Zum Hauptinhalt springen
Artikel Open Access

WTAP affects intracranial aneurysm progression by regulating m6A methylation modification

  • , , , , und EMAIL logo
Veröffentlicht/Copyright: 16. Oktober 2023

Abstract

Intracranial aneurysm (IA) is a type of cerebrovascular disease that mainly occurs in the circle of Willis. Abnormalities in RNA methylation at the N6-methyladenosine (m6A) site have been associated with numerous types of human diseases. WTAP recruits the m6A methyltransferase complexes to the mRNA targets, and its expression is positively correlated with m6A methylation levels. This research aimed to explore the potential mechanisms of m6A methylation in IA. A selective arterial ligation method was used to establish an IA rat model; thereafter, the m6A methylation level and m6A methylation-related genes were determined in blood and circle of Willis samples using a commercial kit and real-time quantitative PCR, respectively. Subsequently, rat brain microvascular endothelial cells (rBMVECs) were treated with TNF-α, and the expression of m6A methylation-related genes within the cells were assessed. Lastly, the effects of WTAP on TNF-α-induced rBMVECs were further investigated through in vitro experiments. In result, the m6A RNA methylation level evidently declined in the blood and circle of Willis’ samples of the IA rats, as compared to the corresponding samples from the control rats (P < 0.05). Compared to the results in the control rats/cells, WTAP expression was significantly downregulated, whereas ALKBH1 expression was evidently upregulated in the blood and circle of Willis samples of the TNF-α-induced rBMVECs of IA rats. Consequently, TNF-α-induced rBMVECs and rBMVECs with WTAP overexpression were successfully established. TNF-α inhibited the viability of the rBMVECs, promoted apoptosis, and significantly upregulated cleaved-caspase3 and downregulated WTAP expression. In contrast, WTAP overexpression significantly reversed these changes caused by TNF-α (P < 0.05). In conclusion, WTAP overexpression may modulate the growth of TNF-α-induced rBMVECs by enhancing WTAP expression and its m6A methylation.

1 Introduction

Intracranial aneurysm (IA) is a type of cerebrovascular disease characterized by the local dilation or expansion of blood vessels and is caused by weakness of the cerebral veins or cerebral artery walls [1,2]. It mainly occurs in the circle of Willis and affects about 3–5% of the total population [3]. The most frequent reason for a subarachnoid hemorrhage is the rupture of an IA; this is a devastating disease that can lead to death or permanent disability [4]. An unruptured IA is usually asymptomatic but can be recognized using magnetic resonance angiography as well as computed tomography angiography [5]. However, due to the high costs involved in brain imaging, IA screening for the entire population is not practical [2]. Despite evolvements in neurological intensive care, craniotomy, and endovascular coiling [6], meta-analysis studies have proved that the effects of the clinical treatments are not ideal, and the prognosis of IA is poor [7,8]. Therefore, it is imperative to further explore the underlying pathogenesis of IAs and unearth the novel potential biomarkers that will help diagnose and predict IA rupture in early stages; this will advance the survival as well as the prognosis of patients with the condition.

The gradual dilation and the eventual rupture of the intracranial artery are the natural processes of IAs. While the mechanisms of IA formation, growth, and eventual breakdown are not fully elucidated, it is known that the regulation of gene expressions (such as mRNA, rRNA, tRNA, long non-coding RNA, and microRNA) has important functions in IAs [3,9]. N6-methyladenosine (m6A) is the most abundant internal chemical modifier in RNA and is a crucial regulator of mRNA stability, protein expression, and multiple cellular processes, including cell differentiation and metabolism, splicing, stability and decay, processing, nuclear export, and translation [10,11,12]. Recent studies have indicated that m6A RNA methylation is strongly linked with the genesis and development of multiple types of cancers [13] as well as cardiovascular and cerebrovascular diseases [14]. Berulava et al. [15] demonstrated that the m6A structure was altered in cardiac hypertrophy and heart failure and that modifications in m6A RNA methylation can contribute to changes in protein levels; this indicated that m6A methylation may serve as a novel target for therapeutic intervention in heart failure. Another study demonstrated that in the endothelial cells under oscillatory stress, METTL3 was highly expressed; it was accompanied by a high level of m6A methylation, which implied that METTL3-mediated m6A methylation modification plays vital roles in the occurrence of atherosclerosis induced by oscillatory stress and the disturbance of blood flow [16]. Guan et al. reported that dysregulation of the m6A-related genes in gastric carcinoma (GC) patients was closely associated with the prognosis of the disease and that FTO could be a novel biomarker for GC prognosis [17]. All these reports have indicated that m6A methylation may offer more possibilities and new insights for the early diagnosis and treatment of various diseases. Additionally, lipopolysaccharide stimulation can enhance m6A methylation levels and trigger inflammatory cytokine production and pathways in liver tumors and dental pulps inflammation [18,19]. In rheumatoid arthritis, lipopolysaccharides can lead to increased levels of METTL3 expression as well as bioactivity in the macrophages; METTL3 overexpression can suppress the inflammatory response caused by the NF-κB pathway [20]. These reports demonstrated a strong association between m6A methylation modifications and inflammation [21]. However, the m6A methylation level and its related mechanisms in IA occurrence and development remain unclear.

