Startseite Green synthesis and characterization of ginger-extract-based oxali-palladium nanoparticles for colorectal cancer: Downregulation of REG4 and apoptosis induction
Artikel Open Access

Green synthesis and characterization of ginger-extract-based oxali-palladium nanoparticles for colorectal cancer: Downregulation of REG4 and apoptosis induction

  • Ilnaz Tork Cherik , Adeleh Divsalar EMAIL logo , Seyed Abdolhamid Angaji EMAIL logo , Milad Rasouli , Sander Bekeschus , Ali Akbar Moosavi Movahedi , Mahboube Eslami Moghadam , Behafarid Ghalandari und Xianting Ding
Veröffentlicht/Copyright: 14. Dezember 2023
Artikel downloaden (PDF)
Veröffentlichen auch Sie bei De Gruyter Brill
Manuskript einreichen Informationen für Autor*innen
Nanotechnology Reviews
Aus der Zeitschrift Nanotechnology Reviews Band 12 Heft 1

Abstract

Colorectal cancer (CRC) continues to pose a significant challenge to healthcare systems, despite considerable advancements in the fields of medicine and pharmaceuticals. Palladium complexes, considered potential alternatives to platinum-based drugs for treating CRC, are being explored. Additionally, green chemistry, which enables the safe, reproducible, and environmentally friendly synthesis of drugs from natural sources, presents a promising avenue for oncological therapy. This study delves into the synthesis, characterization, and physicochemical properties of oxali-palladium nanoparticles (OxPd NPs) as a novel treatment for CRC using a green synthesis approach. Ginger extract, renowned for its antioxidant and anticancer properties, serves as the source material. The obtained results demonstrate that the synthesis and encapsulation of nanoparticles using ginger extract were conducted with an efficiency of 98%. The nanoparticles exhibited a size of approximately 30 nm and displayed a high level of stability. OxPd NPs were more lethal than ginger extract and free oxaliplatin, and this lethality was attributable to the elevated apoptosis rate. Furthermore, the addition of OxPd NPs to CRC cells resulted in significant alterations in the expression of two cancer-related genes, namely catalase and REG4. The pronounced lethal effect on the CRC cell line and the resulting modulation of gene expression highlight OxPd NPs as promising candidates for further investigation as potential drugs in the treatment of CRC.

Keywords: colorectal cancer cell line; oxali-palladium nanoparticles; green chemistry; ginger extract; CAT gene; REG4 gene

1 Introduction

By 2040, colorectal cancer (CRC) incidence is projected to increase by 63%, leading to over 3.1 million new cases and 1.5 million deaths annually. This surge in cases will place a substantial burden on the healthcare system [1]. CRC is the third most frequent cancer overall and the second major cause of mortality from cancer [2], which has led to ongoing research for more effective medications with fewer side effects. Among them, various metal-based drugs have anticancer properties [3]. In the late twentieth century, platinum compounds were launched as colon anticancer agents, including cisplatin, oxaliplatin (OxPt), carboplatin, and nedaplatin [4,5,6]. Nonetheless, platinum complexes are linked to numerous adverse effects, such as hepatotoxicity, gastrointestinal toxicity, cardiotoxicity, nephrotoxicity, neurotoxicity, ototoxicity, and hematological toxicity [7,8,9]. The currently employed drug for CRC, OxPt, belonging to the third generation of platinum-based drugs, exerts its effect by inducing oxidative stress in tumor cells, ultimately leading to cell death by inhibiting DNA replication. However, OxPt is also associated with substantial neurotoxicity. Additionally, resistance to these medications has emerged in certain tumors, posing a significant challenge. Nevertheless, they are still commonly used to treat various malignancies [10]. Thus, research is being conducted to identify more effective drugs with fewer negative effects.

As a result of their structural similarities and anticancer efficacy, palladium compounds were deemed promising candidates [11]. Palladium derivatives that incorporate transition metals in their core can bind to the DNA of cancer cells and the oligonucleotide [d(CGCGAATTCGCG)]2. This binding results in the inhibition of DNA replication. Interestingly, these derivatives have been observed to overcome the resistance of cancer cells. They can also engage in non-covalent interactions with DNA, including electrostatic and hydrogen bonds, ultimately inducing apoptosis by hindering DNA replication [12,13]. The molecular mechanism of palladium(ii) complexes goes beyond DNA intercalation and includes the induction of apoptosis through both the extrinsic (death receptor-mediated) and intrinsic (mitochondrial) pathways. In this process, there is an increase in the Bax protein and a decrease in the Bcl-2 protein, resulting in reduced mitochondrial potential and cytochrome c release. Activation of the caspase cascade confirms apoptosis via the mitochondrial pathway. Simultaneously, in the death receptor-mediated pathway, Pd(ii) complexes elevate the expression of cell death receptor genes DR4 and DR5. Furthermore, damage to the endoplasmic reticulum is observed to be induced by oxidative stress. This damage is attributed to the excessive generation of reactive oxygen species (ROS), which results from the interaction of Pd(ii) with thiol groups of proteins, including vital components of the antioxidant system. As a consequence of this interaction, the levels of antioxidant proteins like glutathione-S-transferase, glutathione peroxidases, catalase (CAT), and glutathione decrease [14,15]. On the other hand, as indicated by previous research, palladium complexes demonstrate enhanced solubility, reduced potential for causing kidney damage, and more significant toxicity to cancer cells when compared to platinum drugs [16]. As a result, oxali-palladium (OxPd), which is a structural analogue of OxPt, the current drug used for CRC, was selected for this study. This choice was made to harness the advantages of palladium-based drugs and, for the first time, investigate this derivative in the context of CRC.

Due to their biomedical applications and unique magnetic, thermal, catalytic, optical, and electrical properties, nanoscale metals have received considerable attention [17]. In cancer research, nano-sized metal drugs offer the advantage of sparing healthy cells from damage, in contrast to their impact on cancer cells [18,19,20]. The three main techniques for synthesizing these nanoparticles are physical, chemical, and biological. Biological methods involve using bacteria, algae, and plants [17]. Compared to chemical and physical methods, the primary advantages of plant-based nanoparticle synthesis are its eco-friendliness, cost-effectiveness, and scalability [21]. Another advantage of plant-based synthesis over microorganism-based synthesis is that it is a one-step process that requires no additional processing. Preparation processes are inexpensive, and mutations do not disable production as with microorganisms [22]. Ginger (Zingiber officinalis), and especially its extract, has been shown to have antioxidant, anti-inflammatory, and anticancer effects. This is attributed to the presence of alkaloids in ginger, including flavonoids, terpenes, and polyphenols like gingerol, shogaol, and paradol [23,24,25]. These molecules not only contribute to the plants’ anticancer effects [26] but also serve as natural reducing agents to facilitate the transformation of metals into nanoparticles [27]. The primary objective of this study was to establish a green synthesis method for OxPd nanoparticles (OxPd NPs) using ginger extracts. This approach aimed to harness the potential anticancer properties of ginger and OxPd while also capitalizing on the advantages of plant-based nanoscale synthesis.

The CAT gene is responsible for encoding the CAT enzyme, which is situated in the peroxisome. It plays a critical role in converting ROS, like H2O2, into water and oxygen. This function effectively prevents oxidative processes [28]. In normal cells, modest ROS levels establish a regulatory network that promotes cellular homeostasis [29]. High levels of ROS in tumors cause oxidative distress, which leads to mutations, carcinogenesis, angiogenesis, and metastasis [30], and its baseline expression is generally changed in tumor cells [31]. On the other hand, some chemotherapeutic drugs, such as OxPt, generate significant levels of ROS, resulting in the death of tumor cells [32,33], and altered CAT expression was also observed. Our group has already demonstrated that OxPd can bind CAT and impair its function or activity [34], which may contribute to therapeutic effects. This study aimed to investigate the impact of OxPd NPs on changes in CAT expression at the messenger RNA (mRNA) level. In addition, the regenerating (REG) protein family is lectin-dependent and mostly secretes small proteins, anti-apoptotic proteins, and growth factors [35]. The REG4 gene was identified during the sequencing analysis of the inflammatory bowel disease [36].

Moreover, increased expression of this gene was recognized as a potential marker for precancerous changes in the initial phases of colorectal carcinogenesis, rendering it a valuable biomarker for chemotherapy [37,38,39]. Human colon cancer tumors with high levels of REG4 expression respond well to radiation therapy. This is because REG4 makes cells resistant to radiation-mediated apoptosis by increasing the expression of genes involved in apoptosis resistance [40]. Consequently, it is expected that an effective chemotherapy drug would lead to a decrease in the expression of the REG4 gene.

This study treated HCT116 CRC cells of the HCT116 class with nanoparticles synthesized from OxPd using the ginger extract. The nanoparticles were characterized using various techniques, including dynamic light scattering (DLS), inductively coupled plasma mass spectroscopy, Fourier transform infrared spectroscopy (FTIR), field emission scanning electron microscopy (FESEM), and atomic force microscopy (AFM). The 50% inhibitory concentration (IC50) of the nanoparticle was determined using the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide) assay. Flow cytometry analysis demonstrated that the nanoparticles induced apoptosis rather than necrosis in the treated cells. Gene expression changes in HCT116 CRC cells were also assessed using real-time PCR after treatment with OxPd NPs.

2 Materials and methods

2.1 Reagents

Commercial ginger was procured for use in this study from Iran. The HCT116 human CRC surface adhesive cell line was obtained from the Pasteur Institute in Iran. Furthermore, for cell culture, RPMI medium (Sigma-Aldrich, USA), fetal bovine serum (FBS) (Gibco, England), phosphate-buffered saline (PBS) (Merck, Germany), and antibiotics (penicillin and streptomycin) from Denazist (Mashhad, Iran) were purchased. 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT powder; Merck, Germany) and dimethyl sulfoxide (DMSO; Merck, Germany) were acquired for cellular studies. Molecular studies were conducted using the RNA extraction column kit from Denazist (Mashhad, Iran), a cDNA synthesis kit (SMO BIO-UK), and SYBR Green Master Mix without ROX (Ampliqon, Denmark).

2.2 Nanoparticle synthesis

Ginger rhizomes were cleaned, peeled, and sliced into thin layers. The ginger pieces were thoroughly dried and subsequently pulverized in a mill. Five grams of ginger powder with 100 mL of double-distilled water were poured into an Erlenmeyer flask and then placed in a shaker incubator (IKA KS 4000, Germany) at 150 rpm for 30 min at 50°C. The extraction was then carried out with a funnel and Whatman filter paper. In the dark condition, the solution was then colored by adding 1 mL of 2 mM OxPd solution (molecular weight: 308.5 g/mol) to 5 mL of the ginger extract and shaking in an incubator shaker for 24 h at 50°C and 200 rpm. The solution was then centrifuged (Hettich Zentrifugen, Werk Nr, Germany) at 6,000 rpm for 30 min. The supernatant was separated to determine the encapsulation efficiency of nanoparticles for induction-coupled plasma mass spectroscopy (ICP-MS), and the precipitate containing the encapsulated nanoparticles (OxPd NPs) was dissolved in 1 mL of deionized water.

