Fabrication and physicochemical characterization of copper oxide–pyrrhotite nanocomposites for the cytotoxic effects on HepG2 cells and the mechanism
-
Yun He
Abstract
Novel CuO–FeS nanocomposites were synthesized to exert anticancer effects on HepG2 cells. The formation was initially demonstrated using UV–Visible spectrophotometry analysis, which indicated two peaks at 335 and 370 nm. Characteristic Fourier transform infrared spectroscopy peaks for Cu–O and Fe–S bonds were observed at 516, 577 and 619 cm−1 in addition to other notable peaks. The Miller indices correspond to the lattice spacing of monoclinic CuO and FeS as observed by selected area diffraction rings concurrent with the X-ray diffraction observations. The morphology was interpreted by scanning electron microscopy and transmission electron microscopy, indicating a particle size of 110 nm. As per energy-dispersive X-ray spectroscopy analysis, strong peaks for Cu (0.9, 8 and 9 keV), Fe (6–7 keV), O (0.5 keV) and S (2.5 keV) indicated the formation of CuO–FeS blend with no impurities. A mean particle size of 121.9 nm and polydispersity index of 0.150 were displayed by dynamic light scattering analysis and the zeta potential was −29.2 mV. The composites were not toxic to normal 3T3-L1 cells and were not haemolytic even at higher doses. In addition, the stable composites exerted cytotoxic effects on HepG2 cells (IC50 = 250 ± 5.7 μg/mL) and induced cell death by creating a loss in mitochondrial membrane potential and induction of mitochondrial apoptosis in a ROS-independent manner.
1 Introduction
Noncommunicable diseases are known to affect the productive population (ages 30– 69) accounting for more than 70% of global deaths each year [1]. Cancer has a noteworthy global noncommunicable disease burden and accounts for approximately 16% of deaths related to this burden [2,3]. Tobacco use, elevated BMI, drug and alcohol abuse, limited intake of dietary fibres and the shortage of physical activity account for more than 30% of the deaths associated with cancer [4]. To address this issue, the World Health Organization has made its strong efforts to reduce the alcohol dependence and provide impartial access to health care for all affected individuals [5].
To progress efficiently with attempts to manage cancer globally, cell lines are primarily used as in vitro models for preclinical cancer research. These cells serve as an unlimited biological resource for drug testing and form a base for the resultant drug discovery [6,7]. As a well-differentiated human hepatoma of a 15-year-old Caucasian with 50–60 chromosomes and a size range of 12–19 µm, HepG2 is an oncogenic model for liver cancer. It is used in studying the metabolism of several anticancer drug candidates. Molecular studies have determined that it is related more to hepatoblastoma, an early childhood malignancy, than to hepatocellular carcinoma as it lacks the expression of hGSTP1 [8].
Cancer registries form the basis for controlling cancer at the national and international levels. In this regard, publications at the global level from several countries provide updated information on several malignancies every year. This is related to the incidence, chronological aspects and projections of cancer-related incidence and mortality. This can help in exploring the current challenges and future perspectives for managing cancer [9,10]. With this background, the American Cancer Society data provide the information that an estimated 41,260 new cases and 30,520 deaths related to liver cancer are expected to occur in the United States alone in 2022 [11]. Additionally, the United States projections for liver cancer in 2023 are 41,210 new cases and 29,380 deaths with a low survival rate of 21% [12]. For the same year, an astounding 4,820,000 new cancer cases and 3,210,000 deaths are projected to happen in China. As the second-most common cause of death after lung cancer, liver cancer accounts for 431,383 new cases and 412,216 deaths [13].
As an alternative to current therapeutic approaches intended for cancer therapy, nanomedicine is projected to fill a global demand with increases of approximately 13% every year. Subsequently, revenue may rise from 8,500 million USD in 2019 to 30,000 billion USD by 2030. Health care and medicine are considered the key sectors for this growth [14]. In this regard, the worldwide market for cancer medications accounted for nearly one-third of the overall nanomedicine arena in 2014 [15]. Although it is a growing market, nanomedicine is still relatively in its infancy due to insufficient research on safety and other guideline issues [16]. To accomplish the increased application of nanomedicine, nanomaterials are comprehensively used in diagnosing, detecting and managing tumours. This may be attained through drug delivery and therapy at the primary or distant sites after they metastasize [17–19].
To achieve the enhanced use of nanomedicine, novel metallic nanoparticles have been developed for everyday use in onco-nanotherapy. In this regard, bimetallic nanoparticles display enhanced therapeutic effects compared to their metallic counterparts with limited systemic toxicity. Therefore, the beneficial effects of both monometallic nanoparticles can be attained simultaneously when used in combination. Hence, improved therapeutic efficacy can be achieved based on the intrinsic properties of the individual material [20]. Metallic nanoparticles fabricated based on copper oxide (CuO) have been used extensively in preclinical trials for use in cancer therapy [21–24]. Although ferrous sulphide (FeS) based nanoparticles have been synthesized for purposes other than in medicine, they are seldom studied for their anticancer effects [25–27]. Furthermore, CuO and iron-based nanoparticles exhibited improved cytotoxic effects on cancer cell lines when used in combination with several other nanomaterials compared to their use alone [28–30]. This may be because their magnetic and other properties related to synergism can make the bimetallic nanoparticles more efficient in their biological applications than their monometallic counterparts [31].
In general, nanocomposites are prepared by combining organic or inorganic compounds with the intention of being created with smaller sizes and larger surface area. They are frequently loaded with standard anticancer drugs, fluorescent probes and other biological macromolecules by covalent or noncovalent contact and/or binding [32,33]. Among bimetallic nanocomposites, CuO is usually prepared and blended with zinc oxide and this nanocomposite is commonly used for antibacterial effects [34–37]. The combination of CuO with zinc oxide and/or graphene oxide as composites has also been tested for cytotoxic effects on a small number of cancer cell lines [38–40]. However, the copper oxide–pyrrhotite (CuO–FeS) composite is a novel blend and has not been studied for use in nanomedicine, especially for cancer therapy. In this connection, we report the synthesis of CuO–FeS nanocomposites and attempt to determine their cytotoxic effects for the first time on HepG2 cells with the probable mechanism involved.
2 Materials and methods
2.1 Preparation of the CuO–FeS composite
All chemicals used for this study were of analytical grade and bought from Sigma Aldrich. In a simple synthesis through the hydrothermal route, 10 mL of 0.01 M Fe(NO3)2, 10 mL of 0.05 M Na2S, 10 mL of 0.01 M Cu(CH3COO)2 and 10 mL of 1 M NaOH aqueous solutions were added into a Teflon beaker, sealed and kept in an autoclave at 220°C for 12 h. After completion of the reaction, the mixture was cooled to room temperature and washed with ethanol and water. Finally, the obtained product was filtered and dried at 60°C overnight in an oven and used further [41–44].
2.2 Physicochemical characterization of the composite
UV–Visible spectrophotometry (UV‒Vis) analysis was performed using Spectramax 190 absorbance reader. The surface properties of the composites were studied using Fourier transform infrared spectroscopy (FTIR) analysis (Perkin Elmer Spectrum RX1 model). Particle size and polydispersity index (PDI) were measured using Particulate Systems model Nano Plus instrument. Zeta potential was determined using Zetasizer Nano ZS (Malvern Panalytical, Malvern, UK). The crystalline nature of the composites was studied using X-ray diffraction (XRD) analysis (D8 ADVANCE, Bruker AXS, Germany). The morphology and diffraction patterns were studied using transmission electron microscopy (TEM) and selected area diffraction (SAED) analysis (JEM-2100 Plus, JEOL Ltd, Japan). Scanning electron microscopy (SEM) and energy-dispersive X-ray spectroscopy (EDAX) analyses were conducted using Thermo Scientific Apreo S instrument (ThermoFisher Scientific, USA).
2.3 Cytotoxic effects of the composite
Human hepatocellular carcinoma cell line HepG2 (ATCC® HB8065™) was cultured in Minimum Essential Media at 1 × 104 cells/well. The media with the cancerous cells was then treated with standard antibiotics (1× antibiotic antimycotic solution) besides 10% fetal bovine serum and incubated at 37°C with 5% CO2. Furthermore, the cells were washed and treated with various concentrations of the composite (25–500 μg/mL) and incubated for 24 h. Later, the medium was aspirated, treated with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (0.5 mg/mL) and incubated at 37°C for 4 h. At the end of the incubation period, MTT was discarded, and the suspension was read at 570 nm using a microplate reader. HepG2 cells were replaced with 3T3-L1 fibroblasts (ATCC® CL-173™) and the same methodology was adopted for safety testing of the composites [45]. The cytotoxic effects of the standard doxorubicin were also determined using the same protocol.
2.4 Hemocompatibility assay
Sheep blood was collected in heparin or sodium citrate tubes and the erythrocytes were instantaneously separated by centrifugation at 3,000 rpm for 5 min. The supernatant was aspirated, and the erythrocytes were washed using phosphate-buffered saline (PBS) and centrifuged again at 3,000 rpm for 5 min. The supernatant was centrifuged thrice until it turned clear. The erythrocyte-containing pellet was then diluted to 1:100 in PBS. Later, 1% erythrocyte solution was prepared and mixed with equal volume of the composites. 10% Triton X-100 was used as a positive control, while PBS was used as a negative control. The blend was incubated at 37°C for 60 min and centrifuged at 3,000 rpm for 5 min. The final supernatant was collected and the absorbance was read at 450 nm using a microplate reader [46]. The activity was expressed via the following formula:
Haemolysis ratio = (OD(test) − OD(negative control))/(OD(positive control) − OD(negative control)) × 100%.
2.5 Mechanistic analysis of the composite–HepG2 interactions
2.5.1 Evaluation of mitochondrial membrane potential (MMP), ROS and acridine orange (AO)-ethidium bromide (EB) staining
The MMP was measured by adhering 2 × 105 cells/well overnight, treating them with composites and incubating for 8 h. After incubation, the cells were loaded with 1 μg/mL rhodamine 123 for 30 min at 37°C. The cells were later washed and observed using a fluorescent microscope (Nikon ECLIPSE TE2000-U). The average fluorescence was studied using ImageJ software and a histogram was plotted [47,48]. For determining the intracellular reactive oxygen species (ROS), 5 × 105 cells were allowed to adhere overnight, treated with the composites and incubated for 8 h. Later, the media was removed and 5 μM H2DCFDA was added and left for 30 min at 37°C. The cells were observed as described above for the MMP assay [49]. For determining the induction of apoptosis, HepG2 cells were treated with dual fluorescence staining solution (1 μL) containing 100 μg/mL AO and 100 μg/mL EB and observed after 20 min using a fluorescent microscope [50]. All these experiments were conducted in triplicate.
2.5.2 Quantitative PCR based analysis of gene expressions
Total RNA was extracted with TRIzol reagent (Ambion, USA) at the IC50 dose and PrimeScript™ 1st strand cDNA Synthesis Kit (TAKARA BIO INC) was used for cDNA synthesis. Furthermore, the reaction was continued at 42°C for 60 min followed by termination at 95°C for 5 min. SYBR® Select Master Mix (Applied Biosystems) was used in a Rotor-Gene Q 2PLEX HRM Real-Time PCR system (Qiagen) for the quantification of each gene using the 2−ΔΔCT method. The conditions applied for enzyme activation were followed as per previous reports with slight modifications. β-actin was used as the internal standard [51–53]. The list of primers used for analysing the expressions of every gene is enlisted in Table 1.
List of primers used for qPCR
| Gene of interest | Primers |
|---|---|
| Bax | FP: 5′ CCTGTGCACCAAGGTGCCGGAACT 3′ |
| RP: 5′ CCACCCTGGTCTTGGATCCAGCCC 3′ | |
| Bcl-2 | FP: 5′ TTTCTCATGGCTGTCCTTCAGGGT 3′ |
| RP: 5′ AGGTCTGGCTTCATACCACAGGTT 3′ | |
| p53 | FP: 5′ GCTGCTCAGATAGCGATGGTC 3′ |
| RP: 5′ CTCCCAGGACAGGCACAAACA 3′ | |
| CASP9 | FP: 5′ AGGCCCCATATGATCGAGGA 3′ |
| RP: 5′ GGCCTGTGTCCTCTAAGCAG 3′ | |
| CASP8 | FP: 5′ AGAGTCTGTGCCCAAATCAAC 3′ |
| RP: 5′ GCTGCTTCTCTCTTTGCTGAA 3′ | |
| CASP3 | FP: 5′ CTGGAATATCCCTGGACAAC 3′ |
| RP: 5′ 5CAGGTCAACAGGTCCATTTG 3′ | |
| β-actin | FP: 5′ GGTCATCACCATTGGCAATGAG 3′ |
| RP: 5′ TACAGGTCTTTGCGGATGTCC 3′ |
2.6 Statistical analyses
The expression of apoptosis-related genes was analysed in triplicate and is presented as the mean ± SEM (P value <0.05 was considered significant). Central composite design of response surface methodology (RSM) was employed for the study. The ideal responses for cell viability of HepG2 cells after being treated with the nanocomposites were determined using Design-Expert software Version 12 (State-Ease Inc., Minneapolis, MN, USA).
3 Results and discussion
3.1 Physicochemical characteristics of the nanocomposites
3.1.1 Surface, structure and morphology
UV‒Vis spectra of CuO was observed at 305 nm which corresponds well to the peak range of 280–380 nm previously reported for CuO nanoparticles [54–56]. The peaks at 310 and 350 nm correspond well to the peak range reported for FeS nanoparticles [57,58]. Two peaks with very minor shift were observed at 335 and 370 nm for the composites. These two peaks relate to the peaks observed for CuO and FeS supporting the formation of the CuO–FeS blend. The minor shift in absorbance is commonly observed during the formation of nanocomposites [59–62] (Figure 1). The FTIR peaks at 517 and 603 cm−1 are due to the existence of CuO. The peak at 3,432 cm−1 is due to the O–H stretching and the peak at 2,963 cm−1 is due to the C–H bonds. The peaks at 1,628 and 1,455 cm−1 are due to the alkenes and C–H stretching, whereas the peaks at 1,377 and 1,162 cm−1 are due to the pyrrole ring and vibrating C–N bonds [63]. Additionally, the peak at 3,388 cm−1 is due to the n (N–H) vibrations, while the peak at 2,347 cm−1 is possibly due to the sp stretching vibrations. The peaks at 1,095 and 618 cm−1 are due to the S–O and Fe–O stretching vibrations [58,64,65]. A combination of these peaks is observed for the CuO–FeS composite. The FTIR peaks for CuO–FeS composites at 516, 577 and 619 cm−1 are a combination of peaks characteristic for the Cu–O and Fe–S bonds. The multiple peaks at the range of 400–1,500 cm−1 are due to the vibrations of the SO4 group. Remarkably, the peaks at 1,636 and 3,435 cm−1 signify the presence of O–H vibrations relating to the chemistry of pyrite surfaces at the nanoscale [63,66–68]. The surface properties of the composite displayed the characteristic features of CuO and FeS as exhibited by the FTIR analysis (Figure 2).
UV–Vis peaks of CuO, FeS and CuO-FeS composites.
FTIR spectra of the CuO, FeS and CuO-FeS composites.
The XRD patterns of CuO, FeS and the CuO–FeS composite are depicted in Figure 3. The diffraction peaks at 2θ = 18.2°, 32.07°, 34.82°, 46.9° and 52.6° corresponds to (001), (101), (203), (206) and (220) monoclinic crystal phases of FeS [69–72]. Similarly, the peaks at 2θ = 32.53°, 37.58°, 48.12°, 50.40°, 62.41°, 70.69° and 72.24° correspond to (110), (111), (−202), (200), (−113), (310) and (311) phases of CuO [37,73–78]. A combination of these peaks is observed for the composite. The crystal planes of the composite as analysed using SAED pattern is presented in Figure 4. The d-spacing values and Miller indices observed in this study correspond to lattice spacing of monoclinic CuO and FeS, respectively [79–83]. These results are consistent with the XRD observations which indicated a particle size of the composites to be 30.5 nm.
