Home Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
Article Open Access

Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression

  • Chao Yan and Yue Jin EMAIL logo
Published/Copyright: April 3, 2023

Abstract

Myocardial infarction–associated transcript (MIAT) is a long noncoding RNA that plays a critical role in a variety of diseases. Accordingly, this study probed into the possible interaction mechanism between MIAT and miR-378a-5p in breast cancer. Concretely, MIAT and miR-378a-5p expressions in breast cancer tissues and cells were measured. After transfection with siMIAT and miR-378a-5p inhibitor, the viability and proliferation of breast cancer cells were examined by cell counting kit-8 and colony formation assays. The expressions of apoptosis-related proteins were detected. According to the results, MIAT was highly expressed in breast cancer tissues and cells. MIAT silencing could decrease Bcl-2 expression, viability, and proliferation of breast cancer cells and increase the expressions of cleaved caspase-3 and Bax. MIAT and miR-378a-5p could directly bind to each other, and MIAT silencing promoted the expression of miR-378a-5p. miR-378a-5p expression was low in breast cancer tissues. The miR-378a-5p inhibitor enhanced the viability and proliferation of breast cancer cells and partially reversed the effects of MIAT silencing on the breast cancer cells. In conclusion, MIAT silencing inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p, indicating the potential of MIAT as a new target for the treatment of breast cancer.

1 Introduction

Breast cancer is a common malignant tumor that occurs in the glandular epithelial tissues of the breast [1], with the incidence increasing year by year [2]. Owing to the high mortality rate, breast cancer has currently emerged as one of the major diseases that seriously endanger women’s life and health worldwide [2]. The clinical symptoms of patients with breast cancer are insidious at the early stages. However, at the time of diagnosis, the clinical manifestations were quite obvious, and even lymph node metastasis occurs, which greatly affects the prognosis and survival rate of patients [3,4,5,6]. In recent years, with the development of bioinformatics and the in-depth studies of the mechanism of breast cancer, target therapy for breast cancer has become a research hotspot [7].

Long noncoding RNAs (lncRNAs) refer to a type of noncoding RNA with over 200 nucleotides in length and no protein-coding potential [8]. A study has demonstrated that a variety of lncRNAs are involved in cancer progression, and their misregulation and mutations may play important roles in cancer [9]. Myocardial infarction–associated transcript (MIAT) is a lncRNA conserved in assorted species that was first reported in mitotic retinal precursor cells [10]. In recent years, MIAT has been proved to be implicated in the development of diversified human diseases, especially tumors [11]. For instance, MIAT is highly expressed in lung cancer and neuroendocrine prostate cancer and interacts with multiple genes to participate in cancer development, which has been widely perceived as a therapeutic target [12,13]. Likewise, MIAT is highly expressed in breast cancer, and inhibition of MIAT can repress breast cancer cell migration and proliferation and promote apoptosis [14]. In addition, it has been reported that MIAT silencing induces the apoptosis of breast cancer cells and enhances cell sensitivity to chemotherapy drugs [15]. Although the role of MIAT in breast cancer has been partially reported, its regulatory mechanism needs to be further analyzed.

In the past few years, researchers have discovered a new mode of regulation in cancer in which lncRNAs can regulate their expressions by competitively binding to related microRNAs (miRNAs), further affecting the progression of cancer [9,16,17]. For example, lncRNA growth-stasis-specific transcript 5 can promote apoptosis by targeting and regulating the expression of miR-378a-5p in triple-negative breast cancer [18]. In addition, several reports have uncovered that miR-378a-5p is able to regulate the proliferation, angiogenesis, apoptosis, and migration of cancer cells [19,20]. For example, miR-378a-5p may serve as a tumor suppressor gene in colorectal cancer [20], and miR-378a-5p expression has a correlation with the occurrence of breast cancer tumors [21]. The balance between cell apoptosis and proliferation is important in a wide variety of physiological settings. Dysfunctional apoptosis and uncontrolled proliferation can result in assorted diseases, including cancer [22,23]. Cancer is one of the conditions where there is too little apoptosis to cause malignant cells to die [24]. BCL-2 family members play integral roles in apoptosis, among which cleaved caspase-3 and Bax are pro-apoptotic genes and Bcl-2 is an anti-apoptotic gene [25]. Based on the abovementioned information, the effect of miR-378a-5p on the apoptosis of breast cancer cells was further explored in this study.

Herein, we explored the interaction mechanism of miR-378a-5p and MIAT in breast cancer, with the aim of uncovering a new molecular mechanism of breast cancer development and providing novel cues for the treatment of breast cancer.

2 Materials and methods

2.1 Patient tissue specimens

In this study, 30 breast cancer tissue samples were collected from patients at Huai’an Second People’s Hospital on March 19, 2022. All patients were pathologically diagnosed with breast cancer and had not received preoperative treatment. At the same time, normal tissues around the breast cancer tissue were collected as the control group. The clinical data of all patients are shown in Table 1, including age, estrogen receptor (ER) status, tumor size, tumor grades, low grade, high grade, progesterone receptor (PR) status, P53 status, tumor stage, subtype, histology, and human epidermal growth factor 2 (HER2) status.

Table 1

The clinical data of all breast cancer patients in this study

Characteristics Numbers (%) Mean of 2△ct ± SE P-value MIAT
Age 0.017*
 <45 years 11 (36.7) 0.032 ± 0.012
 ≥45 years 19 (63.3) 0.017 ± 0.005
Tumor size (V/cm3) 0.028*
 <14 cm3 17 (56.7) 0.015 ± 0.037
 ≥14 cm3 13 (43.0) 0.036 ± 0.009
Tumor grades 0.071
 Ⅰ 8 (26.7) 0.018 ± 0.003
 Ⅱ 7 (23.3) 0.022 ± 0.007
 Ⅲ 10 (33.3) 0.029 ± 0.013
 Ⅳ 5 (16.7) 0.029 ± 0.005
Low grade 17 (56.7) 0.018 ± 0.007 0.003**
High grade 13 (43.3) 0.031 ± 0.015
ER status 0.023*
 Negative 5 (16.7) 0.017 ± 0.056
 Positive 25 (83.3) 0.026 ± 0.008
PR status 0.360
 Negative 11 (30.0) 0.018 ± 0.053
 Positive 19 (70) 0.028 ± 0.009
HER2 status 0.020*
 Negative 9 (23.3) 0.020 ± 0.004
 Positive 21 (76.7) 0.036 ± 0.019
P53 status <0.001***
 Negative 19 (63.3) 0.032 ± 0.013
 Positive 11 (36.7) 0.009 ± 0.003
Stage 0.046*
 Ⅰ–Ⅱ 21 (70.0) 0.031 ± 0.014
 Ⅲ–Ⅳ 9 (30.0) 0.041 ± 0.015
Subtype 0.057
 Luminal A 16 (53.3) 0.049 ± 0.020
 Luminal B 5 (16.7) 0.042 ± 0.039
 Triple negative 3 (10.0) 0.016 ± 0.012
 HER2 Tyre 2 (6.0) 0.008 ± 0.003
 Unclassified 4 (13.3) 0.036 ± 0.017
Histology 0.091
 Lobular 5 (16.7) 0.097 ± 0.142
 Ductal 25 (83.3) 0.097 ± 0.058

*P < 0.05, **P < 0.01, ***P < 0.001.

2.2 Cell culture

Five cell lines purchased from ATCC (MD, USA) were selected for this experiment, including one normal breast epithelial cell line, MCF-10A (CRL-10317), and four breast cancer cell lines, MDA-MB-231 (HTB-26), SK-BR-3 (HTB-30), BT-20 (HTB-19), and MDA-MB-436 (HTB-130). MCF-10A cells were cultured in the MEBM (CC-3151; Lonza, Basel, Switzerland), containing the components from the Medium Kit (CC-3150; Lonza, Basel, Switzerland). MDA-MB-231 cells were cultured in the specific medium (CM-0150; Procell, Wuhan, China); SK-BR-3 cells were cultured in the specific culture medium (CM-0211; Procell); BT-20 cells were cultured in the specific culture medium (CM-0324; Procell); and MDA-MB-436 cells were cultured in their specific culture medium (CM-0383; Procell).

2.3 Cell transfection

After the SK-BR-3 and MDA-MB-231 cell lines were collected, the cell concentration was adjusted. Then, cells were transferred into six-well plates in two parts and cultured for later transfection experiments. In the first part, small interfering RNAs targeting MIAT (siMIAT; target sequence: 5′-GAGGCTTTACAGCCTGTAATTCT-3′) and the negative control of siMIAT (siNC; 5′-CAAATCACAGAATCGTCGTAT-3′) were severally transfected into cells. In the second part, siNC/siMIAT and miR-378a-5p inhibitor (I; 5′-ACACAGGACCUGGAGUCAGGAG-3′)/inhibitor control (IC; 5′-CAGUACUUUUGUGUAGUACAA-3′) were co-transfected into SK-BR-3 and MDA-MB-231 cell lines. When cells reached 80% confluence, the transfection was performed as indicated in the Transfection Reagent Kit (L3000150; Thermo Fisher, MA, USA). All the above cell lines were transfected for 48 h.

2.4 Dual-luciferase reporter assay

The wild-type sequence (WT; 5′-AAACCUGGCAGAUGGUCCUAGGUCAGGAU-3′) and mutant sequence (MUT; 5′-AAACCUGCUCGGUAAUGACAUCAGGCAGU-3′) of MIAT specifically synthesized in combination with miR-378a-5p were inserted into the dual-luciferase reporter vector pmirGLO (Promega, Madison, WI, USA) to construct dual-luciferase reporter plasmids (pmirGLO-MIAT-WT and pmirGLO-MIAT-MUT). In this experiment, SK-BR-3 and MDA-MB-231 cells (5 × 105 cells/well) were cultured in the six-well plate. About 5 µg pmirGLO-MIAT-WT or pmirGLO-MIAT-MUT, 100 nM mimic control (Blank) or miR-378a-5p mimic, and Lipofectamine 3000 reagent were diluted with Opti-MEM medium, respectively. Then, the dilutions were mixed and maintained at room temperature for 10 min. After that, these lipid complexes were added to incubate the SK-BR-3 and MDA-MB-231 cells at 37℃ for 48 h. The activity of luciferase was tested on the dual-luciferase reporter system (30IOC; Promega) using a dual-luciferase assay kit (D0010; Solarbio, Beijing, China).

2.5 Cell counting kit-8 (CCK-8) assay

The viability of SK-BR-3 and MDA-MB-231 cells after transfection was measured using the CCK-8 Cell Viability Assay Kit (KGA317; Keygen, Nanjing, China). Briefly, cells (3 × 103) were collected and cultured in 96-well plates according to the instructions. After the cells were treated and cultured continuously for 48 h, and 10 µl CCK-8 reaction solution was added to the well. Next, the cells were cultured for another 2 h, and then the absorbance of cells in each well was measured at 450 nm by a microplate reader (EnSight; PerkinElmer, MA, USA).

2.6 Colony formation assay

SK-BR-3 and MDA-MB-231 cells in each group were separately collected 48 h after transfection, washed with phosphate buffer saline (PBS; C0221A; Beyotime, Shanghai, China), and later centrifuged at 1,000 × g for 5 min on a centrifuge (HT175R; Cence, Changsha, China). Thereafter, the number of cells was counted and then added to 6-well plates (800 cells/well). Colony formation was observed after the cells were cultured for ∼2 weeks. Then, cells were rinsed with PBS and treated with 4% paraformaldehyde (158127; Sigma–Aldrich, Missouri, USA) for 10 min. Later, Giemsa working solution (C0131; Beyotime) was used to stain the cells for 10 min, followed by PBS washing. The number of colony formations per well was observed and recorded under an inverted microscope (XDS-1B; Liuhui Science, Chongqing, China). Colonies containing more than 50 cells were counted.

2.7 Quantitative real-time polymerase chain reaction (qRT-PCR)

The transfected cells and tissues were collected in centrifuge tubes. To be specific, the cells were washed with PBS and the collected tissues were homogenized. Later, the total RNA was extracted using the Total RNA Isolation Kit (AM1914; Thermo Fisher) and miRNAs were extracted using the miRNA Isolation Kit (K157001; Thermo Fisher). After that, RNA purity and concentration were analyzed by the agarose gel electrophoresis and spectrophotometer (Evolution 350; Thermo Fisher), respectively. The reverse transcription was implemented as per the instructions of the cDNA Reverse-transcription Kit (D7170S; Beyotime), and the cDNA was amplified in the PCR instrument. The expressions of genes were detected on the RT-PCR system (ABI 7500; Applied Biosystems, CA, USA) with the PowerUp™ SYBR™ Green Master Mix (A25742; Thermo Fisher). All primer sequences are listed in Table 2. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 acted as the reference genes. The data were analyzed by the 2−ΔΔct method.

Table 2

All primers in RT-PCR experiments in this study

ID Forward sequence (5′-3′) Reverse sequence (5′-3′)
MIAT TCTTCATGTCAGAACACGCTTTA AAGGTCACCCGAGGTCCAA
miR-378a-5p CAAACCTCCTCCTGACTCCAG TATGCTTGTTCTCGTCTCTGTGTC
U6 CTCGCTTCGGCAGCACA ACGCTTCACGAATTTGCGT
GAPDH CAATGACCCCTTCATTGACC GACAAGCTTCCCGTTCTCAG

2.8 Western blot

The treated cells from each group were collected and transferred into a centrifuge tube. Then, the appropriate amount of lysis buffer (R0030; Solarbio) was added to the centrifuge tube, and the total proteins were extracted from the cells. The protein standard sample and bicinchoninic acid (BCA) working solution were prepared according to the specification of the BCA Protein Assay Kit (P0012S ). Next, the protein concentration was determined. The prepared gel (AR0138; BOSTER, Wuhan, China) was installed into the electrophoresis tank, after which the protein sample to be tested and the protein marker were added into the gel well for the electrophoresis experiment. Afterward, the proteins were transferred to a polyvinylidene difluoride (PVDF) membrane (YA1701; Solarbio). The PVDF membrane was soaked in the prepared 5% skimmed milk for 2 h and rinsed three times with Tris-buffered saline with Tween 20 (TBST; Solarbio) for 5 min. The PVDF membrane was then incubated with primary antibodies at 4℃ overnight, washed with TBST, and cultured with secondary antibodies at room temperature for 1.5 h. Later, the membrane was completely immersed in a luminescent working solution (WBKLS; Millipore, MA, USA) at room temperature for 3 min and scanned with an automatic chemiluminescence image analysis system (BIO-BEST; SIM, CA, USA). The information on all antibodies is displayed in Table 3, and GAPDH served as a loading control.

Table 3

All antibodies information and sources in Western blot in this study

ID Catalog number Company (country) Molecular weight (kDa) Dilution ratio
Bcl-2 #4223 CST (Massachusetts, USA) 26 1/1,000
Bax #5023 CST (Massachusetts, USA) 20 1/1,000
Cleaved caspase-3 ab2302 Abcam (Cambridge, UK) 17 1/500
Caspase-3 ab32351 Abcam (Cambridge, UK) 35 1/5,000
GAPDH ab181602 Abcam (Cambridge, UK) 36 1/10,000
Rabbit IgG ab205718 Abcam (Cambridge, UK) 1/5,000

2.9 Statistical analysis

In this study, measurement data were described by mean ± standard deviation. One-way analysis of variance was used for comparison among multiple groups, and the Tukey test was applied for pairwise comparison. In addition, a paired sample t-test was used for analyzing the data in Figures 1a and 5a, and an independent sample t-test was applied for comparison between the two groups in Table 1. All statistical analyses were implemented using Graphpad8.0 software and considered statistically significant at P < 0.05.

Figure 1 
                  The expression of lncRNA MIAT was upregulated in breast cancer tissue samples and cell lines. (a) The expression of MIAT in breast cancer tissues was examined by qRT-PCR, and GAPDH was used as a reference gene. (b) The expression of MIAT in MCF-10A and breast cancer cell lines (SK-BR-3, BT-20, MDA-MB-231, and MDA-MB-436) was examined by qRT-PCR, and GAPDH was used as a reference gene. ***
                     P < 0.001.
Figure 1

The expression of lncRNA MIAT was upregulated in breast cancer tissue samples and cell lines. (a) The expression of MIAT in breast cancer tissues was examined by qRT-PCR, and GAPDH was used as a reference gene. (b) The expression of MIAT in MCF-10A and breast cancer cell lines (SK-BR-3, BT-20, MDA-MB-231, and MDA-MB-436) was examined by qRT-PCR, and GAPDH was used as a reference gene. *** P < 0.001.

  1. Ethics statement: All clinical operating procedures in this experiment were approved by the Ethics Committee of the Huai’an Second People’s Hospital (HEYLL202021). Written informed consent was obtained from all patients for the use of the collected specimens.

3 Results

3.1 MIAT was highly expressed in breast cancer, and high MIAT expression was associated with various clinical features of the patients

We determined the expression of MIAT in human breast cancer tissues and normal tissues by qRT-PCR. From Figure 1a, it can be observed that MIAT expression was markedly upregulated in tumor tissues as compared to that in the normal tissues. Similarly, qRT-PCR results also indicated that MIAT expression was increased in breast cancer cell lines when a comparison was made with that in the normal breast epithelial cell line MCF-10A (Figure 1b). In addition, we found that high MIAT expression was associated with various clinical characteristics of patients, including age, tumor size (V/cm3), low grade, ER status, HER2 status, P53 status, and tumor stage (Table 1).

3.2 siMIAT decreased breast cancer cell viability and proliferation and regulated the expression of apoptosis-related proteins

As shown in Figure 2a and b, MIAT expression was downregulated by siMIAT in MDA-MB-231 and SK-BR-3 cells. Moreover, by testing the viability (Figure 2c and d) and proliferation (Figure 2e–h) of breast cancer cells after transfection, it can be proved that siMIAT inhibited the viability and proliferation compared to siNC. The expressions of apoptosis-related proteins in the transfected MDA-MB-231 (Figure 3a, b, e, and f) and SK-BR-3 cells (Figure 3c, d, g, and h) were also detected by Western blot. The data indicated that siMIAT elevated the expressions of cleaved caspase-3 and Bax while reducing Bcl-2 expression.

Figure 2 
                  Silencing of MIAT decreased the viability and proliferation of breast cancer cells. (a and b) The expression of MIAT in MDA-MB-231 and SK-BR-3 cells after transfection with siMIAT was examined by qRT-PCR, and GAPDH was used as a reference gene. (c and d) The viability of MDA-MB-231 and SK-BR-3 cells after transfection with siMIAT was examined by the CCK-8 assay. (e–h) The proliferation abilities of MDA-MB-231 and SK-BR-3 cells after transfection with siMIAT were assessed by a colony formation assay. ***
                     P < 0.001. siMIAT: small interfering RNA targeting MIAT; siNC: negative control for siRNA.
Figure 2

Silencing of MIAT decreased the viability and proliferation of breast cancer cells. (a and b) The expression of MIAT in MDA-MB-231 and SK-BR-3 cells after transfection with siMIAT was examined by qRT-PCR, and GAPDH was used as a reference gene. (c and d) The viability of MDA-MB-231 and SK-BR-3 cells after transfection with siMIAT was examined by the CCK-8 assay. (e–h) The proliferation abilities of MDA-MB-231 and SK-BR-3 cells after transfection with siMIAT were assessed by a colony formation assay. *** P < 0.001. siMIAT: small interfering RNA targeting MIAT; siNC: negative control for siRNA.

Figure 3 
                  Silencing of MIAT regulated the expressions of apoptosis-related proteins in breast cancer cells. (a–d) The expressions of Bax and Bcl-2 in MDA-MB-231 and SK-BR-3 cells after transfection with siMIAT were examined by Western blot, and GAPDH was used as an internal loading control. (e–h) The expressions of caspase-3 and cleaved caspase-3 in MDA-MB-231 and SK-BR-3 cells after transfection with siMIAT were tested by Western blot, and GAPDH acted as an internal loading control. ***
                     P < 0.001. siMIAT: small interfering RNA targeting MIAT; siNC: negative control for siRNA.
Figure 3

Silencing of MIAT regulated the expressions of apoptosis-related proteins in breast cancer cells. (a–d) The expressions of Bax and Bcl-2 in MDA-MB-231 and SK-BR-3 cells after transfection with siMIAT were examined by Western blot, and GAPDH was used as an internal loading control. (e–h) The expressions of caspase-3 and cleaved caspase-3 in MDA-MB-231 and SK-BR-3 cells after transfection with siMIAT were tested by Western blot, and GAPDH acted as an internal loading control. *** P < 0.001. siMIAT: small interfering RNA targeting MIAT; siNC: negative control for siRNA.

3.3 MIAT can sponge miR-378a-5p, and MIAT silencing promoted the expression of miR-378a-5p

The binding sites of MIAT and miR-378a-5p were predicted by the DIANA tools-LncBase Experimental V2. As depicted in Figure 4a, there may be a binding relationship between MIAT and miR-378a-5p, which was subsequently validated using a dual-luciferase reporter assay. Based on Figure 4b and c, the luciferase activity was prominently reduced in breast cancer cells with co-transfection of miR-378a-5p mimic and MIAT-WT, as compared with that in cells with co-transfection of the mimic control and MIAT-WT. Besides, no distinct difference was observed in the breast cancer cells after co-transfection of miR-378a-5p mimic/mimic control and MIAT-MUT. It indicated that MIAT can sponge miR-378a-5p. In addition, miR-378a-5p expression in breast cancer cells was notably increased after transfection of siMIAT while being decreased after transfection of miR-378a-5p inhibitor, when comparison was made with that after transfection of IC and siNC (Figure 5a and b). Meanwhile, it can be observed that the miR-378a-5p inhibitor reversed the enhancing effect of siMIAT on miR-378a-5p expression in cells (Figure 5a and b).

Figure 4 
                  MIAT can sponge miR-378a-5p. (a) The binding relationship between MIAT and miR-378a-5p was predicted by DIANA tools-LncBase Experimental V2. (b and c) The binding relationship between MIAT and miR-378a-5p was validated by a dual-luciferase reporter assay. ***
                     P < 0.001. M: miR-378a-5p mimic; MUT: mutant type; WT: wild type.
Figure 4

MIAT can sponge miR-378a-5p. (a) The binding relationship between MIAT and miR-378a-5p was predicted by DIANA tools-LncBase Experimental V2. (b and c) The binding relationship between MIAT and miR-378a-5p was validated by a dual-luciferase reporter assay. *** P < 0.001. M: miR-378a-5p mimic; MUT: mutant type; WT: wild type.

Figure 5 
                  miR-378a-5p inhibitor counteracted the effects of siMIAT on breast cancer cell viability and proliferation. (a and b) The expression of miR-378a-5p in MDA-MB-231 and SK-BR-3 cells after transfection was examined by qRT-PCR, and U6 was applied as a reference gene. (c and d) The viability of MDA-MB-231 and SK-BR-3 cells after transfection was examined by the CCK-8 assay. (e–h) The proliferation abilities of MDA-MB-231 and SK-BR-3 cells after transfection were evaluated by a colony formation assay. *
                     P < 0.05, **
                     P < 0.01, ***
                     P < 0.001. I: miR-378a-5p inhibitor; IC: inhibitor control; siMIAT: small interfering RNA targeting MIAT; siNC: negative control for siRNA.
Figure 5

miR-378a-5p inhibitor counteracted the effects of siMIAT on breast cancer cell viability and proliferation. (a and b) The expression of miR-378a-5p in MDA-MB-231 and SK-BR-3 cells after transfection was examined by qRT-PCR, and U6 was applied as a reference gene. (c and d) The viability of MDA-MB-231 and SK-BR-3 cells after transfection was examined by the CCK-8 assay. (e–h) The proliferation abilities of MDA-MB-231 and SK-BR-3 cells after transfection were evaluated by a colony formation assay. * P < 0.05, ** P < 0.01, *** P < 0.001. I: miR-378a-5p inhibitor; IC: inhibitor control; siMIAT: small interfering RNA targeting MIAT; siNC: negative control for siRNA.

3.4 miR-378a-5p inhibitor counteracted the effects of siMIAT on viability, proliferation, and the expressions of apoptosis-related proteins in breast cancer cells

The effects of miR-378a-5p on the breast cancer cells were detected. The results demonstrated that siMIAT suppressed but miR-378a-5p inhibitor promoted the breast cancer cell viability and proliferation, as compared with the IC and siNC (Figure 5c–h). Besides, the miR-378a-5p inhibitor offset the suppressive effect of siMIAT on cell viability and proliferation (Figure 5c–h). The experimental data from Western blot also illustrated that the miR-378a-5p inhibitor inhibited Bax and cleaved caspase-3 expressions while promoting Bcl-2 expression (Figure 6a–h). Similarly, miR-378a-5p inhibitors also neutralized the effect of siMIAT on these expressions of apoptosis-related proteins in breast cancer cells (Figure 6a–h).

Figure 6 
                  miR-378a-5p inhibitor reversed the effects of siMIAT on the expressions of apoptosis-related proteins in breast cancer cells. (a–d) The expressions of Bax, and Bcl-2 in MDA-MB-231 and SK-BR-3 cells after transfection were tested by Western blot, and GAPDH was utilized as an internal loading control. (e–h) The expressions of caspase-3 and cleaved caspase-3 in MDA-MB-231 and SK-BR-3 cells after transfection were determined by Western blot, and GAPDH was employed as an internal loading control. *
                     P < 0.05, **
                     P < 0.01, ***
                     P < 0.001. I: miR-378a-5p inhibitor; IC: inhibitor control; siMIAT: small interfering RNA targeting MIAT; siNC: negative control for siRNA.
Figure 6

miR-378a-5p inhibitor reversed the effects of siMIAT on the expressions of apoptosis-related proteins in breast cancer cells. (a–d) The expressions of Bax, and Bcl-2 in MDA-MB-231 and SK-BR-3 cells after transfection were tested by Western blot, and GAPDH was utilized as an internal loading control. (e–h) The expressions of caspase-3 and cleaved caspase-3 in MDA-MB-231 and SK-BR-3 cells after transfection were determined by Western blot, and GAPDH was employed as an internal loading control. * P < 0.05, ** P < 0.01, *** P < 0.001. I: miR-378a-5p inhibitor; IC: inhibitor control; siMIAT: small interfering RNA targeting MIAT; siNC: negative control for siRNA.

3.5 miR-378a-5p expression was downregulated in breast cancer tissues and negatively correlated with MIAT expression

The expression of miR-378a-5p in breast cancer tissues was measured, and we discovered that miR-378a-5p expression was diminished in breast cancer tissues relative to that in human normal tissues (Figure 7a). After analyzing the relationship between miR-378a-5p and MIAT expressions in breast cancer tissues and normal tissues, we further found that their expressions were evidently negatively correlated (Figure 7b and c).

Figure 7 
                  miR-378a-5p expression was downregulated in breast cancer tissues and negatively correlated with MIAT expression. (a) The expression of miR-378a-5p in breast cancer tissues was quantified by qRT-PCR, and U6 was used as a reference gene. (b and c) The expression relationship between MIAT and miR-378a-5p in breast cancer tissue samples and normal tissues was analyzed.
Figure 7

miR-378a-5p expression was downregulated in breast cancer tissues and negatively correlated with MIAT expression. (a) The expression of miR-378a-5p in breast cancer tissues was quantified by qRT-PCR, and U6 was used as a reference gene. (b and c) The expression relationship between MIAT and miR-378a-5p in breast cancer tissue samples and normal tissues was analyzed.

4 Discussion

At present, patients with breast cancer usually require surgical treatment to remove the tumor [26], and drugs or X-rays are also commonly used to destruct cancer cells in clinical practice [27,28]. However, the development mechanism of breast cancer is complex, and breast cancer has become one of the malignant tumors that are difficult to be cured due to its easy metastasis [29,30]. Substantial evidence has revealed that lncRNAs play key roles in tumor cell proliferation, apoptosis, etc., and their abnormal expressions have a certain relationship with tumor malignant grade, histological differentiation, and lymph node metastasis [9,31,32]. Thus, lncRNAs can act as potential biomarkers in the prognosis and diagnosis of assorted tumors [33].

MIAT has been proved to be highly expressed in breast cancer, and its aberrant expression is implicated in the clinical characteristics of patients with breast cancer [34]. Similarly, MIAT expression is upregulated in high-grade breast tumors, as well as ER- and Her2-positive tumor tissues [14]. Besides, MIAT expression is higher in ER-positive breast cancer tissues than in ER-negative tissues, and MIAT promotes estrogen-induced proliferation of ER-positive breast cancer cells [35]. In addition, MIAT is highly expressed in P53-negative cells (WTK1 cells) [36]. Consistent with what has been reported in previous studies, in this research, we found that the expression of MIAT was enhanced in breast cancer tissues and cells and that highly expressed MIAT was associated with multiple clinical characteristics of patients, including age, tumor size, low grade, ER status, HER2 status, P53 status, and tumor stage. These results indicate that MIAT can be applied to predict the degree of malignancy of breast tumors. Collectively, MIAT was found to be involved in regulating the development of breast cancer, but its specific role still needed further exploration.

Cancer-related death is mainly attributed to metastasis, and lncRNAs are involved in regulating a variety of physiological behaviors of cancer cells, including proliferation, migration, and apoptosis [37,38]. In gastric cancer, MIAT promotes the metastasis of cancer cells by mediating the expression of miR-141 [39]; in ovarian cancer, MIAT is involved in modulating the invasive process of cancer cells [40]; and in breast cancer cells, lncRNA TINCR and MIAT can regulate cell invasion, proliferation, and apoptosis [41,42]. Moreover, suppression of MIAT can cause G1 arrest in breast cancer cells, and MIAT may participate in tumorigenesis via regulation of the cell cycle [14,15,35]. Analogous to these findings, our experimental results uncovered that inhibition of MIAT reduced breast cancer cell viability and proliferation, but further verification still needed to be conducted at the molecular level.

Members of the Bcl-2 protein family play crucial roles in the process of apoptosis [43]. The Bcl-2 family can be divided into two major categories: one with anti-apoptotic effects (such as Bcl-2 and Bcl-W) and the other with pro-apoptotic effects (Bax, Bak, Bcl-XS, etc.) [43,44,45]. Caspases belong to the family of cysteine proteases and are key mediators of apoptosis [46]. Cleaved caspase-3 is an activated form of caspase-3, and high expression of cleaved caspase-3 in cells promotes apoptosis [47]. Our experiments demonstrated that siMIAT may promote the apoptosis of breast cancer cells by regulating the expressions of apoptosis-related proteins. These results provided a mechanistic basis to fathom the interaction between MIAT and miR-378a-5p in breast cancer.

As previously documented, miR-378a-5p impacts the physiological behaviors of oral squamous cell carcinoma cells and colorectal cancer cells, such as migration, angiogenesis, and apoptosis [19,20], and its expression was low in both colorectal and breast cancer cells. In triple-negative breast cancer cells, lncRNA GAS5 promotes cancer cell apoptosis by targeting miR-378a-5p, and the targeting relationship of miR-378a-5p and cyclin G2 has been confirmed by luciferase reporter assay in BeWo cells [18,20,21,48]. On this basis, this research further unveiled that miR-378a-5p expression was regulated by MIAT and that miR-378a-5p inhibitor countervailed the effects of siMIAT on the viability, proliferation, and expressions of apoptosis-related proteins in breast cancer cells. It can be concluded that MIAT silencing inhibits the viability and proliferation of breast cancer cells by promoting the expression of miR-378a-5p.

In conclusion, this research confirms that MIAT is highly expressed but miR-378a-5p expression is low in breast cancer cells, and MIAT silencing inhibits the viability and proliferation of breast cancer cells by promoting the expression of miR-378a-5p. These results, to some extent, unveil an underlying molecular mechanism of breast cancer development and provide potential new targets for the treatment of breast cancer.

  1. Funding information: This study did not receive any funding.

  2. Conflict of interest: The authors declare that there are no conflicts of interest.

  3. Data availability statement: The analyzed data sets generated during the study are available from the corresponding author on reasonable request.

References

[1] Manning L, Holmes J, Bonin K, Vidi PA. Radial profile analysis of epithelial polarity in breast acini: a tool for primary (breast) cancer prevention. Front Med (Lausanne). 2019;6:314.10.3389/fmed.2019.00314Search in Google Scholar PubMed PubMed Central

[2] Li X, Zeng Z, Wang J, Wu Y, Chen W, Zheng L, et al. MicroRNA-9 and breast cancer. Biomed Pharmacother. 2020;122:109687.10.1016/j.biopha.2019.109687Search in Google Scholar PubMed

[3] Milosevic M, Jankovic D, Milenkovic A, Stojanov D. Early diagnosis and detection of breast cancer. Technol Health Care. 2018;26(4):729–59.10.3233/THC-181277Search in Google Scholar PubMed

[4] Leon-Ferre RA, Majithia N, Loprinzi CL. Management of hot flashes in women with breast cancer receiving ovarian function suppression. Cancer Treat Rev. 2017;52:82–90.10.1016/j.ctrv.2016.11.012Search in Google Scholar PubMed

[5] Manca G, Tardelli E, Rubello D, Gennaro M, Marzola MC, Cook GJ, et al. Sentinel lymph node biopsy in breast cancer: a technical and clinical appraisal. Nucl Med Commun. 2016;37(6):570–6.10.1097/MNM.0000000000000489Search in Google Scholar PubMed

[6] Engel J, Weichert W, Jung A, Emeny R, Holzel D. Lymph node infiltration, parallel metastasis and treatment success in breast cancer. Breast. 2019;48:1–6.10.1016/j.breast.2019.07.008Search in Google Scholar PubMed

[7] Nagini S. Breast cancer: current molecular therapeutic targets and new players. Anticancer Agents Med Chem. 2017;17(2):152–63.10.2174/1871520616666160502122724Search in Google Scholar PubMed

[8] Li J, Jiang X, Li Z, Huang L, Zhou Y, Liu Y, et al. Long noncoding RNA GHET1 in human cancer. Clin Chim Acta. 2019;488:111–5.10.1016/j.cca.2018.11.007Search in Google Scholar PubMed

[9] Bhan A, Soleimani M, Mandal SS. Long noncoding RNA and cancer: a new paradigm. Cancer Res. 2017;77(15):3965–81.10.1158/0008-5472.CAN-16-2634Search in Google Scholar PubMed PubMed Central

[10] Ishii N, Ozaki K, Sato H, Mizuno H, Susumu S, Takahashi A, et al. Identification of a novel non-coding RNA, MIAT, that confers risk of myocardial infarction. J Hum Genet. 2006;51(12):1087–99.10.1007/s10038-006-0070-9Search in Google Scholar PubMed

[11] Liu W, Wang Z, Wang C, Ai Z. Long non-coding RNA MIAT promotes papillary thyroid cancer progression through upregulating LASP1. Cancer Cell Int. 2019;19:194.10.1186/s12935-019-0913-zSearch in Google Scholar PubMed PubMed Central

[12] Li DS, Ainiwaer JL, Sheyhiding I, Zhang Z, Zhang LW. Identification of key long non-coding RNAs as competing endogenous RNAs for miRNA-mRNA in lung adenocarcinoma. Eur Rev Med Pharmacol Sci. 2016;20(11):2285–95.Search in Google Scholar

[13] Crea F, Venalainen E, Ci X, Cheng H, Pikor L, Parolia A, et al. The role of epigenetics and long noncoding RNA MIAT in neuroendocrine prostate cancer. Epigenomics. 2016;8(5):721–31.10.2217/epi.16.6Search in Google Scholar PubMed

[14] Alipoor FJ, Asadi MH, Torkzadeh-Mahani M. MIAT lncRNA is overexpressed in breast cancer and its inhibition triggers senescence and G1 arrest in MCF7 cell line. J Cell Biochem. 2018;119(8):6470–81.10.1002/jcb.26678Search in Google Scholar PubMed

[15] Almnaseer ZA, Mourtada-Maarabouni M. Long noncoding RNA MIAT regulates apoptosis and the apoptotic response to chemotherapeutic agents in breast cancer cell lines. Biosci Rep. 2018;38(4):BSR20180704.10.1042/BSR20180704Search in Google Scholar PubMed PubMed Central

[16] Zhao W, Geng D, Li S, Chen Z, Sun M. LncRNA HOTAIR influences cell growth, migration, invasion, and apoptosis via the miR-20a-5p/HMGA2 axis in breast cancer. Cancer Med. 2018;7(3):842–55.10.1002/cam4.1353Search in Google Scholar PubMed PubMed Central

[17] Zhen Q, Gao LN, Wang RF, Chu WW, Zhang YX, Zhao XJ, et al. LncRNA DANCR promotes lung cancer by sequestering miR-216a. Cancer Control. 2018;25(1):1073274818769849.10.1177/1073274818769849Search in Google Scholar PubMed PubMed Central

[18] Zheng S, Li M, Miao K, Xu H. lncRNA GAS5-promoted apoptosis in triple-negative breast cancer by targeting miR-378a-5p/SUFU signaling. J Cell Biochem. 2020;121(3):2225–35.10.1002/jcb.29445Search in Google Scholar PubMed

[19] Cui Z, Liu QL, Sun SQ, Jiao K, Liu DR, Zhou XC, et al. MiR-378a-5p inhibits angiogenesis of oral squamous cell carcinoma by targeting KLK4. Neoplasma. 2020;67(1):85–92.10.4149/neo_2019_190306N191Search in Google Scholar PubMed

[20] Li H, Dai S, Zhen T, Shi H, Zhang F, Yang Y, et al. Clinical and biological significance of miR-378a-3p and miR-378a-5p in colorectal cancer. Eur J Cancer. 2014;50(6):1207–21.10.1016/j.ejca.2013.12.010Search in Google Scholar PubMed

[21] Winsel S, Maki-Jouppila J, Tambe M, Aure MR, Pruikkonen S, Salmela AL, et al. Excess of miRNA-378a-5p perturbs mitotic fidelity and correlates with breast cancer tumourigenesis in vivo. Br J Cancer. 2014;111(11):2142–51.10.1038/bjc.2014.524Search in Google Scholar PubMed PubMed Central

[22] Shen Y, Dong LF, Zhou RM, Yao J, Song YC, Yang H, et al. Role of long non-coding RNA MIAT in proliferation, apoptosis and migration of lens epithelial cells: a clinical and in vitro study. J Cell Mol Med. 2016;20(3):537–48.10.1111/jcmm.12755Search in Google Scholar PubMed PubMed Central

[23] Goldar S, Khaniani MS, Derakhshan SM, Baradaran B. Molecular mechanisms of apoptosis and roles in cancer development and treatment. Asian Pac J Cancer Prev. 2015;16(6):2129–44.10.7314/APJCP.2015.16.6.2129Search in Google Scholar PubMed

[24] Wong RS. Apoptosis in cancer: from pathogenesis to treatment. J Exp Clin Cancer Res. 2011;30(1):87.10.1186/1756-9966-30-87Search in Google Scholar PubMed PubMed Central

[25] Warren CFA, Wong-Brown MW, Bowden NA. BCL-2 family isoforms in apoptosis and cancer. Cell Death Dis. 2019;10(3):177.10.1038/s41419-019-1407-6Search in Google Scholar PubMed PubMed Central

[26] Jonczyk MM, Jean J, Graham R, Chatterjee A. Surgical trends in breast cancer: a rise in novel operative treatment options over a 12 year analysis. Breast Cancer Res Treat. 2019;173(2):267–74.10.1007/s10549-018-5018-1Search in Google Scholar PubMed PubMed Central

[27] Arslan C, Altundag K, Dizdar O. Emerging drugs in metastatic breast cancer: an update. Expert Opin Emerg Drugs. 2011;16(4):647–67.10.1517/14728214.2011.640672Search in Google Scholar PubMed

[28] Merino Bonilla JA, Torres Tabanera M, Ros Mendoza LH. Breast cancer in the 21st century: from early detection to new therapies. Radiologia. 2017;59(5):368–79.10.1016/j.rxeng.2017.08.001Search in Google Scholar

[29] Wen C, Wu L, Fu L, Wang B, Zhou H. Unifying mechanism in the initiation of breast cancer by metabolism of estrogen (Review). Mol Med Rep. 2017;16(2):1001–6.10.3892/mmr.2017.6738Search in Google Scholar PubMed

[30] Scully OJ, Bay BH, Yip G, Yu Y. Breast cancer metastasis. Cancer Genomics Proteom. 2012;9(5):311–20.Search in Google Scholar

[31] Lim LJ, Wong SYS, Huang F, Lim S, Chong SS, Ooi LL, et al. Roles and regulation of long noncoding RNAs in hepatocellular carcinoma. Cancer Res. 2019;79(20):5131–9.10.1158/0008-5472.CAN-19-0255Search in Google Scholar PubMed

[32] Ji D, Zhong X, Jiang X, Leng K, Xu Y, Li Z, et al. The role of long non-coding RNA AFAP1-AS1 in human malignant tumors. Pathol Res Pract. 2018;214(10):1524–31.10.1016/j.prp.2018.08.014Search in Google Scholar PubMed

[33] Fan CN, Ma L, Liu N. Systematic analysis of lncRNA-miRNA-mRNA competing endogenous RNA network identifies four-lncRNA signature as a prognostic biomarker for breast cancer. J Transl Med. 2018;16(1):264.10.1186/s12967-018-1640-2Search in Google Scholar PubMed PubMed Central

[34] Tang J, Ren J, Cui Q, Zhang D, Kong D, Liao X, et al. A prognostic 10-lncRNA expression signature for predicting the risk of tumour recurrence in breast cancer patients. J Cell Mol Med. 2019;23(10):6775–84.10.1111/jcmm.14556Search in Google Scholar PubMed PubMed Central

[35] Li Y, Jiang B, Wu X, Huang Q, Chen W, Zhu H, et al. Long non-coding RNA MIAT is estrogen-responsive and promotes estrogen-induced proliferation in ER-positive breast cancer cells. Biochem Biophys Res Commun. 2018;503(1):45–50.10.1016/j.bbrc.2018.05.146Search in Google Scholar PubMed

[36] Chaudhry MA. Expression pattern of small nucleolar RNA host genes and long non-coding RNA in X-rays-treated lymphoblastoid cells. Int J Mol Sci. 2013;14(5):9099–110.10.3390/ijms14059099Search in Google Scholar PubMed PubMed Central

[37] Gilkes DM, Semenza GL, Wirtz D. Hypoxia and the extracellular matrix: drivers of tumour metastasis. Nat Rev Cancer. 2014;14(6):430–9.10.1038/nrc3726Search in Google Scholar PubMed PubMed Central

[38] Wang AH, Fan WJ, Fu L, Wang XT. LncRNA PCAT-1 regulated cell proliferation, invasion, migration and apoptosis in colorectal cancer through targeting miR-149-5p. Eur Rev Med Pharmacol Sci. 2019;23(19):8310–20.Search in Google Scholar

[39] Sha M, Lin M, Wang J, Ye J, Xu J, Xu N, et al. Long non-coding RNA MIAT promotes gastric cancer growth and metastasis through regulation of miR-141/DDX5 pathway. J Exp Clin Cancer Res. 2018;37(1):58.10.1186/s13046-018-0725-3Search in Google Scholar PubMed PubMed Central

[40] Zhou S, Xu A, Song T, Gao F, Sun H, Kong X. lncRNA MIAT regulates cell growth, migration, and invasion through sponging miR-150-5p in ovarian cancer. Cancer Biother Radiopharm. 2020;35(9):650–60.10.1089/cbr.2019.3259Search in Google Scholar PubMed

[41] Guo F, Zhu X, Zhao Q, Huang Q. miR5893p sponged by the lncRNA TINCR inhibits the proliferation, migration and invasion and promotes the apoptosis of breast cancer cells by suppressing the Akt pathway via IGF1R. Int J Mol Med. 2020;46(3):989–1002.10.3892/ijmm.2020.4666Search in Google Scholar PubMed PubMed Central

[42] Luan T, Zhang X, Wang S, Song Y, Zhou S, Lin J, et al. Long non-coding RNA MIAT promotes breast cancer progression and functions as ceRNA to regulate DUSP7 expression by sponging miR-155-5p. Oncotarget. 2017;8(44):76153–64.10.18632/oncotarget.19190Search in Google Scholar PubMed PubMed Central

[43] Dietrich JB. Apoptosis and anti-apoptosis genes in the Bcl-2 family. Arch Physiol Biochem. 1997;105(2):125–35.10.1076/apab.105.2.125.12927Search in Google Scholar PubMed

[44] Tse C, Shoemaker AR, Adickes J, Anderson MG, Chen J, Jin S, et al. ABT-263: a potent and orally bioavailable Bcl-2 family inhibitor. Cancer Res. 2008;68(9):3421–8.10.1158/0008-5472.CAN-07-5836Search in Google Scholar PubMed

[45] Moldoveanu T, Czabotar PE. BAX, BAK, and BOK: a coming of age for the BCL-2 family effector proteins. Cold Spring Harb Perspect Biol. 2020;12(4):a036319.10.1101/cshperspect.a036319Search in Google Scholar PubMed PubMed Central

[46] Chowdhury I, Tharakan B, Bhat GK. Current concepts in apoptosis: the physiological suicide program revisited. Cell Mol Biol Lett. 2006;11(4):506–25.10.2478/s11658-006-0041-3Search in Google Scholar PubMed PubMed Central

[47] Kavanagh E, Rodhe J, Burguillos MA, Venero JL, Joseph B. Regulation of caspase-3 processing by cIAP2 controls the switch between pro-inflammatory activation and cell death in microglia. Cell Death Dis. 2014;5:e1565.10.1038/cddis.2014.514Search in Google Scholar PubMed PubMed Central

[48] Nadeem U, Ye G, Salem M, Peng C. MicroRNA-378a-5p targets cyclin G2 to inhibit fusion and differentiation in BeWo cells. Biol Reprod. 2014;91(3):76.10.1095/biolreprod.114.119065Search in Google Scholar PubMed

Received: 2022-05-24
Revised: 2023-01-10
Accepted: 2023-02-06
Published Online: 2023-04-03

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Downloaded on 8.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0676/html
Scroll to top button