2.3 DLS

DLS spectroscopy, a rapid method for finding particle size in the colloidal system, is a technique dependent on photon-correlation spectroscopy [41]. The OxPd NPs were diluted 1:10 and placed under an ultrasonic probe (Hielscher, UP400St, 400 W, 24 kHz) for 5 min before DLS spectroscopy (Horiba SZ-100 nanoparticle analyzer, Japan). Furthermore, Zeta-sizer detects the potential difference between the outer ion layer and the particle surface to determine the amount of charge on the particles in the colloidal system and their stability. Greater stability and a lower probability of particle accumulation occur for positively or negatively charged particles [42]. The zeta potential of the diluted (1:10) OxPd NPs was measured (Horiba SZ-100 nanoparticle analyzer, Japan).

2.4 High-resolution microscopy

Nanoparticle morphology was studied via surface imaging, captured using an FESEM. Since the electron beam in FESEM is approximately 1,000× smaller and more focused than in SEM, it is more suitable for this study [43]. The solution of produced nanoparticles was diluted in a ratio of 1:10 and then placed on a sheet of aluminum conductor. In order to remedy the solution’s lack of conductivity, a thin layer of gold was then applied. After that, it was put into a microscope (SEM, FEI Nova NanoSEM450). AFM was utilized to physically scan a nanometer-sized sample by capturing three-dimensional images of nanoparticles and determining their volume and height based on a probe tip [41]. Therefore, 2 µL of nanoparticles were poured onto a mica sheet, which was subsequently dried and placed under a microscope (Nanosurf-easyScan, Switzerland).

2.5 Nanoparticle spectroscopy

FTIR is a method of qualitative molecular spectroscopy based on the absorption of infrared radiation by molecules [44]. This type of spectroscopy identifies the functional groups found in chemical compounds and predicts their potential structures [43]. OxPd NPs, ginger extract, and free OxPd solution were freeze-dried for this purpose (Christ Freeze Dryer-Alpha 1–2 LD, Maryland, USA). Then, they were compared based on their FTIR spectra (Perkin Elmer-Spectrum RXI, USA). ICP-MS is based on the emission spectrum, and stressed plasma is used to ionize the sample and analyze the amount and quantity of heavy metals [45]. The amount of free OxPd (not encapsulated in ginger) was determined by ICP to evaluate the effectiveness of nanoparticle production. For this purpose, the synthesis supernatant was moved from the centrifuge to the ICP-MS (Perkin-Elmer Elan 6000) instrument.

2.6 Cell culture and cytotoxicity analysis

The HCT116 human CRC surface adhesive cell line was cultivated in a 5% CO2 incubator at 37°C using a complete culture medium composed of the RPMI medium (89%), FBS (10%), and antibiotics (penicillin and streptomycin) (1%). In a 96-well plate, 5 × 10⁴ cells were cultured for 24 h and subsequently treated with various doses of OxPd NPs, ginger extract, and OxPt solution; the current drug used for CRC and employed as a positive control. Each treatment was carried out in triplicate. After the incubation period, 50 μL of the MTT powder in PBS solvent (2 mg/mL) was added to each well. The MTT compound is reduced by the mitochondria of viable cells, forming blue-formazan crystals, which were used to quantify cell viability. This process was performed at 24-h and 48-h time points. After 4 h, the crystals were dissolved in DMSO, and the adsorption was measured at a 590 wavelength using a microplate reader with a reference wavelength of 630 nm. The viability was calculated using the following formula: [% viability = 100 × (average sample absorption/average control absorption)]. The IC50, the nanoparticle concentration that inhibits 50% of cell growth, was determined. During apoptosis, one of the stages is to transfer phosphatidylserine from the cell membrane’s inner layer to the outer layer. Using flow cytometry 24 h after treatment with an IC50 concentration of OxPd NPs, annexin V (FITC) and propidium iodide were used to discriminate early and late apoptotic as well as necrotic cells [46].

2.7 qPCR studies

The Denazist kit procedure was used to extract total RNA from 5 × 106 cells treated for 24 and 48 h with nanoparticles-treated (IC50 concentration) and -untreated cells. The extracted product was then loaded onto a 1% agarose gel for qualitative analysis and read quantitatively using a nanodrop device. cDNA synthesis, according to the SMO BIO kit, was carried out. First, mixture A (1 ng total RNA, 1 µL dNTP mix, 1 µL oligo dT primer, the rest to 10 µL DEPC-treated H2O) was incubated at 70°C/5 min and then placed on ice for at least 1 min. Second, mixture B (4 µL RT buffer, 1 µL RNase inhibitor, 1 µL reverse transcriptase, 4 µL DEPC-treated H2O) was prepared, and the two mixtures were mixed well, incubated at 25°C/10 min and subsequently incubated at 50°C/50 min for first-strand cDNA synthesis. Third, termination was conducted at 85°C/5 min. These steps were carried out for each RNA extracted from 24 and 48 h treated and untreated cells. Primers to exon–exon junction for the three genes, CAT, REG4, and GAPDH, were synthesized by Sinacolon (Iran) (Table 1). The primer sequences were validated using OligoAnalyzer and PrimerBLAST software tools. A PCR gradient test was performed at five temperatures of 58, 58.9, 59.6, 60.5, and 61.7°C to check the synthesis of cDNA and determine the exact T m of the primers; the optimal annealing temperature for primers was 60°C. qPCR tests were conducted using a Rotor-gene Qiagen (Q 6plex Platform, Germany) device in a total volume of 25 μL (including 2.5 μL cDNA, 10 μL Ampliqon SYBR Green Master Mix, 0.5 μL F primer, 0.5 μL R primer, and 7 μL DEPC-treated H2O) and the following temperature protocol: (1) pre-denaturation: 15 min at 95°C; (2) denaturation: 30 s at 95°C; (3) annealing: 30 s at 60°C; and (4) extension: 30 s at 72°C. Steps 2–4 were repeated for 40 cycles for each gene in duplicate and three biologically independent replicates.

Table 1

Characteristics of the primers

Primer name Sequence Length of primer TM Product size
CAT.F AGGACAATCAGGGTGGTGCTC 21 62.07 165
CAT.R CGTTCACATAGAATGCCCGC 20 59.70
REG4.F GGTTGCCAAACAGAATGCCC 20 60.32 114
REG4.R CAATTTGTAAACCACCGAGCACTC 24 60.85
GAPDH.F GCTCATTTCCTGGTATGACAACGA 24 61.16 184
GAPDH.R GAGATTCAGTGTGGTGGGGG 20 60.04

2.8 Statistical analysis

We conducted the statistical analysis with GraphPad Prism 9 (GraphPad Software). The findings are presented as mean ± standard deviation (SD), derived from a minimum of three separate experiments, each conducted in triplicate. We employed both one-way analysis of variance (ANOVA) and two-way ANOVA, followed by Tukey’s and Dunnett’s post hoc multiple-comparison tests, to evaluate variations among groups. Statistical significance was denoted as follows: *p < 0.05, **p < 0.01, and ***p < 0.001 when compared to the control group.

3 Results

3.1 Synthesis and characterization of nanoparticles

The massive ionic particles of OxPd were shrunk and encapsulated by the ginger extract, decreasing their size to nanoscale levels. After the proposed incubation time, the color of the solution altered, indicating the successful synthesis of these nanoparticles.

The mean zeta potential, size, and polydispersity index (PI) as reported by the DLS test were determined for our synthesized OxPd NPs, with these values being the average of three replicates. For DLS, the average zeta potential reading was –55.9 mV. Strong particle stability is indicated by zeta potentials above 30 mV and below –30 mV, both suggesting the absence of aggregation features [42]. The nanoparticles we created were quite stable, and it was clear that the nanoparticles encased in ginger were negatively charged. The DLS measurements showed that, on average, our OxPd NPs were 35.6 nm in size, which was well within the range required to enter a cell. Their PI was 5.517, indicating little variation in the particle size.

FESEM imaging was used to explore the morphology of OxPd NPs (Figure 1). The 3D dimensions of our OxPd NPs were also assessed using AFM, a technique used in topographic investigations of nanoparticles (Figure 2). AFM also proved the results of the DLS study about the nanoparticles’ average size and round shape.

Figure 1 The FE-SEM result. The size of the OxPd NPs was approximately 30 nm.
Figure 1

The FE-SEM result. The size of the OxPd NPs was approximately 30 nm.

Figure 2 AFM images of the produced NPs.
Figure 2

AFM images of the produced NPs.

FTIR results depicted in Figure 3 indicate that both ginger and OxPd NPs share similar spectral patterns, with prominent peaks at 3,300, 2,920, 1,640, 1,510, 1,070, and 760 cm–1. According to the FTIR literature, these peaks are associated with various vibrational modes: O–H, C–H, N–H, C–C (in the ring), C–O, and C–H stretching vibrations, which correspond to phenols, alkenes, amines, aromatics, and esters, respectively. These findings suggest that important active compounds present in ginger, such as phenols, flavonoids [47], and alkaloids [48], are retained in the synthesized nanoparticles.

Figure 3 FTIR spectra were obtained for free OxPd, ginger extract, and OxPd NP samples. FTIR analysis indicated that both ginger extract and OxPd NPs showed similar peaks. However, there were additional peaks observed in free OxPd that were not present in the synthesized OxPd NPs.
Figure 3

FTIR spectra were obtained for free OxPd, ginger extract, and OxPd NP samples. FTIR analysis indicated that both ginger extract and OxPd NPs showed similar peaks. However, there were additional peaks observed in free OxPd that were not present in the synthesized OxPd NPs.

In addition, numerous wavelengths associated with OxPd, such as 820–920, 1,100–1,200, and 3,100–3,400 cm–1, are not seen in our synthesized OxPd NPs. Comparing the peaks of OxPd NPs with those of OxPd and ginger extract revealed that the surface of our nanoparticles no longer contained all the OxPd functional groups but rather the ginger extract functional groups. All of these proved the synthesis and coating of nanoparticles.

The ICP measurement for OxPd free of ginger encapsulation was 0.0158 mg/mL. Based on the initial concentration of the OxPd solution (2 mM), the resulting molecular weight was 308.5. The outcome is equivalent to 0.617 mg/mL. The ginger-encapsulated OxPd concentration was 0.6012 mg/mL. It was determined by subtracting the quantity of free OxPd from the total quantity of OxPd solution. The final yield of OxPd NPs was 97.4%.

3.2 Nanoparticle lethality tests

The viability of the HCT116 CRC cell line was evaluated while being treated with ginger extract, OxPd NPs, and OxPt (the current drug for CRC) for both 24 and 48 h. Notably, the synthesized nanoparticles exhibited the lowest survival rate (Figure 4(a) and (b)). OxPd NPs are superior to ginger extract and OxPt in terms of toxicity. This can be explained by the strong reactivity of OxPd rather than OxPt [9,49], their nanodimensions, and the antitumor properties of the ginger extract, as supported by previous studies [25,50,51]. Furthermore, IC50 has been calculated to be 7.621 μM and 4.870 μM for 24 and 48 h, respectively.

Figure 4 The viability of HCT116 CRC cells following (a) 24 h and (b) 48 h treatment with ginger, OxPd NPs, and OxPt using a cell viability assay was examined. The surviving cell percentages in each treatment group were determined in comparison to the control group. These experiments were repeated at least three times, and the results are displayed as mean ± SD. Statistical significance was indicated as *p < 0.05, **p < 0.01, and ***p < 0.001 when compared to the control group.
Figure 4

The viability of HCT116 CRC cells following (a) 24 h and (b) 48 h treatment with ginger, OxPd NPs, and OxPt using a cell viability assay was examined. The surviving cell percentages in each treatment group were determined in comparison to the control group. These experiments were repeated at least three times, and the results are displayed as mean ± SD. Statistical significance was indicated as *p < 0.05, **p < 0.01, and ***p < 0.001 when compared to the control group.

