we compared cutaneous melanoma and uveal melanoma. The R2 Microarray Analysis and Visualization Platform (http://r2.amc.nl) was used to further study the clinical significance of TAZ in melanoma patients. Based on the analysis of cutaneous melanoma, high TAZ expression was associated with lower OS (Figure 4a, TCGA: high, n = 350; low, n = 118; P = 0.396). Likewise, high TAZ expression was also associated with lower OS in uveal melanoma (Figure 4b, TCGA: high, n = 35; low, n = 33; P < 0.05), indicating that TAZ might have potential diagnostic, treatment, and prognosis applications in MM.

Figure 4 
                  TAZ negatively correlates with melanoma patient’s OS. Association of TAZ expression with OS was presented by Kaplan–Meier plotter based on TCGA database of tumor skin cutaneous melanoma ((a) high, n = 350; low, n = 118; P = 0.396) and tumor uveal melanoma ((b) high, n = 35; low, n = 33; P < 0.05). The expression cutoff of tumor skin cutaneous melanoma was 434.5735 and that of tumor uveal melanoma was 5.32.
Figure 4

TAZ negatively correlates with melanoma patient’s OS. Association of TAZ expression with OS was presented by Kaplan–Meier plotter based on TCGA database of tumor skin cutaneous melanoma ((a) high, n = 350; low, n = 118; P = 0.396) and tumor uveal melanoma ((b) high, n = 35; low, n = 33; P < 0.05). The expression cutoff of tumor skin cutaneous melanoma was 434.5735 and that of tumor uveal melanoma was 5.32.

4 Discussion

In the past few years, the hippo signaling pathway has been widely explored in melanoma, but its precise mechanism remains to be elucidated [18]. This article found that the mutation or deletion of TAZ in the protein kinase cascade chain may affect the occurrence and development of melanoma.

The hippo pathway is an important signaling pathway that controls homeostasis. However, it has an inherent drawback: the mutation of a single gene can lead to dysregulation of the pathway and promote the occurrence of tumors. For organisms with a short life span, pathway disorders have no obvious consequences; but for organisms with a long life span, where cells are in constant renewal and complement, pathway disorders exert significant negative effects [6]. Therefore, it is important to clarify the regulation of the hippo pathway and TAZ in the development of MM.

During the growth process of tumors, after multiple divisions and proliferation, cells exhibit molecular biology or genetic changes, resulting in differences in tumor growth rate, invasion ability, drug sensitivity, prognosis, and other aspects. There are both oncogenic and non-oncogenic cell subpopulations in tumor tissue, reflecting the heterogeneity of tumor tissue. Normally, the human melanoma tissue is often a mixture, which includes melanoma cells, endothelial cells, fibroblasts, and so on, which can grow at the same time with the tumor cells. However, melanoma cell line is a type of cell. Thus, the expression levels of different genes differ between melanoma samples and cell lines. To explore whether TAZ plays a role in the tumorigenesis of melanoma, we used the TCGA database to predict its expression in human MM tissue samples (TCGA) and cell lines [15]. The A375 cell line was used to validate the expression of TAZ. Our results showed high TAZ expression in human MM tissue samples. In addition, the mRNA and protein expression of TAZ was higher than that of YAP in melanoma cell line A375. This finding is in accordance with Jason’s (2019) findings, which showed a higher TAZ protein expression than YAP in melanoma cell lines, such as A375, SKMEL5, and mel-537 [19]. The findings suggest that TAZ may play an important role in the occurrence and development of MM.

Moreover, the role of TAZ in melanoma tumorigenesis was explored. To study the effects of TAZ on melanoma metastasis, a Transwell assay was used to clarify the effect of TAZ on tumor cell invasion and migration. Our results showed a significant reduction in the invasion and migration ability of MM cells after TAZ down-regulation compared with the control group, indicating that TAZ can promote melanoma metastasis. Flore Nallet-Staub et al. also demonstrated that TAZ increases the invasiveness of melanoma by down-regulating TAZ in the 1205Lu melanoma cell line, which suppressed melanoma lung metastases in a mouse model [20]. In addition, Yap, the homolog of TAZ, has been confirmed to promote cell invasion in A375 [21], which is also in accordance with the present results. Furthermore, previous studies have reported that TAZ promotes cell invasion and migration in solid tumors and could be a reliable molecular target for gene therapy of MM. Surprisingly, TAZ was also found to boost melanoma cell proliferation without affecting cell apoptosis, which requires further research.

Our results showed that TAZ down-regulation could significantly inhibit the invasion and migration of MM cells. However, the mechanism underlying TAZ-mediated melanoma metastasis remains unclear. The Hippo signaling pathway comprises a series of protein kinase cascades, and a TAZ-dependent pathway in MM could provide a plausible explanation for this study’s findings. The results of this study suggest that down-regulation of TAZ can regulate the expression of Cyr61 and affect its downstream signaling, thereby affecting the invasion and migration of MM. Our results match those observed in earlier studies. For example, inhibition of Cyr61 prevented cell migration and invasion in melanoma A375 and B16 cell lines [22]. Long noncoding RNA CPS1-IT1 mediated melanoma cell migration and invasion by reducing Cyr61 expression [23]. Hence, a TAZ-Cyr61 axis could be hypothesized to participate in melanoma metastasis. Nevertheless, MM dissemination is an active process involving multiple steps, including the growth of transformed cells, cell dissociation of solid tumors, invasion of surrounding tissues, penetration of blood vessels, survival and accumulation in the circulation, penetration of the wall of bleeding vessels, entry into surrounding tissues, continued growth, and finally the formation of metastatic cancer [24]. Tumor invasion and metastasis can be divided into two aspects: ECM infiltration and vascular dissemination, and tumor cell homing and colonization [24,25]. Future studies should investigate how the TAZ-Cyr61 axis contributes to the invasion process.

