Abstract
This study aimed to explore the role and mechanism of felodipine in lung cancer therapy. Murine subcutaneous lung squamous cancer (LUSC) models constructed by KLN-205 cells were utilized to assess the effect of felodipine monotherapy and in combination with the programmed cell death protein 1 antibody (PD1ab) and cytotoxic T lymphocyte-associated antigen-4 (CTLA4ab). Immunohistochemistry analysis was subsequently applied to detect the number of CD8+ T cells and Ki67+ cells. Lastly, a series of in vitro and in vivo experiments were performed to evaluate the effects of felodipine on human LUSC cells and explore the preliminary mechanism underlying felodipine inhibition. The results revealed that felodipine monotherapy exerted a significant inhibitory effect on LUSC growth and synergistic antitumoral activity with PD1ab and CTLA4ab. Meanwhile, immunohistochemistry analysis displayed that felodipine promoted CD8+ T-cell infiltration and downregulated Ki67 expression in tumor cells. Moreover, in vitro and in vivo experiments utilizing human LUSC cells determined that felodipine impaired the proliferative and migratory abilities of cancer cells. In addition, TCGA data analysis uncovered that nuclear factor of activated T cell (NFAT1) expression was positively correlated with overall survival and disease-free survival. Finally, the cell counting kit-8 assay signaled that felodipine might suppress tumor growth by modulating NFAT1.
1 Introduction
Felodipine, a member of the dihydropyridine class of calcium channel blockers (CCBs), is a first-line drug that has been extensively used for the management and treatment of essential hypertension [1]. Besides hypertension, it is widely administered for the treatment of other diseases, such as Prinzmetal angina and chronic stable angina pectoris [2]. Literature on the potential anti-tumorigenic properties of CCBs, such as verapamil and nifedipine, is scarce. A growing body of evidence suggested that the former could restrain tumor-malignant biological behavior and mitigate cancer-related mortality [3,4], whereas dissenting opinions hypothesize that the latter could increase the risk of several cancers [5,6,7]. Nifedipine has been reported to suppress colorectal cancer (CRC) progression and immune escape [8], although contrasting studies have revealed that it stimulated the proliferation and migration of different breast cancer cells via distinct pathways [9]. As for the commonly prescribed CCB, felodipine, studies on its anti-cancer activity are limited. Interestingly, a prior study reported that felodipine could inhibit cholangiocarcinoma progression and enhance the therapeutic effect of gemcitabine in nude mice [10]. However, its role and clinical significance in cancer therapy, such as in combination with immune checkpoint blockades (ICBs) for the treatment of lung cancer, remains to be elucidated.
Lung cancer remains the most lethal malignant tumor worldwide. According to a recent epidemiological investigation, an estimated 1,796,144 deaths have been attributed to lung cancer, accounting for 18% of all cancer-associated deaths globally in 2020 [11,12]. Among the subtypes of lung cancer characterized by a deficiency of known driver genes, late diagnosis, high heterogeneity, and lung squamous cell carcinoma (LUSC) occupy commonplace and are often associated with a poor prognosis. Indeed, almost half of LUSC patients have already progressed to late-stage cancer at the time of diagnosis. The 5-year survival rates of LUSC patients with stages II, III, and IV disease are approximately 32, 13, and 2%, respectively [13]. Currently, ICB therapies have emerged as the gold standard for various tumors, with programmed death 1 (PD-1), programmed death ligand 1 (PD-L1), and cytotoxic T lymphocyte antigen 4 (CTLA-4) inhibitors being the most commonly used inhibitors [14,15]. As is well documented, immune surveillance is essential for maintaining cellular homeostasis and preventing carcinogenesis [16]. Overexpression of immune checkpoint molecules such as PD-L1 and CTLA-4 in tumors can contribute to the formation of an immunosuppressive microenvironment that facilitates carcinogenesis. As a result, blockade of the PD-1/PD-L1 axis and CTLA4/B7 can eliminate these knock-on effects and remains the most common and effective checkpoint inhibition strategy. To date, many checkpoint blockade drugs have been licensed for the clinical treatment of cancer with improved overall survival (OS) time and a lower incidence of toxic side effects than traditional chemotherapeutic regimens [17]. As for LUSC patients, ICBs, such as PD-L1/PD-1 inhibitors, have significantly improved their prognosis, especially for late-stage cancer patients limited by a lack of treatment options. However, only 30% of the patients are responsive to the therapy [18,19]. Indeed, there is an urgent need to identify novel and effective functions from safe, widely clinically used drugs and develop combined therapeutic strategies with ICBs for LUSC patients.
Overall, the role of felodipine in cancer therapy, such as in combination with ICBs for the treatment of lung cancer, remains largely unknown. Herein, in this study, we aimed to investigate the action and mechanism of felodipine in LUSC tumor progression and ICB therapy.
2 Materials and methods
2.1 Cell culture and RNA interference
The murine LUSC cell line KLN-205 was purchased from Kangbai Biotechnology (Cat # CBP60080). The human LUSC cell lines SKMES-1 and NCIH226 were procured from Pricella, Wuhan, China (Cat # CL-0213, Cat # CL-0396) and American Type Culture Collection, respectively. The cells were cultured in an Eagle’s Minimum Essential Medium (Cat # M6074, MEM, Sigma-Aldrich, USA) supplemented with 10% fetal bovine serum (Cat # 10091148, Gibco) at 37°C with 5% CO2. All the cell lines were tested for mycoplasma, and the results were negative. When the cell confluency reached 70–80%, pancreatin was added for digestion. Human siRNA was used to knock down nuclear factor of activated T cell (NFAT1) expression, and the sequences were as follows: CCGAGTCCAAAGTTGTGTTTA (Shanghai Genechem Co., Ltd). SKMES-1 and NCIH226 were transfected with the aforementioned siRNA utilizing Lipofectamine 2000 (ThermoFisher).
2.2 Animal study
All animal procedures were conducted in accordance with the recommendations of the National Institutes of Health’s guidance for the use and care of laboratory animals and were approved by the Animal Care and Use Committee of Taizhou University, the ethical approval number is TZXY-2023-20231056.