Flow cytometry analysis (Figure 5) confirmed the highest apoptosis rate (87.6 + 4.6%) and the lowest necrosis rate (3.8%) for our OxPd NPs at the concentration of IC50 obtained from the MTT test on 5 × 10⁴ cells. Consequently, it seemed reasonable to investigate changes in gene expression during treatment with this concentration of IC50. Additionally, it inhibited cell division in the G1 and S phases, resulting in a cell frequency of 38.6 and 34.9% in each phase, respectively.

Figure 5 The outcomes of flow cytometry analysis categorized cells into distinct regions, including the necrosis region (Q1), pre-apoptosis region (Q2), apoptosis region (Q3), and living cell region (Q4). After a 24 h treatment with OxPd NPs at the IC50 concentration, a significant proportion of cells were observed in the pre-apoptosis region (87.6%) and the apoptosis region (4.6%). Furthermore, the cell cycle analysis revealed that a substantial portion of cells were arrested in the G1 phase (38.6%) and the S phase (34.9%).
Figure 5

The outcomes of flow cytometry analysis categorized cells into distinct regions, including the necrosis region (Q1), pre-apoptosis region (Q2), apoptosis region (Q3), and living cell region (Q4). After a 24 h treatment with OxPd NPs at the IC50 concentration, a significant proportion of cells were observed in the pre-apoptosis region (87.6%) and the apoptosis region (4.6%). Furthermore, the cell cycle analysis revealed that a substantial portion of cells were arrested in the G1 phase (38.6%) and the S phase (34.9%).

3.3 Gene expression tests

The real-time PCR apparatus amplifies and measures CAT, REG4, and GAPDH genes based on the size of the amplified products, which were put onto a 1.5% agarose gel following real-time PCR. Figure 6 illustrates the REG4 and CAT mRNA expression of HCT116 CRC. Table 2 provides adjusted p-values for the genes in the 24- and 48-h treatments and their corresponding fold changes. After 24 and 48 h of treatment with OxPd NPs at the IC50 concentration, the REG4 gene is dramatically lowered, and the CAT gene is significantly upregulated in HCT116 CRC cells. The quantities of fold changes for these genes are shown in Table 2.

Figure 6 Reverse‐transcription polymerase chain reaction quantitation of mRNA levels of (a) REG4 and (b) CAT in HCT116 CRC. GAPDH was used as the housekeeping gene. Data are the mean of at least three different experiments. Data are presented as mean ± SD (*p < 0.05, **p < 0.01, ***p < 0.001 vs control).
Figure 6

Reverse‐transcription polymerase chain reaction quantitation of mRNA levels of (a) REG4 and (b) CAT in HCT116 CRC. GAPDH was used as the housekeeping gene. Data are the mean of at least three different experiments. Data are presented as mean ± SD (*p < 0.05, **p < 0.01, ***p < 0.001 vs control).

Table 2

Adjusted p-values for the genes in the 24- and 48-h treatments and their corresponding fold changes

Pairs p-value Gene names Fold-change
REG4.UN-REG4.T24 0.001 REG4.treat.24h 0.391
REG4.UN-REG4.T48 0.001 REG4.treat.48h 0.091
CAT.UN-CAT.T24 0.467 CAT.treat.24 h 6.049
CAT.UN-CAT.T48 0.001 CAT.treat.48h 22.345

4 Discussion

Due to the side effects associated with OxPt, such as peripheral sensory neuropathy, muscle contractions, and resistance observed in certain cancers [52], OxPd, a structurally related compound with fewer indirect effects, has been developed [49]. The therapeutic properties and adverse effects of palladium derivatives are continually under investigation [12,33,53]. This study explored the anticancer potential of ginger-encapsulated OxPd NPs and assessed the alteration in the expression of two cancer-related marker genes, representing a step toward the development of a more potent drug.

Veisi et al. synthesized palladium nanoparticles using an aqueous tea extract for conducting the Suzuki–Mira catalytic coupling reaction and nitrogen reduction reaction. The nanoparticles had a size range of 7–10 nm and exhibited a spherical shape [54]. Additionally, many palladium and platinum nanoparticles have been synthesized through green chemistry techniques, and their catalytic, biosensing, medical diagnostic, and pharmaceutical applications have been extensively proven [17,55]. Dewan et al. reported using papaya skin to synthesize green palladium nanoparticles. The nanoparticles had a size of 2.4 nm and exhibited a spherical crystal morphology. These nanoparticles were successfully employed in catalytic coupling reactions such as Suzuki–Miyaura and Sonogashira [56]. However, to date, nanoparticles have not been produced from palladium derivatives, particularly OxPd, through the utilization of green chemistry in conjunction with plant (ginger) extracts. Palladium oxide nanoparticles were synthesized from palladium derivatives using the physical method of ultrasonic waves. The cytotoxicity of these nanoparticles was evaluated against the prostate cancer DU145 cell line and MCF-7 breast cancer cell line.

Additionally, the binding of this drug to DNA/BSA was investigated [16]. Tris(dibenzylideneacetone)dipalladium (Tris DBA-Pd) nanoparticles, another palladium derivative, were synthesized with hyaluronic acid nanoparticles similar to the method proposed by Zhang et al. previously, and NPs lethality against LM36R xenograft tissue in melanoma cancer and BRAF inhibitor-resistant cancers was higher than the large Tris DBA-Pd particles [57]. In two studies conducted by our group, OxPd nanoparticles were synthesized using milk beta-lactoglobulin protein, and they were encapsulated within low-methylation pectin as an outer layer for the complex. These studies have provided new insights into the drug delivery system for colon cancer using these nanoparticles [11]. Nevertheless, the toxicity of OxPd NPs synthesized using plant extracts has not been thoroughly investigated.

Similarly, increased expression and high serum levels of REG IV are associated with liver metastasis in CRC [38]. REG4 is an anti-apoptotic, prognostic diagnostic factor in CRC and an invasive factor in CRC cell lines [37]. Measurement and reduction in REG4 gene expression in CRC cell lines treated with substances with antiproliferative and antitumor properties have been proven in other studies [58]. Reduction in REG4 by siRNA or antibody also reduced the viability of pancreatic cancer cell lines [59,60]. In our study involving the HCT116 cell line of CRC, we identified a decrease in REG4 gene expression, with fold changes of 0.391 at 24 h and 0.091 at 48 h when the cells were exposed to OxPd NPs, as compared to untreated cells. These results are consistent with previous research in this area. Moreover, this decrease in the REG4 gene expression, according to the flow cytometry test results and apoptosis induced by our OxPd NPs, indicates the possibility of apoptosis by disruption of the signaling pathway of some epidermal growth factors and the probability of decreased expression of anti-apoptotic proteins. It is recommended to study the expression of their genes treated with our nanoparticles.

Numerous studies have shown that CAT activity is reduced in cancer [61,62,63,64,65,66,67]. Therefore, CAT activity may be considered a helpful parameter in evaluating the effect of different chemotherapy types on the growing tumor cell population [68]. The impact of various drugs on CAT activity has been studied both in vitro and in vivo. Some of these drugs, such as anthracyclines commonly used in chemotherapy, induce apoptosis in cancer cells by binding to DNA and generating ROS. However, the increased activity of antioxidant enzymes can contribute to drug resistance in certain tumors when exposed to this class of chemotherapy drugs. It is worth noting that these drugs can also decrease CAT activity [69].

In a 2014 study, the effect of OxPd as an anticancer drug on the activity and structure of bovine liver CAT was investigated kinetically and thermodynamically. The results showed that this anticancer drug inhibits the CAT enzyme by a non-competitive mechanism. It also changes the second and third structures of the enzymes [33]. Another study in 2015 examined the effect of MgO nanoparticles used to treat liver cancer on the expression of the glutathione transferase and CAT genes. The results showed that MgO nanoparticles increased these genes’ expression by increasing the concentration, proving the potential of using this drug as an anticancer compound [70].

According to our findings, the mRNA level of the CAT gene increased 6.049-fold after 24 h of treatment with our OxPd NPs in HCT116 cells. This upregulation increased even further to 22.345-fold after 48 h of treatment. In the proposed mechanism currently under discussion, it is important to emphasize two key points. First, it is well-documented that OxPd NPs can generate ROS. The primary factors contributing to nanoparticle ROS generation include their interaction with mitochondria and NADPH oxidase. Additionally, ginger extract has been found to enhance ROS generation in human pancreatic cancer cells. Notably, the antioxidant N-acetylcysteine effectively reduced this cell death, suggesting that ginger extract holds promise for potential use in pancreatic cancer treatment. Second, previous research has revealed that ROS can trigger lipid peroxidation, which plays a pivotal role in various forms of cell death, including apoptosis. This mechanism is predicated on an excess of ROS, which initiates attacks on biomembranes, triggers the propagation of lipid peroxidation chain reactions, and subsequently leads to different types of cell death. In this context, even if CAT is upregulated to counteract ROS, the surplus of ROS can still induce apoptosis [71,72,73]. These results are aligned with other studies, such as the treatment of CRC cells with turmeric [74], saffron crocin [75], kefir [76], or with the aqueous extract of Manilkara zapota (L.) P. Royen leaf [77], and the increase in CAT at the protein level. Nevertheless, the impact of elevated ROS levels on normal cells and the specific underlying mechanisms warrants thorough investigation in future studies.

5 Conclusion

The synthesized OxPd NPs exhibited favorable characteristics, such as an optimal size of approximately 30 nm, high stability with a zeta potential of –53 mV, and remarkable toxicity. These nanoparticles demonstrated a significant ability to induce apoptosis in CRC cells (87.6%). Our findings suggest that OxPd NPs hold the potential to be more effective treatments compared to current options like ginger extract and OxPt. Additionally, these nanoparticles showed therapeutic promise by significantly downregulating the REG4 gene, a marker for CRC, and upregulating the CAT antioxidant gene. The eco-friendly and cost-effective synthesis method, following green chemistry principles, highlights the potential of using plant-based materials for nanoparticle synthesis. Moreover, the advantages of nanoscale metals over their bulk counterparts enhance the potential for creating more effective and low side-effect-prone drugs for CRC treatment.

Acknowledgments

The authors thank the Research Council of Kharazmi University and the Iran National Science Foundation (No: 99004364) for their financial support.

  1. Funding information: This work was supported by the Iran National Science Foundation (No: 99004364).

  2. Author contributions: All authors have accepted responsibility for the entire content of this manuscript and approved its submission.

  3. Conflict of interest: The authors state no conflict of interest.

  4. Ethical approval: This study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Animal Ethics Committee of Kharazmi University (License No: 1400).