Since YAP/TAZ is widely activated in MM, it is of great significance in the occurrence and development of tumors and shows great therapeutic potential [12]. However, due to technical limitations and the complex self-regulatory function of YAP/TAZ, it cannot be directly targeted to treat tumors [6]. The transcriptional co-regulators YAP/TAZ mainly pair with the TEAD transcription factor family to initiate gene expression signatures that are important in cancer development, progression, and metastasis [26]. Thus, YAP/TAZ-TEAD inhibition represents a promising novel cancer treatment option. It is exciting that many drugs that have entered the clinic restrict and several novel YAP/TAZ inhibitors are currently being developed [8,26]. In this study, the application of verteporfin (VP) impaired melanoma cell migration and invasion, supporting the role of the TAZ-Cyr61 axis in melanoma metastasis.

Gene therapy for MM is a current research hotspot due to the poor response of MM to traditional surgical resection, chemotherapy, and radiotherapy [27,28]. Novel therapies that have been approved by the FDA and the EMA are including immune checkpoint inhibitors, oncolytic immunotherapies, and targeted therapies (BRAF and MEK inhibitors). DNA markers such as BRAF and NRAS can predict response to target therapy and provide better options for patients. ctDNA and miRNA or lncRNA provide vital insights into the genetics of tumors, contribute to the understanding of disease pathophysiology, and have the great advantage of continuous, noninvasive sampling for disease monitoring [29]. The increase or loss of TAZ expression in MM may interfere with the metastasis of MM by regulating the hippo signaling pathway. At present, the treatment of advanced MM still mainly relies on immunotherapy and targeted therapy. In future studies, hippo intervention will be considered to verify the role of hippo in MM metastasis and to evaluate the potential of YAP/TAZ as a therapeutic target for advanced MM patients. Although the research on the hippo signaling pathway is still in its preliminary stage, YAP/TAZ is expected to become a marker for the early prediction of MM metastasis, which is helpful for the early diagnosis and treatment of MM.


# Hao Zhang and Leijing Tu contributed equally to this work.


  1. Funding information: The financial supports for this article were Entrepreneurship and Innovation Program of Jiangsu Province (JSSSBS20211531) and Nanjing Science and Technology Innovation Plan (NJKJCX2022B42).

  2. Author contributions: Hao Zhang performed the study, analyzed the data, and drafted the manuscript. Leijing Tu and Zhouji Ma performed the study and analyzed the data. Yue Lin revised the manuscript. Corresponding author Qian Tan contributed to the conceptual design of the study, provided funding support, and critically revised the article.

  3. Conflict of interest: Authors state no conflict of interest.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Schadendorf D, van Akkooi ACJ, Berking C, Griewank KG, Gutzmer R, Hauschild A, et al. Melanoma. Lancet. 2018;392(10151):971–84.10.1016/S0140-6736(18)31559-9Suche in Google Scholar PubMed

[2] Boussios S, Rassy E, Samartzis E, Moschetta M, Sheriff M, Perez-Fidalgo JA, et al. Melanoma of unknown primary: New perspectives for an old story. Crit Rev Oncol/Hematol. 2021;158:103208.10.1016/j.critrevonc.2020.103208Suche in Google Scholar PubMed

[3] Karras P, Bordeu I, Pozniak J, Nowosad A, Pazzi C, Van Raemdonck N, et al. A cellular hierarchy in melanoma uncouples growth and metastasis. Nature. 2022;610(7930):190–8.10.1038/s41586-022-05242-7Suche in Google Scholar PubMed

[4] Wu Y, Wang Y, Wang L, Yin P, Lin Y, Zhou M. Burden of melanoma in China, 1990–2017: Findings from the 2017 global burden of disease study. Int J Cancer. 2020;147(3):692–701.10.1002/ijc.32764Suche in Google Scholar PubMed

[5] Ma S, Meng Z, Chen R, Guan KL. The Hippo pathway: Biology and pathophysiology. Annu Rev Biochem. 2019;88:577–604.10.1146/annurev-biochem-013118-111829Suche in Google Scholar PubMed

[6] Moya IM, Halder G. Hippo-YAP/TAZ signalling in organ regeneration and regenerative medicine. Nat Rev Mol Cell Biol. 2019;20(4):211–26.10.1038/s41580-018-0086-ySuche in Google Scholar PubMed

[7] Dey A, Varelas X, Guan KL. Targeting the Hippo pathway in cancer, fibrosis, wound healing and regenerative medicine. Nat Rev Drug Discovery. 2020;19(7):480–94.10.1038/s41573-020-0070-zSuche in Google Scholar PubMed PubMed Central

[8] Li HL, Li QY, Jin MJ, Lu CF, Mu ZY, Xu WY, et al. A review: Hippo signaling pathway promotes tumor invasion and metastasis by regulating target gene expression. J Cancer Res Clin Oncol. 2021;147(6):1569–85.10.1007/s00432-021-03604-8Suche in Google Scholar PubMed

[9] Castellan M, Guarnieri A, Fujimura A, Zanconato F, Battilana G, Panciera T, et al. Single-cell analyses reveal YAP/TAZ as regulators of stemness and cell plasticity in Glioblastoma. Nat Cancer. 2021;2(2):174–88.10.1038/s43018-020-00150-zSuche in Google Scholar PubMed PubMed Central

[10] Lee Y, Finch-Edmondson M, Cognart H, Zhu B, Song H, Low BC, et al. Common and unique transcription signatures of YAP and TAZ in gastric cancer cells. Cancers. 2020;12(12):3667.10.3390/cancers12123667Suche in Google Scholar PubMed PubMed Central