Previous studies have confirmed that the inflammatory response is closely related to IA occurrence and advancement [22,23]. TNF-α is a crucial regulator of inflammatory responses and is highly released and accumulated in IAs [24]. In addition, a selective arterial ligation method has generally been used to construct IA models in vivo, which are histologically similar to humans [25,26]. Therefore, in this study, we aimed to investigate the potential mechanisms of m6A methylation and its related mechanisms in IA in vitro and in vivo. The in vivo and in vitro results showed that WTAP was significantly downregulated in the IA rats and TNF-α-induced rat brain microvascular endothelial cells (rBMVECs). WTAP, an important writer of m6A methylation, recruits the m6A methyltransferase complexes to the mRNA targets, and its expression is positively correlated with m6A methylation levels [27]. Zhu et al. reported that the WTAP expression in rat carotid arteries injured by balloon catheters was decreased; total Panax notoginseng saponin upregulated the decreased WTAP-p16 axis to inhibit intimal hyperplasia, which emphasized the roles of WTAP-p16 signaling in arterial restenosis [28]. Therefore, WTAP was selected to further investigate its roles in IA in vitro. This study will provide novel insights into the diagnosis and treatment of IAs and is expected to reveal novel potential therapeutic targets.

2 Materials and methods

2.1 Establishment of an IA rat model

Sixteen Sprague Dawley rats were purchased from Shanghai SLAC Laboratory Animal Co., Ltd (Shanghai, China). All rats were male and weighed between 200 and 250 g; they were fed in a controlled environment with a temperature of 24 ± 2°C, a humidity of 50 ± 5%, and a 12 h light/dark cycle. After acclimatization for 7 days, the animals were randomly divided into the control and IA groups (n = 8 for each group). Throughout the experiment, the animals were allowed to eat and drink freely.

In the IA group, rats were employed to construct a rat IA model using the selective arterial ligation method, as previously reported [26], with some modifications. Briefly, before modeling, the rats were made to fast for 8 h and were deprived of water for 2 h; then, they were generally anesthetized using a combination of sodium pentobarbital intraperitoneal injection (50 mg/kg) and isoflurane inhalation (2%). Following this, the rats underwent ligation of their left common carotid artery and electrocoagulation of the posterior branch of their ventral median renal artery. On the second day following surgery, 1% saline was given to the rats in the IA group instead of drinking water. The control group rats were not ligated and were given normal drinking water.

  1. Ethics approval and participation consent: All the animal experiments were conducted in accordance with the relevant guidelines and regulations (National Medical Advisory Committee (NMAC) guidelines and ARRIVE guidelines Declaration of Helsinki) and were approved by the Institutional Animal Care and Use Committee of Changzhou Wujin People’s Hospital (approval no. [2022] 79). Additionally, the animal anesthesia procedures complied with the applicable veterinary guidelines (such as the American Veterinary Medical Association).

2.2 Sample collection and preparation

After 2 months of modeling, all rats were generally anesthetized with a combination of sodium pentobarbital intraperitoneal injection (50 mg/kg, China National Pharmaceutical Corporation) and isoflurane inhalation (2%), the process complied with the applicable veterinary guidelines (such as the American Veterinary Medical Association). Thereafter, the rats were intubated to the renal aorta through the left ventricle via a thoracotomy; blood samples were extracted using an EDTA tube and were preserved. Following this, 30 mL of normal saline was injected through a catheter, while the vena cava was cut open to drain the blood. Three rats were slowly injected through a catheter with 120 mL of 4% paraformaldehyde (China National Pharmaceutical Group Corporation)/0.1 M phosphoric acid buffer (pH 7.4, China National Pharmaceutical Group Corporation) for fixation; the other rats remained without this treatment. Thereafter, cervical dislocation was applied to kill the rats, and their brains were removed via craniotomy. The circle of Willis of each brain was carefully separated under a 10–16× surgical microscope. Among them, the three fixed circle of Willis samples were subjected to hematoxylin and eosin (HE) staining; the remaining five and blood samples were used to isolate the total RNA using the Trizol method.

2.3 Measurement of m6A methylation levels

The blood and circle of Willis samples in each group were employed for total RNA isolation using an RNAiso Plus kit (Trizol, Takara) in line with the manufacturer’s instructions. Thereafter, the isolated RNA was used for qualitative and quantitative detections, with a microplate reader (Thermo Scientific, Wilmington, DE, USA). Following this, the RNA m6A methylation levels in the blood and circle of Willis samples of each group were examined using an EpiQuik™ m6A RNA Methylation Quantification Kit (Colorimetric, Epigentek Group Inc., USA), according to the manufacturer’s protocols.

2.4 Quantitative reverse transcription PCR (RT-qPCR)

The aforementioned isolated RNA was reverse transcribed into cDNA using a commercial cDNA synthesis kit (Takara), according to the manufacturer’s instructions. The total RT-qPCR volume was 20 μL, and the displayed RT-qPCR reaction was as follows: 50°C for 3 min, 95°C for 3 min, a total of 40 cycles at 95°C for 10 s and 60°C for 30 s, followed by 95°C for 15 s, 60°C for 60 s, and 95°C for 15 s. The sequences of all the designed primers are shown in Table 1; GAPDH was a housekeeping gene. The relative mRNA levels of the related genes were obtained using the 2−△△Ct method [29].

Table 1

Sequences of all the primers

Primer Sequence (5′–3′)
METTL3 F: CTGGCACCCGAAAGATTGAG
R: CATCTGGGTCCAGAAGGTGT
METTL14 F: GCAGAAACCTACGCGTCCTA
R: CACCACGGTCAGACTTGGAT
WTAP F: GCCTGGAAGTTTACGCCTGATA
R: AATGGTGCTCTGCATACCCTCT
FTO F: CCGTGGAACAAAGGAGTG
R: GCAGAGGCATAGAAGGGT
ALKBH1 F: AGACAAGACTAAGCGGAGAC
R: GAAAGCCAGGTCAGAAGG
VIRMA F: CAGTCGTCGGGAAGGAACAA
R: GACTAGGGCGGTAACCTGTG
TNFα F: TCAGCCTCTTCTCATTCCTGC
R: TTGGTGGTTTGCTACGACGTG
GAPDH F: AGACAGCCGCATCTTCTTGT
R: CTTGCCGTGGGTAGAGTCAT

2.5 Cell culture and cell transfection

The rBMVECs were acquired from Procell Life Science & Technology Co., Ltd (Wuhan, China) and were cultured in Dulbecco’s modification of Eagle’s medium (Gibco, USA), which contained 10% fetal calf serum (Gibco) and 1% penicillin/streptomycin (Gibco). The cells were stored in an incubator that was supplemented with 5% CO2 at 37°C and passed when the cells grew to 80–90% confluence.