References

[1] Xi Y, Xu P. Global colorectal cancer burden in 2020 and projections to 2040. Transl Oncol. 2021;14(10):101174.10.1016/j.tranon.2021.101174Suche in Google Scholar PubMed PubMed Central

[2] Islam MT, Pasha AMK. Colorectal cancer burden, Screening and awareness. J Armed Forces Med Coll Bangladesh. 2021;17(2):1–2.10.3329/jafmc.v17i2.58357Suche in Google Scholar

[3] Muhammad N, Guo Z. Metal-based anticancer chemotherapeutic agents. Curr Opin Chem Biol. 2014;19:144–53.10.1016/j.cbpa.2014.02.003Suche in Google Scholar PubMed

[4] Boulikas T, Vougiouka M. Recent clinical trials using cisplatin, carboplatin and their combination chemotherapy drugs. Oncol Rep. 2004;11(3):559–95.10.3892/or.11.3.559Suche in Google Scholar

[5] André T, Boni C, Mounedji-Boudiaf L, Navarro M, Tabernero J, Hickish T, et al. Oxaliplatin, fluorouracil, and leucovorin as adjuvant treatment for colon cancer. N Engl J Med. 2004;350(23):2343–51.10.1056/NEJMoa032709Suche in Google Scholar PubMed

[6] Shimada M, Itamochi H, Kigawa J. Nedaplatin: a cisplatin derivative in cancer chemotherapy. Cancer Manag Res. 2013;5:67–76.10.2147/CMAR.S35785Suche in Google Scholar PubMed PubMed Central

[7] McWhinney SR, Goldberg RM, McLeod HL. Platinum neurotoxicity pharmacogenetics. Mol Cancer Ther. 2009;8(1):10–6.10.1158/1535-7163.MCT-08-0840Suche in Google Scholar PubMed PubMed Central

[8] Oun R, Moussa YE, Wheate NJ. The side effects of platinum-based chemotherapy drugs: a review for chemists. Dalton Trans. 2018;47(19):6645–53.10.1039/C8DT00838HSuche in Google Scholar

[9] Czarnomysy R, Radomska D, Szewczyk OK, Roszczenko P, Bielawski K. Platinum and palladium complexes as promising sources for antitumor treatments. Int J Mol Sci. 2021;22(15):8271.10.3390/ijms22158271Suche in Google Scholar PubMed PubMed Central

[10] Galluzzi L, Senovilla L, Vitale I, Michels J, Martins I, Kepp O, et al. Molecular mechanisms of cisplatin resistance. Oncogene. 2012;31(15):1869–83.10.1038/onc.2011.384Suche in Google Scholar PubMed

[11] Ghalandari B, Divsalar A, Saboury AA, Parivar K. The new insight into oral drug delivery system based on metal drugs in colon cancer therapy through β-lactoglobulin/oxali-palladium nanocapsules. J Photochem Photobiol B Biol. 2014;140:255–65.10.1016/j.jphotobiol.2014.08.003Suche in Google Scholar PubMed

[12] Luo X, Huang W, Mei Y, Zhou S, Zhu L. Interaction of palladium(ii) complexes with sulfur-containing peptides studied by electrospray mass spectrometry. Inorg Chem. 1999;38(7):1474–80.10.1021/ic9805473Suche in Google Scholar

[13] Gao E, Liu L, Zhu M, Huang Y, Guan F, Gao X, et al. Synthesis, characterization, interaction with DNA, and cytotoxic effect in vitro of new mono-and dinuclear Pd(ii) and Pt(ii) complexes with benzo [d] thiazol-2-amine as the primary ligand. Inorg Chem. 2011;50(11):4732–41.10.1021/ic102142jSuche in Google Scholar PubMed

[14] Carneiro TJ, Martins AS, Marques MPM, Gil AM. Metabolic aspects of palladium(ii)potential anti-cancer drugs. Front Oncol. 2020;10:590970.10.3389/fonc.2020.590970Suche in Google Scholar PubMed PubMed Central

[15] Scattolin T, Voloshkin VA, Visentin F, Nolan SP. A critical review of palladium organometallic anticancer agents. Cell Rep Phys Sci. 2021;2(6):1–29.10.1016/j.xcrp.2021.100446Suche in Google Scholar

[16] Sorinezami Z, Mansouri-Torshizi H, Aminzadeh M, Ghahghaei A, Jamgohari N, Heidari Majd M. Synthesis of new ultrasonic-assisted palladium oxide nanoparticles: an in vitro evaluation on cytotoxicity and DNA/BSA binding properties. J Biomol Struct Dyn. 2019;37(16):4238–50.10.1080/07391102.2018.1546619Suche in Google Scholar PubMed

[17] Khandel P, Yadaw RK, Soni DK, Kanwar L, Shahi SK. Biogenesis of metal nanoparticles and their pharmacological applications: present status and application prospects. J Nanostruct Chem. 2018;8:217–54.10.1007/s40097-018-0267-4Suche in Google Scholar

[18] Mughal SS. Diagnosis and treatment of diseases by using metallic nanoparticles-A review. Int J Glob Sci. 2022;3(1):27–35.10.22541/au.166401168.84305772/v1Suche in Google Scholar

[19] Habibi A, Sadat Shandiz SA, Salehzadeh A, Moradi-Shoeili Z. Novel pyridinecarboxaldehyde thiosemicarbazone conjugated magnetite nanoparticulates (MNPs) promote apoptosis in human lung cancer A549 cells. JBIC J Biol Inorg Chem. 2020;25:13–22.10.1007/s00775-019-01728-4Suche in Google Scholar PubMed

[20] Zhang S, Li J, Yan L, You Y, Zhao F, Cheng J, et al. Zeolitic imidazolate framework-8 (ZIF-8) as a drug delivery vehicle for the transport and release of telomerase inhibitor BIBR 1532. Nanomaterials. 2023;13(11):1779.10.3390/nano13111779Suche in Google Scholar PubMed PubMed Central

[21] Shankar SS, Rai A, Ahmad A, Sastry M. Rapid synthesis of Au, Ag, and bimetallic Au core–Ag shell nanoparticles using Neem (Azadirachta indica) leaf broth. J Colloid Interface Sci. 2004;275(2):496–502.10.1016/j.jcis.2004.03.003Suche in Google Scholar PubMed

[22] Narayanan KB, Sakthivel N. Coriander leaf mediated biosynthesis of gold nanoparticles. Mater Lett. 2008;62(30):4588–90.10.1016/j.matlet.2008.08.044Suche in Google Scholar

[23] Kalantari K, Moniri M, Boroumand Moghaddam A, Abdul Rahim R, Bin Ariff A, Izadiyan Z, et al. A review of the biomedical applications of zerumbone and the techniques for its extraction from ginger rhizomes. Molecules. 2017;22(10):1645.10.3390/molecules22101645Suche in Google Scholar PubMed PubMed Central

[24] Rahmani AH, Aly SM. Active ingredients of ginger as potential candidates in the prevention and treatment of diseases via modulation of biological activities. Int J Physiol Pathophysiol Pharmacol. 2014;6(2):125.Suche in Google Scholar

[25] Kale A, Gawande S, Kotwal S. Cancer phytotherapeutics: role for flavonoids at the cellular level. Phytother Res Int J Devoted Pharmacol Toxicol Eval Nat Prod Derivatives. 2008;22(5):567–77.10.1002/ptr.2283Suche in Google Scholar PubMed

[26] Salehi S, Mirzaie A, Sadat Shandiz SA, Noorbazargan H, Rahimi A, Yarmohammadi S, et al. Chemical composition, antioxidant, antibacterial and cytotoxic effects of Artemisia marschalliana sprengel extract. Nat Prod Res. 2017;31(4):469–72.10.1080/14786419.2016.1174234Suche in Google Scholar PubMed

[27] Abed A, Derakhshan M, Karimi M, Shirazinia M, Mahjoubin-Tehran M, Homayonfal M, et al. Platinum nanoparticles in biomedicine: Preparation, anti-cancer activity, and drug delivery vehicles. Front Pharmacol. 2022;13:797804.10.3389/fphar.2022.797804Suche in Google Scholar PubMed PubMed Central

[28] Mueller S, Riedel H-D, Stremmel W. Direct evidence for catalase as the predominant H2O2-removing enzyme in human erythrocytes. Blood J Am Soc Hematol. 1997;90(12):4973–8.10.1182/blood.V90.12.4973Suche in Google Scholar

[29] Sundaresan M, Yu Z-X, Ferrans VJ, Irani K, Finkel T. Requirement for generation of H2O2 for platelet-derived growth factor signal transduction. Science. 1995;270(5234):296–9.10.1126/science.270.5234.296Suche in Google Scholar PubMed

[30] Liou G-Y, Storz P. Reactive oxygen species in cancer. Free Radic Res. 2010;44(5):479–96.10.3109/10715761003667554Suche in Google Scholar PubMed PubMed Central

[31] Zanetti M, Katusic ZS, O’Brien T. Adenoviral-mediated overexpression of catalase inhibits endothelial cell proliferation. Am J Physiol-Heart Circ Physiol. 2002;283(6):H2620–6.10.1152/ajpheart.00358.2001Suche in Google Scholar PubMed

[32] Gholamian A, Divsalar A. Dual molecular mechanism of catalase in cancer and resistance to chemotherapy. J Gorgan Univ Med Sci. 2016;18(2):1–11.Suche in Google Scholar

[33] Gholamian A, Divsalar A, Saiedifar M, Ghalandari B, Saboury AA, Koohshekan B. Generation of reactive oxygen species via inhibition of liver catalase by oxalli-palladium: A spectroscopic and docking study. Process Biochem. 2017;52:165–73.10.1016/j.procbio.2016.10.012Suche in Google Scholar

[34] Gholamian A, Divsalar A, Eslami Moghadam M, Saiedifar M, Sabory AA. The effects of oxali-palladium on the function and structure of liver catalase. J Arak Univ Med Sci. 2014;17(2):40–9.Suche in Google Scholar

[35] Takasawa S. Regenerating gene (REG) product and its potential clinical usage. Expert Opin Ther Targets. 2016;20(5):541–50.10.1517/14728222.2016.1123691Suche in Google Scholar PubMed

[36] Tsuchida C, Sakuramoto-Tsuchida S, Taked M, Itaya-Hironaka A, Yamauchi A, Misu M, et al. Expression of REG family genes in human inflammatory bowel diseases and its regulation. Biochem Biophys Rep. 2017;12:198–205.10.1016/j.bbrep.2017.10.003Suche in Google Scholar PubMed PubMed Central

[37] Numata M, Oshima T. Significance of regenerating islet-derived type IV gene expression in gastroenterological cancers. World J Gastroenterol. 2012;18(27):3502–10.10.3748/wjg.v18.i27.3502Suche in Google Scholar PubMed PubMed Central

[38] Oue N, Kuniyasu H, Noguchi T, Sentani K, Ito M, Tanaka S, et al. Serum concentration of Reg IV in patients with colorectal cancer: overexpression and high serum levels of Reg IV are associated with liver metastasis. Oncology. 2008;72(5–6):371–80.10.1159/000113147Suche in Google Scholar PubMed

[39] Gao L, Wu X, Zhang L, Dai Y, Zhu Z, Zhi Y, et al. REG4 is a Potential biomarker for radiochemotherapy sensitivity in colorectal cancer. OncoTargets Ther. 2021;14:1605–11.10.2147/OTT.S296031Suche in Google Scholar PubMed PubMed Central

[40] Bishnupuri KS, Luo Q, Sainathan SK, Kikuchi K, Sureban SM, Sabarinathan M, et al. Reg IV regulates normal intestinal and colorectal cancer cell susceptibility to radiation-induced apoptosis. Gastroenterology. 2010;138(2):616–26.e2.10.1053/j.gastro.2009.10.050Suche in Google Scholar PubMed PubMed Central

[41] Patra JK, Baek K-H. Green nanobiotechnology: factors affecting synthesis and characterization techniques. J Nanomater. 2015;2014:219.10.1155/2014/417305Suche in Google Scholar