DBA/2 mice (female, aged 5–6 weeks, 18–20 g) and BALB/c nude mice (female, aged 4–5 weeks, 17–19 g) were procured from the Guangdong Medical Laboratory Animal Center. 0.5–1 × 106 KLN-205 cells were administered to DBA/2 mice, whereas 1–5 × 106 SKMES-1 cells were administered to BALB/c nude mice. When the tumor was palpable, to establish the KLN-205 subcutaneous tumor model, 64 DBA/2 mice were randomized to the 8 following treatment groups and received retro-orbital injections of the designated drugs: control group (n = 8, 2 groups, PBS, intraperitoneally [i.p.], injected once every 2 days), felodipine group (n = 8, 2 groups, Cat # HY-B0309, MedChemExpress, 20 mg/kg, i.p., injected once every 2 days), programmed cell death protein 1 antibody (PD1ab) group (n = 8, 1 group, Cat # BE0146, 0.2 mg/mouse, i.p., injected once every 2 days), CTLA4ab group (n = 8, 1 group, Cat # BE0164, 0.1 mg/mouse, i.p., injected once every 2 days), PD1ab + felodipine group (n = 8, 1 group, PD1ab and felodipine) and CTLA4ab + felodipine group (n = 8, 1 group, CTLA4ab and felodipine). To construct the SKMES-1 subcutaneous tumor model, 16 BALB/c nude mice were randomized to the 2 following treatment groups and received retro-orbital injections of the designated drug: control group (n = 8, 2 groups, PBS) and felodipine group (n = 8, 2 groups, Cat#HY-B0309, MedChemExpress, 20 mg/kg, i.p., injected once every 2 days). The length (a) and width (b) of the tumor was measured by a slide caliper every other day, and tumor volume was calculated with the following formula: volume = a × b 2/2. At the same time, the weight of the mice was measured every other day. Tumor tissues were harvested when the mass reached 1,000 mm3 or was evidently ulcerated; cachexia occurred approximately 2–3 weeks after cell injection. The weight of the tumor was also measured. The tissues were then excised and placed in 10% neutral buffered formalin for at least 24 h. For OS analysis, another group of 80 DBA/2 mice were randomized to the 8 following treatment groups and received retro-orbital injections of the designated drug as follows: control group (n = 10, 2 groups, PBS), felodipine group (n = 8, 2 groups), PD1ab group (n = 8, 1 group), CTLA4ab group (n = 8, 1 group), PD1ab + felodipine group (n = 8, 1 group, PD1ab and felodipine), and CTLA4ab + felodipine group (n = 8, 1 group, CTLA4ab and felodipine). The endpoint was defined as follows: the tumor volume attained 1,500 mm3, or the diameter of the ulcer exceeded 1.5 cm. The procedure references the animal study of a recent report [8,20].
2.3 Immunohistochemistry
The tissues of each group (control group, felodipine group, PD1ab group, PD1ab + felodipine group) were excised and placed in 10% neutral buffered formalin for the same treatments as follows. After the sections of each group (control group, felodipine group, PD1ab group, PD1ab + felodipine group) suffer baking and dewaxing, the sections received same treatments as follows. IHC analysis was conducted using a kit (Cat # K135925C, ZSGBBIO, Beijing, China). After incubating with primary antibodies against CD8 (Cat # ab209775, ABCAM, 1:1,000) and Ki67 (Cat#ZM-0167, ZSGB-BIO, 1:400) and staining with 3,3-diaminobenzi-dine (DAB) and Mayer’s hematoxylin, the sections were photographed, and the number of positive cells was counted. The procedure references the material and method used in a recent literature [21].
2.4 Cell counting kit-8 (CCK-8)
Cell proliferation was analyzed using a CCK-8 (Cat # CK04, Dojindo, Japan). KLN-205 and SKMES-1 NICH226A cells were plated in 96-well plates at a density of 1,000 cells/well. After adding felodipine, cell proliferation of each group (DMSO group, felodipine [10 μM] group, felodipine [50 μM] group) was tested on days 0, 1, 2, 3, 4, 5, and 6 after adding CCK-8 reagent utilizing a microplate reader (Cat# 1681135, Bio-Rad Laboratories Inc, USA), and absorbance was measured at 450 nm. This assay references the material and method used in a recent report [22].
2.5 Colony formation assay
SKMES-1 cells were plated in 6-well plates with felodipine at a density of 400 cells/well at 37°C and 5% CO2 for 10–14 days. Each group (DMSO group, felodipine [10 μM] group) received same treatments as follows. The medium consisted of Eagle’s Minimum Essential Medium supplemented with 10% fetal bovine serum and was timely replaced. When the cell colonies were visible, they were fixed and stained with 0.1% crystal violet. Afterward, the plates were photographed, and the cell colonies were counted. This experiment references the material and method used in a recent report [21].
2.6 Wound healing assay
Cells were plated in 6-well plates at a density of 5 × 105 SKMES-1 cells/well. When the cells approached 100% confluency, a 10 μL sterile pipette tip was employed to scratch a straight line. At the same time, felodipine was added to the medium. Each group (DMSO group, felodipine [10 μM] group) received same treatments as follows. The shapes of the straight lines were photographed at specified time points (0, 12, 24, and 36 h). This experiment was followed by the material and method in a recent report [23].
2.7 Real-time quantitative PCR (qPCR)
SKMES-1 and NCIH226 cells were plated in 6-well plates at a density of 5 × 105 cells/well and cultured in a medium containing felodipine. Each group (DMSO group, felodipine [10 μM] group, felodipine [50 μM] group, felodipine [100 μM] group) received same treatments as follows. After 48 h, the cells were collected, and the total RNA was extracted with a TRIzol reagent (Invitrogen, USA). cDNA was reverse-transcribed using a Prime-Script RT reagent Kit (Promega, Madison, WI, USA). The SYBR Premix EX Taq™ (Takala, Dalian, China), operating on an ABI 7500 Real-Time PCR system (Applied Biosystems, Foster City, USA), was used for qPCR. The primer sequences for NFAT1 amplification were as follows: 5′-CGATTCGGAGAGCCGGATAG-3′ (forward) and 5′-TGGGACGGAGTGATCT CGAT-3′ (reverse) (synthesized by Shenggong Biotechnology, Guangzhou, China). GAPDH served as an internal control. Relative gene expression was calculated by the comparative 2−ΔΔCT method. The procedure follows the instruction of test kits and references the material and method used in a recent report [24].