XRD pattern of CuO, FeS and the CuO–FeS composites.
Diffraction patterns of the composites determined by SAED.
After the structure and surface characteristics were elucidated, the morphology was studied using TEM. Since TEM is generally used for analysing nanomaterials at diverse magnifications, it was adopted for studying the morphology of the prepared composites [84,85]. According to TEM, the materials had an average size of 110 nm. Furthermore, the morphology of the composites as evidenced by TEM is presented in Figure 5. The SEM observations are presented in Figure 6. The EDAX analysis indicated the elemental composition with peaks for Cu, O, Fe and S confirming the synthesis of CuO–FeS composite as elucidated in Figure 7. The strong peaks at 0.9, 8 and 9 keV signifies the presence of Cu, whereas the peak at 0.5 signifies the presence of O [86–88]. The peaks around 6–7 keV signifies the presence of Fe, whereas the peak around 2.5 keV signifies the presence of S [89,90]. This elucidates the formation of CuO–FeS composite with no impurities.
Morphological analysis of the composites using TEM.
Morphological analysis of the composites using SEM.
Elucidation of elemental composition by EDAX.
3.1.2 Particle size, PDI and zeta potential
To validate the prepared composite further, dynamic light scattering (DLS) was implemented to determine the particle size and PDI. This method is commonly adopted by a diverse network of interacting scientists as a valid method to determine particle characteristics at the nanoscale. It is key to recognize that these two measures are used to indicate the quality of the materials at the nanoscale [91,92]. As per the analysis, the mean particle size was 121.9 nm and the PDI was 0.150. Depending on the width of a hypothetical Gaussian distribution, nanomaterials in the PDI range of 0.1–0.4 are considered moderately polydisperse [93–95].
Since the composites had a mean size less than 200 nm, they are expected to flow out into the tumour microenvironment efficiently. Thus, the composites can be used better in tumour targeting as the vascular spaces of the tumour microenvironment have gaps of 400–600 nm. This is because nanomaterials of sizes less than 200 nm have been verified and found to permeate and amass into the tumour openings through enhanced permeability and retention effect [96–100]. In addition, the uptake of nanomaterials by cancer cells is dependent on their particle size [101]. In this regard, materials with sizes of approximately 100 nm were found to be more effective in being taken up by cancer cells in comparison to their shorter counterparts by clathrin-mediated endocytosis [102,103]. These results suggest that the prepared composites were predominantly monodisperse and are suitable for targeting cancer cells (Figure 8). As particles less than 150 nm can extravasate into the intratumoural environment efficiently, it is interesting to note that the absorption, distribution, metabolism, excretion and biodistribution of nanomaterials with sizes greater than 200 nm can change in vivo. These materials with sizes greater than 200 nm can accumulate systemically in major organs like spleen, lungs, liver and kidney over durations longer than usual. Therefore, particles with sizes around 100 nm are better candidates for drug delivery [104–107]. This is consistent with the particle sizes measured by using DLS (121.9 nm) TEM (110 nm) and XRD (30.5 nm) in this study.
Determination of the average particle size of the composites using DLS.
For determination of the particle size of nanomaterials, DLS, XRD and TEM can be used and each technique has its individual advantages and disadvantages [108]. The particle sizes observed using TEM is generally greater than those observed using XRD [109,110]. This is consistent with the observations of our study. There was no considerable difference in the particle size of the composites as measured by DLS and TEM. The outcomes of DLS and TEM analyses can be used to efficiently determine particle aggregation. If the particle sizes of a material calculated using DLS and TEM remain similar or do not have much difference, the suspended particles are deemed to be free of aggregates [111]. The composites were therefore highly monodisperse, unaggregated and possessed sizes optimum for tumour-targeting. These are the properties largely expected of materials intended for use in nanomedicine [104,112]. Determination of particle size by TEM is dependent on the quantity of particles in a specific area as a measurement of individual geometric size; whereas, DLS-based determination focuses on the intensity of light scattered around the area under investigation and provides the average hydrodynamic size of the nanoparticles. In this regard, DLS is considered a more suitable method for materials used in solvents meant for biological assays [113,114].
Zeta potential is used to define the interfaces of the colloids and the electrolytes in addition to flocculation. The basic mechanism underlying this effect is that the counter ions are attracted, while the coions are believed to repel each other [115]. It is the electrokinetic potential of surface charge involving the electrical dual layer of particles with a thickness of 0.2 nm and is measured in millivolts (mV) [116]. As per our study, the zeta potential of the composite was −29.2 mV (Figure 9). It is generally accepted that nanomaterials with a zeta potential in the range of −10 and +10 mV are considered neutral, whereas particles of potential less than −30 mV are believed to be strongly anionic and stable [93,117]. Additionally, charged and harder nanoparticles with metallic or magnetic behaviour are internalized and easily taken up into the cells. Once these nanomaterials enter the bloodstream and interact with the biomolecules, they can form an active protein corona based on the size, shape and charge of the materials [118]. Materials with such anionic corona are expected to exhibit greater levels of apoptosis [119].
Zeta potential of the nanocomposites.
3.2 Interactions of the composites with cancerous cells and the possible mechanisms
3.2.1 Cytotoxicity of the composites on HepG2 cells
In vitro cell lines have long been used for identifying the clinical outcome of an approach to predict the anticancer effects of a drug under trial. In this process of identifying new drug possibilities, cell lines form the basis for developing a drug by studying the associated mechanisms [120,121]. After exposing the HepG2 cells to the nanocomposites for 24 h, the cytotoxic effects were determined using the MTT assay. The MTT assay is a typical standard and the most common tool used for recognizing cell viability and in turn the cytotoxic effects of preclinical-level drugs to be studied further [122,123]. As per the assay, the cell killing effects were too low at the initial dose of 25 μg/mL (99% viable) and with increasing concentrations, the effects began to progress. The mean percentage of viability was 12.91 ± 0.869 at the highest dose tested of 500 μg/mL (Figure 10). The cytotoxicity of the composites was therefore prominent with increasing concentrations and remained dose-dependent. In this regard, the dose or concentration that can result in reducing the cell growth to 50% in comparison to the control cells or simply the IC50 was calculated to be 250 ± 5.7 μg/mL [124,125]. Although there are no existing reports on the cytotoxic profiling of CuO–FeS nanocomposites, the IC50 of composites prepared based on the combination of CuO with other materials ranges between 6.5 and 169 μg/mL [126,127].
Cytotoxic effects of the composites on HepG2 cells.
In addition, the IC50 of the standard doxorubicin was 12.25 μg/mL or 23 μM (Figure 11). The IC50 value was similar to those supported by previous studies and the cytotoxic effects of doxorubicin are usually observed to be higher than those of any drug under testing, such as nanomaterials [128]. The cytotoxic activities of other such tumour-targeting compounds have been identified to be 5–50 folds lower than that of doxorubicin on HepG2 cells [129].
Cytotoxic effects of doxorubicin on HepG2 cells.
RSM as a mathematical and statistical tool for optimizing several experiments including the optimization of cell viability has been previously reported [130]. It has also been reported to optimize the synthesis of nanoparticles with regard to size and other surface parameters [131–134]. The model f value observed in the study (575.70) indicates that the possibility of this as a result of noise is considerably inadequate (0.01%). The linear model is significant, as the P value is <0.0001. The observed signal-to-noise ratio was 57.989. The predicted R 2 and adjusted R 2 values were 0.9894 and 0.9919, respectively [135,136]. Representing the outcomes of the RSM technique, the contour and response surface plots are presented in Figure 12.
Contour and response surface plots for cell viability.
3.2.2 Nanocomposites decreased MMP and triggered apoptotic cell death in HepG2 cells
MMP is a consistent and dependable indicator of the functioning of mitochondria. An MMP value in the range of −100 to −140 mV is considered optimum for ATP production by living cells. Alternatively, an MMP value of approximately −200 mV is observed in cancer cells owing to their higher metabolic needs. Alterations or decreases in MMP levels can lead to a decrease in cellular ATP levels. Mitochondria are therefore a key target in the induction of apoptosis. Therefore, therapeutic interventions for normalizing MMP levels can help in managing several disorders including cancer [137–140]. Additionally, changes in MMP can cause mitochondrial dysfunction and improper functioning of the cells and eventually lead to a decrease in the synthesis of ATP [141,142]. This reduction in cellular ATP can induce the killing of cancer cells as they display decreased glucose levels due to the Warburg effect [143,144]. Hence, cells with decrease in MMP can eventually undergo apoptosis by releasing cytochrome C from the mitochondria [145]. Accordingly, fluorescent dyes such as rhodamine 123 are used to detect MMP across cells as the rate of reduction in florescence is proportionate to MMP [146,147]. The decreased fluorescence after treatment with the composites at a dose of 250 µg/mL indicates that the MMP was decreased considerably in comparison to the control (Figure 13). This decrease in MMP can account for decreased ATP levels and subsequent glucose deprivation in HepG2 cells treated with the composites.
Composite-mediated reduction in MMP as elucidated by cell fluorescence and quantitative mean fluorescence (*P < 0.01).
Since endocytosis is a key mechanism for the uptake and trafficking of nanomaterials by cancerous cells, they can enter specific organelles such as mitochondria after lysosomal escape resulting in apoptosis among such cells [148,149]. Since a decrease in MMP was evidenced, AO/EB staining was subsequently used to determine the change in morphology and apoptosis in the cancerous HepG2 cells [150–153]. In this study, the number of viable cells decreased significantly after treatment with the composites and amplification of apoptotic characteristics was observed. The colour of the HepG2 cells changed from green to yellowish orange after treatment with composites, indicating early apoptosis [154–156]. These observations indicate that apoptosis was induced in HepG2 cells treated with the composites (Figure 14).
Decreased number of viable cells and the establishment of apoptotic characteristics in HepG2 cells by the composites as determined using AO-EB staining.
3.2.3 Nanocomposites induced ROS-independent apoptosis
The incubation of HepG2 cells with the composite decreased the cellular fluorescence in comparison to the positive control as per DCFDA staining. This indicates decreased production of ROS by the cancer cells after treatment with the composites (Figure 15). In general, nanomaterials produce ROS to promote cancer cell death and oxidative stress is a vital mechanism for this cytotoxic effect of metal-based nanomaterials [157–159]. However, the nanotoxicity profile of materials is significantly dependent on the overproduction of ROS leading to oxidative stress. This can lead to a consequent failure in the regular physiological redox-dependent functioning and progression to diseases like cancer. Therefore, the generation of ROS is considered to be an adverse effect of nanomaterial interaction with cells of multiple origins. Hence, redox imbalance is not preferred for therapeutic interventions of diseases and regulating ROS remains key for managing diseases like cancer. The production and after-effects of ROS is dependent on the particle size, shape, surface, dissolution, aggregation and the manner in which they interact with cells [160,161]. Hence, it is important to note that overproduction of ROS can possibly promote the nanotoxic effects of materials being tested for therapeutic benefits. A significant number of studies elucidate that apoptosis can be triggered regardless of the production of ROS as they are not the effectors of an apoptotic trigger. In such cases, loss of MMP and induction of apoptosis was observed although there was a decrease in production of intracellular ROS. In these ROS-independent mechanisms of cell death, ROS is primarily observed as a side-effect of apoptosis. Additionally, the adverse effects on normal cells remain minimal in such modes of cell death [162].
Effects of the composites on ROS of HepG2 cells as elucidated by cell fluorescence and quantitative mean fluorescence (*P < 0.01).
Loss of mitochondria membrane potential and limited production of ROS reveal that the cell death was caused with mitochondria as the organelle being targeted [163–165]. This ROS-independent mechanisms can reduce the unwanted side-effects on normal cells and result in enhanced uptake and targeting of the cancer cells which is usually expected in nano-oncotherapy [166,167]. ROS-independent apoptosis is not so widely studied or observed in cancer cells, especially in nanoparticle-mediated cancer therapy. It is therefore thought of as a highly valued therapeutic approach and the one to be appreciated more for its enhanced and specific targeting of the mitochondria and subsequently the tumour [168,169]. The results of investigating the intracellular ROS determine that the composites decreased the generation of ROS and specifically targeted the mitochondria which could be beneficial in minimizing the side effects of cancer therapy commonly observed while using nanomaterials. This can protect the normal cells from the outcomes of nonspecific targeting, a common consequence of nanomaterial usage.
3.2.4 Quantitative PCR based analysis of gene expressions
Since the cytotoxic effects of the composite were determined, the probable mechanisms of such effects have been elucidated in the following section. Among the methods for determining the mechanisms of cytotoxic effects, quantitative PCR is an easy, sensitive and reliable method to determine the differential expression of genes at the molecular levels [170–172]. In this type of quantification, upregulated expression of a target gene is determined by a positive fold change, whereas the downregulation of a gene expression is determined by a negative fold change [53]. This can help in identifying the biological markers for a disease and improve the therapeutic efficacy of a drug precisely [173]. Considering these advantages, the expression of six different genes related to apoptosis were analysed among the composite-treated and nontreated cells. The genes such as Bax, Bcl-2, CASP8, CASP9, CASP3 and p53 are classic components of apoptosis and were therefore studied [174].
First, caspases are endoproteases that can cause breaks in peptide bonds known to assist aspartic acid in initiation and execution of apoptosis. Even though the “isoleucine–glutamic acid–threonine–aspartic acid” is a target motif for CASP8, it can also cleave the “aspartic acid–glutamic acid–valine–aspartic acid” motif of CASP3 and aid in the suppression of malignant transformations through extrinsic apoptosis [175–178]. This may cause an apoptotic trigger based on ER-stress through the formation of a stressosome [179,180].
Additionally, Bcl-2 is an anti-apoptotic gene upregulated in several cancers which can antagonize the effects of pro-apoptotic Bax, leading to reduced release of cytochrome C. The upregulation of Bcl-2 can promote resistance among cancer cells. Since the Bcl-2 family is known to possess both pro-apoptotic and anti-apoptotic members, the upregulation of Bax, a pro-apoptotic domain and target of p53 can induce apoptosis in harmony. In addition, the increased expressions of CASP9 can cleave Bcl-2 and result in mitochondrial damage by the amplification of the caspase-cascade [181–186]. Since Bcl-2 was downregulated in the study, the role of CASP9 becomes significant.
In this study, the components of initiator caspases such as CASP8 and CASP9 along with the executioner caspase CASP3 were studied. The expressions of the executioner caspase CASP3 and the initiator caspases such as CASP8 and CASP9 were found to be upregulated [187]. Furthermore, the release of cytochrome C could be a critical constituent responsible for activation of an apoptotic trigger [188]. The involvement of caspase-cascade and cytochrome C release along with p53 (known to be a tumour suppressor involved in cell cycle arrest, senescence and apoptosis) being engaged can lead to intrinsic apoptosis. Eventually, the CASP3 release can trigger apoptosis as the final outcome. The upregulation of the caspase-cascade suggests that the probable mechanism of cell death induced by the composite was dependent on both intrinsic (upregulation of CASP9) and extrinsic (upregulation of CASP8) apoptosis. Generally, after being internalized into the cytosol, cytochrome C can combine with apoptosis activating factor-1 (Apaf-1) to form the apoptosome, leading to the activation of procaspase-9 and subsequent activation of CASP9. The so-formed CASP9 can activate CASP3 leading to the induction of apoptosis [189–191]. This confirms that the composite can activate ROS-independent mitochondrial apoptosis of HepG2 cells by involving both the extrinsic and intrinsic modes (Figure 16). The mechanism of cytotoxic effects of the composite is pictorially presented in Figure 17.
Fold change over control of apoptotic genes in HepG2 cells using quantitative PCR. The changes in P value (*P < 0.05, # P < 0.1) are considered significant in comparison to the control.
Pictorial representation of the mechanism of cytotoxic effects of the composites.