[42] Bhattacharjee S. DLS and zeta potential–what they are and what they are not? J Controlled Rel. 2016;235:337–51.10.1016/j.jconrel.2016.06.017Suche in Google Scholar PubMed

[43] Despotopoulou M. Characterisations of Co3O4 thin films deposited by DLI-MOCVD for the photoelectrocatalysis of water. Diploma Thesis. National Technical University of Athens; 2019.Suche in Google Scholar

[44] Mirzaee Rad F, Tafvizi F, Noorbazargan H, Iranbakhsh A. Ag-doped ZnO nanoparticles synthesized through green method using Artemisia turcomanica extract induce cytotoxicity and apoptotic activities against AGS cancer cells: an in vitro study. J Nanostruct Chem. 2023;13:1–16.10.1007/s40097-023-00528-2Suche in Google Scholar

[45] Montaser A. Inductively Coupled Plasma mass Spectrometry. New York: John Wiley & Sons; 1998.Suche in Google Scholar

[46] Yoshihisa Y, Zhao Q-L, Hassan MA, Wei Z-L, Furuichi M, Miyamoto Y, et al. SOD/catalase mimetic platinum nanoparticles inhibit heat-induced apoptosis in human lymphoma U937 and HH cells. Free Radic Res. 2011;45(3):326–35.10.3109/10715762.2010.532494Suche in Google Scholar PubMed

[47] Oliveira RN, Mancini MC, Oliveira FCSd, Passos TM, Quilty B, Thiré RMdSM, et al. FTIR analysis and quantification of phenols and flavonoids of five commercially available plants extracts used in wound healing. Matéria (Rio de Jan). 2016;21:767–79.10.1590/S1517-707620160003.0072Suche in Google Scholar

[48] Fachriyah E, Ghifari M, Anam K, editors. Isolation, identification, and xanthine oxidase inhibition activity of alkaloid compound from Peperomia pellucida. IOP Conference Series: Materials Science and Engineering. Indonesia: IOP Publishing; 2018.10.1088/1757-899X/349/1/012017Suche in Google Scholar

[49] Kelland L. The resurgence of platinum-based cancer chemotherapy. Nat Rev Cancer. 2007;7(8):573–84.10.1038/nrc2167Suche in Google Scholar PubMed

[50] Saxena R, Rida PC, Kucuk O, Aneja R. Ginger augmented chemotherapy: A novel multitarget nontoxic approach for cancer management. Mol Nutr Food Res. 2016;60(6):1364–73.10.1002/mnfr.201500955Suche in Google Scholar PubMed

[51] de Lima RMT, Dos Reis AC, de Menezes AAPM, Santos JVDO, Filho JWGDO, Ferreira JRDO, et al. Protective and therapeutic potential of ginger (Zingiber officinale) extract and [6]‐gingerol in cancer: A comprehensive review. Phytother Res. 2018;32(10):1885–907.10.1002/ptr.6134Suche in Google Scholar PubMed

[52] Beijers A, Mols F, Vreugdenhil G. A systematic review on chronic oxaliplatin-induced peripheral neuropathy and the relation with oxaliplatin administration. Support Care Cancer. 2014;22:1999–2007.10.1007/s00520-014-2242-zSuche in Google Scholar PubMed

[53] Abbasi-Tajarag K, Divsalar A, Saboury A, Ghalandari B, Ghourchian H. Destructive effect of anticancer oxali-palladium on heme degradation through the generation of endogenous hydrogen peroxide. J Biomol Struct Dyn. 2016;34(11):2493–504.10.1080/07391102.2015.1121408Suche in Google Scholar PubMed

[54] Veisi H, Rostami A, Shirinbayan M. Greener approach for synthesis of monodispersed palladium nanoparticles using aqueous extract of green tea and their catalytic activity for the Suzuki–Miyaura coupling reaction and the reduction of nitroarenes. Appl Organomet Chem. 2017;31(6):e3609.10.1002/aoc.3609Suche in Google Scholar

[55] Siddiqi K, Husen A. Green synthesis, characterization and uses of palladium/platinum nanoparticles. Nanoscale Res Lett. 2016;11:482.10.1186/s11671-016-1695-zSuche in Google Scholar PubMed PubMed Central

[56] Dewan A, Sarmah M, Thakur AJ, Bharali P, Bora U. Greener biogenic approach for the synthesis of palladium nanoparticles using papaya peel: An eco-friendly catalyst for C–C coupling reaction. ACS Omega. 2018;3(5):5327–35.10.1021/acsomega.8b00039Suche in Google Scholar PubMed PubMed Central

[57] Yang L, Arbiser JL. Palladium based nanoparticles for the treatment of advanced melanoma. Sci Rep. 2019;9(3255):1–910.1038/s41598-019-40258-6Suche in Google Scholar PubMed PubMed Central

[58] Li Y-G, Ji D-F, Zhong S, Zhu J-X, Chen S, Hu G-Y. Anti-tumor effects of proteoglycan from Phellinus linteus by immunomodulating and inhibiting Reg IV/EGFR/Akt signaling pathway in colorectal carcinoma. Int J Biol Macromol. 2011;48(3):511–7.10.1016/j.ijbiomac.2011.01.014Suche in Google Scholar PubMed

[59] Takehara A, Eguchi H, Ohigashi H, Ishikawa O, Kasugai T, Hosokawa M, et al. Novel tumor marker REG4 detected in serum of patients with resectable pancreatic cancer and feasibility for antibody therapy targeting REG4. Cancer Sci. 2006;97(11):1191–7.10.1111/j.1349-7006.2006.00297.xSuche in Google Scholar PubMed

[60] Legoffic A, Calvo E, Cano C, Folch-Puy E, Barthet M, Delpero JR, et al. The reg4 gene, amplified in the early stages of pancreatic cancer development, is a promising therapeutic target. PLoS one. 2009;4(10):e7495.10.1371/journal.pone.0007495Suche in Google Scholar PubMed PubMed Central

[61] Kwei KA, Finch JS, Thompson EJ, Bowden GT. Transcriptional repression of catalase in mouse skin tumor progression. Neoplasia. 2004;6(5):440–8.10.1593/neo.04127Suche in Google Scholar PubMed PubMed Central

[62] Goh J, Enns L, Fatemie S, Hopkins H, Morton J, Pettan-Brewer C, et al. Mitochondrial targeted catalase suppresses invasive breast cancer in mice. BMC Cancer. 2011;11:1–12.10.1186/1471-2407-11-191Suche in Google Scholar PubMed PubMed Central

[63] Skrzydlewska E, Kozuszko B, Sulkowska M, Bogdan Z, Kozlowski M, Snarska J, et al. Antioxidant potential in esophageal, stomach and colorectal cancers. Hepato-gastroenterology. 2003;50(49):126–31.Suche in Google Scholar

[64] Goth L, Nagy T. Inherited catalase deficiency: is it benign or a factor in various age related disorders. Mutat Res Rev Mutat Res. 2013;753(2):147–54.10.1016/j.mrrev.2013.08.002Suche in Google Scholar PubMed

[65] Ho JC-M, Zheng S, Comhair SA, Farver C, Erzurum SC. Differential expression of manganese superoxide dismutase and catalase in lung cancer. Cancer Res. 2001;61(23):8578–85.Suche in Google Scholar

[66] Stanley J, Neelamohan R, Suthagar E, Vengatesh G, Jayakumar J, Chandrasekaran M, et al. Lipid peroxidation and antioxidants status in human malignant and non-malignant thyroid tumours. Hum Exp Toxicol. 2016;35(6):585–97.10.1177/0960327115597982Suche in Google Scholar PubMed

[67] Shen Y, Li D, Tian P, Shen K, Zhu J, Feng M, et al. The catalase C-262T gene polymorphism and cancer risk: a systematic review and meta-analysis. Medicine. 2015;94(13):1–8.10.1097/MD.0000000000000679Suche in Google Scholar PubMed PubMed Central

[68] De Vizcaya-Ruiz A, Barbier O, Ruiz-Ramos R, Cebrian ME. Biomarkers of oxidative stress and damage in human populations exposed to arsenic. Mutat Res Genet Toxicol Environ Mutagen. 2009;674(1–2):85–92.10.1016/j.mrgentox.2008.09.020Suche in Google Scholar PubMed

[69] Ozkan A, Fiskin K. Epirubicin HCl toxicity in human-liver derived hepatoma G2 cells. Pol J Pharmacol. 2004;56(4):435–44.Suche in Google Scholar

[70] Kumaran RS, Choi Y-K, Singh V, Song H-J, Song K-G, Kim KJ, et al. In vitro cytotoxic evaluation of MgO nanoparticles and their effect on the expression of ROS genes. Int J Mol Sci. 2015;16(4):7551–64.10.3390/ijms16047551Suche in Google Scholar PubMed PubMed Central

[71] Abdal Dayem A, Hossain MK, Lee SB, Kim K, Saha SK, Yang G-M, et al. The role of reactive oxygen species (ROS) in the biological activities of metallic nanoparticles. Int J Mol Sci. 2017;18(1):120.10.3390/ijms18010120Suche in Google Scholar PubMed PubMed Central

[72] Mansingh DP, OJ S, Sali VK, Vasanthi HR. [6]‐Gingerol–induced cell cycle arrest, reactive oxygen species generation, and disruption of mitochondrial membrane potential are associated with apoptosis in human gastric cancer (AGS) cells. J Biochem Mol Toxicol. 2018;32(10):e22206.10.1002/jbt.22206Suche in Google Scholar PubMed

[73] Su L-J, Zhang J-H, Gomez H, Murugan R, Hong X, Xu D, et al. Reactive oxygen species-induced lipid peroxidation in apoptosis, autophagy, and ferroptosis. Oxid Med Cell Longev. 2019;2019:5080843.10.1155/2019/5080843Suche in Google Scholar PubMed PubMed Central

[74] Chung SS, Dutta P, Chard N, Wu Y, Chen Q-H, Chen G, et al. A novel curcumin analog inhibits canonical and non-canonical functions of telomerase through STAT3 and NF-κB inactivation in colorectal cancer cells. Oncotarget. 2019;10(44):4516.10.18632/oncotarget.27000Suche in Google Scholar PubMed PubMed Central

[75] Amerizadeh F, Rezaei N, Rahmani F, Hassanian SM, Moradi‐Marjaneh R, Fiuji H, et al. Crocin synergistically enhances the antiproliferative activity of 5‐flurouracil through Wnt/PI3K pathway in a mouse model of colitis‐associated colorectal cancer. J Cell Biochem. 2018;119(12):10250–61.10.1002/jcb.27367Suche in Google Scholar PubMed

[76] El Golli-Bennour E, Timoumi R, Koroit M, Bacha H, Abid-Essefi S. Protective effects of kefir against zearalenone toxicity mediated by oxidative stress in cultured HCT-116 cells. Toxicon. 2019;157:25–34.10.1016/j.toxicon.2018.11.296Suche in Google Scholar PubMed

[77] Tan BL, Norhaizan ME. Manilkara zapota (L.) P. Royen leaf water extract triggered apoptosis and activated caspase-dependent pathway in HT-29 human colorectal cancer cell line. Biomed Pharmacother. 2019;110:748–57.10.1016/j.biopha.2018.12.027Suche in Google Scholar PubMed

Received: 2023-06-23
Revised: 2023-10-13
Accepted: 2023-10-25
Published Online: 2023-12-14