[11] Li Q, Wang M, Hu Y, Zhao E, Li J, Ren L, et al. MYBL2 disrupts the Hippo-YAP pathway and confers castration resistance and metastatic potential in prostate cancer. Theranostics. 2021;11(12):5794–812.10.7150/thno.56604Suche in Google Scholar PubMed PubMed Central

[12] Zhang X, Yang L, Szeto P, Abali GK, Zhang Y, Kulkarni A, et al. The Hippo pathway oncoprotein YAP promotes melanoma cell invasion and spontaneous metastasis. Oncogene. 2020;39(30):5267–81.10.1038/s41388-020-1362-9Suche in Google Scholar PubMed

[13] Pobbati AV, Hong W. A combat with the YAP/TAZ-TEAD oncoproteins for cancer therapy. Theranostics. 2020;10(8):3622–35.10.7150/thno.40889Suche in Google Scholar PubMed PubMed Central

[14] Gao Y, Chen X, He Q, Gimple RC, Liao Y, Wang L, et al. Adipocytes promote breast tumorigenesis through TAZ-dependent secretion of Resistin. Proc Natl Acad Sci U S A. 2020;117(52):33295–304.10.1073/pnas.2005950117Suche in Google Scholar PubMed PubMed Central

[15] Johansson P, Pavey S, Hayward N. Confirmation of a BRAF mutation-associated gene expression signature in melanoma. Pigment Cell Res. 2007;20(3):216–21.10.1111/j.1600-0749.2007.00375.xSuche in Google Scholar PubMed

[16] Qin Z, Xia W, Fisher GJ, Voorhees JJ, Quan T. YAP/TAZ regulates TGF-beta/Smad3 signaling by induction of Smad7 via AP-1 in human skin dermal fibroblasts. Cell Commun Signal. 2018;16(1):18.10.1186/s12964-018-0232-3Suche in Google Scholar PubMed PubMed Central

[17] Tian T, Li A, Lu H, Luo R, Zhang M, Li Z. TAZ promotes temozolomide resistance by upregulating MCL-1 in human glioma cells. Biochem Biophys Res Commun. 2015;463(4):638–43.10.1016/j.bbrc.2015.05.115Suche in Google Scholar PubMed

[18] Jia J, Wang Y, Mo X, Chen D. Role of yes-associated protein in psoriasis and skin tumor pathogenesis. J Pers Med. 2022;12(6):978.10.3390/jpm12060978Suche in Google Scholar PubMed PubMed Central

[19] Lui JW, Xiao S, Ogomori K, Hammarstedt JE, Little EC, Lang D. The efficiency of verteporfin as a therapeutic option in pre-clinical models of melanoma. J Cancer. 2019;10(1):1–10.10.7150/jca.27472Suche in Google Scholar PubMed PubMed Central

[20] Nallet-Staub F, Marsaud V, Li L, Gilbert C, Dodier S, Bataille V, et al. Pro-invasive activity of the Hippo pathway effectors YAP and TAZ in cutaneous melanoma. J Investig Dermatol. 2014;134(1):123–32.10.1038/jid.2013.319Suche in Google Scholar PubMed PubMed Central

[21] Zhao B, Xie J, Zhou X, Zhang L, Cheng X, Liang C. YAP activation in melanoma contributes to anoikis resistance and metastasis. Exp Biol Med. 2021;246(8):888–96.10.1177/1535370220977101Suche in Google Scholar PubMed PubMed Central

[22] Chen J, Zhou X, Yang J, Sun Q, Liu Y, Li N, et al. Circ-GLI1 promotes metastasis in melanoma through interacting with p70S6K2 to activate Hedgehog/GLI1 and Wnt/beta-catenin pathways and upregulate Cyr61. Cell Death Dis. 2020;11(7):596.10.1038/s41419-020-02799-xSuche in Google Scholar PubMed PubMed Central

[23] Zhou X, Rao Y, Sun Q, Liu Y, Chen J, Bu W. Long noncoding RNA CPS1-IT1 suppresses melanoma cell metastasis through inhibiting Cyr61 via competitively binding to BRG1. J Cell Physiol. 2019;234(12):22017–27.10.1002/jcp.28764Suche in Google Scholar PubMed

[24] Bakir B, Chiarella AM, Pitarresi JR, Rustgi AK. EMT, MET, plasticity, and tumor metastasis. Trends Cell Biol. 2020;30(10):764–76.10.1016/j.tcb.2020.07.003Suche in Google Scholar PubMed PubMed Central

[25] Kudchadkar RR, Lowe MC, Khan MK, McBrien SM. Metastatic melanoma. CA A Cancer J Clin. 2020;70(2):78–85.10.3322/caac.21599Suche in Google Scholar PubMed

[26] Gibault F, Sturbaut M, Bailly F, Melnyk P, Cotelle P. Targeting Transcriptional Enhanced Associate Domains (TEADs). J Med Chem. 2018;61(12):5057–72.10.1021/acs.jmedchem.7b00879Suche in Google Scholar PubMed

[27] Mishra H, Mishra PK, Ekielski A, Jaggi M, Iqbal Z, Talegaonkar S. Melanoma treatment: From conventional to nanotechnology. J Cancer Res Clin Oncol. 2018;144(12):2283–302.10.1007/s00432-018-2726-1Suche in Google Scholar PubMed

[28] Zawit M, Swami U, Awada H, Arnouk J, Milhem M, Zakharia Y. Current status of intralesional agents in treatment of malignant melanoma. Ann Transl Med. 2021;9(12):1038.10.21037/atm-21-491Suche in Google Scholar PubMed PubMed Central

