Home Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
Article Open Access

Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B

  • Xiaogang Huang , Xiongzhi He , Rongxian Qiu , Xuemei Xie , Fengfeng Zheng , Feihua Chen and Zhenting Hu EMAIL logo
Published/Copyright: June 16, 2023
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 18 Issue 1

Abstract

Unfolded protein response (UPR) plays an important role in the pathogenesis of many liver diseases. BMI1 has a liver protection effect, but whether it participates in the regulation of hepatocyte death through UPR is not well defined. Herein, the endoplasmic reticulum stress model was established by inducing hepatocyte line (MIHA) with tunicamycin (TM, 5 µg/ml). Cell counting kit-8 assay and flow cytometry were used to evaluate the viability and apoptosis of hepatocytes. The expression levels of BMI1, KAT2B, and proteins related to UPR (p-eIF2α, eIF2α, ATF4, and ATF6), NF-κB (p65 and p-p65), apoptosis (cleaved caspase-3, bcl-2, and bax) and necroptosis (p-MLKL and MLKL) were determined by Western blot. The relationship between KAT2B and BMI1 was determined by co-immunoprecipitation and ubiquitination assay. The results showed that TM not only promoted UPR, apoptosis, and necroptosis in hepatocytes but also upregulated the expression levels of BMI1 and KAT2B and activated NF-κB pathway. BAY-117082 reversed the effects of TM on viability, apoptosis, NF-κB pathway, and BMI1 but strengthened the effects of TM on KAT2B/MLKL-mediated necroptosis. BMI1 promoted the ubiquitination of KAT2B, and BMI1 overexpression reversed the effects of TM on viability, apoptosis, and KAT2B/MLKL-mediated necroptosis. In summary, overexpression of BMI1 promotes the ubiquitination of KAT2B to block the MLKL-mediated necroptosis of hepatocytes.

Keywords: hepatocytes; necroptosis; unfolded protein response; B cell-specific Moloney MLV insertion site-1; KAT2B

1 Introduction

The liver is the largest biological metabolic organ in the body, and hepatocytes are the main cells to maintain the function and shape of the liver. Due to the particularity of the anatomical location and function, the liver is vulnerable to viruses, exogenous substances, and endogenous metabolites, resulting in damaged hepatocytes, which is the common pathophysiological basis of assorted liver lesions, and the main cause of liver dysfunction [1,2]. A previous study has found that irreversible damage of hepatocytes will lead to hepatocyte death, including apoptosis and necroptosis, which is a key event in the progression of liver disease [3]. Therefore, improving the anti-injury ability of hepatocytes, reducing hepatocyte death, and promoting injury repair are important strategies for alleviating and preventing liver failure.

The accumulated evidence indicates that endoplasmic reticulum (ER) stress plays an important role in the pathogenesis of many liver diseases [4]. ER is a key organelle for the synthesis of protein and lipids. When the homeostasis of ER is disturbed, misfolded protein will accumulate, leading to ER stress [5]. ER stress will trigger the unfolded protein response (UPR) to restore ER homeostasis [6]. UPR can prevent the synthesis of protein in ER and promote the degradation of protein through activating transcription factor 6 (ATF6) and phosphorylated eukaryotic translational initiation factor 2 alpha (eIF2α), thus promoting cell survival [7]. Tian et al. reported that the phosphorylation of eIF2α mitigates ER stress and hepatocyte necroptosis in acute liver injury [8]. However, more mechanisms by which UPR reduces hepatocyte death remain to be elucidated.

In our preliminary study, we found that UPR upregulated the protein expression of B cell-specific Moloney MLV insertion site-1 (BMI1) in the hepatocytes, which might be related to the activation of NF-κB pathway induced by UPR [9], as this pathway has been proved to upregulate BMI1 level [10]. BMI1 is a key transcription inhibitor that regulates gene expression during hematopoietic development [11]. Also, a prior research has reported that the loss of BMI1 can cause liver damage, so BMI1 may play a role in liver protection [12]. In addition, through bioinformatics analysis, we predicted that BMI1 is the ubiquitination-modified protein of lysine acetyltransferase 2B (KAT2B). KAT2B has been shown to mediate mixed lineage kinase domain-like pseudokinase (MLKL)-dependent necroptosis [13]. However, it is unclear whether the mechanism of UPR protecting hepatocytes is implicated in the regulation of KAT2B/MLKL-mediated necroptosis. To this end, this study probed into the relationship between UPR-mediated BMI1 upregulation and KAT2B/MLKL-mediated necroptosis during ER stress in hepatocytes.

2 Materials and methods

2.1 Cell culture

Human normal hepatocytes MIHA (CL0469; Fenghuishengwu, China) were maintained in RPMI-1640 medium (IMC-202; Immocell, China) supplemented with 10% fetal bovine serum (FBS, IMC-101; Immocell) and Penicillin-Streptomycin Solution (IMC-601; Immocell) at 37°C under the humidified air with 5% CO2.

2.2 Bioinformatics analysis

The interaction between KAT2B and BMI1 was predicted by ubibrowser (http://ubibrowser.ncpsb.org.cn).