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Research Articles
  2. Preparation of CdS–Ag2S nanocomposites by ultrasound-assisted UV photolysis treatment and its visible light photocatalysis activity
  3. Significance of nanoparticle radius and inter-particle spacing toward the radiative water-based alumina nanofluid flow over a rotating disk
  4. Aptamer-based detection of serotonin based on the rapid in situ synthesis of colorimetric gold nanoparticles
  5. Investigation of the nucleation and growth behavior of Ti2AlC and Ti3AlC nano-precipitates in TiAl alloys
  6. Dynamic recrystallization behavior and nucleation mechanism of dual-scale SiCp/A356 composites processed by P/M method
  7. High mechanical performance of 3-aminopropyl triethoxy silane/epoxy cured in a sandwich construction of 3D carbon felts foam and woven basalt fibers
  8. Applying solution of spray polyurea elastomer in asphalt binder: Feasibility analysis and DSR study based on the MSCR and LAS tests
  9. Study on the chronic toxicity and carcinogenicity of iron-based bioabsorbable stents
  10. Influence of microalloying with B on the microstructure and properties of brazed joints with Ag–Cu–Zn–Sn filler metal
  11. Thermohydraulic performance of thermal system integrated with twisted turbulator inserts using ternary hybrid nanofluids
  12. Study of mechanical properties of epoxy/graphene and epoxy/halloysite nanocomposites
  13. Effects of CaO addition on the CuW composite containing micro- and nano-sized tungsten particles synthesized via aluminothermic coupling with silicothermic reduction
  14. Cu and Al2O3-based hybrid nanofluid flow through a porous cavity
  15. Design of functional vancomycin-embedded bio-derived extracellular matrix hydrogels for repairing infectious bone defects
  16. Study on nanocrystalline coating prepared by electro-spraying 316L metal wire and its corrosion performance
  17. Axial compression performance of CFST columns reinforced by ultra-high-performance nano-concrete under long-term loading
  18. Tungsten trioxide nanocomposite for conventional soliton and noise-like pulse generation in anomalous dispersion laser cavity
  19. Microstructure and electrical contact behavior of the nano-yttria-modified Cu-Al2O3/30Mo/3SiC composite
  20. Melting rheology in thermally stratified graphene-mineral oil reservoir (third-grade nanofluid) with slip condition
  21. Re-examination of nonlinear vibration and nonlinear bending of porous sandwich cylindrical panels reinforced by graphene platelets
  22. Parametric simulation of hybrid nanofluid flow consisting of cobalt ferrite nanoparticles with second-order slip and variable viscosity over an extending surface
  23. Chitosan-capped silver nanoparticles with potent and selective intrinsic activity against the breast cancer cells
  24. Multi-core/shell SiO2@Al2O3 nanostructures deposited on Ti3AlC2 to enhance high-temperature stability and microwave absorption properties
  25. Solution-processed Bi2S3/BiVO4/TiO2 ternary heterojunction photoanode with enhanced photoelectrochemical performance
  26. Electroporation effect of ZnO nanoarrays under low voltage for water disinfection
  27. NIR-II window absorbing graphene oxide-coated gold nanorods and graphene quantum dot-coupled gold nanorods for photothermal cancer therapy
  28. Nonlinear three-dimensional stability characteristics of geometrically imperfect nanoshells under axial compression and surface residual stress
  29. Investigation of different nanoparticles properties on the thermal conductivity and viscosity of nanofluids by molecular dynamics simulation
  30. Optimized Cu2O-{100} facet for generation of different reactive oxidative species via peroxymonosulfate activation at specific pH values to efficient acetaminophen removal
  31. Brownian and thermal diffusivity impact due to the Maxwell nanofluid (graphene/engine oil) flow with motile microorganisms and Joule heating
  32. Appraising the dielectric properties and the effectiveness of electromagnetic shielding of graphene reinforced silicone rubber nanocomposite
  33. Synthesis of Ag and Cu nanoparticles by plasma discharge in inorganic salt solutions
  34. Low-cost and large-scale preparation of ultrafine TiO2@C hybrids for high-performance degradation of methyl orange and formaldehyde under visible light
  35. Utilization of waste glass with natural pozzolan in the production of self-glazed glass-ceramic materials
  36. Mechanical performance of date palm fiber-reinforced concrete modified with nano-activated carbon
  37. Melting point of dried gold nanoparticles prepared with ultrasonic spray pyrolysis and lyophilisation
  38. Graphene nanofibers: A modern approach towards tailored gypsum composites
  39. Role of localized magnetic field in vortex generation in tri-hybrid nanofluid flow: A numerical approach
  40. Intelligent computing for the double-diffusive peristaltic rheology of magneto couple stress nanomaterials
  41. Bioconvection transport of upper convected Maxwell nanoliquid with gyrotactic microorganism, nonlinear thermal radiation, and chemical reaction
  42. 3D printing of porous Ti6Al4V bone tissue engineering scaffold and surface anodization preparation of nanotubes to enhance its biological property
  43. Bioinspired ferromagnetic CoFe2O4 nanoparticles: Potential pharmaceutical and medical applications
  44. Significance of gyrotactic microorganisms on the MHD tangent hyperbolic nanofluid flow across an elastic slender surface: Numerical analysis
  45. Performance of polycarboxylate superplasticisers in seawater-blended cement: Effect from chemical structure and nano modification
  46. Entropy minimization of GO–Ag/KO cross-hybrid nanofluid over a convectively heated surface
  47. Oxygen plasma assisted room temperature bonding for manufacturing SU-8 polymer micro/nanoscale nozzle
  48. Performance and mechanism of CO2 reduction by DBD-coupled mesoporous SiO2
  49. Polyarylene ether nitrile dielectric films modified by HNTs@PDA hybrids for high-temperature resistant organic electronics field
  50. Exploration of generalized two-phase free convection magnetohydrodynamic flow of dusty tetra-hybrid Casson nanofluid between parallel microplates
  51. Hygrothermal bending analysis of sandwich nanoplates with FG porous core and piezomagnetic faces via nonlocal strain gradient theory
  52. Design and optimization of a TiO2/RGO-supported epoxy multilayer microwave absorber by the modified local best particle swarm optimization algorithm
  53. Mechanical properties and frost resistance of recycled brick aggregate concrete modified by nano-SiO2
  54. Self-template synthesis of hollow flower-like NiCo2O4 nanoparticles as an efficient bifunctional catalyst for oxygen reduction and oxygen evolution in alkaline media
  55. High-performance wearable flexible strain sensors based on an AgNWs/rGO/TPU electrospun nanofiber film for monitoring human activities
  56. High-performance lithium–selenium batteries enabled by nitrogen-doped porous carbon from peanut meal
  57. Investigating effects of Lorentz forces and convective heating on ternary hybrid nanofluid flow over a curved surface using homotopy analysis method
  58. Exploring the potential of biogenic magnesium oxide nanoparticles for cytotoxicity: In vitro and in silico studies on HCT116 and HT29 cells and DPPH radical scavenging
  59. Enhanced visible-light-driven photocatalytic degradation of azo dyes by heteroatom-doped nickel tungstate nanoparticles
  60. A facile method to synthesize nZVI-doped polypyrrole-based carbon nanotube for Ag(i) removal
  61. Improved osseointegration of dental titanium implants by TiO2 nanotube arrays with self-assembled recombinant IGF-1 in type 2 diabetes mellitus rat model
  62. Functionalized SWCNTs@Ag–TiO2 nanocomposites induce ROS-mediated apoptosis and autophagy in liver cancer cells
  63. Triboelectric nanogenerator based on a water droplet spring with a concave spherical surface for harvesting wave energy and detecting pressure
  64. A mathematical approach for modeling the blood flow containing nanoparticles by employing the Buongiorno’s model
  65. Molecular dynamics study on dynamic interlayer friction of graphene and its strain effect
  66. Induction of apoptosis and autophagy via regulation of AKT and JNK mitogen-activated protein kinase pathways in breast cancer cell lines exposed to gold nanoparticles loaded with TNF-α and combined with doxorubicin
  67. Effect of PVA fibers on durability of nano-SiO2-reinforced cement-based composites subjected to wet-thermal and chloride salt-coupled environment
  68. Effect of polyvinyl alcohol fibers on mechanical properties of nano-SiO2-reinforced geopolymer composites under a complex environment
  69. In vitro studies of titanium dioxide nanoparticles modified with glutathione as a potential drug delivery system
  70. Comparative investigations of Ag/H2O nanofluid and Ag-CuO/H2O hybrid nanofluid with Darcy-Forchheimer flow over a curved surface
  71. Study on deformation characteristics of multi-pass continuous drawing of micro copper wire based on crystal plasticity finite element method
  72. Properties of ultra-high-performance self-compacting fiber-reinforced concrete modified with nanomaterials
  73. Prediction of lap shear strength of GNP and TiO2/epoxy nanocomposite adhesives
  74. A novel exploration of how localized magnetic field affects vortex generation of trihybrid nanofluids
  75. Fabrication and physicochemical characterization of copper oxide–pyrrhotite nanocomposites for the cytotoxic effects on HepG2 cells and the mechanism
  76. Thermal radiative flow of cross nanofluid due to a stretched cylinder containing microorganisms
  77. In vitro study of the biphasic calcium phosphate/chitosan hybrid biomaterial scaffold fabricated via solvent casting and evaporation technique for bone regeneration
  78. Insights into the thermal characteristics and dynamics of stagnant blood conveying titanium oxide, alumina, and silver nanoparticles subject to Lorentz force and internal heating over a curved surface
  79. Effects of nano-SiO2 additives on carbon fiber-reinforced fly ash–slag geopolymer composites performance: Workability, mechanical properties, and microstructure
  80. Energy bandgap and thermal characteristics of non-Darcian MHD rotating hybridity nanofluid thin film flow: Nanotechnology application
  81. Green synthesis and characterization of ginger-extract-based oxali-palladium nanoparticles for colorectal cancer: Downregulation of REG4 and apoptosis induction
  82. Abnormal evolution of resistivity and microstructure of annealed Ag nanoparticles/Ag–Mo films
  83. Preparation of water-based dextran-coated Fe3O4 magnetic fluid for magnetic hyperthermia
  84. Statistical investigations and morphological aspects of cross-rheological material suspended in transportation of alumina, silica, titanium, and ethylene glycol via the Galerkin algorithm
  85. Effect of CNT film interleaves on the flexural properties and strength after impact of CFRP composites
  86. Self-assembled nanoscale entities: Preparative process optimization, payload release, and enhanced bioavailability of thymoquinone natural product
  87. Structure–mechanical property relationships of 3D-printed porous polydimethylsiloxane films
  88. Nonlinear thermal radiation and the slip effect on a 3D bioconvection flow of the Casson nanofluid in a rotating frame via a homotopy analysis mechanism
  89. Residual mechanical properties of concrete incorporated with nano supplementary cementitious materials exposed to elevated temperature
  90. Time-independent three-dimensional flow of a water-based hybrid nanofluid past a Riga plate with slips and convective conditions: A homotopic solution
  91. Lightweight and high-strength polyarylene ether nitrile-based composites for efficient electromagnetic interference shielding
  92. Review Articles
  93. Recycling waste sources into nanocomposites of graphene materials: Overview from an energy-focused perspective
  94. Hybrid nanofiller reinforcement in thermoset and biothermoset applications: A review
  95. Current state-of-the-art review of nanotechnology-based therapeutics for viral pandemics: Special attention to COVID-19
  96. Solid lipid nanoparticles for targeted natural and synthetic drugs delivery in high-incidence cancers, and other diseases: Roles of preparation methods, lipid composition, transitional stability, and release profiles in nanocarriers’ development
  97. Critical review on experimental and theoretical studies of elastic properties of wurtzite-structured ZnO nanowires
  98. Polyurea micro-/nano-capsule applications in construction industry: A review
  99. A comprehensive review and clinical guide to molecular and serological diagnostic tests and future development: In vitro diagnostic testing for COVID-19
  100. Recent advances in electrocatalytic oxidation of 5-hydroxymethylfurfural to 2,5-furandicarboxylic acid: Mechanism, catalyst, coupling system
  101. Research progress and prospect of silica-based polymer nanofluids in enhanced oil recovery
  102. Review of the pharmacokinetics of nanodrugs
  103. Engineered nanoflowers, nanotrees, nanostars, nanodendrites, and nanoleaves for biomedical applications
  104. Research progress of biopolymers combined with stem cells in the repair of intrauterine adhesions
  105. Progress in FEM modeling on mechanical and electromechanical properties of carbon nanotube cement-based composites
  106. Antifouling induced by surface wettability of poly(dimethyl siloxane) and its nanocomposites
  107. TiO2 aerogel composite high-efficiency photocatalysts for environmental treatment and hydrogen energy production
  108. Structural properties of alumina surfaces and their roles in the synthesis of environmentally persistent free radicals (EPFRs)
  109. Nanoparticles for the potential treatment of Alzheimer’s disease: A physiopathological approach
  110. Current status of synthesis and consolidation strategies for thermo-resistant nanoalloys and their general applications
  111. Recent research progress on the stimuli-responsive smart membrane: A review
  112. Dispersion of carbon nanotubes in aqueous cementitious materials: A review
  113. Applications of DNA tetrahedron nanostructure in cancer diagnosis and anticancer drugs delivery
  114. Magnetic nanoparticles in 3D-printed scaffolds for biomedical applications
  115. An overview of the synthesis of silicon carbide–boron carbide composite powders
  116. Organolead halide perovskites: Synthetic routes, structural features, and their potential in the development of photovoltaic
  117. Recent advancements in nanotechnology application on wood and bamboo materials: A review
  118. Application of aptamer-functionalized nanomaterials in molecular imaging of tumors
  119. Recent progress on corrosion mechanisms of graphene-reinforced metal matrix composites
  120. Research progress on preparation, modification, and application of phenolic aerogel
  121. Application of nanomaterials in early diagnosis of cancer
  122. Plant mediated-green synthesis of zinc oxide nanoparticles: An insight into biomedical applications
  123. Recent developments in terahertz quantum cascade lasers for practical applications
  124. Recent progress in dielectric/metal/dielectric electrodes for foldable light-emitting devices
  125. Nanocoatings for ballistic applications: A review
  126. A mini-review on MoS2 membrane for water desalination: Recent development and challenges
  127. Recent updates in nanotechnological advances for wound healing: A narrative review
  128. Recent advances in DNA nanomaterials for cancer diagnosis and treatment
  129. Electrochemical micro- and nanobiosensors for in vivo reactive oxygen/nitrogen species measurement in the brain
  130. Advances in organic–inorganic nanocomposites for cancer imaging and therapy
  131. Advancements in aluminum matrix composites reinforced with carbides and graphene: A comprehensive review
  132. Modification effects of nanosilica on asphalt binders: A review
  133. Decellularized extracellular matrix as a promising biomaterial for musculoskeletal tissue regeneration
  134. Review of the sol–gel method in preparing nano TiO2 for advanced oxidation process
  135. Micro/nano manufacturing aircraft surface with anti-icing and deicing performances: An overview
  136. Cell type-targeting nanoparticles in treating central nervous system diseases: Challenges and hopes
  137. An overview of hydrogen production from Al-based materials
  138. A review of application, modification, and prospect of melamine foam
  139. A review of the performance of fibre-reinforced composite laminates with carbon nanotubes
  140. Research on AFM tip-related nanofabrication of two-dimensional materials
  141. Advances in phase change building materials: An overview
  142. Development of graphene and graphene quantum dots toward biomedical engineering applications: A review
  143. Nanoremediation approaches for the mitigation of heavy metal contamination in vegetables: An overview
  144. Photodynamic therapy empowered by nanotechnology for oral and dental science: Progress and perspectives
  145. Biosynthesis of metal nanoparticles: Bioreduction and biomineralization
  146. Current diagnostic and therapeutic approaches for severe acute respiratory syndrome coronavirus-2 (SARS-COV-2) and the role of nanomaterial-based theragnosis in combating the pandemic
  147. Application of two-dimensional black phosphorus material in wound healing
  148. Special Issue on Advanced Nanomaterials and Composites for Energy Conversion and Storage - Part I
  149. Helical fluorinated carbon nanotubes/iron(iii) fluoride hybrid with multilevel transportation channels and rich active sites for lithium/fluorinated carbon primary battery
  150. The progress of cathode materials in aqueous zinc-ion batteries
  151. Special Issue on Advanced Nanomaterials for Carbon Capture, Environment and Utilization for Energy Sustainability - Part I
  152. Effect of polypropylene fiber and nano-silica on the compressive strength and frost resistance of recycled brick aggregate concrete
  153. Mechanochemical design of nanomaterials for catalytic applications with a benign-by-design focus
https://doi.org/10.1515/ntrev-2023-0154
Schlagwörter für diesen Artikel
colorectal cancer cell line; oxali-palladium nanoparticles; green chemistry; ginger extract; CAT gene; REG4 gene
Creative Commons
BY 4.0