2.8 Statistical analysis
Soft EXCEL was utilized to collect the data. GraphPad 9.02 was used to perform statistical analyses. Continuous variables with normal distribution and non-normal distribution were expressed as mean ± standard deviation (SD) and median (interquartile range), respectively. The Student’s t-test (two-tailed) was used for group comparison. The survival rates were evaluated by Kaplan–Meier method and tested by log-rank test. p < 0.05 was considered statistically significant.
3 Results
3.1 Felodipine suppressed LUSC growth and promoted tumor immune responses to ICBs
Felodipine is a dihydropyridine calcium-channel antagonist that significantly reduces diastolic and systolic blood pressure in hypertensive patients and exerts beneficial hemodynamic effects in patients with congestive heart failure and chronic stable angina pectoris. Herein, analyzing the subcutaneous tumor model in immunocompetent DAB/2 mice exposed that felodipine monotherapy significantly inhibited the grafted KLN-205 cells growth, whereas PD1ab monotherapy exerted no significant inhibitory effect compared with the control group. Surprisingly, felodipine plus PD1ab improved the inhibitory effects compared with PD1ab monotherapy, indicating that felodipine may potentiate tumor immune responses to PD1ab (Figure 1a–c). When compared with the control group, the body weight of mice in each group (felodipine, PD1ab, and combination group) showed no significant change (Figure 1d). Furthermore, the survival time of mice in the felodipine monotherapy group and the felodipine plus PD1ab group was significantly longer than the control group and PD1ab monotherapy group, respectively (Figure 1e). Similar results were observed upon the administration of CTLA4ab and felodipine in the tumor-bearing mice. More specifically, tumor growth was slower in the KLN205 tumors of mice in the felodipine monotherapy and the felodipine combined with CTLA4ab groups compared with that of the control and CTLA4ab monotherapy groups (Figure 1f–h). When compared with the control group, the body weight of mice in each group (felodipine, PD1ab, and combination group) showed no significant change (Figure 1i). Consequently, mice in the felodipine monotherapy group and those in the felodipine plus CTLA4ab group achieved longer survival outcomes than those in the control group and the CTLA4ab monotherapy group (Figure 1j).

Felodipine suppressed LUSC growth and strengthened tumor immune responses to ICBs. (a–c) Felodipine plus PD1ab inhibited KLN-205 tumor growth in DBA/2 mice (n = 8). (d) The weight of mice. (e) The survival time of mice receiving felodipine plus PD1ab (n = 10). (f)–(h) Felodipine plus CTLA4ab inhibited KLN-205 tumor growth in DBA/2 mice (n = 8). (i) The weight of mice. (j) The survival time of mice receiving felodipine plus CTLA4ab (n = 10). Data are presented as mean ± SD, n.s. no significance; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Error bars denote s.e.m.
IHC detection of the KLN-205 tumors revealed that felodipine promoted CD8+ T-cell infiltration and decreased Ki67 expression compared with the control group. Besides, an increased number of CD8+ T cells as well as a decreased Ki67 expression were noted in the tumor microenvironment of the felodipine plus PD1ab group (Figure 2a–d).

IHC analysis of the tumor tissue after receiving felodipine plus PD1ab treatment. (a and b) IHC analysis of CD8+ T-cell infiltration of KLN-205 tumor tissue after treatment, representative positive cells were marked with arrows; (c and d) IHC staining of Ki67+ cell infiltration of KLN-205 tumor tissue after treatment, representative positive cells were marked with arrows; scale bars, 20 μm. Data are expressed as mean ± SD, n.s. no significance; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Error bars denote s.e.m.
3.2 Felodipine inhibited human LUSC proliferation and migration
The impact of felodipine on the proliferative ability of the SKME-1 and NCIH226 human LUSC cell lines was investigated using CCK-8 and colony formation assays. The results of the CCK-8 assay indicated that felodipine significantly impaired the proliferative ability of both SKME-1 and NCIH226 cells (Figure 3a and b). Moreover, the inhibitory effect of felodipine was validated by the colony formation assay (Figure 3c and d). Similarly, the migratory capability of SKME-1 human LUSC cells was significantly suppressed by felodipine (Figure 3e and f). Nude mice were subcutaneously injected with human LUSC SKME-1 cells to verify the effects of felodipine in vivo, and the results demonstrated that tumor tissues of mice receiving felodipine were smaller and lighter than those in the control group, suggesting that felodipine suppressed LUSC proliferation in vivo (Figure 3g–i).

Felodipine inhibited human LUSC proliferation and migration. (a) CCK-8 assay analyzing SKMES-1 proliferation after felodipine (0, 10, 50 μM) treatment. (b) CCK-8 assay investigating NCIH226 proliferation after felodipine (0, 10, 50 μM) treatment. (c and d) Colony formation assay evaluating SKMES-1 proliferation after felodipine (10 μM) treatment. (e and f) Wound healing assay examining SKMES-1 migration after felodipine (10 μM) treatment; scale bars, 200 μm. (g) – (i) Subcutaneous tumor model in nude mice (n = 8) evaluating SKMES-1 growth following felodipine treatment (20 mg/kg); data are expressed as mean ± SD, n.s. no significance; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Error bars denote s.e.m.
3.3 Felodipine suppressed human LUSC progression via NFAT1
TCGA data analysis determined that upregulation of NFAT1 was negatively correlated with OS and disease-free survival (DFS) in LUSC patients (Figure 4a and b), signifying that the clinical significance of NFAT1 in LUSC cannot be overlooked. Additionally, qPCR analysis demonstrated that felodipine significantly downregulated NFAT1 expression in SKME-1 and NCIH226 human LUSC cells (Figure 4c and d). Furthermore, the CCK-8 assay showed that felodipine and NFAT1 knockdown by RNA interference technology significantly decreased the proliferative ability of SKMES-1 cells compared with the control group. Nevertheless, there was no significant difference in the felodipine plus si-NFAT1 group compared with the si-NFAT1 group (Figure 4e); that is to say, felodipine may lose its inhibitory effect after NFAT1 knockdown. Consistent results were observed by utilizing another human LUSC cell line, namely NCIH226 (Figure 4f). Nonetheless, further experiments and mechanistic exploration are warranted to validate the credibility of our results.