The pcDNA3.1(+)-WTAP plasmid (oe-WTAP) and pcDNA3.1(+) plasmid (oe-NC) were prepared and synthesized by Yanzai Biotechnology (Shanghai) Co. Ltd; the cell transfection methods were the same as those reported previously [30]. The rBMVECs in good condition were harvested and inoculated into a six-well plate (6 × 105 cells/well). Following overnight incubation, the serum-free medium was replaced with the original medium, and either 2.5 μg of pcDNA3.1(+)-WTAP plasmids or pcDNA3.1(+) plasmids were transfected into the rBMVECs using Lipofectamine 200 (Thermo Fisher Scientific). After 6 h of transfection, the complete medium was added and cultured for another 48 h. The RNA and proteins were extracted from the differently treated cells, whereas the WTAP mRNA and protein expressions were assessed using RT-qPCR and western blotting, to estimate the cell transfection efficiency. The WTAP sequences are displayed in Table 1.

2.6 Cell viability and apoptosis assays

The cells in good condition were collected and inoculated into a 96-well plate (5 × 103 cells/well). Following overnight culture, the rBMVECs were randomly divided into either a control, TNF-α, or TNF-α + oe-WTAP group. First, the rBMVECs in the TNF-α and TNF-α + oe-WTAP groups were induced by TNF-α (2 ng/mL) for 48 h, and thereafter, the rBMVECs in the TNF-α + oe-WTAP group were transfected with the pcDNA3.1(+)-WTAP plasmid. The cells in the control group remained without treatment. Following 24, 48, and 72 h of culture, 10 μL of the cell counting kit-8 (Beyotime Biotechnology) reagent was supplemented to each well, and the mixture was incubated for another 2 h. Finally, a microplate reader was applied to test the absorbance at 450 nm.

The rBMVECs from the different treatments were acquired to determine cell apoptosis, using an Annexin V-FITC apoptosis assay kit (Beyotime Biotechnology). Briefly, the cells were resuspended with 1× Binding Buffer (100 μL), and thereafter 5 μL of Annexin V-FITC with 5 μL of propidium iodide was added. Following 15 min of incubation in the dark, at 25°C, 400 μL of 1× Binding Buffer was added; thereafter a flow cytometer was employed to acquire the cells, and the total cell apoptosis rate (early apoptosis rate + late apoptosis rate) was calculated.

2.7 Western blot

The rBMVECs were lysed using a RIPA lysis buffer (Beyotime Biotechnology) for total protein extraction, and a BAC assay kit (Boster, Wuhan, China) was employed to determine their concentrations. Subsequently, the protein samples were segregated using 10% SDS-PAGE, transferred to PVDF membranes, and then sealed using 5% skim milk. Following 2 h of incubation, the primary antibodies, including the anti-WTAP antibody (1:5,000, Proteintech Group, Inc.), anti-cleaved caspase3 (1:1,000, Proteintech Group, Inc.), and anti-GAPDH antibody (1:1,000, Proteintech Group, Inc.), were added to the membranes. After being incubated further, at 4°C overnight, the secondary antibody (goat anti-rabbit/mouse IgG-HRP, 1:5,000, Jackson ImmunoResearch) was added. Thereafter, following incubation at 37°C for 2 h, the protein bands were visualized using an ECL assay kit (Beyotime Biotechnology), and Image-Pro Plus (version 6.0, Media Cybernetics Imaging Technologies Inc., USA) was employed to quantify these protein bands.

2.8 Statistical analysis

All the data were expressed as the mean ± standard deviation, and each experiment was done in triplicate. The statistical analyses were conducted using GraphPad Prism 5 (GraphPad Software, Inc.). For differential analysis between two groups, Student’s t-test was performed; a one-way ANOVA followed by Tukey’s post hoc test was conducted for the multiple group analyses. The threshold for the statistical difference was set as P < 0.05.

3 Results

3.1 Histopathological changes and the m6A methylation level in an IA rat model

HE staining showed that the circle of Willis in the control rats were intact; whereas, in the IA rats, the inner elastic layer of the circle of Willis was damaged (Figure 1a). This indicated that the rat IA model was successfully established. Thereafter, the m6A methylation levels in the blood and circle of Willis samples of the control and IA rats were determined. It was clear that the m6A methylation levels in the blood and circle of Willis samples of the IA rats were both significantly decreased (P < 0.05) in comparison with the control rats (Figure 1b and c).

Figure 1 
                  Histopathological changes of the circle of Willis and m6A methylation levels in an IA rat model. (a) Histopathological changes in the circle of Willis samples of the IA rats using HE staining. The m6A methylation levels in the blood samples (b) and circle of Willis samples (c) of the IA rats. *P < 0.05, as compared to the corresponding samples from control rats.
Figure 1

Histopathological changes of the circle of Willis and m6A methylation levels in an IA rat model. (a) Histopathological changes in the circle of Willis samples of the IA rats using HE staining. The m6A methylation levels in the blood samples (b) and circle of Willis samples (c) of the IA rats. *P < 0.05, as compared to the corresponding samples from control rats.