Artikel in diesem Heft

  1. Research Articles
  2. Preparation of CdS–Ag2S nanocomposites by ultrasound-assisted UV photolysis treatment and its visible light photocatalysis activity
  3. Significance of nanoparticle radius and inter-particle spacing toward the radiative water-based alumina nanofluid flow over a rotating disk
  4. Aptamer-based detection of serotonin based on the rapid in situ synthesis of colorimetric gold nanoparticles
  5. Investigation of the nucleation and growth behavior of Ti2AlC and Ti3AlC nano-precipitates in TiAl alloys
  6. Dynamic recrystallization behavior and nucleation mechanism of dual-scale SiCp/A356 composites processed by P/M method
  7. High mechanical performance of 3-aminopropyl triethoxy silane/epoxy cured in a sandwich construction of 3D carbon felts foam and woven basalt fibers
  8. Applying solution of spray polyurea elastomer in asphalt binder: Feasibility analysis and DSR study based on the MSCR and LAS tests
  9. Study on the chronic toxicity and carcinogenicity of iron-based bioabsorbable stents
  10. Influence of microalloying with B on the microstructure and properties of brazed joints with Ag–Cu–Zn–Sn filler metal
  11. Thermohydraulic performance of thermal system integrated with twisted turbulator inserts using ternary hybrid nanofluids
  12. Study of mechanical properties of epoxy/graphene and epoxy/halloysite nanocomposites
  13. Effects of CaO addition on the CuW composite containing micro- and nano-sized tungsten particles synthesized via aluminothermic coupling with silicothermic reduction
  14. Cu and Al2O3-based hybrid nanofluid flow through a porous cavity
  15. Design of functional vancomycin-embedded bio-derived extracellular matrix hydrogels for repairing infectious bone defects
  16. Study on nanocrystalline coating prepared by electro-spraying 316L metal wire and its corrosion performance
  17. Axial compression performance of CFST columns reinforced by ultra-high-performance nano-concrete under long-term loading
  18. Tungsten trioxide nanocomposite for conventional soliton and noise-like pulse generation in anomalous dispersion laser cavity
  19. Microstructure and electrical contact behavior of the nano-yttria-modified Cu-Al2O3/30Mo/3SiC composite
  20. Melting rheology in thermally stratified graphene-mineral oil reservoir (third-grade nanofluid) with slip condition
  21. Re-examination of nonlinear vibration and nonlinear bending of porous sandwich cylindrical panels reinforced by graphene platelets
  22. Parametric simulation of hybrid nanofluid flow consisting of cobalt ferrite nanoparticles with second-order slip and variable viscosity over an extending surface
  23. Chitosan-capped silver nanoparticles with potent and selective intrinsic activity against the breast cancer cells
  24. Multi-core/shell SiO2@Al2O3 nanostructures deposited on Ti3AlC2 to enhance high-temperature stability and microwave absorption properties
  25. Solution-processed Bi2S3/BiVO4/TiO2 ternary heterojunction photoanode with enhanced photoelectrochemical performance
  26. Electroporation effect of ZnO nanoarrays under low voltage for water disinfection
  27. NIR-II window absorbing graphene oxide-coated gold nanorods and graphene quantum dot-coupled gold nanorods for photothermal cancer therapy
  28. Nonlinear three-dimensional stability characteristics of geometrically imperfect nanoshells under axial compression and surface residual stress
  29. Investigation of different nanoparticles properties on the thermal conductivity and viscosity of nanofluids by molecular dynamics simulation
  30. Optimized Cu2O-{100} facet for generation of different reactive oxidative species via peroxymonosulfate activation at specific pH values to efficient acetaminophen removal
  31. Brownian and thermal diffusivity impact due to the Maxwell nanofluid (graphene/engine oil) flow with motile microorganisms and Joule heating
  32. Appraising the dielectric properties and the effectiveness of electromagnetic shielding of graphene reinforced silicone rubber nanocomposite
  33. Synthesis of Ag and Cu nanoparticles by plasma discharge in inorganic salt solutions
  34. Low-cost and large-scale preparation of ultrafine TiO2@C hybrids for high-performance degradation of methyl orange and formaldehyde under visible light
  35. Utilization of waste glass with natural pozzolan in the production of self-glazed glass-ceramic materials
  36. Mechanical performance of date palm fiber-reinforced concrete modified with nano-activated carbon
  37. Melting point of dried gold nanoparticles prepared with ultrasonic spray pyrolysis and lyophilisation
  38. Graphene nanofibers: A modern approach towards tailored gypsum composites
  39. Role of localized magnetic field in vortex generation in tri-hybrid nanofluid flow: A numerical approach
  40. Intelligent computing for the double-diffusive peristaltic rheology of magneto couple stress nanomaterials
  41. Bioconvection transport of upper convected Maxwell nanoliquid with gyrotactic microorganism, nonlinear thermal radiation, and chemical reaction
  42. 3D printing of porous Ti6Al4V bone tissue engineering scaffold and surface anodization preparation of nanotubes to enhance its biological property
  43. Bioinspired ferromagnetic CoFe2O4 nanoparticles: Potential pharmaceutical and medical applications
  44. Significance of gyrotactic microorganisms on the MHD tangent hyperbolic nanofluid flow across an elastic slender surface: Numerical analysis
  45. Performance of polycarboxylate superplasticisers in seawater-blended cement: Effect from chemical structure and nano modification
  46. Entropy minimization of GO–Ag/KO cross-hybrid nanofluid over a convectively heated surface
  47. Oxygen plasma assisted room temperature bonding for manufacturing SU-8 polymer micro/nanoscale nozzle
  48. Performance and mechanism of CO2 reduction by DBD-coupled mesoporous SiO2
  49. Polyarylene ether nitrile dielectric films modified by HNTs@PDA hybrids for high-temperature resistant organic electronics field
  50. Exploration of generalized two-phase free convection magnetohydrodynamic flow of dusty tetra-hybrid Casson nanofluid between parallel microplates
  51. Hygrothermal bending analysis of sandwich nanoplates with FG porous core and piezomagnetic faces via nonlocal strain gradient theory
  52. Design and optimization of a TiO2/RGO-supported epoxy multilayer microwave absorber by the modified local best particle swarm optimization algorithm
  53. Mechanical properties and frost resistance of recycled brick aggregate concrete modified by nano-SiO2
  54. Self-template synthesis of hollow flower-like NiCo2O4 nanoparticles as an efficient bifunctional catalyst for oxygen reduction and oxygen evolution in alkaline media
  55. High-performance wearable flexible strain sensors based on an AgNWs/rGO/TPU electrospun nanofiber film for monitoring human activities
  56. High-performance lithium–selenium batteries enabled by nitrogen-doped porous carbon from peanut meal
  57. Investigating effects of Lorentz forces and convective heating on ternary hybrid nanofluid flow over a curved surface using homotopy analysis method
  58. Exploring the potential of biogenic magnesium oxide nanoparticles for cytotoxicity: In vitro and in silico studies on HCT116 and HT29 cells and DPPH radical scavenging
  59. Enhanced visible-light-driven photocatalytic degradation of azo dyes by heteroatom-doped nickel tungstate nanoparticles
  60. A facile method to synthesize nZVI-doped polypyrrole-based carbon nanotube for Ag(i) removal
  61. Improved osseointegration of dental titanium implants by TiO2 nanotube arrays with self-assembled recombinant IGF-1 in type 2 diabetes mellitus rat model
  62. Functionalized SWCNTs@Ag–TiO2 nanocomposites induce ROS-mediated apoptosis and autophagy in liver cancer cells
  63. Triboelectric nanogenerator based on a water droplet spring with a concave spherical surface for harvesting wave energy and detecting pressure
  64. A mathematical approach for modeling the blood flow containing nanoparticles by employing the Buongiorno’s model
  65. Molecular dynamics study on dynamic interlayer friction of graphene and its strain effect
  66. Induction of apoptosis and autophagy via regulation of AKT and JNK mitogen-activated protein kinase pathways in breast cancer cell lines exposed to gold nanoparticles loaded with TNF-α and combined with doxorubicin
  67. Effect of PVA fibers on durability of nano-SiO2-reinforced cement-based composites subjected to wet-thermal and chloride salt-coupled environment
  68. Effect of polyvinyl alcohol fibers on mechanical properties of nano-SiO2-reinforced geopolymer composites under a complex environment
  69. In vitro studies of titanium dioxide nanoparticles modified with glutathione as a potential drug delivery system
  70. Comparative investigations of Ag/H2O nanofluid and Ag-CuO/H2O hybrid nanofluid with Darcy-Forchheimer flow over a curved surface
  71. Study on deformation characteristics of multi-pass continuous drawing of micro copper wire based on crystal plasticity finite element method
  72. Properties of ultra-high-performance self-compacting fiber-reinforced concrete modified with nanomaterials
  73. Prediction of lap shear strength of GNP and TiO2/epoxy nanocomposite adhesives