Felodipine suppressed human LUSC progression via NFAT1. (a and b) Data from the TCGA database were used to explore the relationship between OS, DFS, and NFAT1 expression in LUSC patients, respectively. (c) qPCR detection of NFAT1 after felodipine (10, 50, 100 μM) treatment in SKMES-1. (d) qPCR detection of NFAT1 after felodipine (10, 50, 100 μM) treatment in NCH226. (e) CCK-8 assay examining SKMES-1 proliferation after felodipine treatment and NFAT1 knockdown. (f) CCK-8 assay examining NCH226 proliferation after felodipine treatment and NFAT1 knockdown. Data are presented as mean ± SD, n.s. no significance; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Error bars denote s.e.m.
4 Discussion
In this study, felodipine showed synergistic activity with ICBs, including PD1ab and CTLA4ab, and suppressed the progression of LUSC by inhibiting cell proliferation and migration by regulating NFAT1. This is the first study to investigate the action and mechanism of felodipine in LUSC in vivo and in vitro. Collectively, these findings indicated that felodipine can be used for clinical treatment of LUSC.
Given the high incidence of hypertension and lung cancer, both diseases are frequently co-diagnosed since they share common denominators, such as the age of onset. Besides, a large body of evidence insinuated that hypertension is closely correlated with the incidence and prognosis of common malignant tumors, including lung, colon, oral, esophageal, and laryngeal cancers [25,26,27,28,29]. Cancer patients with hypertension typically have a worse prognosis than normotensive ones [30,31]. Therefore, it is vital to identify the role of common first-line antihypertensives such as felodipine in cancer treatment. The research here has at least three advantages: (1) it affirms the position of felodipine as the drug of choice in cancer patients with comorbid hypertension, Prinzmetal’s variant angina, and chronic stable angina pectoris undergoing cancer treatment, especially immunotherapy. (2) the study may offer novel insights into the development of therapeutic strategies for the treatment of cancer using commonly prescribed drugs. (3) it is conducive to assuring the safety of felodipine for cancer prevention.
Felodipine is a first-line antihypertensive that belongs to the dihydropyridine class of CCBs. CCBs such as verapamil and nifedipine have been reported to exert anti-tumorigenic effects in various cancers, including CRC, skin cancer, and lung cancer. While previous studies predominantly focused on cancer stemness and chemotherapy resistance [32,33,34,35,36], there is a paucity of studies on ICBs such as CTLA4ab, which suppresses expression of CTLA4 to promote proliferation of T cell to attack the tumor cells and are also the standard of care, either as monotherapy or in combination with other drugs for lung cancer therapy [37], however, a considerable portion of patients do not benefit from it. Indeed, report about what effect of CCBs including verapamil, nifedipine and felodipine will generate on this ICBs is rare. As for another common ICBs PD1ab, only one study reported that nifedipine could suppress CRC progression and immune escape by mitigating NFAT2 nuclear translocation, thereby enhancing the effect of PD1ab on tumor inhibition [8]. However, it is worthwhile emphasizing that the pharmacological properties of these three CCBs are distinct. Compared with verapamil and nifedipine, felodipine has a longer duration of action and wider application range in clinical practice [38]; yet its role in LUSC treatment remains unknown, especially when used in conjunction with ICB therapy. In our research, felodipine was verified to show synergistic activity with ICBs including PD1ab and CTLA4ab. And felodipine also significantly increased the infiltration of CD8 + T cells into the tumors. In view of reports about PD1ab and CTLA4ab combination [39,40,41], we may hypothesize that felodipine alter the vascular permeablility for immune cells or induce cytokines secretion and reprogram the tumor immune microenvironment to an suppressed status for enhancing the tumor inhibition of PD1ab and CTLA4ab. The detailed mechanism needs further study.
Laboratory research on felodipine in tumor prevention is scarce. Related research described that felodipine could be repurposed to target the TRPV1 receptor and relieve oral cancer pain [42]. Another study evinced that felodipine could directly suppress cholangiocarcinoma progression and potentiate the therapeutic effect of gemcitabine in vivo [10]. Therefore, this research employed the human LUSC cell lines SKMES-1 and NCIH226 to demonstrate that felodipine can suppress proliferative and migratory abilities both in vivo and in vitro. Nevertheless, research on its inhibitory effects in cholangiocarcinoma is limited to phenotypic studies rather than mechanistic studies. Again, recent research concluded that nifedipine inhibited CRC progression by modulating NFAT2, which may provide insights into novel targets of felodipine for tumor inhibition and immune response to PD1ab.
Calcium-dependent NFAT is a vital transcription family involved in mediating tumor development, which governs angiogenesis, homeostasis, inflammatory response, and the immune system in bones [41,42,43]. Emerging evidence indicates that the NFAT family remains activated and participates in the progression of numerous cancers, such as non-small cell lung cancer, pancreatic cancer, CRC, and breast cancer, thereby playing a decisive role in the malignant biological behaviors of tumors [43,44,45]. Furthermore, a recent study reported that another common calcium-channel antagonist, namely nifedipine, suppressed CRC progression by modulating NFAT2 [8]. Nevertheless, the TCGA database identified no significant correlation between NFAT2 expression and the prognosis of LUSC patients (data not shown). Naturally, the function of NFAT in LUSC is poorly understood. As another important member of the NFAT family, NFAT1 plays a role in the progression of several tumors, including breast cancer, renal cell carcinoma, melanoma, and glioma [46,47,48,49]. Yet, its specific role in tumor immunotherapy and the progression of LUSC is elusive. This study noted that the poor prognosis of LUSC patients was closely associated with high expression of NFAT1. Meanwhile, felodipine can significantly down-regulate the expression of NFAT1 and further suppress SKMES-1 and NCIH226 cell proliferation. Conversely, NFAT1 knockdown reversed the effect of felodipine on tumor inhibition compared with the control group. In other words, the inhibitory effect of felodipine may potentially be NFAT1-dependent.