3.3 Safety testing and hemocompatibility of the nanocomposites
To test the safety of nanocomposites, normal 3T3-L1 fibroblasts with the ability to differentiate into white adipocytes were used [192,193]. Specific targeting of any drug under analysis to be used as an anticancer drug, is typically conducted on normal cell lines and compared with the effect on cancer cells [194,195]. It is widely accepted that drugs with the ability to target cancer cells precisely are not toxic to normal cells [196]. The outcomes of the study indicate that the composites were competent in targeting cancerous HepG2 cells in comparison to normal 3T3-L1 fibroblasts. This is based on the observation that the IC50 for toxic effects on normal cells was not reached at the maximum concentration tested (500 μg/mL). More than 95% of the cells were viable at the tested dose (Figure 18). Therefore, the outcomes indicate that the composites were cytotoxic to cancerous HepG2 cells and not toxic to normal 3T3-L1 cells. This signifies that the composites are safe for use in cancer therapy.
Safety testing of the composites on normal 3T3-L1 fibroblasts.
Measurement of hemocompatibility is an important tool for assessing the credential of an agent to be used in medicine and its application in vivo. The agent to be tested must not create any adverse effect on blood after being treated. No significant toxic effects such as thrombosis, haemolysis, platelet, leukocyte and complement activation or other blood-associated adverse effects should be observed after the composite (the test agent in this study) is being treated. In this regard, the analysis was performed using blood as an in vitro model for interactions with biological materials. Using an in vitro model has several advantages over using in vivo models. Well-controlled settings, such as blood flow and anticoagulation in vitro, can eradicate factors such as flow obstruction, surgical interventions and effects related to the usage of tissues [197,198].
For systemic administration of drug candidates such as nanomaterials, hemocompatibility tests seem essential for analysing immunological outcomes [199]. This is because nanomaterials can interact directly with blood, cells and tissues and their physicochemical properties determine their hemocompatibility [200]. Relatedly, the composites showed no haemolytic effects even at a dose of 500 µg/mL, the dose at which the haemolysis ratio was only 2.03 ± 0.93 in comparison to the 100% lytic effect of Triton X 100 (10%) (Figure 19). Based on the outcomes of safety testing on normal cells and the hemocompatibility assay, the composites were deemed to possess excellent biocompatibility [201,202].
Hemocompatibility of the nanocomposites.
4 Conclusions
Novel CuO–FeS nanocomposites were prepared through a facile route and physicochemically characterized using standard techniques where the outcomes determine the formation of the CuO–FeS blend. Initially, the UV‒Vis and FTIR analyses indicated stable peaks representing the optical and surface characteristics relating to the fabrication of the composite. The observations of SAED rings and XRD patterns were concurrent. The morphology was determined by TEM and SEM; whereas, the elemental composition was determined using EDAX and no impurities other than constituents of CuO–FeS were observed. The composites were stable, free of aggregates and effective in tumour targeting according to the determination of zeta potential and elucidation of particle size using DLS. These stable nanocomposites possessed cytotoxic effects on HepG2 cells by creating a loss in MMP and induction of mitochondrial apoptosis in a ROS-independent manner. The composites were not cytotoxic to normal 3T3-L1 cells and were not haemolytic at higher concentrations; therefore, they are extremely biocompatible. Further in vivo studies are warranted to determine the clinical efficacy of the composite in the management of cancer.
-
Funding information: This study was supported by the Jiangsu Clinical Innovation Center of Digestive Cancer of Traditional Chinese Medicine (No. 2021.6) and the Medical Scientific Research Key Project of Jiangsu Provincial Health Commission (No. ZD2022020).
-
Author contributions: All authors have accepted responsibility for the entire content of this manuscript and approved its submission.
-
Conflict of interest: The authors state no conflict of interest.
References
[1] Boakye H, Atabila A, Hinneh T, Ackah M, Ojo-Benys F, Bello AI. The prevalence and determinants of non-communicable diseases among Ghanaian adults: a survey at a secondary healthcare level. PLoS One. 2023;18:e0281310.10.1371/journal.pone.0281310Search in Google Scholar PubMed PubMed Central
[2] Nethan S, Sinha D, Mehrotra R. Non communicable disease risk factors and their trends in India. Asian Pac J Cancer Prev. 2017;18:2005–10.Search in Google Scholar
[3] Khaltaev N, Axelrod S. Global lung cancer mortality trends and lifestyle modifications: preliminary analysis. Chin Med J. 2020;133:1526–32.10.1097/CM9.0000000000000918Search in Google Scholar PubMed PubMed Central
[4] Ramesh S, Kosalram K. The burden of non-communicable diseases: a scoping review focus on the context of India. J Educ Health Promot. 2023;12:41.10.4103/jfmpc.jfmpc_801_23Search in Google Scholar
[5] Bennett JE, Stevens GA, Mathers CD, Bonita R, Rehm J, Kruk ME, et al. NCD Countdown 2030 collaborators NCD Countdown 2030: worldwide trends in non-communicable disease mortality and progress towards sustainable development goal target 3.4. Lancet (London, Engl). 2018;392:1072–88.10.1016/S0140-6736(18)31992-5Search in Google Scholar PubMed
[6] Mirabelli P, Coppola L, Salvatore M. Cancer cell lines are useful model systems for medical research. Cancers (Basel). 2019;11:1098.10.3390/cancers11081098Search in Google Scholar PubMed PubMed Central
[7] Idrisova KF, Simon HU, Gomzikova MO. Role of patient-derived models of cancer in translational oncology. Cancers. 2022;15(1):139.10.3390/cancers15010139Search in Google Scholar PubMed PubMed Central
[8] Arzumanian VA, Kiseleva OI, Poverennaya EV. The curious case of the HepG2 cell line: 40 years of expertise. Int J Mol Sci. 2021;22:13135.10.3390/ijms222313135Search in Google Scholar PubMed PubMed Central
[9] Mathur P, Sathishkumar K, Chaturvedi M, Das P, Sudarshan KL, Santhappan S, et al. Cancer statistics, 2020: report from national cancer registry programme, India. JCO Glob Oncol. 2020;6:1063–75.10.1200/GO.20.00122Search in Google Scholar PubMed PubMed Central
[10] Singh D, Vignat J, Lorenzoni V, Eslahi M, Ginsburg O, Lauby-Secretan B, et al. Global estimates of incidence and mortality of cervical cancer in 2020: a baseline analysis of the WHO global cervical cancer elimination initiative. Lancet Glob Health. 2023;11:e197–206.10.1016/S2214-109X(22)00501-0Search in Google Scholar PubMed PubMed Central
[11] Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer statistics. CA Cancer J Clin. 2022;72:7–33.10.3322/caac.21708Search in Google Scholar PubMed
[12] Siegel RL, Miller KD, Wagle NS, Jemal A. Cancer statistics. CA Cancer J Clin. 2023;73:17–48.10.3322/caac.21763Search in Google Scholar PubMed
[13] Xia C, Dong X, Li H, Cao M, Sun D, He S, et al. Cancer statistics in China and United States, 2022: profiles, trends, and determinants. Chin Med J (Engl). 2022;135:584–90.10.1097/CM9.0000000000002108Search in Google Scholar PubMed PubMed Central
[14] Pandey G, Jain P. Assessing the nanotechnology on the grounds of costs, benefits, and risks. Beni-Suef Univ J Basic Appl Sci. 2020;9:63.10.1186/s43088-020-00085-5Search in Google Scholar
[15] Morigi V, Tocchio A, Bellavite Pellegrini C, Sakamoto JH, Arnone M, Tasciotti E. Nanotechnology in medicine: from inception to market domination. J Drug Deliv. 2012;2012:389485.10.1155/2012/389485Search in Google Scholar PubMed PubMed Central
[16] Ventola CL. Progress in nanomedicine: approved and investigational nanodrugs. Pharm Therapeut. 2017;42:742–55.Search in Google Scholar
[17] Zhang Y, Li M, Gao X, Chen Y, Liu T. Nanotechnology in cancer diagnosis: progress, challenges and opportunities. J Hematol Oncol. 2019;12:137.10.1186/s13045-019-0833-3Search in Google Scholar PubMed PubMed Central
[18] Mu Q, Wang H, Zhang M. Nanoparticles for imaging and treatment of metastatic breast cancer. Expert Opin Drug Deliv. 2017;14:123–36.10.1080/17425247.2016.1208650Search in Google Scholar PubMed PubMed Central
[19] Avula LR, Grodzinski P. Nanotechnology-aided advancement in the combating of cancer metastasis. Cancer Metastasis Rev. 2022;41:383–404.10.1007/s10555-022-10025-7Search in Google Scholar PubMed PubMed Central
[20] Makada H, Habib S, Singh M. Bimetallic nanoparticles as suitable nanocarriers in cancer therapy. Sci Afr. 2023;20:e01700.10.1016/j.sciaf.2023.e01700Search in Google Scholar
[21] Talebian S, Shahnavaz B, Nejabat M, Abolhassani Y, Rassouli FB. Bacterial-mediated synthesis and characterization of copper oxide nanoparticles with antibacterial, antioxidant, and anticancer potentials. Front Bioeng Biotechnol. 2023;11:1140010.10.3389/fbioe.2023.1140010Search in Google Scholar PubMed PubMed Central
[22] Balaji T, Manushankar CM, Al-Ghanim KA, Kamaraj C, Thirumurugan D, Thanigaivel S, et al. Padina boergesenii-mediated copper oxide nanoparticles synthesis, with their antibacterial and anticancer potential. Biomedicines. 2023;11:2285.10.3390/biomedicines11082285Search in Google Scholar PubMed PubMed Central
[23] Karthika S, Kanchana P, Prabha Devi B, Shanmuga, Sundari S. Antibacterial and anticancer activity (PANC-1) of green synthesized copper oxide nanoparticles from Catharanthus roseus. Inorg Nano-Metal Chem. 2023;1–9.10.1080/24701556.2023.2228777Search in Google Scholar
[24] Mahmood RI, Kadhim AA, Ibraheem S, Albukhaty S, Mohammed-Salih HS, Abbas RH, et al. Biosynthesis of copper oxide nanoparticles mediated Annona muricata as cytotoxic and apoptosis inducer factor in breast cancer cell lines. Sci Rep. 2022;12:16165.10.1038/s41598-022-20360-ySearch in Google Scholar PubMed PubMed Central
[25] Fu X-Z, Wu J, Li J, Ding J, Cui S, Wang X-M, et al. Heavy-metal resistant bio-hybrid with biogenic ferrous sulfide nanoparticles: pH-regulated self-assembly and wastewater treatment application. J Hazard Mater. 2023;446:130667.10.1016/j.jhazmat.2022.130667Search in Google Scholar PubMed
[26] Wang J, Sun Z, Wang S, Zhao C, Xu J, Gao S, et al. Biodegradable ferrous sulfide-based nanocomposites for tumor theranostics through specific intratumoral acidosis-induced metabolic symbiosis disruption. J Am Chem Soc. 2022;144:19884–95.10.1021/jacs.2c07669Search in Google Scholar PubMed
[27] Varalakshmi GS, Pawar CS, Selvam R, Pearl WG, Manikantan V, Pillai AS, et al. Magnetic and photothermally active iron sulfide nanocarriers: enhanced in vitro activity of dysprosium-doped material. Inorg Chem Commun. 2023;111159:156.10.1016/j.inoche.2023.111159Search in Google Scholar
[28] Sarfraz MH, Zubair M, Aslam B, Ashraf A, Siddique MH, Hayat S, et al. Comparative analysis of phyto-fabricated chitosan, copper oxide, and chitosan-based CuO nanoparticles: antibacterial potential against Acinetobacter baumannii isolates and anticancer activity against HepG2 cell lines. Front Microbiol. 2023;14:1188743.10.3389/fmicb.2023.1188743Search in Google Scholar PubMed PubMed Central
[29] Yi J, Luo X, Xing J, Gedanken A, Lin X, Zhang C, et al. Micelle encapsulation zinc‐doped copper oxide nanocomposites reverse Olaparib resistance in ovarian cancer by disrupting homologous recombination repair. Bioeng Transl Med. 2023;8:e10507.10.1002/btm2.10507Search in Google Scholar PubMed PubMed Central
[30] Attia NF, Abd El-Monaem EM, El-Aqapa HG, Elashery SE, Eltaweil AS, El Kady M, et al. Iron oxide nanoparticles and their pharmaceutical applications. Appl Surf Sci Adv. 2022;11:100284.10.1016/j.apsadv.2022.100284Search in Google Scholar
[31] Huynh KH, Pham XH, Kim J, Lee SH, Chang H, Rho WY, et al. Synthesis, properties, and biological applications of metallic alloy nanoparticles. Int J Mol Sci. 2020;21(14):5174. 10.3390/ijms21145174.Search in Google Scholar PubMed PubMed Central
[32] Wang X, Cheng L. Multifunctional two-dimensional nanocomposites for photothermal-based combined cancer therapy. Nanoscale. 2019;11:15685–708.10.1039/C9NR04044GSearch in Google Scholar
[33] Sen M. Nanocomposite materials. Nanotechnol Environ. 2020;1–12. 10.5772/intechopen.93047.Search in Google Scholar
[34] Widiarti N, Sae J, Wahyuni S. Synthesis CuO–ZnO nanocomposite and its application as an antibacterial agent. IOP Conference Series: materials science and engineering. IOP Publishing; 2017. p. 012036.10.1088/1757-899X/172/1/012036Search in Google Scholar
[35] Bandekar SS, Hosamane SN, Patil C, Yaragatti A, Hukerikar A, Patil S, et al. ZnO–CuO nanocomposites: synthesis, characterization and antibacterial activity. Journal of Physics: Conference Series. IOP Publishing; 2020. p. 012018.10.1088/1742-6596/1706/1/012018Search in Google Scholar
[36] Govindasamy GA, Mydin RBSMN, Sreekantan S, Harun NH. Compositions and antimicrobial properties of binary ZnO–CuO nanocomposites encapsulated calcium and carbon from Calotropis gigantea targeted for skin pathogens. Sci Rep. 2021;11:99.10.1038/s41598-020-79547-wSearch in Google Scholar PubMed PubMed Central
[37] Al Baroot A, Alheshibri M, Drmosh QA, Akhtar S, Kotb E, Elsayed KA. A novel approach for fabrication ZnO/CuO nanocomposite via laser ablation in liquid and its antibacterial activity. Arab J Chem. 2022;15:103606.10.1016/j.arabjc.2021.103606Search in Google Scholar
[38] Cao Y, Dhahad HA, El-Shorbagy MA, Alijani HQ, Zakeri M, Heydari A, et al. Green synthesis of bimetallic ZnO–CuO nanoparticles and their cytotoxicity properties. Sci Rep. 2021;11:23479.10.1038/s41598-021-02937-1Search in Google Scholar PubMed PubMed Central
[39] Adeyemi JO, Onwudiwe DC, Oyedeji AO. Biogenic synthesis of CuO, ZnO, and CuO–ZnO nanoparticles using leaf extracts of dovyalis caffra and their biological properties. Molecules. 2022;27:3206.10.3390/molecules27103206Search in Google Scholar PubMed PubMed Central
[40] Ganesan K, Jothi VK, Natarajan A, Rajaram A, Ravichandran S, Ramalingam S. Green synthesis of copper oxide nanoparticles decorated with graphene oxide for anticancer activity and catalytic applications. Arab J Chem. 2020;13:6802–14.10.1016/j.arabjc.2020.06.033Search in Google Scholar
[41] Xian G, Niu L, Zhang G, Zhou N, Long Z, Zhi R. An efficient CuO–γFe2O3 composite activates persulfate for organic pollutants removal: performance, advantages and mechanism. Chemosphere. 2020;242:125191.10.1016/j.chemosphere.2019.125191Search in Google Scholar PubMed
[42] Rahmah MI. Novel triple hydrothermal method for preparation of CuO/Fe2O3/Ag2O nanocomposite with antimicrobial application. Inorg Nano-Metal Chem. 2023;1–6. 10.1080/24701556.2023.2165680.Search in Google Scholar
[43] Nandhakumar E, Priya P, Selvakumar P, Vaishnavi E, Sasikumar A, Senthilkumar N. One step hydrothermal green approach of CuO/Ag nanocomposites: analysis of structural, biological activities. Mater Res Express. 2019;6:095036.10.1088/2053-1591/ab2eb9Search in Google Scholar