Thereafter, we assessed the expression level of the methylation-related genes (METTL3, METTL14, and WTAP) and demethylation-related genes (ALKBH1, VIRMA, and FTO) in the blood and circle of Willis samples of the different rats. In the blood samples, there were no significant differences (P > 0.05) in the relative expressions of METTL3, METTL14, VIRMA, and FTO, between the control and IA rats (Figure 2a). Relative to the control rats, WTAP expression was evidently downregulated (P < 0.05) whereas ALKBH1 expression was markedly upregulated in the IA rats (P < 0.05, Figure 2a). Furthermore, in the circle of Willis samples, expressions of METTL3, METTL14, and WTAP were significantly downregulated in the IA rats, as compared to the samples from control rats (P < 0.05, Figure 2b). For the demethylation-related genes, it was observed that the ALKBH1 expression was significantly elevated, whereas the VIRMA expression was evidently downregulated in the IA rats, as compared to the corresponding samples from the control rats (P < 0.05); the expression of FTO showed no obvious differences between the control and IA rats (P > 0.05, Figure 2b). All outcomes suggested that m6A methylation can be reduced in the IA rats.

Figure 2 
                  Relative mRNA expressions of the methylation-related genes (METTL3, METTL14, and WTAP) and demethylation-related genes (ALKBH1, VIRMA, and FTO) in the rats. Expressions of VIRMA, METTL3, FTO, METTL14, ALKBH1, and WTAP in the blood samples (a) or the circle of Willis samples (b) of the rats. *P < 0.05, as compared to the corresponding samples from control rats.
Figure 2

Relative mRNA expressions of the methylation-related genes (METTL3, METTL14, and WTAP) and demethylation-related genes (ALKBH1, VIRMA, and FTO) in the rats. Expressions of VIRMA, METTL3, FTO, METTL14, ALKBH1, and WTAP in the blood samples (a) or the circle of Willis samples (b) of the rats. *P < 0.05, as compared to the corresponding samples from control rats.

3.2 Methylation-related gene expressions in the TNF-α-induced rBMVECs

TNF-α was applied to stimulate the rBMVECs in order to mimic the IA cell model in vitro [31]; thereafter, the TNF-α and methylation-related gene levels were determined. It was noted that the TNF-α mRNA expression in the control group and the TNF-α-induced rBMVECs were 1.00 ± 0.048 and 5.21 ± 0.155, respectively; this showed a significantly higher level of TNF-α in the TNF-α-induced rBMVECs than that of the control rBMVECs (Figure 3a). This indicated that the TNF-α-induced rBMVECs mimicked the IA model in vitro and could be used for further study.

Figure 3 
                  Expression of the methylation/demethylation-related genes in the TNF-α-induced rBMVECs. (a)Level of TNF-α in the cells treated with TNF-α. (b) Expressions of ALKBH1, METTL3, VIRMA, METTL14, WTAP, and FTO in the TNF-α-induced rBMVECs. *P < 0.05, as compared to the samples from the control cells.
Figure 3

Expression of the methylation/demethylation-related genes in the TNF-α-induced rBMVECs. (a)Level of TNF-α in the cells treated with TNF-α. (b) Expressions of ALKBH1, METTL3, VIRMA, METTL14, WTAP, and FTO in the TNF-α-induced rBMVECs. *P < 0.05, as compared to the samples from the control cells.

Thereafter, it was found that TNF-α did not significantly influence METTL3 and METTL14 expression levels compared to those of the control rBMVECs (P > 0.05, Figure 3b). In comparison to the control rBMVECs, TNF-α induction evidently downregulated WTAP expression (P < 0.05) and upregulated ALKBH1 expression (P < 0.05, Figure 3b). Moreover, VIRMA expression was significantly lower in the TNF-α-induced rBMVECs than the control rBMVECs (P < 0.05) but FTO expression was markedly upregulated in the TNF-α-induced rBMVECs (P < 0.05, Figure 3b). Due to the consistency and significance of RT-qPCR results in the blood, circle of Willis, and TNF-α-induced rBMVECs samples, WTAP was selected as the focus of our subsequent experiments.

3.3 Cell transfection efficiency

The cell transfection efficiency was assessed by measuring the mRNA and protein expressions of WTAP. It was clear that the WTAP relative mRNA expression in the blank and oe-NC groups were 1.00 ± 0.075 and 1.19 ± 0.085, respectively; no significant difference was observed between the two groups (P > 0.05, Figure 4a). Nevertheless, when the rBMVECs were transfected with the pcDNA3.1(+)-WTAP plasmid, the relative expression of WTAP reached 707.92 ± 52.634, which was 700 times the value observed in the control group and significantly elevated compared to that of the blank cells (P < 0.05, Figure 4a). Additionally, the western blot analysis also showed that the WTAP protein expression in the blank and oe-NC cells exhibited no significant differences (P > 0.05), whereas following the transfection of the pcDNA3.1(+)-WTAP plasmid, the WTAP protein expression was evidently increased (P < 0.05, Figure 4b). All the findings indicated that rBMVECs with WTAP overexpression were successfully constructed and could be used for further study.

Figure 4 
                  Cell transfection efficiency in the transfected rBMVECs. RT-qPCR and western blotting were employed to measure the WTAP mRNA (a) and protein (b) expression levels in the transfected rBMVECs. *P < 0.05, as compared to those of the blank cells.
Figure 4

Cell transfection efficiency in the transfected rBMVECs. RT-qPCR and western blotting were employed to measure the WTAP mRNA (a) and protein (b) expression levels in the transfected rBMVECs. *P < 0.05, as compared to those of the blank cells.