  74. A novel exploration of how localized magnetic field affects vortex generation of trihybrid nanofluids
  75. Fabrication and physicochemical characterization of copper oxide–pyrrhotite nanocomposites for the cytotoxic effects on HepG2 cells and the mechanism
  76. Thermal radiative flow of cross nanofluid due to a stretched cylinder containing microorganisms
  77. In vitro study of the biphasic calcium phosphate/chitosan hybrid biomaterial scaffold fabricated via solvent casting and evaporation technique for bone regeneration
  78. Insights into the thermal characteristics and dynamics of stagnant blood conveying titanium oxide, alumina, and silver nanoparticles subject to Lorentz force and internal heating over a curved surface
  79. Effects of nano-SiO2 additives on carbon fiber-reinforced fly ash–slag geopolymer composites performance: Workability, mechanical properties, and microstructure
  80. Energy bandgap and thermal characteristics of non-Darcian MHD rotating hybridity nanofluid thin film flow: Nanotechnology application
  81. Green synthesis and characterization of ginger-extract-based oxali-palladium nanoparticles for colorectal cancer: Downregulation of REG4 and apoptosis induction
  82. Abnormal evolution of resistivity and microstructure of annealed Ag nanoparticles/Ag–Mo films
  83. Preparation of water-based dextran-coated Fe3O4 magnetic fluid for magnetic hyperthermia
  84. Statistical investigations and morphological aspects of cross-rheological material suspended in transportation of alumina, silica, titanium, and ethylene glycol via the Galerkin algorithm
  85. Effect of CNT film interleaves on the flexural properties and strength after impact of CFRP composites
  86. Self-assembled nanoscale entities: Preparative process optimization, payload release, and enhanced bioavailability of thymoquinone natural product
  87. Structure–mechanical property relationships of 3D-printed porous polydimethylsiloxane films
  88. Nonlinear thermal radiation and the slip effect on a 3D bioconvection flow of the Casson nanofluid in a rotating frame via a homotopy analysis mechanism
  89. Residual mechanical properties of concrete incorporated with nano supplementary cementitious materials exposed to elevated temperature
  90. Time-independent three-dimensional flow of a water-based hybrid nanofluid past a Riga plate with slips and convective conditions: A homotopic solution
  91. Lightweight and high-strength polyarylene ether nitrile-based composites for efficient electromagnetic interference shielding
  92. Review Articles
  93. Recycling waste sources into nanocomposites of graphene materials: Overview from an energy-focused perspective
  94. Hybrid nanofiller reinforcement in thermoset and biothermoset applications: A review
  95. Current state-of-the-art review of nanotechnology-based therapeutics for viral pandemics: Special attention to COVID-19
  96. Solid lipid nanoparticles for targeted natural and synthetic drugs delivery in high-incidence cancers, and other diseases: Roles of preparation methods, lipid composition, transitional stability, and release profiles in nanocarriers’ development
  97. Critical review on experimental and theoretical studies of elastic properties of wurtzite-structured ZnO nanowires
  98. Polyurea micro-/nano-capsule applications in construction industry: A review
  99. A comprehensive review and clinical guide to molecular and serological diagnostic tests and future development: In vitro diagnostic testing for COVID-19
  100. Recent advances in electrocatalytic oxidation of 5-hydroxymethylfurfural to 2,5-furandicarboxylic acid: Mechanism, catalyst, coupling system
  101. Research progress and prospect of silica-based polymer nanofluids in enhanced oil recovery
  102. Review of the pharmacokinetics of nanodrugs
  103. Engineered nanoflowers, nanotrees, nanostars, nanodendrites, and nanoleaves for biomedical applications
  104. Research progress of biopolymers combined with stem cells in the repair of intrauterine adhesions
  105. Progress in FEM modeling on mechanical and electromechanical properties of carbon nanotube cement-based composites
  106. Antifouling induced by surface wettability of poly(dimethyl siloxane) and its nanocomposites
  107. TiO2 aerogel composite high-efficiency photocatalysts for environmental treatment and hydrogen energy production
  108. Structural properties of alumina surfaces and their roles in the synthesis of environmentally persistent free radicals (EPFRs)
  109. Nanoparticles for the potential treatment of Alzheimer’s disease: A physiopathological approach
  110. Current status of synthesis and consolidation strategies for thermo-resistant nanoalloys and their general applications
  111. Recent research progress on the stimuli-responsive smart membrane: A review
  112. Dispersion of carbon nanotubes in aqueous cementitious materials: A review
  113. Applications of DNA tetrahedron nanostructure in cancer diagnosis and anticancer drugs delivery
  114. Magnetic nanoparticles in 3D-printed scaffolds for biomedical applications
  115. An overview of the synthesis of silicon carbide–boron carbide composite powders
  116. Organolead halide perovskites: Synthetic routes, structural features, and their potential in the development of photovoltaic
  117. Recent advancements in nanotechnology application on wood and bamboo materials: A review
  118. Application of aptamer-functionalized nanomaterials in molecular imaging of tumors
  119. Recent progress on corrosion mechanisms of graphene-reinforced metal matrix composites
  120. Research progress on preparation, modification, and application of phenolic aerogel
  121. Application of nanomaterials in early diagnosis of cancer
  122. Plant mediated-green synthesis of zinc oxide nanoparticles: An insight into biomedical applications
  123. Recent developments in terahertz quantum cascade lasers for practical applications
  124. Recent progress in dielectric/metal/dielectric electrodes for foldable light-emitting devices
  125. Nanocoatings for ballistic applications: A review
  126. A mini-review on MoS2 membrane for water desalination: Recent development and challenges
  127. Recent updates in nanotechnological advances for wound healing: A narrative review
  128. Recent advances in DNA nanomaterials for cancer diagnosis and treatment
  129. Electrochemical micro- and nanobiosensors for in vivo reactive oxygen/nitrogen species measurement in the brain
  130. Advances in organic–inorganic nanocomposites for cancer imaging and therapy
  131. Advancements in aluminum matrix composites reinforced with carbides and graphene: A comprehensive review
  132. Modification effects of nanosilica on asphalt binders: A review
  133. Decellularized extracellular matrix as a promising biomaterial for musculoskeletal tissue regeneration
  134. Review of the sol–gel method in preparing nano TiO2 for advanced oxidation process
  135. Micro/nano manufacturing aircraft surface with anti-icing and deicing performances: An overview
  136. Cell type-targeting nanoparticles in treating central nervous system diseases: Challenges and hopes
  137. An overview of hydrogen production from Al-based materials
  138. A review of application, modification, and prospect of melamine foam
  139. A review of the performance of fibre-reinforced composite laminates with carbon nanotubes
  140. Research on AFM tip-related nanofabrication of two-dimensional materials
  141. Advances in phase change building materials: An overview
  142. Development of graphene and graphene quantum dots toward biomedical engineering applications: A review
  143. Nanoremediation approaches for the mitigation of heavy metal contamination in vegetables: An overview
  144. Photodynamic therapy empowered by nanotechnology for oral and dental science: Progress and perspectives
  145. Biosynthesis of metal nanoparticles: Bioreduction and biomineralization
  146. Current diagnostic and therapeutic approaches for severe acute respiratory syndrome coronavirus-2 (SARS-COV-2) and the role of nanomaterial-based theragnosis in combating the pandemic
  147. Application of two-dimensional black phosphorus material in wound healing
  148. Special Issue on Advanced Nanomaterials and Composites for Energy Conversion and Storage - Part I
  149. Helical fluorinated carbon nanotubes/iron(iii) fluoride hybrid with multilevel transportation channels and rich active sites for lithium/fluorinated carbon primary battery
  150. The progress of cathode materials in aqueous zinc-ion batteries
  151. Special Issue on Advanced Nanomaterials for Carbon Capture, Environment and Utilization for Energy Sustainability - Part I
  152. Effect of polypropylene fiber and nano-silica on the compressive strength and frost resistance of recycled brick aggregate concrete
  153. Mechanochemical design of nanomaterials for catalytic applications with a benign-by-design focus
Jetzt anmelden und 20% sparen
Institutioneller Zugang
Wie funktioniert Authentifizierung?
Haben Sie eine Idee, wie wir unsere Website verbessern können?
Bitte schreiben Sie uns.
© 2025 De Gruyter Brill
Heruntergeladen am 10.9.2025 von https://www.degruyterbrill.com/document/doi/10.1515/ntrev-2023-0154/html
Button zum nach oben scrollen