2.3 Transfection

BMI1 overexpression plasmid (oe-BMI1, F105834) and its negative control (NC, pcDNA3.1-3xFlag) were purchased from YouBio (China). The BMI1-specific short hairpin RNA (shBMI1, target sequences: ATTGATGCCACAACCATAATA) and the empty vector (shNC) were ordered from VectorBuilder (China). To achieve transfection, the transfection reagent (L3000150; ThermoFisher, USA) and plasmid or shRNA were separately diluted with Opti-MEM (11058021; ThermoFisher), mixed, and then added to the cells for incubation. Following 24 h, the cells were subjected to quantitative reverse transcription polymerase chain reaction (qRT-PCR) to verify the transfection efficiency.

2.4 Grouping

This study was divided into three parts. In the first part, the cells were treated with Tunicamycin (TM, 5 µg/ml, HY-A0098; MedChemExpress, China) for 0, 12, 24, and 48 h, and then, the cell viability was assayed by cell counting kit-8 (CCK-8) [14]. TM treatment for 48 h was selected for the subsequent experiment to evaluate the effect of TM on MIHA cells. In the second part, cells were pretreated with NF-κB inhibitor BAY-117082 (10 µM, HY-13453; MedChemExpress) for 1 h and then received TM (5 µg/ml) treatment for 0, 12, 24, and 48 h, subsequent to which the cell viability was measured by CCK-8 [15]. In the subsequent experiments, cells were pretreated with BAY-117082 for 1 h and then treated with TM for 48 h. In the third part, the cells transfected with oe-BMI1, NC, shNC, or shBMI1 were further treated with TM (5 µg/ml) for 0, 12, 24, and 48 h, whose viability was then tested by CCK-8. In subsequent experiments, the transfected cells underwent 48 h of TM treatment.

2.5 Cell viability

CCK-8 kit (K1018, Apexbio, China) was applied to evaluate the viability of treated MIHA cells. Briefly, cells were inoculated in a 96-well plate (3,000 per well). After 24 h of incubation, the cells were treated in different ways for different times and then reacted with CCK-8 reagent for 2 h. Lastly, the absorbance at 450 nm was detected by a microplate reader (CMaxPlus, MD, China).

2.6 Western blot

Whole-cell lysates were prepared by RIPA lysis buffer (YT612; Bjbalb, China). Total proteins were quantified by BCA kit (BTN80815; Bjbalb), loaded onto SDS-PAGE electrophoresis, and later transferred to nitrocellulose membranes (P2110; Applygen, China). Afterwards, nonspecific binding was blocked with 5% skim milk, and the membranes were incubated with primary antibodies at 4°C overnight and probed with secondary antibodies (Table 1) at room temperature. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal reference. Eventually, immunoreactions were detected by ECL reagent (CW0048; CWBIO, China) and visualized in the ChemiDoc™ XRS plus imaging System (Bio-Rad, USA).

Table 1

Antibodies used in this study

Name Catalog Molecular weight (kDa) Dilution Manufacturer
p-eIF2α #3398 38 1/1,000 Cell Signaling Technology, USA
eIF2α #5324 38 1/1,000 Cell Signaling Technology, USA
ATF4 ab184909 50 1/1,000 Abcam, UK
ATF6 ab122897 75 1/1,000 Abcam, UK
P65 ab32536 65 1/1,000 Abcam, UK
p-p65 ab76302 65 1/1,000 Abcam, UK
BMI1 ab126783 40 1/10,000 Abcam, UK
KAT2B ab12188 93 1/1,000 Abcam, UK
p-MLKL ab187091 54 1/1,000 Abcam, UK
MLKL ab184718 54 1/1,000 Abcam, UK
Bcl-2 ab32124 26 1/1,000 Abcam, UK
Bax ab32503 21 1/1,000 Abcam, UK
Cleaved caspase-3 ab32042 17 1/500 Abcam, UK
GAPDH ab8245 36 1/10,000 Abcam, UK
Goat anti-rabbit ab205718 — 1/2,000 Abcam, UK
Goat anti-mouse ab205719 — 1/2,000 Abcam, UK

2.7 Cell apoptosis

Annexin V-FITC/PI kit (abs5001; absin, China) was employed to analyze the apoptotic cells. In a nutshell, the treated MIHA cells were gently suspended in the binding buffer to prepare cell suspension with the concentration of 1 × 106 cells/ml. Thereafter, Annexin V-FITC and propidium iodide were sequentially added to the cell suspension for 20 min of reaction. Ultimately, the apoptotic cells were detected by a flow cytometer (NL-3000; CYTEK, USA).

2.8 qRT-PCR

Total RNA was isolated from MIHA cells using RNA Extraction Reagent (19201ES60; YEASEN, China). Then, the isolated RNA was reversely transcribed into cDNA using a cDNA Synthesis Kit (11119ES60; YEASEN). Subsequently, qPCR was performed by SYBR Green qPCR Mix (11198ES03; YEASEN) in a real-time PCR system (ABI 7300; ABI, USA). The primer sequences are listed below: BMI1-forward: 5′-AGATCGGGGCGAGACAATG-3′, reverse: 5′-TTTTATTCTGCGGGGCTGGG-3′; GAPDH-forward: 5′-GTCTCCTCTGACTTCAACAGCG-3′, reverse: 5′-ACCACCCTGTTGCTGTAGCCAA-3′. The expression values were normalized to GAPDH using the 2−ΔΔCT method [16].