3.4 Roles of WTAP overexpression in the growth of TNF-α-induced rBMVECs

To further investigate the roles of WTAP on the growth of the TNF-α-induced rBMVECs, TNF-α was applied to treat rBMVECs. After 24 h of culture, the viability in the control cells, TNF-α-induced rBMVECs, and TNF-α-induced rBMVECs with WTAP overexpression showed no significant difference (P > 0.05, Figure 5a). However, after being incubated for 48 and 72 h the cell viability was significantly decreased (P < 0.05) in the TNF-α-induced rBMVECs compared to those in the control cells. Cell viability was significantly increased (P < 0.05) upon WTAP overexpression compared to that of TNF-α-induced cells, and recovered to a similar degree in control cells (P > 0.05, Figure 5a). Therefore, for cell apoptosis detection, the rBMVECs that were cultured for 48 h were selected.

Figure 5 
                  Roles of WTAP overexpression in the growth of the TNF-α-induced rBMVECs. (a) Cell viability of the rBMVECs, with different treatments, following 24, 48, and 72 h of culture. (b) Apoptosis of the rBMVECs, with different treatments, determined using flow cytometry. (c) Cleaved-caspase3 protein expression detected using western blotting. (d) WTAP protein expression detected using western blotting. *P < 0.05, as compared to the samples from the control cells; #
                     P < 0.05, as compared to those from the TNF-α cells.
Figure 5

Roles of WTAP overexpression in the growth of the TNF-α-induced rBMVECs. (a) Cell viability of the rBMVECs, with different treatments, following 24, 48, and 72 h of culture. (b) Apoptosis of the rBMVECs, with different treatments, determined using flow cytometry. (c) Cleaved-caspase3 protein expression detected using western blotting. (d) WTAP protein expression detected using western blotting. *P < 0.05, as compared to the samples from the control cells; # P < 0.05, as compared to those from the TNF-α cells.

Cell apoptosis of the rBMVECs induced by TNF-α was examined, and the acquired representative images of the different groups are shown in Figure 5b. The total cell apoptosis rates in the control, TNF-α, and TNF-α + oe-WTAP groups were 5.17 ± 0.082, 19.79 ± 5.52, and 11.92 ± 0.33%, respectively. These results indicated that TNF-α induction significantly increased (P < 0.05) the cell apoptosis of the rBMVECs compared to the results of the control cells. Cell apoptosis in the TNF-α + oe-WTAP rBMVECs was evidently reduced (P < 0.05, Figure 5b), compared to that in the rBMVECs induced by TNF-α. These results revealed that TNF-α can enhance the apoptosis of rBMVECs, whereas WTAP overexpression can inhibit the apoptosis caused by TNF-α.

Finally, the protein expressions of cleaved-caspase3 and WTAP in the cells with different treatments were detected. It was found that the tendency of cleaved-caspase3 protein expression in the different cells was similar to that of the cell apoptosis in the different groups (Figure 5c). WTAP protein expression was evidently downregulated (P < 0.05) in the TNF-α-induced rBMVECs compared to that in the control cells. However, relative to TNF-α-induced rBMVECs, WTAP protein expression was significantly upregulated (P < 0.05) in the TNF-α-induced rBMVECs with WTAP overexpression (Figure 5d).

4 Discussion

IA is characterized by the phenotypic regulation of vascular smooth muscle cells and the loss of vascular cells, posing a significant threat to human life and health [4]. It has been reported that m6A RNA methylation abnormalities are related to many types of human cancers, including brain tumors and breast and bladder cancers [32]. However, a few studies have reported the effects of m6A RNA methylation in IA. Our study showed, for the first time, the significantly low m6A RNA methylation levels in the blood and circle of Willis samples of IA rats. After measuring the related gene expressions, we found that WTAP expression was significantly downregulated, whereas ALKBH1 expression was evidently upregulated in the blood and circle of Willis samples of the IA rats and TNF-α-induced rBMVECs. Additionally, we successfully established rBMVECs with WTAP overexpression, and observed that TNF-α inhibited the viability of rBMVECs, promoted apoptosis, and downregulated WTAP expression; WTAP overexpression significantly reversed these changes caused by TNF-α. These results will contribute to our comprehension of the important m6A methylation functions in IA progression.

Several previous studies have shown that m6A RNA modifications produce vital effects on both physiological and pathological conditions, especially in the evolvement and progression of different types of human cancers [13,32,33]. Methylation of m6A is reversibly and dynamically regulated by methyltransferase and demethylase, and the m6A binding proteins work by recognizing and binding to the m6A site of the target RNAs [14,34]. Our results showed that the m6A RNA methylation level was significantly reduced in the IA rats. To elucidate the specific molecular mechanisms, the expressions of FTO, METTL3, ALKBH1, METTL14, VIRMA, and WTAP were determined. Furthermore, WTAP, METTL14, and METTL3 are responsible for catalyzing m6A, whereas ALKBH1, VIRMA, and FTO serve as erasers to remove m6A [35,36]. Yue et al. [37] indicated that VIRMA was able to recruit and guide the core methyltransferase complex METTL3/METTL14/WTAP to specific RNA regions for m6A methylation. Another study showed that abnormal expressions of the demethylase genes FTO and ALKBH1 had a significant prognostic value in GC patients, implying that these genes may have crucial functions in the development and metastasis of GC [38]. From these reports and our results, we concluded that the m6A methylation level can be decreased in IAs, accompanied by downregulated WTAP expression and upregulated ALKBH1 expression.