5 Conclusion
To the best of our knowledge, this is the first study to investigate the action and mechanism of felodipine in LUSC in vivo and in vitro. Taken together, felodipine exhibited synergistic activity with ICB and inhibited tumor growth by mediating NFAT1 expression in LUSC (Figure 5). Our research provides elementary experimental results for the treatment of LUSC using felodipine, but there are still some limitations that cannot be overlooked such as more direct evidence are warranted to verify that felodipine inhibited tumor growth via NFAT1, in consideration of the time and cost of the trial, we can only explore this mechanism by simple and feasible experiments of the present kind. More experiments in vivo and vitro are needed to validate the results of this study. We will explore this in more depth in the next stage.

A schematic diagram illustrating felodipine exhibited synergistic activity with ICB and inhibited tumor growth by mediating NFAT1 expression in LUSC.
Acknowledgments
We thank for Guangzhou Medical University providing facilities and technical support. We also thank for Dr. Binbo Fang from Taizhou Medical University kindly helping with the animal study.
-
Funding information: Natural Science Foundation of Guangdong Province (No. 2018A030313980).
-
Author contributions: Conceptualization: SY and HK; methodology: SY; Investigation: SY; visualization: SY; funding acquisition: HK; project administration: SY and HK; supervision: HK; writing – original draft: SY; writing – review & editing: HK.
-
Conflict of interest: Authors declare that they have no competing interest.
-
Data availability statement: The datasets generated during the current study are available from the corresponding author upon reasonable request.
References
[1] Bansal AB, Khandelwal G. Felodipine. StatPearls. Treasure Island (FL): StatPearls Publishing Copyright © 2023. StatPearls Publishing LLC; 2023.Suche in Google Scholar
[2] Drais HK, Hussein AA. Lipid-polymer hybrid nanocarriers for oral delivery of felodipine: formulation, characterization and ex vivo evaluation. Adv Pharm Bull. 2022;12(4):791–800.10.34172/apb.2022.081Suche in Google Scholar PubMed PubMed Central
[3] Fan GF, Pan JJ, Fan PS, Zhang TY, Liu YB, Huang J, et al. The clinical observation of verapamil in combination with interventional chemotherapy in advanced gastric cancer. Eur Rev Med Pharmacol Sci. 2018;22(17):5508–18.Suche in Google Scholar
[4] Nandi SK, Roychowdhury T, Chattopadhyay S, Basu S, Chatterjee K, Choudhury P, et al. Deregulation of the CD44-NANOG-MDR1 associated chemoresistance pathways of breast cancer stem cells potentiates the anti-cancer effect of Kaempferol in synergism with Verapamil. Toxicol Appl Pharmacol. 2022;437:115887.10.1016/j.taap.2022.115887Suche in Google Scholar PubMed
[5] Pahor M, Guralnik JM, Ferrucci L, Corti MC, Salive ME, Cerhan JR, et al. Calcium-channel blockade and incidence of cancer in aged populations. Lancet (London, Engl). 1996;348(9026):493–7.10.1016/S0140-6736(96)04277-8Suche in Google Scholar PubMed
[6] Rotshild V, Azoulay L, Feldhamer I, Perlman A, Glazer M, Muszkat M, et al. Calcium channel blockers and the risk for lung cancer: A population-based nested case-control study. Ann Pharmacother. 2019;53(5):445–52.10.1177/1060028018814684Suche in Google Scholar PubMed
[7] Colt JS, Hofmann JN, Schwartz K, Chow WH, Graubard BI, Davis F, et al. Antihypertensive medication use and risk of renal cell carcinoma. Cancer Causes Control CCC. 2017;28(4):289–97.10.1007/s10552-017-0857-3Suche in Google Scholar PubMed PubMed Central
[8] Wu L, Lin W, Liao Q, Wang H, Lin C, Tang L, et al. Calcium channel blocker nifedipine suppresses colorectal cancer progression and immune escape by preventing NFAT2 nuclear translocation. Cell Rep. 2020;33(4):108327.10.1016/j.celrep.2020.108327Suche in Google Scholar PubMed
[9] Zhao T, Guo D, Gu Y, Ling Y. Nifedipine stimulates proliferation and migration of different breast cancer cells by distinct pathways. Mol Med Rep. 2017;16(2):2259–63.10.3892/mmr.2017.6818Suche in Google Scholar PubMed
[10] Braconi C, Swenson E, Kogure T, Huang N, Patel T. Targeting the IL-6 dependent phenotype can identify novel therapies for cholangiocarcinoma. PLoS one. 2010;5(12):e15195.10.1371/journal.pone.0015195Suche in Google Scholar PubMed PubMed Central
[11] Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: Cancer J Clin. 2021;71(3):209–49.10.3322/caac.21660Suche in Google Scholar PubMed
[12] Jakobsen E, Olsen KE, Bliddal M, Hornbak M, Persson GF, Green A. Forecasting lung cancer incidence, mortality, and prevalence to year 2030. BMC Cancer. 2021;21(1):985.10.1186/s12885-021-08696-6Suche in Google Scholar PubMed PubMed Central
[13] Wang BY, Huang JY, Chen HC, Lin CH, Lin SH, Hung WH, et al. The comparison between adenocarcinoma and squamous cell carcinoma in lung cancer patients. J Cancer Res Clin Oncol. 2020;146(1):43–52.10.1007/s00432-019-03079-8Suche in Google Scholar PubMed
[14] Dermani FK, Samadi P, Rahmani G, Kohlan AK, Najafi R. PD-1/PD-L1 immune checkpoint: Potential target for cancer therapy. J Cell Physiol. 2019;234(2):1313–25.10.1002/jcp.27172Suche in Google Scholar PubMed
[15] Zhang H, Dai Z, Wu W, Wang Z, Zhang N, Zhang L, et al. Regulatory mechanisms of immune checkpoints PD-L1 and CTLA-4 in cancer. J Exp Clin Cancer Res CR. 2021;40(1):184.10.1186/s13046-021-01987-7Suche in Google Scholar PubMed PubMed Central
[16] Adachi K, Tamada K. Immune checkpoint blockade opens an avenue of cancer immunotherapy with a potent clinical efficacy. Cancer Sci. 2015;106(8):945–50.10.1111/cas.12695Suche in Google Scholar PubMed PubMed Central
[17] Ellis PM, Vella ET, Ung YC. Immune checkpoint inhibitors for patients with advanced non-small-cell lung cancer: A systematic review. Clin Lung Cancer. 2017;18(5):444–59.10.1016/j.cllc.2017.02.001Suche in Google Scholar PubMed
[18] Lee BR, Chae S, Moon J, Kim MJ, Lee H, Ko HW, et al. Combination of PD-L1 and PVR determines sensitivity to PD-1 blockade. JCI Insight. 2020;5(14):e128633.10.1172/jci.insight.128633Suche in Google Scholar PubMed PubMed Central
[19] Reck M, Rodríguez-Abreu D, Robinson AG, Hui R, Csőszi T, Fülöp A, et al. Pembrolizumab versus chemotherapy for PD-L1-positive non-small-cell lung cancer. N Engl J Med. 2016;375(19):1823–33.10.1056/NEJMoa1606774Suche in Google Scholar PubMed
[20] Reda M, Ngamcherdtrakul W, Nelson MA, Siriwon N, Wang R, Zaidan HY, et al. Development of a nanoparticle-based immunotherapy targeting PD-L1 and PLK1 for lung cancer treatment. Nat Commun. 2022;13(1):4261.10.1038/s41467-022-31926-9Suche in Google Scholar PubMed PubMed Central
[21] Duan S, Huang W, Liu X, Liu X, Chen N, Xu Q, et al. IMPDH2 promotes colorectal cancer progression through activation of the PI3K/AKT/mTOR and PI3K/AKT/FOXO1 signaling pathways. J Exp Clin Cancer Res CR. 2018;37(1):304.10.1186/s13046-018-0980-3Suche in Google Scholar PubMed PubMed Central
[22] Tang X, Ding H, Liang M, Chen X, Yan Y, Wan N, et al. Curcumin induces ferroptosis in non-small-cell lung cancer via activating autophagy. Thorac Cancer. 2021;12(8):1219–30.10.1111/1759-7714.13904Suche in Google Scholar PubMed PubMed Central
[23] Xie C, Zhou X, Liang C, Li X, Ge M, Chen Y, et al. Apatinib triggers autophagic and apoptotic cell death via VEGFR2/STAT3/PD-L1 and ROS/Nrf2/p62 signaling in lung cancer. J Exp Clin Cancer Res CR. 2021;40(1):266.10.1186/s13046-021-02069-4Suche in Google Scholar PubMed PubMed Central
[24] Yan M, Sun L, Li J, Yu H, Lin H, Yu T, et al. RNA-binding protein KHSRP promotes tumor growth and metastasis in non-small cell lung cancer. J Exp Clin Cancer Res CR. 2019;38(1):478.10.1186/s13046-019-1479-2Suche in Google Scholar PubMed PubMed Central
[25] Kaneko H, Yano Y, Itoh H, Morita K, Kiriyama H, Kamon T, et al. Untreated Hypertension and Subsequent Incidence of Colorectal Cancer: Analysis of a Nationwide Epidemiological Database. J Am Heart Assoc. 2021;10(22):e022479.10.1161/JAHA.121.022479Suche in Google Scholar PubMed PubMed Central
[26] Wang H, Chen L, Qian J, Chen L, Lan M, Zhuang J, et al. [Association between hypertension and oral cancer prognosis in non-smoking and non-drinking women]. Wei sheng yan jiu = J Hyg Res. 2021;50(6):944–51.Suche in Google Scholar
[27] Shi J, Chen G, Wang H, Wang X, Han B, Li K, et al. Occurrence of hypertension during third-line anlotinib is associated with progression-free survival in patients with squamous cell lung cancer (SCC): A post hoc analysis of the ALTER0303 trial. Thorac Cancer. 2021;12(17):2345–51.10.1111/1759-7714.14076Suche in Google Scholar PubMed PubMed Central
[28] Seo JH, Kim YD, Park CS, Han KD, Joo YH. Hypertension is associated with oral, laryngeal, and esophageal cancer: a nationwide population-based study. Sci Rep. 2020;10(1):10291.10.1038/s41598-020-67329-3Suche in Google Scholar PubMed PubMed Central
[29] Han H, Guo W, Shi W, Yu Y, Zhang Y, Ye X, et al. Hypertension and breast cancer risk: a systematic review and meta-analysis. Sci Rep. 2017;7:44877.10.1038/srep44877Suche in Google Scholar PubMed PubMed Central
[30] Sionakidis A, McCallum L, Padmanabhan S. Unravelling the tangled web of hypertension and cancer. Clin Sci London, England 1979. 2021;135(13):1609–25.10.1042/CS20200307Suche in Google Scholar PubMed
[31] Zeng X, Zeng D, Cheng J, Xu C, Sun C, Long H, et al. Influence of hypertension on the survival of non-small cell lung cancer patients with Type 2 diabetes mellitus. Med Sci Monitor Int Med J Exp Clin Res. 2020;26:e921676.10.12659/MSM.921676Suche in Google Scholar PubMed PubMed Central
[32] Dönmez Y, Akhmetova L, İşeri ÖD, Kars MD, Gündüz U. Effect of MDR modulators verapamil and promethazine on gene expression levels of MDR1 and MRP1 in doxorubicin-resistant MCF-7 cells. Cancer Chemother Pharmacol. 2011;67(4):823–8.10.1007/s00280-010-1385-ySuche in Google Scholar PubMed
[33] Li P, Zhong D, Gong PY. Synergistic effect of paclitaxel and verapamil to overcome multi-drug resistance in breast cancer cells. Biochem Biophys Res Commun. 2019;516(1):183–8.10.1016/j.bbrc.2019.05.189Suche in Google Scholar PubMed
[34] Wang X, Wang Z, Wang K, Gao M, Zhang H, Xu X. Metabolomics analysis of multidrug resistance in colorectal cancer cell and multidrug resistance reversal effect of verapamil. Biomed Chromatogr. 2021;35(2):e4976.10.1002/bmc.4976Suche in Google Scholar PubMed
[35] Shiozaki A, Katsurahara K, Otsuji E. ASO author reflections: Amlodipine and verapamil, voltage-gated Ca(2+) channel inhibitors suppressed the growth of gastric cancer stem cells. Ann Surg Oncol. 2021;28(9):5412–3.10.1245/s10434-021-09647-ySuche in Google Scholar PubMed
[36] Zhang Z, Qin S, Chen Y, Zhou L, Yang M, Tang Y, et al. Inhibition of NPC1L1 disrupts adaptive responses of drug-tolerant persister cells to chemotherapy. EMBO Mol Med. 2022;14(2):e14903.10.15252/emmm.202114903Suche in Google Scholar PubMed PubMed Central