[44] Abdulnabi G, Juda AM. Characterization and synthesis of α-Fe2O3 nanoparticles and α-Fe2O3/CuO nanocomposite by hydrothermal method and application them in a solar cell. J Surv Fish Sci. 2023;10:4224–34.10.36329/jkcm/2023/v2.i10.10699Search in Google Scholar
[45] Florento L, Matias R, Tuaño E, Santiago K, dela Cruz F, Tuazon A. Comparison of cytotoxic activity of anticancer drugs against various human tumor cell lines using in vitro cell-based approach. Int J Biomed Sci. 2012;8:76.10.59566/IJBS.2012.8076Search in Google Scholar
[46] Jiang W, Xie Z, Huang S, Huang Q, Chen L, Gao X, et al. Targeting cariogenic pathogens and promoting competitiveness of commensal bacteria with a novel pH-responsive antimicrobial peptide. J Oral Microbiol. 2023;15:2159375.Search in Google Scholar
[47] Biswas R, Mondal A, Chatterjee S, Ahn J. Evaluation of synergistic effects of sulforaphene with photodynamic therapy in human cervical cancer cell line. Lasers Med Sci. 2016;31:1675–82.10.1007/s10103-016-2037-1Search in Google Scholar PubMed
[48] Jakic B, Buszko M, Cappellano G, Wick G. Elevated sodium leads to the increased expression of HSP60 and induces apoptosis in HUVECs. PLoS One. 2017;12:e0179383.10.1371/journal.pone.0179383Search in Google Scholar PubMed PubMed Central
[49] Ling L, Tan K, Lin H, Chiu G. The role of reactive oxygen species and autophagy in safingol-induced cell death. Cell Death Dis. 2011;2:e129.10.1038/cddis.2011.12Search in Google Scholar PubMed PubMed Central
[50] Lalitha P, Veena V, Vidhyapriya P, Lakshmi P, Krishna R, Sakthivel N. Anticancer potential of pyrrole (1, 2, a) pyrazine 1, 4, dione, hexahydro 3-(2-methyl propyl)(PPDHMP) extracted from a new marine bacterium, Staphylococcus sp. strain MB30. Apoptosis. 2016;21:566–77.10.1007/s10495-016-1221-xSearch in Google Scholar PubMed
[51] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25:402–8.10.1006/meth.2001.1262Search in Google Scholar PubMed
[52] Jacob JA, Shanmugam A. Silver nanoparticles provoke apoptosis of Dalton’s ascites lymphoma in vivo by mitochondria dependent and independent pathways. Colloids Surf B: Biointerfaces. 2015;136:1011–6.10.1016/j.colsurfb.2015.11.004Search in Google Scholar PubMed
[53] Jiang Z, Liu J, Chen B, Mani R, Pugazhendhi A, Shanmuganathan R, et al. Cytotoxic effects of a sesquiterpene β-elemene on THP-1 leukemia cells is mediated via crosstalk between beclin-1 mediated autophagy and caspase-dependent apoptosis. Process Biochem. 2019;87:174–8.10.1016/j.procbio.2019.09.006Search in Google Scholar
[54] Keabadile OP, Aremu AO, Elugoke SE, Fayemi OE. Green and traditional synthesis of copper oxide nanoparticles—comparative study. Nanomaterials. 2020;10:2502.10.3390/nano10122502Search in Google Scholar PubMed PubMed Central
[55] Naika HR, Lingaraju K, Manjunath K, Kumar D, Nagaraju G, Suresh D, et al. Green synthesis of CuO nanoparticles using Gloriosa superba L. extract and their antibacterial activity. J Taibah Univ Sci. 2015;9:7–12.10.1016/j.jtusci.2014.04.006Search in Google Scholar
[56] Manasa D, Chandrashekar K, Kumar DM, Niranjana M, Navada KM. Mussaenda frondosa L. mediated facile green synthesis of copper oxide nanoparticles – characterization, photocatalytic and their biological investigations. Arab J Chem. 2021;14:103184.10.1016/j.arabjc.2021.103184Search in Google Scholar
[57] Turali‐Emre ES, Emre AE, Vecchio DA, Kadiyala U, VanEpps JS, Kotov NA. Self‐organization of iron sulfide nanoparticles into complex multicompartment supraparticles. Adv Mater. 2023;35:2211244.10.1002/adma.202211244Search in Google Scholar PubMed PubMed Central
[58] Agoro MA, Meyer EL. FeS/FeS2 nanoscale structures synthesized in one step from Fe(ll) dithiocarbamate complexes as a single source precursor. Front Chem. 2022;10:1035594.10.3389/fchem.2022.1035594Search in Google Scholar PubMed PubMed Central
[59] Elhalawany N, Abdel-karim AM, Saleeb MM. Preparation and evaluation of some nanocarbon (NC) based composites for optoelectronic applications. Sci Rep. 2023;13:8987.10.1038/s41598-023-35754-9Search in Google Scholar PubMed PubMed Central
[60] Ahmad M, Nadeem S, Hassan S, Jamil S, Javed M, Mohyuddin A, et al. UV/VIS absorption properties of metal sulphate polymer nanocomposites. Dig J Nanomater Biostruct. 2021;16:15.10.15251/DJNB.2021.164.1557Search in Google Scholar
[61] Mujahid A, Dickert FL. Chapter 6 – Molecularly imprinted polymers for sensors: comparison of optical and mass-sensitive detection. In: Li S, Ge Y, Piletsky SA, Lunec J, editors. Molecularly imprinted sensors. Amsterdam: Elsevier; 2012. p. 125–59.10.1016/B978-0-444-56331-6.00006-2Search in Google Scholar
[62] Ahmad MA, Aslam S, Mustafa F, Arshad U. Synergistic antibacterial activity of surfactant free Ag-GO nanocomposites. Sci Rep. 2021;11:196.10.1038/s41598-020-80013-wSearch in Google Scholar PubMed PubMed Central
[63] Elango M, Deepa M, Subramanian R, Mohamed Musthafa A. Synthesis, characterization, and antibacterial activity of polyindole/Ag–Cuo nanocomposites by reflux condensation method. Polym Technol Eng. 2018;57:1440–51.10.1080/03602559.2017.1410832Search in Google Scholar
[64] Yin L, Mi N, Yao Y-R, Li J, Zhang Y, Yang S-G, et al. Efficient removal of Cr(VI) by tannic acid-modified FeS nanoparticles: performance and mechanisms. Water Sci Eng. 2021;14:210–8.10.1016/j.wse.2021.08.006Search in Google Scholar
[65] Middya S, Layek A, Dey A, Ray PP. Synthesis of nanocrystalline FeS2 with increased band gap for solar energy harvesting. J Mater Sci Technol. 2014;30:770–5.10.1016/j.jmst.2014.01.005Search in Google Scholar
[66] Radoń A, Łukowiec D. The structure and formation mechanism of FeS2/Fe3S4/S8 nanocomposite synthesized using spherical shaped Fe3O4 nanoparticles as the precursor. Int J Mater Res. 2019;110:75–81.10.3139/146.111670Search in Google Scholar
[67] Bhavyasree PG, Xavier TS. Green synthesis of copper oxide/carbon nanocomposites using the leaf extract of Adhatoda vasica Nees, their characterization and antimicrobial activity. Heliyon. 2020;6:e03323.10.1016/j.heliyon.2020.e03323Search in Google Scholar PubMed PubMed Central
[68] Umoren PS, Kavaz D, Nzila A, Sankaran SS, Umoren SA. Biogenic synthesis and characterization of chitosan–CuO nanocomposite and evaluation of antibacterial activity against gram-positive and -negative bacteria. Polymers (Basel). 2022;14:1832.10.3390/polym14091832Search in Google Scholar PubMed PubMed Central
[69] Paca AM, Ajibade PA. Synthesis, optical, and structural studies of iron sulphide nanoparticles and iron sulphide hydroxyethyl cellulose nanocomposites from bis-(dithiocarbamato) iron(ii) single-source precursors. Nanomaterials. 2018;8:187.10.3390/nano8040187Search in Google Scholar PubMed PubMed Central
[70] Bhattacharjee S, Habib F, Darwish N, Shanableh A. Iron sulfide nanoparticles prepared using date seed extract: green synthesis, characterization and potential application for removal of ciprofloxacin and chromium. Powder Technol. 2021;380:219–28.10.1016/j.powtec.2020.11.055Search in Google Scholar
[71] Roberts DM, Landin AR, Ritter TG, Eaves JD, Stoldt CR. Nanocrystalline iron monosulfides near stoichiometry. Sci Rep. 2018;8:6591.10.1038/s41598-018-24739-8Search in Google Scholar PubMed PubMed Central
[72] Kassim A, Min HSS, Yee LY, Nagalingam S. Structural and morphological characterization of chemical bath deposition of FeS thin films in the presence of sodium tartrate as a complexing agent. Sci Eng Health Stud. 2010;4:36–42.Search in Google Scholar
[73] Chand Mali S, Raj S, Trivedi R. Biosynthesis of copper oxide nanoparticles using Enicostemma axillare (Lam.) leaf extract. Biochem Biophysics Rep. 2019;20:100699.10.1016/j.bbrep.2019.100699Search in Google Scholar PubMed PubMed Central
[74] Bin Mobarak M, Hossain MS, Chowdhury F, Ahmed S. Synthesis and characterization of CuO nanoparticles utilizing waste fish scale and exploitation of XRD peak profile analysis for approximating the structural parameters. Arab J Chem. 2022;15:104117.10.1016/j.arabjc.2022.104117Search in Google Scholar
[75] Mashentseva AA, Barsbay M, Zdorovets MV, Zheltov DA, Güven O. Cu/cuo composite track-etched membranes for catalytic decomposition of nitrophenols and removal of as (III). Nanomaterials. 2020;10:1552.10.3390/nano10081552Search in Google Scholar PubMed PubMed Central
[76] Shehab MA, Sharma N, Valsesia A, Karacs G, Kristály F, Koós T, et al. Preparation and photocatalytic performance of TiO2 nanowire-based self-supported hybrid membranes. Molecules. 2022;27:2951.10.3390/molecules27092951Search in Google Scholar PubMed PubMed Central
[77] Mohamed EA. Green synthesis of copper & copper oxide nanoparticles using the extract of seedless dates. Heliyon. 2020;6:e03123.10.1016/j.heliyon.2019.e03123Search in Google Scholar PubMed PubMed Central
[78] Kacziba B, Szierer Á, Mészáros E, Rónavári A, Kónya Z, Feigl G. Exploration the homeostasis of signaling molecules in monocotyledonous crops with different CuO nanoparticle tolerance. Plant Stress. 2023;7:100145.10.1016/j.stress.2023.100145Search in Google Scholar
[79] Al-Hossainy AF, Zoromba MS, Hassanien R. Eco-friendly method to synthesize and characterize 2D nanostructured (1, 2-bis (diphenyl-phosphino) ethyl) tungsten tetracarbonyl methyl red/copper oxide di-layer thin films. Bull Mater Sci. 2018;41:1–9.10.1007/s12034-018-1594-2Search in Google Scholar
[80] Dhara K, Ramachandran T, Nair BG, Babu TS. Single step synthesis of Au–CuO nanoparticles decorated reduced graphene oxide for high performance disposable nonenzymatic glucose sensor. J Electroanal Chem. 2015;743:1–9.10.1016/j.jelechem.2015.02.005Search in Google Scholar
[81] Desalegn T, Murthy H, Ravikumar C, Nagaswarupa H. Green synthesis of CuO nanostructures using Syzygium guineense (Willd.) DC plant leaf extract and their applications. J Nanostruct. 2021;11:81–94.10.1007/s13204-020-01620-7Search in Google Scholar
[82] Zhao D, Tu C-M, Hu X-J, Zhang N. Notable in situ surface transformation of Cu2O nanomaterials leads to dramatic activity enhancement for CO oxidation. RSC Adv. 2017;7:37596–603.10.1039/C7RA05950GSearch in Google Scholar
[83] Moreno Flores EA. Precipitation and transformation of iron-sulfide nanoparticles in low-temperature aqueous environment: effects of reactant iron and sulfide sources. Open Access Thesis & Dissertations, University of Texas at El Paso, 123, 2019.Search in Google Scholar
[84] Liu X, Shan K, Shao X, Shi X, He Y, Liu Z, et al. Nanotoxic effects of silver nanoparticles on normal HEK-293 cells in comparison to cancerous HeLa cell line. Int J Nanomed. 2021;16:753.10.2147/IJN.S289008Search in Google Scholar PubMed PubMed Central
[85] Salem SS. A mini review on green nanotechnology and its development in biological effects. Arch Microbiol. 2023;205:128.10.1007/s00203-023-03467-2Search in Google Scholar PubMed PubMed Central
[86] Sarkar J, Chakraborty N, Chatterjee A, Bhattacharjee A, Dasgupta D, Acharya K. Green synthesized copper oxide nanoparticles ameliorate defence and antioxidant enzymes in Lens culinaris. Nanomaterials (Basel). 2020;10:312.10.3390/nano10020312Search in Google Scholar PubMed PubMed Central
[87] Khan A, Rashid A, Younas R, Chong R. A chemical reduction approach to the synthesis of copper nanoparticles. Int Nano Lett. 2016;6:21–6.10.1007/s40089-015-0163-6Search in Google Scholar
[88] Nassar A-RA, Atta HM, Abdel-Rahman MA, El Naghy WS, Fouda A. Myco-synthesized copper oxide nanoparticles using harnessing metabolites of endophytic fungal strain Aspergillus terreus: an insight into antibacterial, anti-Candida, biocompatibility, anticancer, and antioxidant activities. BMC Complement Med Ther. 2023;23:261.10.1186/s12906-023-04056-ySearch in Google Scholar PubMed PubMed Central
[89] Malek TJ, Chaki SH, Deshpande M. Structural, morphological, optical, thermal and magnetic study of mackinawite FeS nanoparticles synthesized by wet chemical reduction technique. Phys B: Condens Matter. 2018;546:59–66.10.1016/j.physb.2018.07.024Search in Google Scholar
[90] Kim Y, Lee Y, Roh Y. Microbial synthesis of iron sulfide (FeS) and iron carbonate (FeCO3) nanoparticles. J Nanosci Nanotechnol. 2015;15:5794–7.10.1166/jnn.2015.10457Search in Google Scholar PubMed
[91] Danaei M, Dehghankhold M, Ataei S, Hasanzadeh Davarani F, Javanmard R, Dokhani A, et al. Impact of particle size and polydispersity index on the clinical applications of lipidic nanocarrier systems. Pharmaceutics. 2018;10:57.10.3390/pharmaceutics10020057Search in Google Scholar PubMed PubMed Central
[92] Takechi-Haraya Y, Ohgita T, Demizu Y, Saito H, Izutsu K-I, Sakai-Kato K. Current status and challenges of analytical methods for evaluation of size and surface modification of nanoparticle-based drug formulations. AAPS PharmSciTech. 2022;23:150.10.1208/s12249-022-02303-ySearch in Google Scholar PubMed PubMed Central
[93] Ardani H, Imawan C, Handayani W, Djuhana D, Harmoko A, Fauzia V. Enhancement of the stability of silver nanoparticles synthesized using aqueous extract of Diospyros discolor Willd. leaves using polyvinyl alcohol. IOP Conference Series: Materials Science and Engineering. IOP Publishing; 2017. p. 012056.10.1088/1757-899X/188/1/012056Search in Google Scholar
[94] Maguire CM, Rösslein M, Wick P, Prina-Mello A. Characterisation of particles in solution – a perspective on light scattering and comparative technologies. Sci Technol Adv Mater. 2018;19:732–45.10.1080/14686996.2018.1517587Search in Google Scholar PubMed PubMed Central
[95] Elamawi RM, Al-Harbi RE, Hendi AA. Biosynthesis and characterization of silver nanoparticles using Trichoderma longibrachiatum and their effect on phytopathogenic fungi. Egypt J Biol Pest Control. 2018;28:28.10.1186/s41938-018-0028-1Search in Google Scholar
[96] Erdogan O, Abbak M, Demirbolat GM, Birtekocak F, Aksel M, Pasa S, et al. Green synthesis of silver nanoparticles via Cynara scolymus leaf extracts: the characterization, anticancer potential with photodynamic therapy in MCF7 cells. PLoS One. 2019;14:e0216496.10.1371/journal.pone.0216496Search in Google Scholar PubMed PubMed Central
[97] Wen X, Wang Q, Dai T, Shao J, Wu X, Jiang Z, et al. Identification of possible reductants in the aqueous leaf extract of mangrove plant Rhizophora apiculata for the fabrication and cytotoxicity of silver nanoparticles against human osteosarcoma MG-63 cells. Mater Sci Eng C. 2020;116:111252.10.1016/j.msec.2020.111252Search in Google Scholar PubMed
[98] Sangwan S, Seth R. Nanotechnology: a boon in cancer therapy. Int J Nanomater Nanotechnol Nanomed. 2021;7:1–6.Search in Google Scholar
[99] Lo Presti E, Pizzolato G, Corsale AM, Caccamo N, Sireci G, Dieli F, , et al. γδ T cells and tumor microenvironment: from immunosurveillance to tumor evasion. Front Immunol. 2018;9:1395.10.3389/fimmu.2018.01395Search in Google Scholar PubMed PubMed Central
[100] Deshpande PP, Biswas S, Torchilin VP. Current trends in the use of liposomes for tumor targeting. Nanomedicine (London). 2013;8:1509–28.10.2217/nnm.13.118Search in Google Scholar PubMed PubMed Central
[101] Kettler K, Veltman K, van de Meent D, van Wezel A, Hendriks AJ. Cellular uptake of nanoparticles as determined by particle properties, experimental conditions, and cell type. Environ Toxicol Chem. 2014;33:481–92.10.1002/etc.2470Search in Google Scholar PubMed