Owing to the consistency and significance in the blood, circle of Willis, and TNF-α-induced rBMVECs samples, WTAP was selected for the subsequent experiments. A study of Jia et al. [39] demonstrated that miR-133a-3p enrichment can suppress the apoptosis of vascular endothelial cells and promote their proliferation and migration, thereby inhibiting IA progression. Another study also demonstrated that endothelial dysfunction was considered the first step in the pathogenesis of IAs; high levels of inflammation and apoptosis of the vascular endothelial cells can promote IA progression [40]. Therefore, rBMVECs were used in this study. In our study, rBMVECs with WTAP overexpression were successfully constructed, and the WTAP overexpression enhances the viability of TNF-α-induced rBMVECs, inhibits apoptosis, and significantly downregulates cleaved-caspase3, while upregulating WTAP expression. WTAP can interact with the METTL3–METTL14 complex [41] and is essential to initiate and guide nuclear spot localization, which is necessary for the activation of m6A methylation [27]. Additionally, WTAP has been identified as a nuclear protein that participates in the regulation of cell proliferation and apoptosis. Recently, WTAP was found to be overexpressed in glioblastoma; its ablation repressed the migration and invasion of the glioblastoma cells by regulating EGFR activity [42]. Another study illustrated that WTAP was highly expressed in hepatocellular carcinoma (HCC) and that WTAP-mediated m6A modifications could promote HCC progression via the HuR-ETS1-p21/p27 axis [43]. Another study reported that WTAP can facilitate osteosarcoma oncogenesis by inhibiting the expression of HMBOX1 in an m6A methylation-dependent manner [44]. In summary, it can be inferred that WTAP overexpression enhances the viability and suppresses the apoptosis of TNF-α-induced rBMVECs by down-regulating cleaved-caspase3, upregulating WTAP expression, and increasing its m6A methylation, thereby playing important roles in IA progression.

5 Conclusions

Lower m6A methylation levels were observed in the IA samples, and WTAP and ALKBH1 may have potential as novel biomarkers for IAs. However, a large number of samples are required to confirm this finding. Additionally, WTAP overexpression may improve IAs by regulating the growth of rBMVECs and increasing their m6A methylation. Our findings help improve our understanding of the role of m6A methylation in IA progression, thereby laying the foundation for WTAP as a novel therapeutic target for IAs.


# Co-first authors.

tel: +86-0519-88589082

  1. Funding information: This study was supported by the Social Development Plan of Changzhou Wujin Science and Technology Bureau (No. WS202024) and the Clinical Technology Development Foundation of Jiangsu University (No. JLY2021025).

  2. Author contributions: Conceptualization: Xuesong Yuan, Qing Bao, and Wenfeng Wei; methodology: Xuesong Yuan, Qing Bao, and Bin Lu; formal analysis and investigation: Xuesong Yuan, Qing Bao, Bin Lu, Chong Xiang, and Xiaoshan Hou; writing – original draft preparation: Xuesong Yuan, and Qing Bao; writing – review and editing: Wenfeng Wei; supervision: Wenfeng Wei. All authors have read and approved the final version.

  3. Conflict of interest: The authors declare that they have no competing interests.

  4. Data availability statement: The dataset used and/or analyzed during the current study are available from the corresponding author on a reasonable request.

References

[1] Steiner T, Juvela S, Unterberg A, Jung C, Forsting M, Rinkel G. European Stroke Organization guidelines for the management of intracranial aneurysms and subarachnoid haemorrhage. Cerebrovasc Dis. 2013;35(2):93–112.10.1159/000346087Suche in Google Scholar PubMed

[2] Xu Z, Rui YN, Hagan JP, Kim DH. Intracranial aneurysms: pathology, genetics, and molecular mechanisms. Neuromol Med. 2019;21(4):325–43.10.1007/s12017-019-08537-7Suche in Google Scholar PubMed PubMed Central

[3] Liao B, Zhou MX, Zhou FK, Luo XM, Zhong SX, Zhou YF, et al. Exosome-derived MiRNAs as biomarkers of the development and progression of intracranial aneurysms. J Atheroscler Thromb. 2020;27(6):545–610.10.5551/jat.51102Suche in Google Scholar PubMed PubMed Central

[4] Li XG, Wang YB. SRPK1 gene silencing promotes vascular smooth muscle cell proliferation and vascular remodeling via inhibition of the PI3K/Akt signaling pathway in a rat model of intracranial aneurysms. CNS Neurosci Ther. 2019;25(2):233–44. 10.1111/cns.13043.Suche in Google Scholar PubMed PubMed Central

[5] Shimizu K, Kushamae M, Aoki T. Macrophage imaging of intracranial aneurysms. Neurol Med Chir. 2019;59(7):257–63.10.2176/nmc.st.2019-0034Suche in Google Scholar PubMed PubMed Central

[6] Ihn YK, Shin SH, Baik SK, Choi IS. Complications of endovascular treatment for intracranial aneurysms: management and prevention. Interv Neuroradiol. 2018;24(3):237–45.10.1177/1591019918758493Suche in Google Scholar PubMed PubMed Central

[7] Naggara ON, Lecler A, Oppenheim C, Meder JF, Raymond J. Endovascular treatment of intracranial unruptured aneurysms: a systematic review of the literature on safety with emphasis on subgroup analyses. Radiology. 2012;263(3):828–35.10.1148/radiol.12112114Suche in Google Scholar PubMed

[8] Ruan C, Long H, Sun H, He M, Yang K, Zhang H, et al. Endovascular coiling vs. surgical clipping for unruptured intracranial aneurysm: a meta-analysis. Br J Neurosurg. 2015;29(4):485–92.10.3109/02688697.2015.1023771Suche in Google Scholar PubMed