[29] Revythis A, Shah S, Kutka M, Moschetta M, Ozturk MA, Pappas-Gogos G, et al. Unraveling the wide spectrum of melanoma biomarkers. Diagnostics. 2021;11(8):1341.10.3390/diagnostics11081341Suche in Google Scholar PubMed PubMed Central

Received: 2023-02-18
Revised: 2023-05-03
Accepted: 2023-05-17
Published Online: 2023-06-21

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Biomedical Sciences
  2. Systemic investigation of inetetamab in combination with small molecules to treat HER2-overexpressing breast and gastric cancers
  3. Immunosuppressive treatment for idiopathic membranous nephropathy: An updated network meta-analysis
  4. Identifying two pathogenic variants in a patient with pigmented paravenous retinochoroidal atrophy
  5. Effects of phytoestrogens combined with cold stress on sperm parameters and testicular proteomics in rats
  6. A case of pulmonary embolism with bad warfarin anticoagulant effects caused by E. coli infection
  7. Neutrophilia with subclinical Cushing’s disease: A case report and literature review
  8. Isoimperatorin alleviates lipopolysaccharide-induced periodontitis by downregulating ERK1/2 and NF-κB pathways
  9. Immunoregulation of synovial macrophages for the treatment of osteoarthritis
  10. Novel CPLANE1 c.8948dupT (p.P2984Tfs*7) variant in a child patient with Joubert syndrome
  11. Antiphospholipid antibodies and the risk of thrombosis in myeloproliferative neoplasms
  12. Immunological responses of septic rats to combination therapy with thymosin α1 and vitamin C
  13. High glucose and high lipid induced mitochondrial dysfunction in JEG-3 cells through oxidative stress
  14. Pharmacological inhibition of the ubiquitin-specific protease 8 effectively suppresses glioblastoma cell growth
  15. Levocarnitine regulates the growth of angiotensin II-induced myocardial fibrosis cells via TIMP-1
  16. Age-related changes in peripheral T-cell subpopulations in elderly individuals: An observational study
  17. Single-cell transcription analysis reveals the tumor origin and heterogeneity of human bilateral renal clear cell carcinoma
  18. Identification of iron metabolism-related genes as diagnostic signatures in sepsis by blood transcriptomic analysis
  19. Long noncoding RNA ACART knockdown decreases 3T3-L1 preadipocyte proliferation and differentiation
  20. Surgery, adjuvant immunotherapy plus chemotherapy and radiotherapy for primary malignant melanoma of the parotid gland (PGMM): A case report
  21. Dosimetry comparison with helical tomotherapy, volumetric modulated arc therapy, and intensity-modulated radiotherapy for grade II gliomas: A single‑institution case series
  22. Soy isoflavone reduces LPS-induced acute lung injury via increasing aquaporin 1 and aquaporin 5 in rats
  23. Refractory hypokalemia with sexual dysplasia and infertility caused by 17α-hydroxylase deficiency and triple X syndrome: A case report
  24. Meta-analysis of cancer risk among end stage renal disease undergoing maintenance dialysis
  25. 6-Phosphogluconate dehydrogenase inhibition arrests growth and induces apoptosis in gastric cancer via AMPK activation and oxidative stress
  26. Experimental study on the optimization of ANM33 release in foam cells
  27. Primary retroperitoneal angiosarcoma: A case report
  28. Metabolomic analysis-identified 2-hydroxybutyric acid might be a key metabolite of severe preeclampsia
  29. Malignant pleural effusion diagnosis and therapy
  30. Effect of spaceflight on the phenotype and proteome of Escherichia coli
  31. Comparison of immunotherapy combined with stereotactic radiotherapy and targeted therapy for patients with brain metastases: A systemic review and meta-analysis
  32. Activation of hypermethylated P2RY1 mitigates gastric cancer by promoting apoptosis and inhibiting proliferation
  33. Association between the VEGFR-2 -604T/C polymorphism (rs2071559) and type 2 diabetic retinopathy
  34. The role of IL-31 and IL-34 in the diagnosis and treatment of chronic periodontitis
  35. Triple-negative mouse breast cancer initiating cells show high expression of beta1 integrin and increased malignant features
  36. mNGS facilitates the accurate diagnosis and antibiotic treatment of suspicious critical CNS infection in real practice: A retrospective study
  37. The apatinib and pemetrexed combination has antitumor and antiangiogenic effects against NSCLC
  38. Radiotherapy for primary thyroid adenoid cystic carcinoma
  39. Design and functional preliminary investigation of recombinant antigen EgG1Y162–EgG1Y162 against Echinococcus granulosus
  40. Effects of losartan in patients with NAFLD: A meta-analysis of randomized controlled trial
  41. Bibliometric analysis of METTL3: Current perspectives, highlights, and trending topics
  42. Performance comparison of three scaling algorithms in NMR-based metabolomics analysis
  43. PI3K/AKT/mTOR pathway and its related molecules participate in PROK1 silence-induced anti-tumor effects on pancreatic cancer
  44. The altered expression of cytoskeletal and synaptic remodeling proteins during epilepsy
  45. Effects of pegylated recombinant human granulocyte colony-stimulating factor on lymphocytes and white blood cells of patients with malignant tumor
  46. Prostatitis as initial manifestation of Chlamydia psittaci pneumonia diagnosed by metagenome next-generation sequencing: A case report
  47. NUDT21 relieves sevoflurane-induced neurological damage in rats by down-regulating LIMK2
  48. Association of interleukin-10 rs1800896, rs1800872, and interleukin-6 rs1800795 polymorphisms with squamous cell carcinoma risk: A meta-analysis
  49. Exosomal HBV-DNA for diagnosis and treatment monitoring of chronic hepatitis B
  50. Shear stress leads to the dysfunction of endothelial cells through the Cav-1-mediated KLF2/eNOS/ERK signaling pathway under physiological conditions
  51. Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection
  52. Meta-analysis of the rs231775 locus polymorphism in the CTLA-4 gene and the susceptibility to Graves’ disease in children