[37] Genova C, Dellepiane C, Carrega P, Sommariva S, Ferlazzo G, Pronzato P, et al. Therapeutic implications of tumor microenvironment in lung cancer: Focus on immune checkpoint blockade. Front Immunol. 2021;12:799455.10.3389/fimmu.2021.799455Suche in Google Scholar PubMed PubMed Central
[38] Elmslie KS. Calcium channel blockers in the treatment of disease. J Neurosci Res. 2004;75(6):733–41.10.1002/jnr.10872Suche in Google Scholar PubMed
[39] Liu Y, Zheng P. Preserving the CTLA-4 checkpoint for safer and more effective cancer immunotherapy. Trends Pharmacol Sci. 2020;41(1):4–12.10.1016/j.tips.2019.11.003Suche in Google Scholar PubMed PubMed Central
[40] Zhu S, Ma AH, Zhu Z, Adib E, Rao T, Li N, et al. Synergistic antitumor activity of pan-PI3K inhibition and immune checkpoint blockade in bladder cancer. J Immunother Cancer. 2021;9(11):e002917.10.1136/jitc-2021-002917Suche in Google Scholar PubMed PubMed Central
[41] Geindreau M, Ghiringhelli F, Bruchard M. Vascular endothelial growth factor, a key modulator of the anti-tumor immune response. Int J Mol Sci. 2021;22(9):4871.10.3390/ijms22094871Suche in Google Scholar PubMed PubMed Central
[42] Yadalam PK, Anegundi RV, Ramadoss R, Joseph B, Veeramuthu A. Felodipine repurposed for targeting TRPV1 receptor to relieve oral cancer pain. Oral Oncol. 2022;134:106094.10.1016/j.oraloncology.2022.106094Suche in Google Scholar PubMed
[43] Ding W, Dong M, Deng J, Yan D, Liu Y, Xu T, et al. Polydatin attenuates cardiac hypertrophy through modulation of cardiac Ca2 + handling and calcineurin-NFAT signaling pathway. Am J Physiol Heart Circ Physiol. 2014;307(5):H792–802.10.1152/ajpheart.00017.2014Suche in Google Scholar PubMed
[44] Müller MR, Rao A. NFAT, immunity and cancer: a transcription factor comes of age. Nat Rev Immunol. 2010;10(9):645–56.10.1038/nri2818Suche in Google Scholar PubMed
[45] Qin JJ, Nag S, Wang W, Zhou J, Zhang WD, Wang H, et al. NFAT as cancer target: mission possible. Biochim Biophys Acta. 2014;1846(2):297–311.10.1016/j.bbcan.2014.07.009Suche in Google Scholar PubMed PubMed Central
[46] Liu W, Ren D, Xiong W, Jin X, Zhu L. A novel FBW7/NFAT1 axis regulates cancer immunity in sunitinib-resistant renal cancer by inducing PD-L1 expression. J Exp Clin Cancer Res CR. 2022;41(1):38.10.1186/s13046-022-02253-0Suche in Google Scholar PubMed PubMed Central
[47] Qin JJ, Wang W, Zhang R. Experimental therapy of advanced breast cancer: Targeting NFAT1-MDM2-p53 pathway. Prog Mol Biol Transl Sci. 2017;151:195–216.10.1016/bs.pmbts.2017.07.005Suche in Google Scholar PubMed PubMed Central
[48] Jiang Y, Song Y, Wang R, Hu T, Zhang D, Wang Z, et al. NFAT1-mediated regulation of NDEL1 promotes growth and invasion of glioma stem-like cells. Cancer Res. 2019;79(10):2593–603.10.1158/0008-5472.CAN-18-3297Suche in Google Scholar PubMed
[49] Shoshan E, Braeuer RR, Kamiya T, Mobley AK, Huang L, Vasquez ME, et al. NFAT1 directly regulates IL8 and MMP3 to promote melanoma tumor growth and metastasis. Cancer Res. 2016;76(11):3145–55.10.1158/0008-5472.CAN-15-2511Suche in Google Scholar PubMed PubMed Central
© 2023 the author(s), published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Artikel in diesem Heft
- Research Articles
- Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
- Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
- circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
- circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
- WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
- Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
- Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
- 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
- Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
- PVT1/miR-16/CCND1 axis regulates gastric cancer progression
- Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
- Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
- SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
- Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
- lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
- SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
- Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
- Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
- Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
- circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
- Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
- UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
- Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
- Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
- UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
- LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
- Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
- Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
- circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
- Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
- Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
- A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
- WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
- Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
- Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
- Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
- Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
- Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
- Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
- Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
- CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
- Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
- Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
- HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
- The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
- Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
- A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
- Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
- Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
- TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
- The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
- miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
- Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
- IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
- Comprehensive analysis of the role of SFXN family in breast cancer
- Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
- Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
- AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
- Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
- Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
- Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
- The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
- Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
- Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
- F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
- Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
- Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
- Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
- Cholesterol induces inflammation and reduces glucose utilization
- circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
- NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
- The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
- miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
- Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
- α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
- Changes of microbiota level in urinary tract infections: A meta-analysis
- Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
- Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
- Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
- Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
- Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
- Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
- Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
- An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
- Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
- Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
- PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
- miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
- lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
- Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
- Subjective well-being in informal caregivers during the COVID-19 pandemic
- Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
- Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
- Bladder cancer screening: The new selection and prediction model
- circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
- Prone position effect in intensive care patients with SARS-COV-2 pneumonia
- Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
- Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
- Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
- Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
- Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
- Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
- Clinical significance of serum MBD3 detection in girls with central precocious puberty
- Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
- Collagen treatment of complex anorectal fistula: 3 years follow-up
- LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
- Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
- SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
- A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
- circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
- hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
- Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
- lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
- Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
- Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
- Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
- Analysis of somatic mutations and key driving factors of cervical cancer progression
- Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
- Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
- Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
- Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
- Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
- Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
- Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
- Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
- The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
- Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
- Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
- The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
- Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
- Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
- Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
- The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
- Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
- Clinical characteristics of current COVID-19 rehabilitation outpatients in China
- Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
- miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
- The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
- Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
- The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
- Identification of cuproptosis-related genes for predicting the development of prostate cancer
- Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
- Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
- A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
- Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
- Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
- Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
- A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
- A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
- Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
- The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
- Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
- AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
- Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
- Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
- LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
- Factors associated with gastrointestinal dysmotility in critically ill patients
- Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
- Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
- Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
- Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
- Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
- The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
- Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
- Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
- Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
- Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
- Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
- Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
- D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
- WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
- Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
- Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
- Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
- Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
- Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
- Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
- A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
- Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
- A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
- Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
- The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
- Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
- CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
- Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
- KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
- Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
- The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
- Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
- Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
- Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
- Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
- Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
- Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
- lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
- Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
- The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
- The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
- Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
- MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
- Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
- Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
- Predictors of gastrointestinal complaints in patients on metformin therapy
- Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
- A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
- Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
- miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
- Clinical features and management of lymphoepithelial cyst
- Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
- ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
- Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
- The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
- Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
- Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
- Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
- miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
- Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
- Review Articles
- Prenatal diagnosis of fetal defects and its implications on the delivery mode
- Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
- Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
- Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
- Vitamin C and epigenetics: A short physiological overview
- Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
- Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
- Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
- Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
- The progress of autoimmune hepatitis research and future challenges
- METTL16 in human diseases: What should we do next?
- New insights into the prevention of ureteral stents encrustation
- VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
- Case Reports
- Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
- Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
- Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
- Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
- Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
- Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
- Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
- Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
- Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
- Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
- CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
- Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
- Anesthetic management of fetal pulmonary valvuloplasty: A case report
- Rapid Communication
- Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
- Erratum
- Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
- Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
- Retraction
- Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
- Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
- Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
- Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
- Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
- Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
- Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
- Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
- Special issue The evolving saga of RNAs from bench to bedside - Part I
- FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
- Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Artikel in diesem Heft
- Research Articles
- Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
- Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
- circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
- circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
- WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
- Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
- Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
- 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
- Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
- PVT1/miR-16/CCND1 axis regulates gastric cancer progression
- Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
- Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
- SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
- Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
- lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
- SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
- Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
- Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
- Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
- circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
- Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
- UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
- Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
- Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
- UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
- LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
- Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
- Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
- circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
- Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
- Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
- A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
- WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
- Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
- Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
- Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
- Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
- Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
- Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
- Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
- CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
- Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
- Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
- HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
- The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
- Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
- A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
- Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
- Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
- TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
- The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
- miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
- Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
- IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
- Comprehensive analysis of the role of SFXN family in breast cancer
- Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
- Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
- AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
- Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
- Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
- Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
- The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
- Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
- Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
- F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
- Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
- Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
- Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
- Cholesterol induces inflammation and reduces glucose utilization
- circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
- NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
- The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
- miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
- Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
- α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
- Changes of microbiota level in urinary tract infections: A meta-analysis
- Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
- Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
- Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
- Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
- Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
- Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
- Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
- An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
- Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
- Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
- PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
- miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
- lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
- Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
- Subjective well-being in informal caregivers during the COVID-19 pandemic
- Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
- Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
- Bladder cancer screening: The new selection and prediction model
- circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
- Prone position effect in intensive care patients with SARS-COV-2 pneumonia
- Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
- Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
- Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
- Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
- Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
- Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
- Clinical significance of serum MBD3 detection in girls with central precocious puberty
- Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
- Collagen treatment of complex anorectal fistula: 3 years follow-up
- LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
- Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
- SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
- A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
- circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
- hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
- Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
- lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
- Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
- Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
- Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
- Analysis of somatic mutations and key driving factors of cervical cancer progression
- Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
- Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
- Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
- Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
- Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
- Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
- Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
- Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
- The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
- Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
- Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
- The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
- Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
- Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
- Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
- The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
- Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
- Clinical characteristics of current COVID-19 rehabilitation outpatients in China
- Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
- miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
- The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
- Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
- The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
- Identification of cuproptosis-related genes for predicting the development of prostate cancer
- Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
- Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
- A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
- Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
- Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
- Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
- A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
- A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
- Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
- The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
- Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
- AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
- Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
- Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
- LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
- Factors associated with gastrointestinal dysmotility in critically ill patients
- Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
- Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
- Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
- Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
- Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
- The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
- Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
- Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
- Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
- Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
- Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
- Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
- D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
- WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
- Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
- Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
- Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
- Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
- Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
- Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
- A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
- Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
- A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
- Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
- The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
- Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
- CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
- Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
- KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
- Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
- The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
- Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
- Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
- Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
- Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
- Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
- Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
- lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
- Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
- The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
- The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
- Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
- MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
- Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
- Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
- Predictors of gastrointestinal complaints in patients on metformin therapy
- Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
- A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
- Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
- miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
- Clinical features and management of lymphoepithelial cyst
- Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
- ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
- Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
- The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
- Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
- Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
- Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
- miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
- Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
- Review Articles
- Prenatal diagnosis of fetal defects and its implications on the delivery mode
- Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
- Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
- Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
- Vitamin C and epigenetics: A short physiological overview
- Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
- Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
- Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
- Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
- The progress of autoimmune hepatitis research and future challenges
- METTL16 in human diseases: What should we do next?
- New insights into the prevention of ureteral stents encrustation
- VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
- Case Reports
- Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
- Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
- Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
- Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
- Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
- Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
- Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
- Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
- Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
- Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
- CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
- Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
- Anesthetic management of fetal pulmonary valvuloplasty: A case report
- Rapid Communication
- Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
- Erratum
- Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
- Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
- Retraction
- Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
- Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
- Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
- Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
- Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
- Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
- Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
- Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
- Special issue The evolving saga of RNAs from bench to bedside - Part I
- FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
- Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer