Startseite Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
Artikel Open Access

Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats

  • Jinchai Zhao , Wei Chen und Jian Liu EMAIL logo
Veröffentlicht/Copyright: 25. Februar 2023

Abstract

Decreased locomotor activity and altered urinary frequency are induced by bilateral common iliac vein ligation in rats. As a carotenoid, lycopene has a strong anti-oxidative function. This research investigated the function of lycopene in the pelvic venous congestion (PC) rat model and the underlying molecular mechanism. Lycopene and olive oil were administered intragastrically on a daily basis for 4 weeks after successful modeling. Locomotor activity, voiding behavior, and continuous cystometry were analyzed. The levels of 8-hydroxy-2′-deoxyguanosine (8-OHdG), nitrate and nitrite (NO x ), and creatinine in the urine were measured. Gene expression in the bladder wall was analyzed by quantitative reverse transcription polymerase chain reaction, enzyme-linked immunosorbent assay, and Western blot. Locomotor activity, single voided volume, the interval between the bladder contractions, and urinary NO x /cre ratio were all decreased in rats with PC, while the frequency of urination, urinary 8-OHdG/cre ratio, inflammatory responses, and nuclear factor-κB (NF-κB) signal activity were all increased. Lycopene treatment increased locomotor activity, decreased frequency of urination, elevated urinary NO x level, and decreased urinary 8-OHdG level in the PC rat model. Lycopene also inhibited PC-enhanced pro-inflammatory mediator expression and NF‐κB signaling pathway activity. In conclusion, lycopene treatment ameliorates PC-induced phenotypes and shows an anti-inflammatory effect in the PC rat model.

1 Introduction

Pelvic congestion syndrome is caused by unilateral or bilateral ovarian vein incompetence [1,2]. The pathogenesis of pelvic congestion syndrome induces pelvic organ dysfunction, dysmenorrhea, dyspareunia, urinary urgency, irritable bladder, chronic pelvic pain, and varicose veins and vulval varices [3,4]. Pelvic venous congestion (PC) contributes to chronic pelvic pain [5]. The main cause of PC is the gonadal vein valves, and its main symptoms are pelvic venous engorgement and gonadal vein reflux [6].

In spontaneously hypertensive rats, prostate blood flow, bladder capacity, and voiding volume are all decreased [7,8]. The overactivity of detrusor-caused voiding frequency is observed in rats with atherosclerosis-induced chronic bladder ischemia [9]. Studies have demonstrated that decreased locomotor activity and altered urinary frequency are induced in the PC rat model [10]. Surgically altered rats exhibited reduced bladder blood flow by ∼20% compared to intact bladder flow [10]. Thus, PC may be related to pelvic ischemia and other urinary tract diseases [11].

Lycopene is widely distributed in different kinds of fruits. Based on its special conjugated double bonds, lycopene has a strong anti-oxidative capacity [12]. In rats with pentylenetetrazole-induced epileptic seizures and memory impairment, lycopene supplementation displayed anti-epileptic activity by inhibiting the inducible nitric oxide synthase (iNOS) pathway [13]. Lycopene can attenuate chronic pelvic pain syndrome by inhibiting inflammation and oxidative stress via the nuclear factor-κB (NF-κB) pathway [14]. In this study, we investigated lycopene function in the PC rat model and the underlying molecular mechanism.

2 Materials and methods

2.1 Animals

Animal studies were approved by the Institutional Animal Care and Use Committee of the Second Hospital of Hebei Medical University. In this study, female Sprague–Dawley rats weighing 200–230 g were used. Rats were anesthetized with 2% isoflurane. After lower abdomen dissection, the bilateral uterine veins were ligated with the uterine artery, and the uterine horns near the ovaries and the bilateral common iliac veins were ligated with metal clips. After venous ligation, the distal common iliac vein was dilated. Antibiotics (30 mg of ampicillin) were administered subcutaneously to all the animals after closing the abdomen. The rats then recovered in the dam for 2 h post-surgery.

In the sham group, the bilateral common iliac veins were dissected free of the common iliac arteries. Rats with PC were randomized into four groups: PC group, PC + 5 mg/kg/day lycopene (PC + Lyc5) group, PC + 10 mg/kg/day lycopene (PC + Lyc10) group, and PC + 20 mg/kg/day lycopene (PC + Lyc20) group. Lycopene (purity ≥98%; Solarbio, Wuhan, China) was dissolved in olive oil. Lycopene and olive oil were administered intragastrically on a daily basis for 4 weeks after successful modeling. The rats in the sham group and the PC groups received the same volume of olive oil as the lycopene-treated groups.

After the 4-week treatment, locomotor activity and urinary voiding tests were performed, and spontaneously voided urine was collected. The continuous cystometric parameters, 8-hydroxy-2′-deoxyguanosine (8-OHdG), nitrate and nitrite (NO x ), and creatinine levels were analyzed. The rats were sacrificed, and the bladders were collected and cut into halves longitudinally. Half of the bladder was homogenized in 50 mM Tris–HCl pH 7.4 (1/10, w/v) and stored at −80℃ for enzyme-linked immunosorbent assay (ELISA), and the other half was mixed in groups and subjected to four replicates of polymerase chain reaction (PCR) or Western blot experiments.

2.2 Locomotor activity

The rats were housed individually, and the locomotor activity was measured by the infrared sensor and digital counter (NS-ASS01; Neuroscience, Inc., Tokyo, Japan). The sum of all movements between 8:00 p.m. and 1:00 a.m. was calculated as locomotor activity.

2.3 Voiding behavior

The rats were housed individually for 24 h. During the assessment, integrating urine weight, voiding volumes, and voiding times were measured at 1-min intervals through a computer with a camera (Mijia, China).

2.4 Continuous cystometry

After being anesthetized, rats were kept in a restraining cage. A polyethylene catheter (NS-ASS01; Neuroscience, Inc.) connected with a pressure transducer and infusion pump was transurethrally placed in the bladder. About 0.05 mL of saline was pumped into the bladder within a minute and continued for at least 90 min. Bladder activity was evaluated.

2.5 8-OHdG, NO x , and creatinine measurements

Spontaneously voided urine was gathered for measurement. The levels of creatinine and 8-OHdG were analyzed by commercial ELISA kits (Trevigen, Gaithersburg, MD, USA). NO x was evaluated through the Griess method by a high-performance liquid chromatography system.

2.6 IL-1β, IL-6, and iNOS measurements

In the bladder, the iNOS, interleukin 1β (IL-1β) and interleukin 6 (IL-6) levels were analyzed through corresponding ELISA kits (MultiSciences Biotech, China).

2.7 Quantitative reverse transcription polymerase chain reaction (qRT-PCR)

Total ribonucleic acid (RNA) was extracted from the bladder tissue with an RNeasy Mini Kit (Qiagen, Hilden, Germany). After being treated with DNase I to avoid genomic contamination, 1 μg of RNA was used for the synthesis of complementary deoxyribonucleic acid with the SuperScript™ II Reverse Transcriptase (ThermoFisher Scientific). Real-time PCR was executed by the SYBR Green Real-Time PCR Master Mixes (ThermoFisher, Waltham, MA, USA).

IL-1β F: CCACCTCCAGGGACAGGATA

IL-1β R: AACACGCAGGACAGGTACAG;

IL-6 F: CCGTTTCTACCTGGAGTTTG

IL-6 R: GTTTGCCGAGTAGACCTCAT;

iNOS F: GATCAATAACCTGAAGCCCG

iNOS R: GCCCTTTTTTGCTCCATAGG;

GAPDH F: GTGCCAGCCTCGTCTCATAG

GAPDH R: CTTTGTCACAAGAGAAGGCAG.

2.8 Western blot

Tissues were lysed by a radioimmunoprecipitation assay buffer (Beyotime, Nantong, China). The Western blot was performed using the standard method. Antibodies used in this experiment included anti-p65 (Cell Signaling Technology, Danvers, MA, USA), anti-p-p65 (Cell Signaling Technology), anti-iNOS (Santa Cruz, Biotechnology, Santa Cruz, CA, USA), and anti-β-actin (Santa Cruz).

2.9 Statistical analysis

Statistical analysis was performed by the GraphPad PRISM 6.0 software. Data were presented as mean ± standard deviation (SD). One-way analysis of variance (ANOVA) followed by Dunn’s multiple comparisons test was used to calculate the differences between each group.

3 Results

3.1 Lycopene ameliorates decreased locomotor activity in rats with PC

As shown in Figure 1, the PC group showed remarkably lower locomotor activity than the sham group. Lycopene treatment at doses of 5, 10, and 20 mg/kg/day increased locomotor activity in a dose-dependent manner (Figure 1). The representative actograms of locomotor activities among different groups are shown in Figure S1.

Figure 1 
                  Effects of lycopene on locomotor activity of rats with PC. Locomotor activity during the dark period was compared among different groups. N = 10 for each group. Mean ± SD with all data presented. One-way ANOVA followed by Dunn’s multiple comparisons test. #
                     p < 0.05, ##
                     p < 0.01, ###
                     p < 0.001 compared to the PC group. *
                     p < 0.05, **
                     p < 0.01, ***
                     p < 0.001 compared to the sham group.
Figure 1

Effects of lycopene on locomotor activity of rats with PC. Locomotor activity during the dark period was compared among different groups. N = 10 for each group. Mean ± SD with all data presented. One-way ANOVA followed by Dunn’s multiple comparisons test. # p < 0.05, ## p < 0.01, ### p < 0.001 compared to the PC group. * p < 0.05, ** p < 0.01, *** p < 0.001 compared to the sham group.

3.2 Lycopene ameliorates increased urinary frequency in rats with PC

As shown in Figure 2a, the PC group exhibited a significantly higher frequency of urination than the sham group, the PC + Lyc5 group, the PC + Lyc10 group, and the PC + Lyc20 group. The PC group showed markedly lower single-voided volume than the other groups (Figure 2b). However, the total voided volume was not influenced (Figure 2c). Lycopene treatment at doses of 5, 10, and 20 mg/kg/day attenuated the frequency of urination and increased the single voided volume in rats with PC.

Figure 2 
                  Effects of lycopene on the voiding behavior of rats with PC. The 24-h frequency of urination (a), single-voided volume during the light and dark periods (b), and total voided urine volume at 24 h (c) were compared. N = 10 for each group. Mean ± SD with all data presented. One-way ANOVA followed by Dunn’s multiple comparisons test. #
                     p < 0.05, ##
                     p < 0.01, ###
                     p < 0.001 compared to the PC group. *
                     p < 0.05, **
                     p < 0.01, ***
                     p < 0.001 compared to the sham group.
Figure 2

Effects of lycopene on the voiding behavior of rats with PC. The 24-h frequency of urination (a), single-voided volume during the light and dark periods (b), and total voided urine volume at 24 h (c) were compared. N = 10 for each group. Mean ± SD with all data presented. One-way ANOVA followed by Dunn’s multiple comparisons test. # p < 0.05, ## p < 0.01, ### p < 0.001 compared to the PC group. * p < 0.05, ** p < 0.01, *** p < 0.001 compared to the sham group.

3.3 Lycopene ameliorates shortened interval between bladder contractions in rats with PC

The PC group showed a shorter interval between bladder contractions than the other groups, while the lycopene treatment at doses of 5, 10, and 20 mg/kg/day could increase the interval in rats with PC (Figure 3a). Maximum bladder contraction pressure and bladder baseline pressure in these groups showed no significant difference (Figure 3b and c).

Figure 3 
                  Effects of lycopene on the continuous cystometric parameters. The interval between the bladder contractions (a), the bladder baseline pressure (b), and the maximum bladder contraction pressure (c) were recorded. N = 10 for each group. Mean ± SD with all data presented. A one-way ANOVA followed by Dunn’s multiple comparisons test. #
                     p < 0.05, ##
                     p < 0.01, ###
                     p < 0.001 compared to the PC group. **
                     p < 0.01, ***
                     p < 0.001 compared to the sham group.
Figure 3

Effects of lycopene on the continuous cystometric parameters. The interval between the bladder contractions (a), the bladder baseline pressure (b), and the maximum bladder contraction pressure (c) were recorded. N = 10 for each group. Mean ± SD with all data presented. A one-way ANOVA followed by Dunn’s multiple comparisons test. # p < 0.05, ## p < 0.01, ### p < 0.001 compared to the PC group. ** p < 0.01, *** p < 0.001 compared to the sham group.

3.4 Lycopene ameliorates altered urinary NO x and 8-OHdG levels in rats with PC

In the PC group, the 8-OHdG/creatinine ratio was significantly higher than in the other groups (Figure 4a). In the PC group, the urinary NO x /creatinine ratio was lower than in the other groups (Figure 4b). Lycopene treatment at doses of 5, 10, and 20 mg/kg/day successfully decreased the 8-OHdG/creatinine ratio while increasing the NO x /creatinine ratio in rats with PC.

Figure 4 
                  Effects of lycopene on 8-OHdG and NO
                        x
                      levels. Comparisons of the urinary 8-OHdG (a) and NO
                        x
                      (b) levels corrected for creatinine among different groups. N = 10 for each group. Mean ± SD with all data presented. One-way ANOVA followed by Dunn’s multiple comparisons test. #
                     p < 0.05, ##
                     p < 0.01, ###
                     p < 0.001 compared to the PC group. *
                     p < 0.05, ***
                     p < 0.001 compared to the sham group.
Figure 4

Effects of lycopene on 8-OHdG and NO x levels. Comparisons of the urinary 8-OHdG (a) and NO x (b) levels corrected for creatinine among different groups. N = 10 for each group. Mean ± SD with all data presented. One-way ANOVA followed by Dunn’s multiple comparisons test. # p < 0.05, ## p < 0.01, ### p < 0.001 compared to the PC group. * p < 0.05, *** p < 0.001 compared to the sham group.

3.5 Lycopene ameliorates enhanced inflammatory responses in the bladder of rats with PC

Based on the ELISA results, iNOS, IL-1β, and IL-6 levels in the PC group were significantly higher than in the sham group, the PC + Lyc5 group, the PC + Lyc10 group, and the PC + Lyc20 group (Figure 5a–c). iNOS, IL-1β, and IL-6 mRNA levels showed the same tendency (Figure 5d–f). Lycopene treatment at doses of 5, 10, and 20 mg/kg/day successfully attenuated the inflammatory responses in rats with PC, as evidenced by the decreased levels of iNOS, IL-1β, and IL-6.

Figure 5 
                  Effects of lycopene on inflammatory response in the bladder of rats with PC. iNOS (a), IL-6 (b), and IL-1β (c) levels in the bladder among different groups were measured by ELISA. N = 10 for each group. The mRNA levels of iNOS (d), IL-6 (e), and IL-1β (f) in the bladder were measured by qRT-PCR. N = 4 from ten mixed tissues for each group. Mean ± SD with all data presented. One-way ANOVA followed by Dunn’s multiple comparisons test. #
                     p < 0.05, ##
                     p < 0.01, ###
                     p < 0.001 compared to the PC group. *
                     p < 0.05, **
                     p < 0.01, ***
                     p < 0.001 compared to the sham group.
Figure 5

Effects of lycopene on inflammatory response in the bladder of rats with PC. iNOS (a), IL-6 (b), and IL-1β (c) levels in the bladder among different groups were measured by ELISA. N = 10 for each group. The mRNA levels of iNOS (d), IL-6 (e), and IL-1β (f) in the bladder were measured by qRT-PCR. N = 4 from ten mixed tissues for each group. Mean ± SD with all data presented. One-way ANOVA followed by Dunn’s multiple comparisons test. # p < 0.05, ## p < 0.01, ### p < 0.001 compared to the PC group. * p < 0.05, ** p < 0.01, *** p < 0.001 compared to the sham group.

3.6 Lycopene ameliorates enhanced expressions of iNOS and NF-κB in the bladder of rats with PC

In the PC group, the protein level of iNOS and the phosphorylation level of p65 subunit of NF-κB were significantly higher than in the other groups (Figure 6a and b). Lycopene treatment at doses of 5, 10, and 20 mg/kg/day was able to inhibit the expression of iNOS and the phosphorylation of p65.

Figure 6 
                  Effects of lycopene on iNOS expression and NF-κB activity in the bladder of rats with PC. (a) iNOS, (b) p-p65 and p65 levels in the bladder among different groups were analyzed by Western blot. N = 4 from ten mixed tissues for each group. Mean ± SD with all data presented. One-way ANOVA followed by Dunn’s multiple comparisons test. ##
                     p < 0.01, ###
                     p < 0.001 compared to the PC group. *
                     p < 0.05, **
                     p < 0.01, ***
                     p < 0.001 compared to the sham group.
Figure 6

Effects of lycopene on iNOS expression and NF-κB activity in the bladder of rats with PC. (a) iNOS, (b) p-p65 and p65 levels in the bladder among different groups were analyzed by Western blot. N = 4 from ten mixed tissues for each group. Mean ± SD with all data presented. One-way ANOVA followed by Dunn’s multiple comparisons test. ## p < 0.01, ### p < 0.001 compared to the PC group. * p < 0.05, ** p < 0.01, *** p < 0.001 compared to the sham group.

4 Discussion

Previous studies have illustrated that rats with PC have increased bladder vascular permeability and decreased bladder blood flow [15,16]. Furthermore, another study has also demonstrated that the induction of PC increases the frequency of urination and urinary 8-OHdG level and decreases the interval between bladder contractions, locomotor activity, and urinary NO x level [17].

In this research, we also established the rat PC model. Results showed that the induction of PC in rats decreased the interval between bladder contractions and the 24-h single-voided volume and increased the frequency of urination. However, lycopene administration reduced the frequency of urination and elevated the interval between bladder contractions and 24-h single-voided volume in PC rats. The effect of lycopene was also observed in a dose-dependent manner. Therefore, in the PC rat model, lycopene improved bladder overactivity and local vascular permeability.

Meanwhile, the induction of PC in rats decreased the locomotor activity and the urinary level of NO x and increased the urinary level of 8-OHdG. Decreased locomotor activity suggests that PC-induced impairment is associated with pelvic pain or discomfort. Lycopene administration also enhanced locomotor activity. Meanwhile, the abnormal urinary 8-OHdG and NO x levels in the PC rat model were also alleviated by lycopene. These results indicated that lycopene could elevate the urinary NO x level. Nitric oxide has been shown to exhibit relaxant and facilitatory effects and act directly on bladder smooth muscle [18]. NO x causes the relaxation of smooth muscle by activating soluble guanylate cyclase to produce cGMP. In rats with PC, the decreased urinary NO x level indicates that the alteration of urinary frequency is related to bladder tissue hypoxia [17]. In this study, decreased urinary NO x was reversed by the administration of lycopene. Thus, lycopene might improve bladder tissue hypoxia by relaxing the bladder and the pelvic vessels.

Lycopene contains several conjugated double bonds [19]. In vivo, lycopene is oxidized and degraded to form carbon chain-shorted isomers as metabolites, including 2,6-cyclolycopene-1 and 5,6-dihydroxy-5′, 6′-dihydrolycopene [20]. Lycopene acts as a free radical scavenger to prevent oxidative injury [21].

Increased urinary levels of oxidative stress markers in the PC rat model suggest that bladder tissue hypoxia is one of the factors contributing to lower urinary tract symptoms [16]. The high frequency of urination in a chronic bladder ischemia rat model is associated with increased oxidative stress in the bladder tissue [22]. 8-OHdG is an oxidative stress marker. PC decreases locomotor activity, increases the urinary 8-OHdG level, and decreases urinary NO x [17]. Increased urinary 8-OHdG levels in the PC rat model were alleviated by lycopene. Meanwhile, the expression of IL-1β, IL-6, and iNOS in the bladder tissue was enhanced in PC rats. These results demonstrated that the inflammation response in the bladder was enhanced in rats with PC. The expression of IL-1β, IL-6, and iNOS was all inhibited by lycopene, which supports its potent anti-inflammatory effect. In the inflammatory response, IL‐1β is the vital pro-inflammatory factor and IL-6 is the crucial immune factor. Meanwhile, iNOS enhances oxidative stress by participating in extensive oxidative damage through the generation of NO and superoxide anions [23]. NO displays both relaxant and facilitatory effects on the bladder smooth muscle [18]. Decreased urinary NO x in the PC rat model suggests that bladder tissue hypoxia is one of the causes of altered urinary frequency [17].

NF-κB regulates oxidative stress and inflammatory response. In the inactivated state, p65/p50 heterodimer binds to IκB and locates in the cytoplasm. In the activated state, IκB is degraded and the p65 subunit is phosphorylated and translocated into the nucleus to induce inflammatory factor expression [24,25]. NF-κB is an inducer of iNOS, which is normally absent in the bladder but is largely expressed during inflammatory conditions [26]. In mice with an overactive bladder profile, bladder inflammation and increased NF-kB/iNOS signaling were observed [26]. Studies have demonstrated the function of lycopene in the NF‐κB signaling pathway. Hung et al. have illustrated that lycopene affects the NF‐κB pathway to suppress tumor necrosis factor‐α-mediated expression of intercellular adhesion molecule‐1 [27]. Another research has indicated that the activation of NF‐κB is inhibited by lycopene [28]. Since lycopene showed a significant anti-inflammatory effect in the bladder of rats with PC, it might also regulate the NF‐κB pathway to alleviate the inflammation response.

Therefore, in this research, we also explored the effect of lycopene on the activity of the NF‐κB signaling pathway. Elevated iNOS protein levels in the bladder of the PC rat model indicated an enhanced inflammatory response. However, the administration of lycopene effectively decreased the iNOS protein level in the bladder of the PC rat model. In rats with PC, p65 phosphorylation in the bladder was significantly enhanced, but its total protein level remained unchanged, which showed enhanced NF‐κB pathway activity. Lycopene remarkably suppressed p65 phosphorylation but had no influence on total p65 protein level, which indicated that lycopene prevented the activation of NF‐κB.

In conclusion, the induction of PC in rats decreases locomotor activity, increases the frequency of urination, shortens the interval between bladder contractions, elevates urinary 8-OHdG level, and reduces urinary No x level. All these symptoms could be effectively reversed by the administration of lycopene. Furthermore, in the bladder of rats with PC, pro-inflammatory mediator expression and the activity of the NF‐κB signaling pathway are all enhanced.

Acknowledgement

None.

  1. Funding information: This research was supported by the Medical Science Research Program of the Health and Family Planning Commission in Hebei Province of China (20170554).

  2. Conflict of interest: None declared.

  3. Data availability statement: Data could be obtained upon reasonable request to the corresponding author.

References

[1] Asciutto G, Mumme A, Marpe B, Koster O, Asciutto KC, Geier B. MR venography in the detection of pelvic venous congestion. Eur J Vasc Endovasc Surg. 2008;36(4):491–6. 10.1016/j.ejvs.2008.06.024.Suche in Google Scholar PubMed

[2] Durham JD, Machan L. Pelvic congestion syndrome. Semin Interventional Radiol. 2013;30(4):372–80. 10.1055/s-0033-1359731.Suche in Google Scholar PubMed PubMed Central

[3] Ganeshan A, Upponi S, Hon LQ, Uthappa MC, Warakaulle DR, Uberoi R. Chronic pelvic pain due to pelvic congestion syndrome: The role of diagnostic and interventional radiology. Cardiovasc Interventional Radiol. 2007;30(6):1105–11. 10.1007/s00270-007-9160-0.Suche in Google Scholar PubMed

[4] Hobbs JT. Varicose veins arising from the pelvis due to ovarian vein incompetence. Int J Clin Pract. 2005;59(10):1195–203. 10.1111/j.1368-5031.2005.00631.x.Suche in Google Scholar PubMed

[5] Bookwalter CA, VanBuren WM, Neisen MJ, Bjarnason H. Imaging appearance and nonsurgical management of pelvic venous congestion syndrome. Radiographics. 2019;39(2):596–608. 10.1148/rg.2019180159.Suche in Google Scholar PubMed

[6] Black CM, Thorpe K, Venrbux A, Kim HS, Millward SF, Clark TW, et al. Research reporting standards for endovascular treatment of pelvic venous insufficiency. J Vasc Interventional Radiol. 2010;21(6):796–803. 10.1016/j.jvir.2010.02.017.Suche in Google Scholar PubMed

[7] Saito M, Tsounapi P, Oikawa R, Shimizu S, Honda M, Sejima T, et al. Prostatic ischemia induces ventral prostatic hyperplasia in the SHR; possible mechanism of development of BPH. Sci Rep. 2014;4:3822. 10.1038/srep03822.Suche in Google Scholar PubMed PubMed Central

[8] Steers WD, Clemow DB, Persson K, Sherer TB, Andersson KE, Tuttle JB. The spontaneously hypertensive rat: Insight into the pathogenesis of irritative symptoms in benign prostatic hyperplasia and young anxious males. Exp Physiol. 1999;84(1):137–47. 10.1111/j.1469-445x.1999.tb00079.x.Suche in Google Scholar PubMed

[9] Nomiya M, Yamaguchi O, Andersson KE, Sagawa K, Aikawa K, Shishido K, et al. The effect of atherosclerosis-induced chronic bladder ischemia on bladder function in the rat. Neurourol Urodyn. 2012;31(1):195–200. 10.1002/nau.21073.Suche in Google Scholar PubMed

[10] Sugaya K, Nishijima S, Kadekawa K, Ashitomi K, Ueda T, Yamamoto H. Pelvic venous congestion with castration causes chronic prostatitis in rats. Int J Urol. 2016;23(5):431–5. 10.1111/iju.13061.Suche in Google Scholar PubMed

[11] Sugaya K, Nishijima S, Kadekawa K, Ashitomi K, Ueda T, Yamamoto H. Naftopidil improves locomotor activity and urinary frequency in rats with pelvic venous congestion. Biomed Res. 2016;37(4):221–6. 10.2220/biomedres.37.221.Suche in Google Scholar PubMed

[12] Clinton SK. Lycopene: Chemistry, biology, and implications for human health and disease. Nutr Rev. 1998;56(2 Pt 1):35–51. 10.1111/j.1753-4887.1998.tb01691.x.Suche in Google Scholar PubMed

[13] Taskiran AS, Tastemur Y. The role of nitric oxide in anticonvulsant effects of lycopene supplementation on pentylenetetrazole-induced epileptic seizures in rats. Exp Brain Res. 2021;239(2):591–9. 10.1007/s00221-020-06012-5.Suche in Google Scholar PubMed

[14] Zhao Q, Yang F, Meng L, Chen D, Wang M, Lu X, et al. Lycopene attenuates chronic prostatitis/chronic pelvic pain syndrome by inhibiting oxidative stress and inflammation via the interaction of NF-kappaB, MAPKs, and Nrf2 signaling pathways in rats. Andrology. 2020;8(3):747–55. 10.1111/andr.12747.Suche in Google Scholar PubMed PubMed Central

[15] Sugaya K, Nishijima S, Kadekawa K, Ashitomi K, Ueda T, Yamamoto H. Effects of silodosin on bladder activity in rats with frequent urination induced by pelvic venous congestion. Int J Urol. 2016;23(10):881–7. 10.1111/iju.13158.Suche in Google Scholar PubMed

[16] Sugaya K, Nishijima S, Kadekawa K, Noguchi K, Ashitomi K, Ueda T, et al. Pelvic venous congestion induces lower urinary tract dysfunction in rats. Biomed Res. 2018;39(6):269–77. 10.2220/biomedres.39.269.Suche in Google Scholar PubMed

[17] Nishijima S, Sugaya K, Kadekawa K, Ashitomi K, Ueda T, Yamamoto H. Mechanisms underlying the effects of propiverine on bladder activity in rats with pelvic venous congestion and urinary frequency. Biomed Res. 2019;40(4):145–52. 10.2220/biomedres.40.145.Suche in Google Scholar PubMed

[18] Daly DM, Collins VM, Chapple CR, Grundy D. The afferent system and its role in lower urinary tract dysfunction. Curr Opin Urol. 2011;21(4):268–74. 10.1097/MOU.0b013e3283476ea2.Suche in Google Scholar PubMed

[19] Kawata A, Murakami Y, Suzuki S, Fujisawa S. Anti-inflammatory activity of beta-carotene, lycopene and tri-n-butylborane, a scavenger of reactive oxygen species. In Vivo. 2018;32(2):255–64. 10.21873/invivo.11232.Suche in Google Scholar PubMed PubMed Central

[20] Moran NE, Erdman Jr JW, Clinton SK. Complex interactions between dietary and genetic factors impact lycopene metabolism and distribution. Arch Biochem Biophys. 2013;539(2):171–80. 10.1016/j.abb.2013.06.017.Suche in Google Scholar PubMed PubMed Central

[21] Chen J, Song Y, Zhang L. Effect of lycopene supplementation on oxidative stress: An exploratory systematic review and meta-analysis of randomized controlled trials. J Med Food. 2013;16(5):361–74. 10.1089/jmf.2012.2682.Suche in Google Scholar PubMed PubMed Central

[22] Nomiya M, Sagawa K, Yazaki J, Takahashi N, Kushida N, Haga N, et al. Increased bladder activity is associated with elevated oxidative stress markers and proinflammatory cytokines in a rat model of atherosclerosis-induced chronic bladder ischemia. Neurourol Urodyn. 2012;31(1):185–9. 10.1002/nau.21191.Suche in Google Scholar PubMed

[23] Nagai N, Liu Y, Fukuhata T, Ito Y. Inhibitors of inducible nitric oxide synthase prevent damage to human lens epithelial cells induced by interferon-gamma and lipopolysaccharide. Biol Pharm Bull. 2006;29(10):2077–81. 10.1248/bpb.29.2077.Suche in Google Scholar PubMed

[24] Awasthi N, Guo S, Wagner BJ. Posterior capsular opacification: A problem reduced but not yet eradicated. Arch Ophthalmol. 2009;127(4):555–62. 10.1001/archophthalmol.2009.3.Suche in Google Scholar PubMed

[25] Hayden MS, Ghosh S. Shared principles in NF-kappaB signaling. Cell. 2008;132(3):344–62. 10.1016/j.cell.2008.01.020.Suche in Google Scholar PubMed

[26] de Oliveira MG, de Medeiros ML, Tavares EBG, Monica FZ, Antunes E. Methylglyoxal, a reactive glucose metabolite, induces bladder overactivity in addition to inflammation in mice. Front Physiol. 2020;11:290. 10.3389/fphys.2020.00290.Suche in Google Scholar PubMed PubMed Central

[27] Hung CF, Huang TF, Chen BH, Shieh JM, Wu PH, Wu WB. Lycopene inhibits TNF-alpha-induced endothelial ICAM-1 expression and monocyte-endothelial adhesion. Eur J Pharmacol. 2008;586(1–3):275–82. 10.1016/j.ejphar.2008.03.001.Suche in Google Scholar PubMed

[28] Bai SK, Lee SJ, Na HJ, Ha KS, Han JA, Lee H, et al. Beta-carotene inhibits inflammatory gene expression in lipopolysaccharide-stimulated macrophages by suppressing redox-based NF-kappaB activation. Exp Mol Med. 2005;37(4):323–34. 10.1038/emm.2005.42.Suche in Google Scholar PubMed

Received: 2022-08-03
Revised: 2022-11-17
Accepted: 2022-12-19
Published Online: 2023-02-25

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Heruntergeladen am 19.9.2025 von https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0638/html
Button zum nach oben scrollen