  53. Cloning, subcellular localization and expression of phosphate transporter gene HvPT6 of hulless barley
  54. Coptisine mitigates diabetic nephropathy via repressing the NRLP3 inflammasome
  55. Significant elevated CXCL14 and decreased IL-39 levels in patients with tuberculosis
  56. Whole-exome sequencing applications in prenatal diagnosis of fetal bowel dilatation
  57. Gemella morbillorum infective endocarditis: A case report and literature review
  58. An unusual ectopic thymoma clonal evolution analysis: A case report
  59. Severe cumulative skin toxicity during toripalimab combined with vemurafenib following toripalimab alone
  60. Detection of V. vulnificus septic shock with ARDS using mNGS
  61. Novel rare genetic variants of familial and sporadic pulmonary atresia identified by whole-exome sequencing
  62. The influence and mechanistic action of sperm DNA fragmentation index on the outcomes of assisted reproduction technology
  63. Novel compound heterozygous mutations in TELO2 in an infant with You-Hoover-Fong syndrome: A case report and literature review
  64. ctDNA as a prognostic biomarker in resectable CLM: Systematic review and meta-analysis
  65. Diagnosis of primary amoebic meningoencephalitis by metagenomic next-generation sequencing: A case report
  66. Phylogenetic analysis of promoter regions of human Dolichol kinase (DOLK) and orthologous genes using bioinformatics tools
  67. Collagen changes in rabbit conjunctiva after conjunctival crosslinking
  68. Effects of NM23 transfection of human gastric carcinoma cells in mice
  69. Oral nifedipine and phytosterol, intravenous nicardipine, and oral nifedipine only: Three-arm, retrospective, cohort study for management of severe preeclampsia
  70. Case report of hepatic retiform hemangioendothelioma: A rare tumor treated with ultrasound-guided microwave ablation
  71. Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1α signaling
  72. Rare presentation of double-clonal Waldenström macroglobulinemia with pulmonary embolism: A case report
  73. Giant duplication of the transverse colon in an adult: A case report and literature review
  74. Ectopic thyroid tissue in the breast: A case report
  75. SDR16C5 promotes proliferation and migration and inhibits apoptosis in pancreatic cancer
  76. Vaginal metastasis from breast cancer: A case report
  77. Screening of the best time window for MSC transplantation to treat acute myocardial infarction with SDF-1α antibody-loaded targeted ultrasonic microbubbles: An in vivo study in miniswine
  78. Inhibition of TAZ impairs the migration ability of melanoma cells
  79. Molecular complexity analysis of the diagnosis of Gitelman syndrome in China
  80. Effects of maternal calcium and protein intake on the development and bone metabolism of offspring mice
  81. Identification of winter wheat pests and diseases based on improved convolutional neural network
  82. Ultra-multiplex PCR technique to guide treatment of Aspergillus-infected aortic valve prostheses
  83. Virtual high-throughput screening: Potential inhibitors targeting aminopeptidase N (CD13) and PIKfyve for SARS-CoV-2
  84. Immune checkpoint inhibitors in cancer patients with COVID-19
  85. Utility of methylene blue mixed with autologous blood in preoperative localization of pulmonary nodules and masses
  86. Integrated analysis of the microbiome and transcriptome in stomach adenocarcinoma
  87. Berberine suppressed sarcopenia insulin resistance through SIRT1-mediated mitophagy
  88. DUSP2 inhibits the progression of lupus nephritis in mice by regulating the STAT3 pathway
  89. Lung abscess by Fusobacterium nucleatum and Streptococcus spp. co-infection by mNGS: A case series
  90. Genetic alterations of KRAS and TP53 in intrahepatic cholangiocarcinoma associated with poor prognosis
  91. Granulomatous polyangiitis involving the fourth ventricle: Report of a rare case and a literature review
  92. Studying infant mortality: A demographic analysis based on data mining models
  93. Metaplastic breast carcinoma with osseous differentiation: A report of a rare case and literature review
  94. Protein Z modulates the metastasis of lung adenocarcinoma cells
  95. Inhibition of pyroptosis and apoptosis by capsaicin protects against LPS-induced acute kidney injury through TRPV1/UCP2 axis in vitro
  96. TAK-242, a toll-like receptor 4 antagonist, against brain injury by alleviates autophagy and inflammation in rats
  97. Primary mediastinum Ewing’s sarcoma with pleural effusion: A case report and literature review
  98. Association of ADRB2 gene polymorphisms and intestinal microbiota in Chinese Han adolescents
  99. Tanshinone IIA alleviates chondrocyte apoptosis and extracellular matrix degeneration by inhibiting ferroptosis
  100. Study on the cytokines related to SARS-Cov-2 in testicular cells and the interaction network between cells based on scRNA-seq data
  101. Effect of periostin on bone metabolic and autophagy factors during tooth eruption in mice
  102. HP1 induces ferroptosis of renal tubular epithelial cells through NRF2 pathway in diabetic nephropathy
  103. Intravaginal estrogen management in postmenopausal patients with vaginal squamous intraepithelial lesions along with CO2 laser ablation: A retrospective study
  104. Hepatocellular carcinoma cell differentiation trajectory predicts immunotherapy, potential therapeutic drugs, and prognosis of patients
  105. Effects of physical exercise on biomarkers of oxidative stress in healthy subjects: A meta-analysis of randomized controlled trials
  106. Identification of lysosome-related genes in connection with prognosis and immune cell infiltration for drug candidates in head and neck cancer
  107. Development of an instrument-free and low-cost ELISA dot-blot test to detect antibodies against SARS-CoV-2
  108. Research progress on gas signal molecular therapy for Parkinson’s disease