[102] Wu M, Guo H, Liu L, Liu Y, Xie L. Size-dependent cellular uptake and localization profiles of silver nanoparticles. Int J Nanomed. 2019;14:4247–59.10.2147/IJN.S201107Search in Google Scholar PubMed PubMed Central
[103] Augustine R, Hasan A, Primavera R, Wilson RJ, Thakor AS, Kevadiya BD. Cellular uptake and retention of nanoparticles: insights on particle properties and interaction with cellular components . Mater Today Commun. 2020;25:101692.10.1016/j.mtcomm.2020.101692Search in Google Scholar
[104] Chenthamara D, Subramaniam S, Ramakrishnan SG, Krishnaswamy S, Essa MM, Lin F-H, et al. Therapeutic efficacy of nanoparticles and routes of administration. Biomater Res. 2019;23:20.10.1186/s40824-019-0166-xSearch in Google Scholar PubMed PubMed Central
[105] Khan I, Saeed K, Khan I. Nanoparticles: properties, applications and toxicities. Arab J Chem. 2019;12:908–31.10.1016/j.arabjc.2017.05.011Search in Google Scholar
[106] Blanco E, Shen H, Ferrari M. Principles of nanoparticle design for overcoming biological barriers to drug delivery. Nat Biotechnol. 2015;33:941–51.10.1038/nbt.3330Search in Google Scholar PubMed PubMed Central
[107] Hoshyar N, Gray S, Han H, Bao G. The effect of nanoparticle size on in vivo pharmacokinetics and cellular interaction. Nanomedicine (London). 2016;11:673–92.10.2217/nnm.16.5Search in Google Scholar PubMed PubMed Central
[108] Agbabiaka A, Wiltfong M, Park C. Small angle X-ray scattering technique for the particle size distribution of nonporous nanoparticles. J Nanopart. 2013;2013:1–11.10.1155/2013/640436Search in Google Scholar
[109] Gencalp Irizalp S, Saklakoglu N. 1.14 laser peening of metallic materials. In: Hashmi MSJ, editor. Comprehensive materials finishing. Oxford: Elsevier; 2017. p. 408–40.10.1016/B978-0-12-803581-8.09160-8Search in Google Scholar
[110] Pu Y, Niu Y, Wang Y, Liu S, Zhang B. Statistical morphological identification of low-dimensional nanomaterials by using TEM. Particuology. 2022;61:11–7.10.1016/j.partic.2021.03.013Search in Google Scholar
[111] Raval N, Maheshwari R, Kalyane D, Youngren-Ortiz SR, Chougule MB, Tekade RK. Importance of physicochemical characterization of nanoparticles in pharmaceutical product development. Basic fundamentals of drug delivery. Amsterdam, Netherlands: Elsevier; 2019. p. 369–400.10.1016/B978-0-12-817909-3.00010-8Search in Google Scholar
[112] Dheyab MA, Aziz AA, Moradi Khaniabadi P, Jameel MS, Oladzadabbasabadi N, Mohammed SA, et al. Monodisperse gold nanoparticles: a review on synthesis and their application in modern medicine. Int J Mol Sci. 2022;23:7400.10.3390/ijms23137400Search in Google Scholar PubMed PubMed Central
[113] Kaasalainen M, Aseyev V, von Haartman E, Karaman DŞ, Mäkilä E, Tenhu H, et al. Size, stability, and porosity of mesoporous nanoparticles characterized with light scattering. Nanoscale Res Lett. 2017;12:74.10.1186/s11671-017-1853-ySearch in Google Scholar PubMed PubMed Central
[114] Jia Z, Li J, Gao L, Yang D, Kanaev A. Dynamic light scattering: a powerful tool for in situ nanoparticle sizing. Colloids Interfaces. 2023;7:15.10.3390/colloids7010015Search in Google Scholar
[115] Rajpoot K, Tekade RK. Chapter 10 – Microemulsion as drug and gene delivery vehicle: an inside story. In: Tekade RK, editor. Drug delivery systems. Amsterdam, Netherlands: Elsevier; 2019. p. 455–520.10.1016/B978-0-12-814487-9.00010-7Search in Google Scholar
[116] Al Thaher Y, Satoof A, Kamal A, Almani D, Shaban D, Kassab G, et al. Chapter 7 – Instrumental analytical techniques for physicochemical characterization of bio-nanomaterials. In: Anand K, Saravanan M, Chandrasekaran B, Kanchi S, Jeeva Panchu S, Chen Q, editors. Handbook on nanobiomaterials for therapeutics and diagnostic applications. Amsterdam, Netherlands: Elsevier; 2021. p. 133–50.10.1016/B978-0-12-821013-0.00011-8Search in Google Scholar
[117] Clogston JD, Patri AK. Zeta potential measurement. Methods Mol Biol (Clifton, NJ). 2011;697:63–70.10.1007/978-1-60327-198-1_6Search in Google Scholar PubMed
[118] Agrawal N, Mahendra M, Singh T, Gangil B. 4 – Nanobiology in medicine. In: Verpoort F, Ahmad I, Ahmad A, Khan A, Chee CY, editors. Nanomedicine manufacturing and applications. Amsterdam, Netherlands: Elsevier; 2021. p. 57–71.10.1016/B978-0-12-820773-4.00012-3Search in Google Scholar
[119] Mao W, Lee S, Shin JU, Yoo HS. Surface-initiated atom transfer polymerized anionic corona on gold nanoparticles for anti-cancer therapy. Pharmaceutics. 2020;12:261.10.3390/pharmaceutics12030261Search in Google Scholar PubMed PubMed Central
[120] Niu N, Wang L. In vitro human cell line models to predict clinical response to anticancer drugs. Pharmacogenomics. 2015;16:273–85.10.2217/pgs.14.170Search in Google Scholar PubMed PubMed Central
[121] Pan E, Bogumil D, Cortessis V, Yu S, Nieva J. A systematic review of the efficacy of preclinical models of lung cancer drugs. Front Oncol. 2020;10:591.10.3389/fonc.2020.00591Search in Google Scholar PubMed PubMed Central
[122] Kumar N, Afjei R, Massoud TF, Paulmurugan R. Comparison of cell-based assays to quantify treatment effects of anticancer drugs identifies a new application for Bodipy-L-cystine to measure apoptosis. Sci Rep. 2018;8:16363.10.1038/s41598-018-34696-xSearch in Google Scholar PubMed PubMed Central
[123] Ghasemi M, Turnbull T, Sebastian S, Kempson I. The MTT assay utility, limitations, pitfalls, and interpretation in bulk and single-cell. Analysis. 2021;22(23)12827.10.3390/ijms222312827Search in Google Scholar PubMed PubMed Central
[124] Hanna DH, Saad GR. Nanocurcumin: preparation, characterization and cytotoxic effects towards human laryngeal cancer cells. RSC Adv. 2020;10:20724–37.10.1039/D0RA03719BSearch in Google Scholar
[125] Wang Y, Zhang W, Yip H, Qu C, Hu H, Chen X, et al. SIC50: determining drug inhibitory concentrations using a vision transformer and an optimized Sobel operator. Patterns. 2023;4:100686.10.1016/j.patter.2023.100686Search in Google Scholar PubMed PubMed Central
[126] Li X, Xu H, Li C, Qiao G, Farooqi AA, Gedanken A, et al. Zinc-doped copper oxide nanocomposites inhibit the growth of pancreatic cancer by inducing autophagy through AMPK/mTOR pathway. Front Pharmacol. 2019;10:319.10.3389/fphar.2019.00319Search in Google Scholar PubMed PubMed Central
[127] Yuan R, Xu H, Liu X, Tian Y, Li C, Chen X, et al. Zinc-doped copper oxide nanocomposites inhibit the growth of human cancer cells through reactive oxygen species-mediated NF-κB activations. ACS Appl Mater Interfaces. 2016;8:31806–12.10.1021/acsami.6b09542Search in Google Scholar PubMed
[128] Mansour H, Eid M, El-Arnaouty M. Effect of silver nanoparticles synthesized by gamma radiation on the cytotoxicity of doxorubicin in human cancer cell lines and experimental animals. Hum Exp Toxicol. 2018;37:38–50.10.1177/0960327116689717Search in Google Scholar PubMed
[129] Al-Salahi R, Alswaidan I, Marzouk M. Cytotoxicity evaluation of a new set of 2-aminobenzo [de] iso-quinoline-1, 3-diones. Int J Mol Sci. 2014;15:22483–91.10.3390/ijms151222483Search in Google Scholar PubMed PubMed Central
[130] Das MK, Sahu PK, Rao GS, Mukkanti K, Silpavathi L. Application of response surface method to evaluate the cytotoxic potency of Ulva fasciata Delile, a marine macro alga. Saudi J Biol Sci. 2014;21:539–46.10.1016/j.sjbs.2014.02.003Search in Google Scholar PubMed PubMed Central
[131] Rakhmanova A, Kalybekkyzy S, Soltabayev B, Bissenbay A, Kassenova N, Bakenov Z, et al. Application of response surface methodology for optimization of nanosized zinc oxide synthesis conditions by electrospinning technique. Nanomaterials. 2022;12:1733.10.3390/nano12101733Search in Google Scholar PubMed PubMed Central
[132] Aydar AY. Utilization of response surface methodology in optimization of extraction of plant materials. Statistical approaches with emphasis on design of experiments applied to chemical processes. London, UK: IntechOpen; 2018. p. 157–69.10.5772/intechopen.73690Search in Google Scholar
[133] Ba-Abbad MM, Chai P, Benamour A, Ewis D, Mohammad AW, Mahmoudi E. Optimizing and control of effective synthesize parameters for Fe3O4 nanoparticles using response surface methodology. Chem Pap. 2022;76:6359–70.10.1007/s11696-022-02320-ySearch in Google Scholar
[134] Ahani M, Khatibzadeh M. Size optimisation of silver nanoparticles synthesised by gallic acid using the response surface methodology. Micro Nano Lett. 2020;15:403–8.10.1049/mnl.2019.0780Search in Google Scholar
[135] Ahmadi S, Mohammadi L, Rahdar A, Rahdar S, Dehghani R, Adaobi Igwegbe C, et al. Acid dye removal from aqueous solution by using neodymium(iii) oxide nanoadsorbents. Nanomaterials. 2020;10:556.10.3390/nano10030556Search in Google Scholar PubMed PubMed Central
[136] Sandhya M, Rajkumar K, Burgula S. Efficient eco-friendly approach towards bimetallic nanoparticles synthesis and characterization using Exiguobacterium aestuarii by statistical optimization. Green Chem Lett Rev. 2019;12:420–34.10.1080/17518253.2019.1687762Search in Google Scholar
[137] Bagkos G, Koufopoulos K, Piperi C. A new model for mitochondrial membrane potential production and storage. Med Hypotheses. 2014;83:175–81.10.1016/j.mehy.2014.05.001Search in Google Scholar PubMed
[138] Rovini A, Heslop K, Hunt EG, Morris ME, Fang D, Gooz M, et al. Quantitative analysis of mitochondrial membrane potential heterogeneity in unsynchronized and synchronized cancer cells. FASEB J Off Publ Fed Am Soc Exp Biol. 2021;35:e21148.10.1096/fj.202001693RSearch in Google Scholar PubMed PubMed Central
[139] Peng H, Yao F, Zhao J, Zhang W, Chen L, Wang X, et al. Unraveling mitochondria-targeting reactive oxygen species modulation and their implementations in cancer therapy by nanomaterials. Exploration. 2023;3(2):20220115.10.1002/EXP.20220115Search in Google Scholar PubMed PubMed Central
[140] Sakamuru S, Attene-Ramos MS, Xia M. Mitochondrial membrane potential assay. Methods Mol Biol (Clifton, NJ). 2016;1473:17–22.10.1007/978-1-4939-6346-1_2Search in Google Scholar PubMed PubMed Central
[141] Dehghani MA, Sabahi A, Vanani AR, Amirrajab N, Ansari AC, Bazmi A, et al. Chapter 18 – Mechanisms of bisphenol A toxicity in mitochondria. In: de Oliveira MR, editor. Mitochondrial intoxication. Amsterdam, Netherlands: Elsevier; 2023. p. 409–23.10.1016/B978-0-323-88462-4.00020-1Search in Google Scholar
[142] Yang H, van der Stel W, Lee R, Bauch C, Bevan S, Walker P, et al. Dynamic modeling of mitochondrial membrane potential upon exposure to mitochondrial inhibitors. Front Pharmacol. 2021;12:679407.10.3389/fphar.2021.679407Search in Google Scholar PubMed PubMed Central
[143] Kang M, Kang JH, Sim IA, Seong DY, Han S, Jang H, et al. Glucose deprivation induces cancer cell death through failure of ROS regulation. Int J Mol Sci. 2023;24:11969.10.3390/ijms241511969Search in Google Scholar PubMed PubMed Central
[144] Lee H, Woo SM, Jang H, Kang M, Kim S-Y. Cancer depends on fatty acids for ATP production: a possible link between cancer and obesity. Semin Cancer Biol. 2022;86:347–57.10.1016/j.semcancer.2022.07.005Search in Google Scholar PubMed
[145] Gottlieb E, Armour SM, Harris MH, Thompson CB. Mitochondrial membrane potential regulates matrix configuration and cytochrome c release during apoptosis. Cell Death Differ. 2003;10:709–17.10.1038/sj.cdd.4401231Search in Google Scholar PubMed
[146] Zielonka J, Joseph J, Sikora A, Hardy M, Ouari O, Vasquez-Vivar J, et al. Mitochondria-targeted triphenylphosphonium-based compounds: syntheses, mechanisms of action, and therapeutic and diagnostic applications. Chem Rev. 2017;117:10043–120.10.1021/acs.chemrev.7b00042Search in Google Scholar PubMed PubMed Central
[147] Baracca A, Sgarbi G, Solaini G, Lenaz G. Rhodamine 123 as a probe of mitochondrial membrane potential: evaluation of proton flux through F(0) during ATP synthesis. Biochim Biophys Acta. 2003;1606:137–46.10.1016/S0005-2728(03)00110-5Search in Google Scholar
[148] Wang X, Qiu Y, Wang M, Zhang C, Zhang T, Zhou H, et al. Endocytosis and organelle targeting of nanomedicines in cancer therapy. Int J Nanomed. 2020;15:9447–67.10.2147/IJN.S274289Search in Google Scholar PubMed PubMed Central
[149] Fu X, Shi Y, Qi T, Qiu S, Huang Y, Zhao X, et al. Precise design strategies of nanomedicine for improving cancer therapeutic efficacy using subcellular targeting. Signal Transduct Target Ther. 2020;5:262.10.1038/s41392-020-00342-0Search in Google Scholar PubMed PubMed Central
[150] Rao Q, Li R, Yu H, Xiang L, He B, Wu F, et al. Effects of dihydroartemisinin combined with cisplatin on proliferation, apoptosis and migration of HepG2 cells. Oncol Lett. 2022;24:275.10.3892/ol.2022.13395Search in Google Scholar PubMed PubMed Central
[151] Liu K, Liu PC, Liu R, Wu X. Dual AO/EB staining to detect apoptosis in osteosarcoma cells compared with flow cytometry. Med Sci Monit Basic Res. 2015;21:15–20.10.12659/MSMBR.893327Search in Google Scholar PubMed PubMed Central
[152] Murugesan AK, Sathuvan M, Javee A. PFL-lectin regulates the expression of apoptosis-related proteins to antecedent apoptosis in A549 and HT29 cells. Adv Cancer Biol – Metastasis. 2023;7:100099.10.1016/j.adcanc.2023.100099Search in Google Scholar
[153] Nie Z, Wang D, Wang S, Wang L. Facile construction of irinotecan loaded mesoporous nano-formulation with surface-initiated polymerization to improve stimuli-responsive drug delivery for breast cancer therapy. Heliyon. 2023;9:e15087.10.1016/j.heliyon.2023.e15087Search in Google Scholar PubMed PubMed Central
[154] Ganapathy P, Elumalai K, Arumugam MK, Amulya CS, Manivel R. Anticancer potential of Siddha formulations against oral cancer cell line in vitro. Trends Med. 2019;19:1–6.10.15761/TiM.1000192Search in Google Scholar
[155] Yashaswee S, Trigun SK. Cytotoxicity and induction of apoptosis in melanoma (MDA-MB-435S) cells by emodin. J Sci Res. 2020;64:158–166.10.37398/JSR.2020.640223Search in Google Scholar
[156] Ramalingam V, Revathidevi S, Shanmuganayagam T, Muthulakshmi L, Rajaram R. Biogenic gold nanoparticles induce cell cycle arrest through oxidative stress and sensitize mitochondrial membranes in A549 lung cancer cells. RSC Adv. 2016;6:20598–608.10.1039/C5RA26781ASearch in Google Scholar
[157] Manke A, Wang L, Rojanasakul Y. Mechanisms of nanoparticle-induced oxidative stress and toxicity. Biomed Res Int. 2013;2013:942916.10.1155/2013/942916Search in Google Scholar PubMed PubMed Central
[158] Cheng Z, Li M, Dey R, Chen Y. Nanomaterials for cancer therapy: current progress and perspectives. J Hematol Oncol. 2021;14:85.10.1186/s13045-021-01096-0Search in Google Scholar PubMed PubMed Central
[159] Tang JLY, Moonshi SS, Ta HT. Nanoceria: an innovative strategy for cancer treatment. Cell Mol Life Sci. 2023;80:46.10.1007/s00018-023-04694-ySearch in Google Scholar PubMed PubMed Central
[160] Fu PP, Xia Q, Hwang H-M, Ray PC, Yu H. Mechanisms of nanotoxicity: generation of reactive oxygen species. J Food Drug Anal. 2014;22:64–75.10.1016/j.jfda.2014.01.005Search in Google Scholar PubMed PubMed Central
[161] Adhikari A, Mondal S, Das M, Ghosh R, Biswas P, Darbar S, et al. Redox buffering capacity of nanomaterials as an index of ROS-based therapeutics and toxicity: a preclinical animal study. ACS Biomater Sci Eng. 2021;7:2475–84.10.1021/acsbiomaterials.1c00402Search in Google Scholar PubMed