[9] Zhang J, Wei J, Wang Y, Xu J, Jin J. Identification and validation of TREM2 in intracranial aneurysms. Genet Test Mol Biomarkers. 2021;25(10):646–53.10.1089/gtmb.2021.0076Suche in Google Scholar PubMed

[10] Huang H, Weng H, Chen J. m(6)A modification in coding and non-coding RNAs: roles and therapeutic implications in cancer. Cancer Cell. 2020;37(3):270–88.10.1016/j.ccell.2020.02.004Suche in Google Scholar PubMed PubMed Central

[11] Shi H, Wang X, Lu Z, Zhao BS, Ma H, Hsu PJ, et al. YTHDF3 facilitates translation and decay of N(6)-methyladenosine-modified RNA. Cell Res. 2017;27(3):315–28.10.1038/cr.2017.15Suche in Google Scholar PubMed PubMed Central

[12] Wang X, He C. Dynamic RNA modifications in posttranscriptional regulation. Mol Cell. 2014;56(1):5–12.10.1016/j.molcel.2014.09.001Suche in Google Scholar PubMed PubMed Central

[13] Sun T, Wu R, Ming L. The role of m6A RNA methylation in cancer. Biomed Pharmacother. 2019;112(108613):19.10.1016/j.biopha.2019.108613Suche in Google Scholar PubMed

[14] Qin Y, Li L, Luo E, Hou J, Yan G, Wang D, et al. Role of m6A RNA methylation in cardiovascular disease (Review). Int J Mol Med. 2020;46(6):1958–72.10.3892/ijmm.2020.4746Suche in Google Scholar PubMed PubMed Central

[15] Berulava T, Buchholz E, Elerdashvili V, Pena T, Islam MR, Lbik D, et al. Changes in m6A RNA methylation contribute to heart failure progression by modulating translation. Eur J Heart Fail. 2020;22(1):54–66.10.1002/ejhf.1672Suche in Google Scholar PubMed

[16] Chien CS, Li JY, Chien Y, Wang ML, Yarmishyn AA, Tsai PH, et al. METTL3-dependent N(6)-methyladenosine RNA modification mediates the atherogenic inflammatory cascades in vascular endothelium. Proc Natl Acad Sci U S A. 2021;118(7):e2025070118. 10.1073/pnas.2025070118.Suche in Google Scholar PubMed PubMed Central

[17] Guan K, Liu X, Li J, Ding Y, Li J, Cui G, et al. Expression status and prognostic value of M6A-associated genes in gastric cancer. J Cancer. 2020;11(10):3027–40. 10.7150/jca.40866.Suche in Google Scholar PubMed PubMed Central

[18] Ding H, Zhang X, Su Y, Jia C, Dai C. GNAS promotes inflammation-related hepatocellular carcinoma progression by promoting STAT3 activation. Cell Mol Biol Lett. 2020;25:8. 10.1186/s11658-020-00204-1.Suche in Google Scholar PubMed PubMed Central

[19] Feng Z, Li Q, Meng R, Yi B, Xu Q. METTL3 regulates alternative splicing of MyD88 upon the lipopolysaccharide-induced inflammatory response in human dental pulp cells. J Cell Mol Med. 2018;22(5):2558–68. 10.1111/jcmm.13491.Suche in Google Scholar PubMed PubMed Central

[20] Wang J, Yan S, Lu H, Wang S, Xu D. METTL3 attenuates LPS-induced inflammatory response in macrophages via NF-κB signaling pathway. Mediators Inflamm. 2019;2019:3120391. 10.1155/2019/3120391.Suche in Google Scholar PubMed PubMed Central

[21] Luo J, Xu T, Sun K. N6-methyladenosine RNA modification in inflammation: roles, mechanisms, and applications. Front Cell Dev Biol. 2021;9:670711. 10.3389/fcell.2021.670711.Suche in Google Scholar PubMed PubMed Central

[22] Muhammad S, Hänggi D. Inflammation and anti-inflammatory targets after aneurysmal subarachnoid hemorrhage. Int J Mol Sci. 2021;22(14):7355. 10.3390/ijms22147355.Suche in Google Scholar PubMed PubMed Central

[23] Frösen J, Cebral J, Robertson AM, Aoki T. Flow-induced, inflammation-mediated arterial wall remodeling in the formation and progression of intracranial aneurysms. Neurosurg Focus. 2019;47(1):E21. 10.3171/2019.5.Focus19234.Suche in Google Scholar PubMed PubMed Central

[24] Zhang HF, Zhao MG, Liang GB, Song ZQ, Li ZQ. Expression of pro-inflammatory cytokines and the risk of intracranial aneurysm. Inflammation. 2013;36(6):1195–200. 10.1007/s10753-013-9655-6.Suche in Google Scholar PubMed

[25] Aoki T, Miyata H, Abekura Y, Koseki H, Shimizu K. Rat model of intracranial aneurysm: variations, usefulness, and limitations of the hashimoto model. Acta Neurochir Suppl. 2020;127:35–41. 10.1007/978-3-030-04615-6_6.Suche in Google Scholar PubMed

[26] Abekura Y, Ono I, Kawashima A, Takizawa K, Koseki H, Miyata H, et al. Eicosapentaenoic acid prevents the progression of intracranial aneurysms in rats. J Neuroinflammation. 2020;17(1):129. 10.1186/s12974-020-01802-8.Suche in Google Scholar PubMed PubMed Central

[27] Ping XL, Sun BF, Wang L, Xiao W, Yang X, Wang WJ, et al. Mammalian WTAP is a regulatory subunit of the RNA N6-methyladenosine methyltransferase. Cell Res. 2014;24(2):177–89. 10.1038/cr.2014.3.Suche in Google Scholar PubMed PubMed Central