  109. Adiponectin inhibits TGF-β1-induced skin fibroblast proliferation and phenotype transformation via the p38 MAPK signaling pathway
  110. The G protein-coupled receptor-related gene signatures for predicting prognosis and immunotherapy response in bladder urothelial carcinoma
  111. α-Fetoprotein contributes to the malignant biological properties of AFP-producing gastric cancer
  112. CXCL12/CXCR4/CXCR7 axis in placenta tissues of patients with placenta previa
  113. Association between thyroid stimulating hormone levels and papillary thyroid cancer risk: A meta-analysis
  114. Significance of sTREM-1 and sST2 combined diagnosis for sepsis detection and prognosis prediction
  115. Diagnostic value of serum neuroactive substances in the acute exacerbation of chronic obstructive pulmonary disease complicated with depression
  116. Research progress of AMP-activated protein kinase and cardiac aging
  117. TRIM29 knockdown prevented the colon cancer progression through decreasing the ubiquitination levels of KRT5
  118. Cross-talk between gut microbiota and liver steatosis: Complications and therapeutic target
  119. Metastasis from small cell lung cancer to ovary: A case report
  120. The early diagnosis and pathogenic mechanisms of sepsis-related acute kidney injury
  121. The effect of NK cell therapy on sepsis secondary to lung cancer: A case report
  122. Erianin alleviates collagen-induced arthritis in mice by inhibiting Th17 cell differentiation
  123. Loss of ACOX1 in clear cell renal cell carcinoma and its correlation with clinical features
  124. Signalling pathways in the osteogenic differentiation of periodontal ligament stem cells
  125. Crosstalk between lactic acid and immune regulation and its value in the diagnosis and treatment of liver failure
  126. Clinicopathological features and differential diagnosis of gastric pleomorphic giant cell carcinoma
  127. Traumatic brain injury and rTMS-ERPs: Case report and literature review
  128. Extracellular fibrin promotes non-small cell lung cancer progression through integrin β1/PTEN/AKT signaling
  129. Knockdown of DLK4 inhibits non-small cell lung cancer tumor growth by downregulating CKS2
  130. The co-expression pattern of VEGFR-2 with indicators related to proliferation, apoptosis, and differentiation of anagen hair follicles
  131. Inflammation-related signaling pathways in tendinopathy
  132. CD4+ T cell count in HIV/TB co-infection and co-occurrence with HL: Case report and literature review
  133. Clinical analysis of severe Chlamydia psittaci pneumonia: Case series study
  134. Bioinformatics analysis to identify potential biomarkers for the pulmonary artery hypertension associated with the basement membrane
  135. Influence of MTHFR polymorphism, alone or in combination with smoking and alcohol consumption, on cancer susceptibility
  136. Catharanthus roseus (L.) G. Don counteracts the ampicillin resistance in multiple antibiotic-resistant Staphylococcus aureus by downregulation of PBP2a synthesis
  137. Combination of a bronchogenic cyst in the thoracic spinal canal with chronic myelocytic leukemia
  138. Bacterial lipoprotein plays an important role in the macrophage autophagy and apoptosis induced by Salmonella typhimurium and Staphylococcus aureus
  139. TCL1A+ B cells predict prognosis in triple-negative breast cancer through integrative analysis of single-cell and bulk transcriptomic data
  140. Ezrin promotes esophageal squamous cell carcinoma progression via the Hippo signaling pathway
  141. Ferroptosis: A potential target of macrophages in plaque vulnerability
  142. Predicting pediatric Crohn's disease based on six mRNA-constructed risk signature using comprehensive bioinformatic approaches
  143. Applications of genetic code expansion and photosensitive UAAs in studying membrane proteins
  144. HK2 contributes to the proliferation, migration, and invasion of diffuse large B-cell lymphoma cells by enhancing the ERK1/2 signaling pathway
  145. IL-17 in osteoarthritis: A narrative review
  146. Circadian cycle and neuroinflammation
  147. Probiotic management and inflammatory factors as a novel treatment in cirrhosis: A systematic review and meta-analysis
  148. Hemorrhagic meningioma with pulmonary metastasis: Case report and literature review
  149. SPOP regulates the expression profiles and alternative splicing events in human hepatocytes
  150. Knockdown of SETD5 inhibited glycolysis and tumor growth in gastric cancer cells by down-regulating Akt signaling pathway
  151. PTX3 promotes IVIG resistance-induced endothelial injury in Kawasaki disease by regulating the NF-κB pathway
  152. Pancreatic ectopic thyroid tissue: A case report and analysis of literature
  153. The prognostic impact of body mass index on female breast cancer patients in underdeveloped regions of northern China differs by menopause status and tumor molecular subtype
  154. Report on a case of liver-originating malignant melanoma of unknown primary
  155. Case report: Herbal treatment of neutropenic enterocolitis after chemotherapy for breast cancer
  156. The fibroblast growth factor–Klotho axis at molecular level
  157. Characterization of amiodarone action on currents in hERG-T618 gain-of-function mutations
  158. A case report of diagnosis and dynamic monitoring of Listeria monocytogenes meningitis with NGS
  159. Effect of autologous platelet-rich plasma on new bone formation and viability of a Marburg bone graft
  160. Small breast epithelial mucin as a useful prognostic marker for breast cancer patients
  161. Continuous non-adherent culture promotes transdifferentiation of human adipose-derived stem cells into retinal lineage
  162. Nrf3 alleviates oxidative stress and promotes the survival of colon cancer cells by activating AKT/BCL-2 signal pathway
  163. Favorable response to surufatinib in a patient with necrolytic migratory erythema: A case report
  164. Case report of atypical undernutrition of hypoproteinemia type