[162] Ivanova D, Zhelev Z, Aoki I, Bakalova R, Higashi T. Overproduction of reactive oxygen species – obligatory or not for induction of apoptosis by anticancer drugs. Chin J Cancer Res. 2016;28:383–96.10.21147/j.issn.1000-9604.2016.04.01Search in Google Scholar PubMed PubMed Central
[163] Marchi S, Giorgi C, Suski JM, Agnoletto C, Bononi A, Bonora M, et al. Mitochondria-Ros crosstalk in the control of cell death and aging. J Signal Transduct. 2012;2012:329635.10.1155/2012/329635Search in Google Scholar PubMed PubMed Central
[164] Gao Y, Tong H, Li J, Li J, Huang D, Shi J, et al. Mitochondria-targeted nanomedicine for enhanced efficacy of cancer therapy. Front Bioeng Biotechnol. 2021;682:720508.10.3389/fbioe.2021.720508Search in Google Scholar PubMed PubMed Central
[165] Juan CA, Pérez de la Lastra JM, Plou FJ, Pérez-Lebeña E. The chemistry of reactive oxygen species (ROS) revisited: outlining their role in biological macromolecules (DNA, lipids and proteins) and induced pathologies. Int J Mol Sci. 2021;22:4642.10.3390/ijms22094642Search in Google Scholar PubMed PubMed Central
[166] Hua S, De Matos MB, Metselaar JM, Storm G. Current trends and challenges in the clinical translation of nanoparticulate nanomedicines: pathways for translational development and commercialization. Front Pharmacol. 2018;9:790.10.3389/fphar.2018.00790Search in Google Scholar PubMed PubMed Central
[167] Corbo C, Molinaro R, Parodi A, Toledano Furman NE, Salvatore F, Tasciotti E. The impact of nanoparticle protein corona on cytotoxicity, immunotoxicity and target drug delivery. Nanomedicine. 2016;11:81–100.10.2217/nnm.15.188Search in Google Scholar PubMed PubMed Central
[168] Zhang L, Cheng X, Gao Y, Bao J, Guan H, Lu R, et al. Induction of ROS-independent DNA damage by curcumin leads to G2/M cell cycle arrest and apoptosis in human papillary thyroid carcinoma BCPAP cells. Food Funct. 2016;7:315–25.10.1039/C5FO00681CSearch in Google Scholar PubMed
[169] Mohammadinejad R, Moosavi MA, Tavakol S, Vardar DÖ, Hosseini A, Rahmati M, et al. Necrotic, apoptotic and autophagic cell fates triggered by nanoparticles. Autophagy. 2019;15:4–33.10.1080/15548627.2018.1509171Search in Google Scholar PubMed PubMed Central
[170] Hoy MA. Chapter 8 – DNA amplification by the polymerase chain reaction: molecular biology made accessible. In: Hoy MA, editor. Insect molecular genetics. 3rd edn. San Diego: Academic Press; 2013. p. 307–72.10.1016/B978-0-12-415874-0.00008-1Search in Google Scholar
[171] Lobert S, Hiser L, Correia JJ. Chapter 4 – Expression profiling of tubulin isotypes and microtubule-interacting proteins using real-time polymerase chain reaction. In: Wilson L, Correia JJ, editors. Methods in cell biology. Amsterdam, Netherlands: Elsevier; 2010. p. 47–58.10.1016/S0091-679X(10)95004-8Search in Google Scholar PubMed
[172] Ozturk M, Ozsoylemez OD, Dagistanli FK. The detection techniques for autophagy-associated cell death-related genes and proteins: gene expression assay and immunohistochemistry. Methods Mol Biol (Clifton, NJ). 2019;1854:119–30.10.1007/7651_2017_67Search in Google Scholar PubMed
[173] Amatori S, Persico G, Fanelli M. Real-time quantitative PCR array to study drug-induced changes of gene expression in tumor cell lines. J Cancer Metastasis Treat. 2017;3:90–9.10.20517/2394-4722.2017.22Search in Google Scholar
[174] Ranjitkar S, Zhang D, Sun F, Salman S, He W, Venkitanarayanan K, et al. Cytotoxic effects on cancerous and non-cancerous cells of trans-cinnamaldehyde, carvacrol, and eugenol. Sci Rep. 2021;11:16281.10.1038/s41598-021-95394-9Search in Google Scholar PubMed PubMed Central
[175] Stupack DG. Caspase-8 as a therapeutic target in cancer. Cancer Lett. 2013;332:133–40.10.1016/j.canlet.2010.07.022Search in Google Scholar PubMed PubMed Central
[176] Fianco G, Contadini C, Ferri A, Cirotti C, Stagni V, Barilà D. Caspase-8: a novel target to overcome resistance to chemotherapy in glioblastoma. Int J Mol Sci. 2018;19:3798.10.3390/ijms19123798Search in Google Scholar PubMed PubMed Central
[177] Zhao Y, Zhu Q, Bu X, Zhou Y, Bai D, Guo Q, et al. Triggering apoptosis by oroxylin A through caspase-8 activation and p62/SQSTM1 proteolysis. Redox Biol. 2020;29:101392.10.1016/j.redox.2019.101392Search in Google Scholar PubMed PubMed Central
[178] Fritsch M, Günther SD, Schwarzer R, Albert M-C, Schorn F, Werthenbach JP, et al. Caspase-8 is the molecular switch for apoptosis, necroptosis and pyroptosis. Nature. 2019;575:683–7.10.1038/s41586-019-1770-6Search in Google Scholar PubMed
[179] Lindner P, Christensen SB, Nissen P, Møller JV, Engedal N. Cell death induced by the ER stressor thapsigargin involves death receptor 5, a non-autophagic function of MAP1LC3B, and distinct contributions from unfolded protein response components. Cell Commun Signal. 2020;18:12.10.1186/s12964-019-0499-zSearch in Google Scholar PubMed PubMed Central
[180] Mnich K, Koryga I, Pakos‐Zebrucka K, Thomas M, Logue SE, Eriksson LA, et al. The stressosome, a caspase‐8‐activating signalling complex assembled in response to cell stress in an ATG5‐mediated manner. J Cell Mol Med. 2021;25:8809–20.10.1111/jcmm.16840Search in Google Scholar PubMed PubMed Central
[181] Khazaei S, Esa NM, Ramachandran V, Hamid RA, Pandurangan AK, Etemad A, et al. In vitro antiproliferative and apoptosis inducing effect of Allium atroviolaceum bulb extract on breast, cervical, and liver cancer cells. Front Pharmacol. 2017;8:5.10.3389/fphar.2017.00005Search in Google Scholar PubMed PubMed Central
[182] Hientz K, Mohr A, Bhakta-Guha D, Efferth T. The role of p53 in cancer drug resistance and targeted chemotherapy. Oncotarget. 2017;8:8921–46.10.18632/oncotarget.13475Search in Google Scholar PubMed PubMed Central
[183] Marquez RT, Xu L. Bcl-2:Beclin 1 complex: multiple, mechanisms regulating autophagy/apoptosis toggle switch. Am J Cancer Res. 2012;2:214–21.Search in Google Scholar
[184] Pfeffer CM, Singh ATK. Apoptosis: a target for anticancer therapy. Int J Mol Sci. 2018;19:448.10.3390/ijms19020448Search in Google Scholar PubMed PubMed Central
[185] Campbell KJ, Tait SWG. Targeting BCL-2 regulated apoptosis in cancer. Open Biol. 2018;8:180002.10.1098/rsob.180002Search in Google Scholar PubMed PubMed Central
[186] D’Aguanno S, Del Bufalo D. Inhibition of anti-apoptotic Bcl-2 proteins in preclinical and clinical studies: current overview in cancer. Cells. 2020;9:1287.10.3390/cells9051287Search in Google Scholar PubMed PubMed Central
[187] Riedl SJ, Shi Y. Molecular mechanisms of caspase regulation during apoptosis. Nat Rev Mol Cell Biol. 2004;5:897–907.10.1038/nrm1496Search in Google Scholar PubMed
[188] Chen T-T, Tian X, Liu C-L, Ge J, Chu X, Li Y. Fluorescence activation imaging of cytochrome c released from mitochondria using aptameric nanosensor. J Am Chem Soc. 2015;137:982–9.10.1021/ja511988wSearch in Google Scholar PubMed
[189] Redza-Dutordoir M, Averill-Bates DA. Activation of apoptosis signalling pathways by reactive oxygen species. Biochim Biophys Acta (BBA) – Mol Cell Res. 2016;1863:2977–92.10.1016/j.bbamcr.2016.09.012Search in Google Scholar PubMed
[190] Rodriguez J, Lazebnik Y. Caspase-9 and APAF-1 form an active holoenzyme. Genes Dev. 1999;13:3179–84.10.1101/gad.13.24.3179Search in Google Scholar PubMed PubMed Central
[191] Parrish AB, Freel CD, Kornbluth S. Cellular mechanisms controlling caspase activation and function. Cold Spring Harb Perspect Biol. 2013;5:a008672.10.1101/cshperspect.a008672Search in Google Scholar PubMed PubMed Central
[192] Morrison S, McGee SL. 3T3-L1 adipocytes display phenotypic characteristics of multiple adipocyte lineages. Adipocyte. 2015;4:295–302.10.1080/21623945.2015.1040612Search in Google Scholar PubMed PubMed Central
[193] Mu T, Sun H, Zhang M, Wang C. Chapter 2 – Sweet potato proteins. In: Mu T, Sun H, Zhang M, Wang C, editors. Sweet potato processing technology. Amsterdam, Netherlands: Elsevier; 2017. p. 49–119.10.1016/B978-0-12-812871-8.00002-7Search in Google Scholar
[194] Campoccia D, Ravaioli S, Santi S, Mariani V, Santarcangelo C, De Filippis A, et al. Exploring the anticancer effects of standardized extracts of poplar-type propolis: in vitro cytotoxicity toward cancer and normal cell lines. Biomed Pharmacother. 2021;141:111895.10.1016/j.biopha.2021.111895Search in Google Scholar PubMed
[195] Hadjzadeh M-A-R, Ghanbari H, Keshavarzi Z, Tavakol-Afshari J. The effects of aqueous extract of alpinia galangal on gastric cancer cells (AGS) and L929 cells in vitro. Iran J Cancer Prev. 2014;7:142–6.Search in Google Scholar
[196] Chang M-C, Wu J-Y, Liao H-F, Chen Y-J, Kuo C-D. Comparative assessment of therapeutic safety of norcantharidin, N-farnesyloxy-norcantharimide, and N-farnesyl-norcantharimide against Jurkat T cells relative to human normal lymphoblast: a quantitative pilot study. Medicine (Baltimore). 2016;95:e4467.10.1097/MD.0000000000004467Search in Google Scholar PubMed PubMed Central
[197] Nalezinková M. In vitro hemocompatibility testing of medical devices. Thrombosis Res. 2020;195:146–50.10.1016/j.thromres.2020.07.027Search in Google Scholar PubMed
[198] Weber M, Steinle H, Golombek S, Hann L, Schlensak C, Wendel HP, et al. Blood-contacting biomaterials: in vitro evaluation of the hemocompatibility. Front Bioeng Biotechnol. 2018;6:99.10.3389/fbioe.2018.00099Search in Google Scholar PubMed PubMed Central
[199] Perugini V, Schmid R, Mørch Ý, Texier I, Brodde M, Santin M. A multistep in vitro hemocompatibility testing protocol recapitulating the foreign body reaction to nanocarriers. Drug Deliv Transl Res. 2022;12:2089–100.10.1007/s13346-022-01141-6Search in Google Scholar PubMed PubMed Central
[200] Li X, Wang L, Fan Y, Feng Q, Cui F-Z. Biocompatibility and toxicity of nanoparticles and nanotubes. J Nanomater. 2012;2012:6.10.1155/2012/548389Search in Google Scholar
[201] Luo J, Feng Z, Jiang W, Jiang X, Chen Y, Lv X, et al. Novel lactotransferrin-derived synthetic peptides suppress cariogenic bacteria in vitro and arrest dental caries in vivo: [novel lactotransferrin-derived anticaries peptides]. J Oral Microbiol. 2021;13:1943999.10.1080/20002297.2021.1943999Search in Google Scholar PubMed PubMed Central
[202] Jiang W, Xie Z, Huang S, Huang Q, Chen L, Gao X, et al. Targeting cariogenic pathogens and promoting competitiveness of commensal bacteria with a novel pH-responsive antimicrobial peptide. J Oral Microbiol. 2023;15:2159375.10.1080/20002297.2022.2159375Search in Google Scholar PubMed PubMed Central
© 2023 the author(s), published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Articles in the same Issue
- Research Articles
- Preparation of CdS–Ag2S nanocomposites by ultrasound-assisted UV photolysis treatment and its visible light photocatalysis activity
- Significance of nanoparticle radius and inter-particle spacing toward the radiative water-based alumina nanofluid flow over a rotating disk
- Aptamer-based detection of serotonin based on the rapid in situ synthesis of colorimetric gold nanoparticles
- Investigation of the nucleation and growth behavior of Ti2AlC and Ti3AlC nano-precipitates in TiAl alloys
- Dynamic recrystallization behavior and nucleation mechanism of dual-scale SiCp/A356 composites processed by P/M method
- High mechanical performance of 3-aminopropyl triethoxy silane/epoxy cured in a sandwich construction of 3D carbon felts foam and woven basalt fibers
- Applying solution of spray polyurea elastomer in asphalt binder: Feasibility analysis and DSR study based on the MSCR and LAS tests
- Study on the chronic toxicity and carcinogenicity of iron-based bioabsorbable stents
- Influence of microalloying with B on the microstructure and properties of brazed joints with Ag–Cu–Zn–Sn filler metal
- Thermohydraulic performance of thermal system integrated with twisted turbulator inserts using ternary hybrid nanofluids
- Study of mechanical properties of epoxy/graphene and epoxy/halloysite nanocomposites
- Effects of CaO addition on the CuW composite containing micro- and nano-sized tungsten particles synthesized via aluminothermic coupling with silicothermic reduction
- Cu and Al2O3-based hybrid nanofluid flow through a porous cavity
- Design of functional vancomycin-embedded bio-derived extracellular matrix hydrogels for repairing infectious bone defects
- Study on nanocrystalline coating prepared by electro-spraying 316L metal wire and its corrosion performance
- Axial compression performance of CFST columns reinforced by ultra-high-performance nano-concrete under long-term loading
- Tungsten trioxide nanocomposite for conventional soliton and noise-like pulse generation in anomalous dispersion laser cavity
- Microstructure and electrical contact behavior of the nano-yttria-modified Cu-Al2O3/30Mo/3SiC composite
- Melting rheology in thermally stratified graphene-mineral oil reservoir (third-grade nanofluid) with slip condition
- Re-examination of nonlinear vibration and nonlinear bending of porous sandwich cylindrical panels reinforced by graphene platelets
- Parametric simulation of hybrid nanofluid flow consisting of cobalt ferrite nanoparticles with second-order slip and variable viscosity over an extending surface
- Chitosan-capped silver nanoparticles with potent and selective intrinsic activity against the breast cancer cells
- Multi-core/shell SiO2@Al2O3 nanostructures deposited on Ti3AlC2 to enhance high-temperature stability and microwave absorption properties
- Solution-processed Bi2S3/BiVO4/TiO2 ternary heterojunction photoanode with enhanced photoelectrochemical performance
- Electroporation effect of ZnO nanoarrays under low voltage for water disinfection
- NIR-II window absorbing graphene oxide-coated gold nanorods and graphene quantum dot-coupled gold nanorods for photothermal cancer therapy
- Nonlinear three-dimensional stability characteristics of geometrically imperfect nanoshells under axial compression and surface residual stress
- Investigation of different nanoparticles properties on the thermal conductivity and viscosity of nanofluids by molecular dynamics simulation
- Optimized Cu2O-{100} facet for generation of different reactive oxidative species via peroxymonosulfate activation at specific pH values to efficient acetaminophen removal
- Brownian and thermal diffusivity impact due to the Maxwell nanofluid (graphene/engine oil) flow with motile microorganisms and Joule heating
- Appraising the dielectric properties and the effectiveness of electromagnetic shielding of graphene reinforced silicone rubber nanocomposite
- Synthesis of Ag and Cu nanoparticles by plasma discharge in inorganic salt solutions
- Low-cost and large-scale preparation of ultrafine TiO2@C hybrids for high-performance degradation of methyl orange and formaldehyde under visible light
- Utilization of waste glass with natural pozzolan in the production of self-glazed glass-ceramic materials
- Mechanical performance of date palm fiber-reinforced concrete modified with nano-activated carbon
- Melting point of dried gold nanoparticles prepared with ultrasonic spray pyrolysis and lyophilisation
- Graphene nanofibers: A modern approach towards tailored gypsum composites
- Role of localized magnetic field in vortex generation in tri-hybrid nanofluid flow: A numerical approach
- Intelligent computing for the double-diffusive peristaltic rheology of magneto couple stress nanomaterials