[28] Zhu B, Gong Y, Shen L, Li J, Han J, Song B, et al. Total Panax notoginseng saponin inhibits vascular smooth muscle cell proliferation and migration and intimal hyperplasia by regulating WTAP/p16 signals via m(6)A modulation. Biomed Pharmacother. 2020;124:109935. 10.1016/j.biopha.2020.109935.Suche in Google Scholar PubMed

[29] Xu G, Ao R, Zhi Z, Jia J, Yu B. miR-21 and miR-19b delivered by hMSC-derived EVs regulate the apoptosis and differentiation of neurons in patients with spinal cord injury. J Cell Physiol. 2019;234(7):10205–17. 10.1002/jcp.27690.Suche in Google Scholar PubMed

[30] Lin Y, Jin Y, Xu T, Zhou S, Cui M. MicroRNA-215 targets NOB1 and inhibits growth and invasion of epithelial ovarian cancer. Am J Transl Res. 2017;9(2):466–77.Suche in Google Scholar

[31] Sun B, Liu Z, Yu Z. miRNA-323a-3p promoted intracranial, aneurysm-induced inflammation via AMPK/NF-κB signaling pathway by AdipoR1. Adv Clin Exp Med: Off Organ Wroclaw Med Univ. 2022;31(11):1243–54. 10.17219/acem/151053.Suche in Google Scholar PubMed

[32] Jiang X, Liu B, Nie Z, Duan L, Xiong Q, Jin Z, et al. The role of m6A modification in the biological functions and diseases. Signal Transduct Target Ther. 2021;6(1):020-00450.10.1038/s41392-020-00450-xSuche in Google Scholar PubMed PubMed Central

[33] Yin H, Zhang X, Yang P, Peng Y, Li D, Yu Y, et al. RNA m6A methylation orchestrates cancer growth and metastasis via macrophage reprogramming. Nat Commun. 2021;12(1):021-21514.10.1038/s41467-021-21514-8Suche in Google Scholar PubMed PubMed Central

[34] Chen XY, Zhang J, Zhu JS. The role of m(6)A RNA methylation in human cancer. Mol Cancer. 2019;18(1):019-1033.10.1186/s12943-019-1033-zSuche in Google Scholar PubMed PubMed Central

[35] Zhang C, Fu J, Zhou Y. A review in research progress concerning m6A methylation and immunoregulation. Front Immunol. 2019;10:922.10.3389/fimmu.2019.00922Suche in Google Scholar PubMed PubMed Central

[36] Zhang H, Shi X, Huang T, Zhao X, Chen W, Gu N, et al. Dynamic landscape and evolution of m6A methylation in human. Nucleic Acids Res. 2020;48(11):6251–64.10.1093/nar/gkaa347Suche in Google Scholar PubMed PubMed Central

[37] Yue Y, Liu J, Cui X, Cao J, Luo G, Zhang Z, et al. VIRMA mediates preferential m(6)A mRNA methylation in 3’UTR and near stop codon and associates with alternative polyadenylation. Cell Discov. 2018;4(10):018-0019.10.1038/s41421-018-0019-0Suche in Google Scholar PubMed PubMed Central

[38] Li Y, Zheng D, Wang F, Xu Y, Yu H, Zhang H. Expression of demethylase genes, FTO and ALKBH1, is associated with prognosis of gastric cancer. Dig Dis Sci. 2019;64(6):1503–13.10.1007/s10620-018-5452-2Suche in Google Scholar PubMed PubMed Central

[39] Jia Q, Yan S, Huang J, Xu S. Restored microRNA-133a-3p or depleted PSAT1 restrains endothelial cell damage-induced intracranial aneurysm via suppressing the GSK3β/β-catenin pathway. Nanoscale Res Lett. 2020;15(1):177. 10.1186/s11671-020-03396-9.Suche in Google Scholar PubMed PubMed Central

[40] Tu J, Jufri NF. Estrogen signaling through estrogen receptor beta and G-protein-coupled estrogen receptor 1 in human cerebral vascular endothelial cells: implications for cerebral aneurysms. Biomed Res Int. 2013;2013:524324. 10.1155/2013/524324.Suche in Google Scholar PubMed PubMed Central

[41] Liu J, Yue Y, Han D, Wang X, Fu Y, Zhang L, et al. A METTL3–METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation. Nat Chem Biol. 2014;10(2):93–5.10.1038/nchembio.1432Suche in Google Scholar PubMed PubMed Central

[42] Jin DI, Lee SW, Han ME, Kim HJ, Seo SA, Hur GY, et al. Expression and roles of Wilms’ tumor 1-associating protein in glioblastoma. Cancer Sci. 2012;103(12):2102–9.10.1111/cas.12022Suche in Google Scholar PubMed PubMed Central

[43] Chen Y, Peng C, Chen J, Chen D, Yang B, He B, et al. WTAP facilitates progression of hepatocellular carcinoma via m6A-HuR-dependent epigenetic silencing of ETS1. Mol Cancer. 2019;18(1):019-1053.10.1186/s12943-019-1053-8Suche in Google Scholar PubMed PubMed Central

[44] Chen S, Li Y, Zhi S, Ding Z, Wang W, Peng Y, et al. WTAP promotes osteosarcoma tumorigenesis by repressing HMBOX1 expression in an m(6)A-dependent manner. Cell Death Dis. 2020;11(8):020-02847.10.1038/s41419-020-02847-6Suche in Google Scholar PubMed PubMed Central

Received: 2023-03-20
Revised: 2023-08-06
Accepted: 2023-09-13
Published Online: 2023-10-16

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Heruntergeladen am 4.5.2026 von https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0818/html?lang=de
Button zum nach oben scrollen