  165. Down-regulation of COL1A1 inhibits tumor-associated fibroblast activation and mediates matrix remodeling in the tumor microenvironment of breast cancer
  166. Sarcoma protein kinase inhibition alleviates liver fibrosis by promoting hepatic stellate cells ferroptosis
  167. Research progress of serum eosinophil in chronic obstructive pulmonary disease and asthma
  168. Clinicopathological characteristics of co-existing or mixed colorectal cancer and neuroendocrine tumor: Report of five cases
  169. Role of menopausal hormone therapy in the prevention of postmenopausal osteoporosis
  170. Precisional detection of lymph node metastasis using tFCM in colorectal cancer
  171. Advances in diagnosis and treatment of perimenopausal syndrome
  172. A study of forensic genetics: ITO index distribution and kinship judgment between two individuals
  173. Acute lupus pneumonitis resembling miliary tuberculosis: A case-based review
  174. Plasma levels of CD36 and glutathione as biomarkers for ruptured intracranial aneurysm
  175. Fractalkine modulates pulmonary angiogenesis and tube formation by modulating CX3CR1 and growth factors in PVECs
  176. Novel risk prediction models for deep vein thrombosis after thoracotomy and thoracoscopic lung cancer resections, involving coagulation and immune function
  177. Exploring the diagnostic markers of essential tremor: A study based on machine learning algorithms
  178. Evaluation of effects of small-incision approach treatment on proximal tibia fracture by deep learning algorithm-based magnetic resonance imaging
  179. An online diagnosis method for cancer lesions based on intelligent imaging analysis
  180. Medical imaging in rheumatoid arthritis: A review on deep learning approach
  181. Predictive analytics in smart healthcare for child mortality prediction using a machine learning approach
  182. Utility of neutrophil–lymphocyte ratio and platelet–lymphocyte ratio in predicting acute-on-chronic liver failure survival
  183. A biomedical decision support system for meta-analysis of bilateral upper-limb training in stroke patients with hemiplegia
  184. TNF-α and IL-8 levels are positively correlated with hypobaric hypoxic pulmonary hypertension and pulmonary vascular remodeling in rats
  185. Stochastic gradient descent optimisation for convolutional neural network for medical image segmentation
  186. Comparison of the prognostic value of four different critical illness scores in patients with sepsis-induced coagulopathy
  187. Application and teaching of computer molecular simulation embedded technology and artificial intelligence in drug research and development
  188. Hepatobiliary surgery based on intelligent image segmentation technology
  189. Value of brain injury-related indicators based on neural network in the diagnosis of neonatal hypoxic-ischemic encephalopathy
  190. Analysis of early diagnosis methods for asymmetric dementia in brain MR images based on genetic medical technology
  191. Early diagnosis for the onset of peri-implantitis based on artificial neural network
  192. Clinical significance of the detection of serum IgG4 and IgG4/IgG ratio in patients with thyroid-associated ophthalmopathy
  193. Forecast of pain degree of lumbar disc herniation based on back propagation neural network
  194. SPA-UNet: A liver tumor segmentation network based on fused multi-scale features
  195. Systematic evaluation of clinical efficacy of CYP1B1 gene polymorphism in EGFR mutant non-small cell lung cancer observed by medical image
  196. Rehabilitation effect of intelligent rehabilitation training system on hemiplegic limb spasms after stroke
  197. A novel approach for minimising anti-aliasing effects in EEG data acquisition
  198. ErbB4 promotes M2 activation of macrophages in idiopathic pulmonary fibrosis
  199. Clinical role of CYP1B1 gene polymorphism in prediction of postoperative chemotherapy efficacy in NSCLC based on individualized health model
  200. Lung nodule segmentation via semi-residual multi-resolution neural networks
  201. Evaluation of brain nerve function in ICU patients with Delirium by deep learning algorithm-based resting state MRI
  202. A data mining technique for detecting malignant mesothelioma cancer using multiple regression analysis
  203. Markov model combined with MR diffusion tensor imaging for predicting the onset of Alzheimer’s disease
  204. Effectiveness of the treatment of depression associated with cancer and neuroimaging changes in depression-related brain regions in patients treated with the mediator-deuterium acupuncture method
  205. Molecular mechanism of colorectal cancer and screening of molecular markers based on bioinformatics analysis
  206. Monitoring and evaluation of anesthesia depth status data based on neuroscience
  207. Exploring the conformational dynamics and thermodynamics of EGFR S768I and G719X + S768I mutations in non-small cell lung cancer: An in silico approaches
  208. Optimised feature selection-driven convolutional neural network using gray level co-occurrence matrix for detection of cervical cancer
  209. Incidence of different pressure patterns of spinal cerebellar ataxia and analysis of imaging and genetic diagnosis
  210. Pathogenic bacteria and treatment resistance in older cardiovascular disease patients with lung infection and risk prediction model
  211. Adoption value of support vector machine algorithm-based computed tomography imaging in the diagnosis of secondary pulmonary fungal infections in patients with malignant hematological disorders
  212. From slides to insights: Harnessing deep learning for prognostic survival prediction in human colorectal cancer histology
  213. Ecology and Environmental Science
  214. Monitoring of hourly carbon dioxide concentration under different land use types in arid ecosystem
  215. Comparing the differences of prokaryotic microbial community between pit walls and bottom from Chinese liquor revealed by 16S rRNA gene sequencing