- Bioconvection transport of upper convected Maxwell nanoliquid with gyrotactic microorganism, nonlinear thermal radiation, and chemical reaction
- 3D printing of porous Ti6Al4V bone tissue engineering scaffold and surface anodization preparation of nanotubes to enhance its biological property
- Bioinspired ferromagnetic CoFe2O4 nanoparticles: Potential pharmaceutical and medical applications
- Significance of gyrotactic microorganisms on the MHD tangent hyperbolic nanofluid flow across an elastic slender surface: Numerical analysis
- Performance of polycarboxylate superplasticisers in seawater-blended cement: Effect from chemical structure and nano modification
- Entropy minimization of GO–Ag/KO cross-hybrid nanofluid over a convectively heated surface
- Oxygen plasma assisted room temperature bonding for manufacturing SU-8 polymer micro/nanoscale nozzle
- Performance and mechanism of CO2 reduction by DBD-coupled mesoporous SiO2
- Polyarylene ether nitrile dielectric films modified by HNTs@PDA hybrids for high-temperature resistant organic electronics field
- Exploration of generalized two-phase free convection magnetohydrodynamic flow of dusty tetra-hybrid Casson nanofluid between parallel microplates
- Hygrothermal bending analysis of sandwich nanoplates with FG porous core and piezomagnetic faces via nonlocal strain gradient theory
- Design and optimization of a TiO2/RGO-supported epoxy multilayer microwave absorber by the modified local best particle swarm optimization algorithm
- Mechanical properties and frost resistance of recycled brick aggregate concrete modified by nano-SiO2
- Self-template synthesis of hollow flower-like NiCo2O4 nanoparticles as an efficient bifunctional catalyst for oxygen reduction and oxygen evolution in alkaline media
- High-performance wearable flexible strain sensors based on an AgNWs/rGO/TPU electrospun nanofiber film for monitoring human activities
- High-performance lithium–selenium batteries enabled by nitrogen-doped porous carbon from peanut meal
- Investigating effects of Lorentz forces and convective heating on ternary hybrid nanofluid flow over a curved surface using homotopy analysis method
- Exploring the potential of biogenic magnesium oxide nanoparticles for cytotoxicity: In vitro and in silico studies on HCT116 and HT29 cells and DPPH radical scavenging
- Enhanced visible-light-driven photocatalytic degradation of azo dyes by heteroatom-doped nickel tungstate nanoparticles
- A facile method to synthesize nZVI-doped polypyrrole-based carbon nanotube for Ag(i) removal
- Improved osseointegration of dental titanium implants by TiO2 nanotube arrays with self-assembled recombinant IGF-1 in type 2 diabetes mellitus rat model
- Functionalized SWCNTs@Ag–TiO2 nanocomposites induce ROS-mediated apoptosis and autophagy in liver cancer cells
- Triboelectric nanogenerator based on a water droplet spring with a concave spherical surface for harvesting wave energy and detecting pressure
- A mathematical approach for modeling the blood flow containing nanoparticles by employing the Buongiorno’s model
- Molecular dynamics study on dynamic interlayer friction of graphene and its strain effect
- Induction of apoptosis and autophagy via regulation of AKT and JNK mitogen-activated protein kinase pathways in breast cancer cell lines exposed to gold nanoparticles loaded with TNF-α and combined with doxorubicin
- Effect of PVA fibers on durability of nano-SiO2-reinforced cement-based composites subjected to wet-thermal and chloride salt-coupled environment
- Effect of polyvinyl alcohol fibers on mechanical properties of nano-SiO2-reinforced geopolymer composites under a complex environment
- In vitro studies of titanium dioxide nanoparticles modified with glutathione as a potential drug delivery system
- Comparative investigations of Ag/H2O nanofluid and Ag-CuO/H2O hybrid nanofluid with Darcy-Forchheimer flow over a curved surface
- Study on deformation characteristics of multi-pass continuous drawing of micro copper wire based on crystal plasticity finite element method
- Properties of ultra-high-performance self-compacting fiber-reinforced concrete modified with nanomaterials
- Prediction of lap shear strength of GNP and TiO2/epoxy nanocomposite adhesives
- A novel exploration of how localized magnetic field affects vortex generation of trihybrid nanofluids
- Fabrication and physicochemical characterization of copper oxide–pyrrhotite nanocomposites for the cytotoxic effects on HepG2 cells and the mechanism
- Thermal radiative flow of cross nanofluid due to a stretched cylinder containing microorganisms
- In vitro study of the biphasic calcium phosphate/chitosan hybrid biomaterial scaffold fabricated via solvent casting and evaporation technique for bone regeneration
- Insights into the thermal characteristics and dynamics of stagnant blood conveying titanium oxide, alumina, and silver nanoparticles subject to Lorentz force and internal heating over a curved surface
- Effects of nano-SiO2 additives on carbon fiber-reinforced fly ash–slag geopolymer composites performance: Workability, mechanical properties, and microstructure
- Energy bandgap and thermal characteristics of non-Darcian MHD rotating hybridity nanofluid thin film flow: Nanotechnology application
- Green synthesis and characterization of ginger-extract-based oxali-palladium nanoparticles for colorectal cancer: Downregulation of REG4 and apoptosis induction
- Abnormal evolution of resistivity and microstructure of annealed Ag nanoparticles/Ag–Mo films
- Preparation of water-based dextran-coated Fe3O4 magnetic fluid for magnetic hyperthermia
- Statistical investigations and morphological aspects of cross-rheological material suspended in transportation of alumina, silica, titanium, and ethylene glycol via the Galerkin algorithm
- Effect of CNT film interleaves on the flexural properties and strength after impact of CFRP composites
- Self-assembled nanoscale entities: Preparative process optimization, payload release, and enhanced bioavailability of thymoquinone natural product
- Structure–mechanical property relationships of 3D-printed porous polydimethylsiloxane films
- Nonlinear thermal radiation and the slip effect on a 3D bioconvection flow of the Casson nanofluid in a rotating frame via a homotopy analysis mechanism
- Residual mechanical properties of concrete incorporated with nano supplementary cementitious materials exposed to elevated temperature
- Time-independent three-dimensional flow of a water-based hybrid nanofluid past a Riga plate with slips and convective conditions: A homotopic solution
- Lightweight and high-strength polyarylene ether nitrile-based composites for efficient electromagnetic interference shielding
- Review Articles
- Recycling waste sources into nanocomposites of graphene materials: Overview from an energy-focused perspective
- Hybrid nanofiller reinforcement in thermoset and biothermoset applications: A review
- Current state-of-the-art review of nanotechnology-based therapeutics for viral pandemics: Special attention to COVID-19
- Solid lipid nanoparticles for targeted natural and synthetic drugs delivery in high-incidence cancers, and other diseases: Roles of preparation methods, lipid composition, transitional stability, and release profiles in nanocarriers’ development
- Critical review on experimental and theoretical studies of elastic properties of wurtzite-structured ZnO nanowires
- Polyurea micro-/nano-capsule applications in construction industry: A review
- A comprehensive review and clinical guide to molecular and serological diagnostic tests and future development: In vitro diagnostic testing for COVID-19
- Recent advances in electrocatalytic oxidation of 5-hydroxymethylfurfural to 2,5-furandicarboxylic acid: Mechanism, catalyst, coupling system
- Research progress and prospect of silica-based polymer nanofluids in enhanced oil recovery
- Review of the pharmacokinetics of nanodrugs
- Engineered nanoflowers, nanotrees, nanostars, nanodendrites, and nanoleaves for biomedical applications
- Research progress of biopolymers combined with stem cells in the repair of intrauterine adhesions
- Progress in FEM modeling on mechanical and electromechanical properties of carbon nanotube cement-based composites
- Antifouling induced by surface wettability of poly(dimethyl siloxane) and its nanocomposites
- TiO2 aerogel composite high-efficiency photocatalysts for environmental treatment and hydrogen energy production
- Structural properties of alumina surfaces and their roles in the synthesis of environmentally persistent free radicals (EPFRs)
- Nanoparticles for the potential treatment of Alzheimer’s disease: A physiopathological approach
- Current status of synthesis and consolidation strategies for thermo-resistant nanoalloys and their general applications
- Recent research progress on the stimuli-responsive smart membrane: A review
- Dispersion of carbon nanotubes in aqueous cementitious materials: A review
- Applications of DNA tetrahedron nanostructure in cancer diagnosis and anticancer drugs delivery
- Magnetic nanoparticles in 3D-printed scaffolds for biomedical applications
- An overview of the synthesis of silicon carbide–boron carbide composite powders
- Organolead halide perovskites: Synthetic routes, structural features, and their potential in the development of photovoltaic
- Recent advancements in nanotechnology application on wood and bamboo materials: A review
- Application of aptamer-functionalized nanomaterials in molecular imaging of tumors
- Recent progress on corrosion mechanisms of graphene-reinforced metal matrix composites
- Research progress on preparation, modification, and application of phenolic aerogel
- Application of nanomaterials in early diagnosis of cancer
- Plant mediated-green synthesis of zinc oxide nanoparticles: An insight into biomedical applications
- Recent developments in terahertz quantum cascade lasers for practical applications
- Recent progress in dielectric/metal/dielectric electrodes for foldable light-emitting devices
- Nanocoatings for ballistic applications: A review
- A mini-review on MoS2 membrane for water desalination: Recent development and challenges
- Recent updates in nanotechnological advances for wound healing: A narrative review
- Recent advances in DNA nanomaterials for cancer diagnosis and treatment
- Electrochemical micro- and nanobiosensors for in vivo reactive oxygen/nitrogen species measurement in the brain
- Advances in organic–inorganic nanocomposites for cancer imaging and therapy
- Advancements in aluminum matrix composites reinforced with carbides and graphene: A comprehensive review
- Modification effects of nanosilica on asphalt binders: A review
- Decellularized extracellular matrix as a promising biomaterial for musculoskeletal tissue regeneration
- Review of the sol–gel method in preparing nano TiO2 for advanced oxidation process
- Micro/nano manufacturing aircraft surface with anti-icing and deicing performances: An overview
- Cell type-targeting nanoparticles in treating central nervous system diseases: Challenges and hopes
- An overview of hydrogen production from Al-based materials
- A review of application, modification, and prospect of melamine foam
- A review of the performance of fibre-reinforced composite laminates with carbon nanotubes
- Research on AFM tip-related nanofabrication of two-dimensional materials
- Advances in phase change building materials: An overview
- Development of graphene and graphene quantum dots toward biomedical engineering applications: A review
- Nanoremediation approaches for the mitigation of heavy metal contamination in vegetables: An overview
- Photodynamic therapy empowered by nanotechnology for oral and dental science: Progress and perspectives
- Biosynthesis of metal nanoparticles: Bioreduction and biomineralization
- Current diagnostic and therapeutic approaches for severe acute respiratory syndrome coronavirus-2 (SARS-COV-2) and the role of nanomaterial-based theragnosis in combating the pandemic
- Application of two-dimensional black phosphorus material in wound healing
- Special Issue on Advanced Nanomaterials and Composites for Energy Conversion and Storage - Part I
- Helical fluorinated carbon nanotubes/iron(iii) fluoride hybrid with multilevel transportation channels and rich active sites for lithium/fluorinated carbon primary battery
- The progress of cathode materials in aqueous zinc-ion batteries
- Special Issue on Advanced Nanomaterials for Carbon Capture, Environment and Utilization for Energy Sustainability - Part I
- Effect of polypropylene fiber and nano-silica on the compressive strength and frost resistance of recycled brick aggregate concrete
- Mechanochemical design of nanomaterials for catalytic applications with a benign-by-design focus
Articles in the same Issue
- Research Articles
- Preparation of CdS–Ag2S nanocomposites by ultrasound-assisted UV photolysis treatment and its visible light photocatalysis activity
- Significance of nanoparticle radius and inter-particle spacing toward the radiative water-based alumina nanofluid flow over a rotating disk
- Aptamer-based detection of serotonin based on the rapid in situ synthesis of colorimetric gold nanoparticles
- Investigation of the nucleation and growth behavior of Ti2AlC and Ti3AlC nano-precipitates in TiAl alloys
- Dynamic recrystallization behavior and nucleation mechanism of dual-scale SiCp/A356 composites processed by P/M method
- High mechanical performance of 3-aminopropyl triethoxy silane/epoxy cured in a sandwich construction of 3D carbon felts foam and woven basalt fibers
- Applying solution of spray polyurea elastomer in asphalt binder: Feasibility analysis and DSR study based on the MSCR and LAS tests
- Study on the chronic toxicity and carcinogenicity of iron-based bioabsorbable stents
- Influence of microalloying with B on the microstructure and properties of brazed joints with Ag–Cu–Zn–Sn filler metal
- Thermohydraulic performance of thermal system integrated with twisted turbulator inserts using ternary hybrid nanofluids
- Study of mechanical properties of epoxy/graphene and epoxy/halloysite nanocomposites
- Effects of CaO addition on the CuW composite containing micro- and nano-sized tungsten particles synthesized via aluminothermic coupling with silicothermic reduction
- Cu and Al2O3-based hybrid nanofluid flow through a porous cavity
- Design of functional vancomycin-embedded bio-derived extracellular matrix hydrogels for repairing infectious bone defects
- Study on nanocrystalline coating prepared by electro-spraying 316L metal wire and its corrosion performance
- Axial compression performance of CFST columns reinforced by ultra-high-performance nano-concrete under long-term loading
- Tungsten trioxide nanocomposite for conventional soliton and noise-like pulse generation in anomalous dispersion laser cavity
- Microstructure and electrical contact behavior of the nano-yttria-modified Cu-Al2O3/30Mo/3SiC composite
- Melting rheology in thermally stratified graphene-mineral oil reservoir (third-grade nanofluid) with slip condition
- Re-examination of nonlinear vibration and nonlinear bending of porous sandwich cylindrical panels reinforced by graphene platelets