  216. Effects of cadmium stress on fruits germination and growth of two herbage species
  217. Bamboo charcoal affects soil properties and bacterial community in tea plantations
  218. Optimization of biogas potential using kinetic models, response surface methodology, and instrumental evidence for biodegradation of tannery fleshings during anaerobic digestion
  219. Understory vegetation diversity patterns of Platycladus orientalis and Pinus elliottii communities in Central and Southern China
  220. Studies on macrofungi diversity and discovery of new species of Abortiporus from Baotianman World Biosphere Reserve
  221. Food Science
  222. Effect of berrycactus fruit (Myrtillocactus geometrizans) on glutamate, glutamine, and GABA levels in the frontal cortex of rats fed with a high-fat diet
  223. Guesstimate of thymoquinone diversity in Nigella sativa L. genotypes and elite varieties collected from Indian states using HPTLC technique
  224. Analysis of bacterial community structure of Fuzhuan tea with different processing techniques
  225. Untargeted metabolomics reveals sour jujube kernel benefiting the nutritional value and flavor of Morchella esculenta
  226. Mycobiota in Slovak wine grapes: A case study from the small Carpathians wine region
  227. Elemental analysis of Fadogia ancylantha leaves used as a nutraceutical in Mashonaland West Province, Zimbabwe
  228. Microbiological transglutaminase: Biotechnological application in the food industry
  229. Influence of solvent-free extraction of fish oil from catfish (Clarias magur) heads using a Taguchi orthogonal array design: A qualitative and quantitative approach
  230. Chromatographic analysis of the chemical composition and anticancer activities of Curcuma longa extract cultivated in Palestine
  231. The potential for the use of leghemoglobin and plant ferritin as sources of iron
  232. Investigating the association between dietary patterns and glycemic control among children and adolescents with T1DM
  233. Bioengineering and Biotechnology
  234. Biocompatibility and osteointegration capability of β-TCP manufactured by stereolithography 3D printing: In vitro study
  235. Clinical characteristics and the prognosis of diabetic foot in Tibet: A single center, retrospective study
  236. Agriculture
  237. Biofertilizer and NPSB fertilizer application effects on nodulation and productivity of common bean (Phaseolus vulgaris L.) at Sodo Zuria, Southern Ethiopia
  238. On correlation between canopy vegetation and growth indexes of maize varieties with different nitrogen efficiencies
  239. Exopolysaccharides from Pseudomonas tolaasii inhibit the growth of Pleurotus ostreatus mycelia
  240. A transcriptomic evaluation of the mechanism of programmed cell death of the replaceable bud in Chinese chestnut
  241. Melatonin enhances salt tolerance in sorghum by modulating photosynthetic performance, osmoregulation, antioxidant defense, and ion homeostasis
  242. Effects of plant density on alfalfa (Medicago sativa L.) seed yield in western Heilongjiang areas
  243. Identification of rice leaf diseases and deficiency disorders using a novel DeepBatch technique
  244. Artificial intelligence and internet of things oriented sustainable precision farming: Towards modern agriculture
  245. Animal Sciences
  246. Effect of ketogenic diet on exercise tolerance and transcriptome of gastrocnemius in mice
  247. Combined analysis of mRNA–miRNA from testis tissue in Tibetan sheep with different FecB genotypes
  248. Isolation, identification, and drug resistance of a partially isolated bacterium from the gill of Siniperca chuatsi
  249. Tracking behavioral changes of confined sows from the first mating to the third parity
  250. The sequencing of the key genes and end products in the TLR4 signaling pathway from the kidney of Rana dybowskii exposed to Aeromonas hydrophila
  251. Development of a new candidate vaccine against piglet diarrhea caused by Escherichia coli
  252. Plant Sciences
  253. Crown and diameter structure of pure Pinus massoniana Lamb. forest in Hunan province, China
  254. Genetic evaluation and germplasm identification analysis on ITS2, trnL-F, and psbA-trnH of alfalfa varieties germplasm resources
  255. Tissue culture and rapid propagation technology for Gentiana rhodantha
  256. Effects of cadmium on the synthesis of active ingredients in Salvia miltiorrhiza
  257. Cloning and expression analysis of VrNAC13 gene in mung bean
  258. Chlorate-induced molecular floral transition revealed by transcriptomes
  259. Effects of warming and drought on growth and development of soybean in Hailun region
  260. Effects of different light conditions on transient expression and biomass in Nicotiana benthamiana leaves
  261. Comparative analysis of the rhizosphere microbiome and medicinally active ingredients of Atractylodes lancea from different geographical origins
  262. Distinguish Dianthus species or varieties based on chloroplast genomes
  263. Comparative transcriptomes reveal molecular mechanisms of apple blossoms of different tolerance genotypes to chilling injury
  264. Study on fresh processing key technology and quality influence of Cut Ophiopogonis Radix based on multi-index evaluation
  265. An advanced approach for fig leaf disease detection and classification: Leveraging image processing and enhanced support vector machine methodology
  266. Erratum
  267. Erratum to “Protein Z modulates the metastasis of lung adenocarcinoma cells”
  268. Erratum to “BRCA1 subcellular localization regulated by PI3K signaling pathway in triple-negative breast cancer MDA-MB-231 cells and hormone-sensitive T47D cells”
  269. Retraction
  270. Retraction to “Protocatechuic acid attenuates cerebral aneurysm formation and progression by inhibiting TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanisms in experimental rats”
Heruntergeladen am 29.5.2026 von https://www.degruyterbrill.com/document/doi/10.1515/biol-2022-0633/html?lang=de
Button zum nach oben scrollen