- Parametric simulation of hybrid nanofluid flow consisting of cobalt ferrite nanoparticles with second-order slip and variable viscosity over an extending surface
- Chitosan-capped silver nanoparticles with potent and selective intrinsic activity against the breast cancer cells
- Multi-core/shell SiO2@Al2O3 nanostructures deposited on Ti3AlC2 to enhance high-temperature stability and microwave absorption properties
- Solution-processed Bi2S3/BiVO4/TiO2 ternary heterojunction photoanode with enhanced photoelectrochemical performance
- Electroporation effect of ZnO nanoarrays under low voltage for water disinfection
- NIR-II window absorbing graphene oxide-coated gold nanorods and graphene quantum dot-coupled gold nanorods for photothermal cancer therapy
- Nonlinear three-dimensional stability characteristics of geometrically imperfect nanoshells under axial compression and surface residual stress
- Investigation of different nanoparticles properties on the thermal conductivity and viscosity of nanofluids by molecular dynamics simulation
- Optimized Cu2O-{100} facet for generation of different reactive oxidative species via peroxymonosulfate activation at specific pH values to efficient acetaminophen removal
- Brownian and thermal diffusivity impact due to the Maxwell nanofluid (graphene/engine oil) flow with motile microorganisms and Joule heating
- Appraising the dielectric properties and the effectiveness of electromagnetic shielding of graphene reinforced silicone rubber nanocomposite
- Synthesis of Ag and Cu nanoparticles by plasma discharge in inorganic salt solutions
- Low-cost and large-scale preparation of ultrafine TiO2@C hybrids for high-performance degradation of methyl orange and formaldehyde under visible light
- Utilization of waste glass with natural pozzolan in the production of self-glazed glass-ceramic materials
- Mechanical performance of date palm fiber-reinforced concrete modified with nano-activated carbon
- Melting point of dried gold nanoparticles prepared with ultrasonic spray pyrolysis and lyophilisation
- Graphene nanofibers: A modern approach towards tailored gypsum composites
- Role of localized magnetic field in vortex generation in tri-hybrid nanofluid flow: A numerical approach
- Intelligent computing for the double-diffusive peristaltic rheology of magneto couple stress nanomaterials
- Bioconvection transport of upper convected Maxwell nanoliquid with gyrotactic microorganism, nonlinear thermal radiation, and chemical reaction
- 3D printing of porous Ti6Al4V bone tissue engineering scaffold and surface anodization preparation of nanotubes to enhance its biological property
- Bioinspired ferromagnetic CoFe2O4 nanoparticles: Potential pharmaceutical and medical applications
- Significance of gyrotactic microorganisms on the MHD tangent hyperbolic nanofluid flow across an elastic slender surface: Numerical analysis
- Performance of polycarboxylate superplasticisers in seawater-blended cement: Effect from chemical structure and nano modification
- Entropy minimization of GO–Ag/KO cross-hybrid nanofluid over a convectively heated surface
- Oxygen plasma assisted room temperature bonding for manufacturing SU-8 polymer micro/nanoscale nozzle
- Performance and mechanism of CO2 reduction by DBD-coupled mesoporous SiO2
- Polyarylene ether nitrile dielectric films modified by HNTs@PDA hybrids for high-temperature resistant organic electronics field
- Exploration of generalized two-phase free convection magnetohydrodynamic flow of dusty tetra-hybrid Casson nanofluid between parallel microplates
- Hygrothermal bending analysis of sandwich nanoplates with FG porous core and piezomagnetic faces via nonlocal strain gradient theory
- Design and optimization of a TiO2/RGO-supported epoxy multilayer microwave absorber by the modified local best particle swarm optimization algorithm
- Mechanical properties and frost resistance of recycled brick aggregate concrete modified by nano-SiO2
- Self-template synthesis of hollow flower-like NiCo2O4 nanoparticles as an efficient bifunctional catalyst for oxygen reduction and oxygen evolution in alkaline media
- High-performance wearable flexible strain sensors based on an AgNWs/rGO/TPU electrospun nanofiber film for monitoring human activities
- High-performance lithium–selenium batteries enabled by nitrogen-doped porous carbon from peanut meal
- Investigating effects of Lorentz forces and convective heating on ternary hybrid nanofluid flow over a curved surface using homotopy analysis method
- Exploring the potential of biogenic magnesium oxide nanoparticles for cytotoxicity: In vitro and in silico studies on HCT116 and HT29 cells and DPPH radical scavenging
- Enhanced visible-light-driven photocatalytic degradation of azo dyes by heteroatom-doped nickel tungstate nanoparticles
- A facile method to synthesize nZVI-doped polypyrrole-based carbon nanotube for Ag(i) removal
- Improved osseointegration of dental titanium implants by TiO2 nanotube arrays with self-assembled recombinant IGF-1 in type 2 diabetes mellitus rat model
- Functionalized SWCNTs@Ag–TiO2 nanocomposites induce ROS-mediated apoptosis and autophagy in liver cancer cells
- Triboelectric nanogenerator based on a water droplet spring with a concave spherical surface for harvesting wave energy and detecting pressure
- A mathematical approach for modeling the blood flow containing nanoparticles by employing the Buongiorno’s model
- Molecular dynamics study on dynamic interlayer friction of graphene and its strain effect
- Induction of apoptosis and autophagy via regulation of AKT and JNK mitogen-activated protein kinase pathways in breast cancer cell lines exposed to gold nanoparticles loaded with TNF-α and combined with doxorubicin
- Effect of PVA fibers on durability of nano-SiO2-reinforced cement-based composites subjected to wet-thermal and chloride salt-coupled environment
- Effect of polyvinyl alcohol fibers on mechanical properties of nano-SiO2-reinforced geopolymer composites under a complex environment
- In vitro studies of titanium dioxide nanoparticles modified with glutathione as a potential drug delivery system
- Comparative investigations of Ag/H2O nanofluid and Ag-CuO/H2O hybrid nanofluid with Darcy-Forchheimer flow over a curved surface
- Study on deformation characteristics of multi-pass continuous drawing of micro copper wire based on crystal plasticity finite element method
- Properties of ultra-high-performance self-compacting fiber-reinforced concrete modified with nanomaterials
- Prediction of lap shear strength of GNP and TiO2/epoxy nanocomposite adhesives
- A novel exploration of how localized magnetic field affects vortex generation of trihybrid nanofluids
- Fabrication and physicochemical characterization of copper oxide–pyrrhotite nanocomposites for the cytotoxic effects on HepG2 cells and the mechanism
- Thermal radiative flow of cross nanofluid due to a stretched cylinder containing microorganisms
- In vitro study of the biphasic calcium phosphate/chitosan hybrid biomaterial scaffold fabricated via solvent casting and evaporation technique for bone regeneration
- Insights into the thermal characteristics and dynamics of stagnant blood conveying titanium oxide, alumina, and silver nanoparticles subject to Lorentz force and internal heating over a curved surface
- Effects of nano-SiO2 additives on carbon fiber-reinforced fly ash–slag geopolymer composites performance: Workability, mechanical properties, and microstructure
- Energy bandgap and thermal characteristics of non-Darcian MHD rotating hybridity nanofluid thin film flow: Nanotechnology application
- Green synthesis and characterization of ginger-extract-based oxali-palladium nanoparticles for colorectal cancer: Downregulation of REG4 and apoptosis induction
- Abnormal evolution of resistivity and microstructure of annealed Ag nanoparticles/Ag–Mo films
- Preparation of water-based dextran-coated Fe3O4 magnetic fluid for magnetic hyperthermia
- Statistical investigations and morphological aspects of cross-rheological material suspended in transportation of alumina, silica, titanium, and ethylene glycol via the Galerkin algorithm
- Effect of CNT film interleaves on the flexural properties and strength after impact of CFRP composites
- Self-assembled nanoscale entities: Preparative process optimization, payload release, and enhanced bioavailability of thymoquinone natural product
- Structure–mechanical property relationships of 3D-printed porous polydimethylsiloxane films
- Nonlinear thermal radiation and the slip effect on a 3D bioconvection flow of the Casson nanofluid in a rotating frame via a homotopy analysis mechanism
- Residual mechanical properties of concrete incorporated with nano supplementary cementitious materials exposed to elevated temperature
- Time-independent three-dimensional flow of a water-based hybrid nanofluid past a Riga plate with slips and convective conditions: A homotopic solution
- Lightweight and high-strength polyarylene ether nitrile-based composites for efficient electromagnetic interference shielding
- Review Articles
- Recycling waste sources into nanocomposites of graphene materials: Overview from an energy-focused perspective
- Hybrid nanofiller reinforcement in thermoset and biothermoset applications: A review
- Current state-of-the-art review of nanotechnology-based therapeutics for viral pandemics: Special attention to COVID-19
- Solid lipid nanoparticles for targeted natural and synthetic drugs delivery in high-incidence cancers, and other diseases: Roles of preparation methods, lipid composition, transitional stability, and release profiles in nanocarriers’ development
- Critical review on experimental and theoretical studies of elastic properties of wurtzite-structured ZnO nanowires
- Polyurea micro-/nano-capsule applications in construction industry: A review
- A comprehensive review and clinical guide to molecular and serological diagnostic tests and future development: In vitro diagnostic testing for COVID-19
- Recent advances in electrocatalytic oxidation of 5-hydroxymethylfurfural to 2,5-furandicarboxylic acid: Mechanism, catalyst, coupling system
- Research progress and prospect of silica-based polymer nanofluids in enhanced oil recovery
- Review of the pharmacokinetics of nanodrugs
- Engineered nanoflowers, nanotrees, nanostars, nanodendrites, and nanoleaves for biomedical applications
- Research progress of biopolymers combined with stem cells in the repair of intrauterine adhesions
- Progress in FEM modeling on mechanical and electromechanical properties of carbon nanotube cement-based composites
- Antifouling induced by surface wettability of poly(dimethyl siloxane) and its nanocomposites
- TiO2 aerogel composite high-efficiency photocatalysts for environmental treatment and hydrogen energy production
- Structural properties of alumina surfaces and their roles in the synthesis of environmentally persistent free radicals (EPFRs)
- Nanoparticles for the potential treatment of Alzheimer’s disease: A physiopathological approach
- Current status of synthesis and consolidation strategies for thermo-resistant nanoalloys and their general applications
- Recent research progress on the stimuli-responsive smart membrane: A review
- Dispersion of carbon nanotubes in aqueous cementitious materials: A review
- Applications of DNA tetrahedron nanostructure in cancer diagnosis and anticancer drugs delivery
- Magnetic nanoparticles in 3D-printed scaffolds for biomedical applications
- An overview of the synthesis of silicon carbide–boron carbide composite powders
- Organolead halide perovskites: Synthetic routes, structural features, and their potential in the development of photovoltaic
- Recent advancements in nanotechnology application on wood and bamboo materials: A review
- Application of aptamer-functionalized nanomaterials in molecular imaging of tumors
- Recent progress on corrosion mechanisms of graphene-reinforced metal matrix composites
- Research progress on preparation, modification, and application of phenolic aerogel
- Application of nanomaterials in early diagnosis of cancer
- Plant mediated-green synthesis of zinc oxide nanoparticles: An insight into biomedical applications
- Recent developments in terahertz quantum cascade lasers for practical applications
- Recent progress in dielectric/metal/dielectric electrodes for foldable light-emitting devices
- Nanocoatings for ballistic applications: A review
- A mini-review on MoS2 membrane for water desalination: Recent development and challenges
- Recent updates in nanotechnological advances for wound healing: A narrative review
- Recent advances in DNA nanomaterials for cancer diagnosis and treatment
- Electrochemical micro- and nanobiosensors for in vivo reactive oxygen/nitrogen species measurement in the brain
- Advances in organic–inorganic nanocomposites for cancer imaging and therapy
- Advancements in aluminum matrix composites reinforced with carbides and graphene: A comprehensive review
- Modification effects of nanosilica on asphalt binders: A review
- Decellularized extracellular matrix as a promising biomaterial for musculoskeletal tissue regeneration
- Review of the sol–gel method in preparing nano TiO2 for advanced oxidation process
- Micro/nano manufacturing aircraft surface with anti-icing and deicing performances: An overview
- Cell type-targeting nanoparticles in treating central nervous system diseases: Challenges and hopes
- An overview of hydrogen production from Al-based materials
- A review of application, modification, and prospect of melamine foam
- A review of the performance of fibre-reinforced composite laminates with carbon nanotubes
- Research on AFM tip-related nanofabrication of two-dimensional materials
- Advances in phase change building materials: An overview
- Development of graphene and graphene quantum dots toward biomedical engineering applications: A review
- Nanoremediation approaches for the mitigation of heavy metal contamination in vegetables: An overview
- Photodynamic therapy empowered by nanotechnology for oral and dental science: Progress and perspectives
- Biosynthesis of metal nanoparticles: Bioreduction and biomineralization
- Current diagnostic and therapeutic approaches for severe acute respiratory syndrome coronavirus-2 (SARS-COV-2) and the role of nanomaterial-based theragnosis in combating the pandemic
- Application of two-dimensional black phosphorus material in wound healing
- Special Issue on Advanced Nanomaterials and Composites for Energy Conversion and Storage - Part I
- Helical fluorinated carbon nanotubes/iron(iii) fluoride hybrid with multilevel transportation channels and rich active sites for lithium/fluorinated carbon primary battery
- The progress of cathode materials in aqueous zinc-ion batteries
- Special Issue on Advanced Nanomaterials for Carbon Capture, Environment and Utilization for Energy Sustainability - Part I
- Effect of polypropylene fiber and nano-silica on the compressive strength and frost resistance of recycled brick aggregate concrete
- Mechanochemical design of nanomaterials for catalytic applications with a benign-by-design focus