2.9 Co-Immunoprecipitation (co-IP)

The interaction between BMI1 and KAT2B was verified by co-IP kit (Bes3011; BersinBio, China). Briefly, cell lysates were prepared in RIPA buffer and centrifuged at 13,000 × g for 10 min to obtain the supernatant. Part of the supernatant was utilized as input and the remaining was used for IP. The protein was then incubated with anti-KAT2B antibody (Table 1) or anti-IgG antibody (in the co-IP kit) overnight. Thereafter, the proteins were immunoprecipitated by Protein A/G beads and the precipitated proteins were subjected to the detection of Western blot.

2.10 Ubiquitination assay

The ubiquitination level of KAT2B was determined by Ubiquitination detection Kit (BK161; Cytoskeleton, USA) as previously described [17]. In short, cells transfected with shNC or shBMI1 were treated with 20 μM MG132 (HY-13259; MedChemExpress) for 4 h and then lysed with lysis buffer. Subsequently, the lysate was incubated with ubiquitination affinity bead suspension. The beads were washed with washing buffer and samples were eluted. Subsequent standard Western blot procedures were performed using the indicated antibodies.

2.11 Statistical analysis

The measurement data were presented as mean ± standard deviation. One-way analysis of variance was adopted for comparison among multiple groups, followed by post hoc Bonferroni. Two groups were compared through independent-samples t-test. All statistical analyses were implemented with Graphpad 8.0 software (California, USA), and P-values less than 0.05 were considered to be statistically significant.

3 Results

3.1 TM induced apoptosis and necroptosis of MIHA cells

After 12, 24, and 48 h of TM treatment, the cell viability was significantly reduced (Figure 1a, P < 0.05). To further evaluate the effect of TM on MIHA cells, MIHA cells underwent TM treatment for 48 h. We detected the effect of TM treatment on the expression levels of UPR-related proteins in MIHA cells by Western blot, and the results unveiled that TM increased the ratio of p-eIF2α/eIF2α as well as the protein levels of ATF4 and ATF6 (Figure 1b–d, P < 0.05). Furthermore, TM enhanced the apoptosis rate of MIHA cells (Figure 1e and f, P < 0.001). Next, we found that TM also promoted p-p65/p65 and p-MLKL/MLKL ratios and upregulated the protein expression levels of BMI1 and KAT2B in MIHA cells (Figure 1g–l, P < 0.01). These evidences indicated that TM could promote the activation of NF-κB pathway and KAT2B/MLKL pathway and upregulate the expression of BMI1 in MIHA cells.

Figure 1 TM induced apoptosis and necroptosis of MIHA cells. (a) The viability of MIHA cells treated with or without TM (5 µg/ml) was analyzed at 0, 12, 24, and 48 h by CCK-8 assay. (b–d) The protein levels of p-eIF2α, eIF2α, ATF4, and ATF6 in MIHA cells treated with or without TM (5 µg/ml) were determined by Western blot. (e and f) The apoptosis of MIHA cells treated with or without TM (5 µg/ml) was determined by flow cytometry. (g–i) The protein levels of p65, p-p65, and BMI1 in MIHA cells treated with or without TM (5 µg/ml) were assayed by Western blot. (j–l) The protein levels of KAT2B, p-MLKL, and MLKL in MIHA cells treated with or without TM (5 µg/ml) were tested by Western blot. GAPDH was used as the internal control. * P < 0.05, ** P < 0.01, *** P < 0.001 vs control. Quantified values were presented as mean ± standard deviation of at least three independent experiments. TM: Tunicamycin. CCK-8: cell counting kit-8. GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
Figure 1

TM induced apoptosis and necroptosis of MIHA cells. (a) The viability of MIHA cells treated with or without TM (5 µg/ml) was analyzed at 0, 12, 24, and 48 h by CCK-8 assay. (b–d) The protein levels of p-eIF2α, eIF2α, ATF4, and ATF6 in MIHA cells treated with or without TM (5 µg/ml) were determined by Western blot. (e and f) The apoptosis of MIHA cells treated with or without TM (5 µg/ml) was determined by flow cytometry. (g–i) The protein levels of p65, p-p65, and BMI1 in MIHA cells treated with or without TM (5 µg/ml) were assayed by Western blot. (j–l) The protein levels of KAT2B, p-MLKL, and MLKL in MIHA cells treated with or without TM (5 µg/ml) were tested by Western blot. GAPDH was used as the internal control. * P < 0.05, ** P < 0.01, *** P < 0.001 vs control. Quantified values were presented as mean ± standard deviation of at least three independent experiments. TM: Tunicamycin. CCK-8: cell counting kit-8. GAPDH: glyceraldehyde-3-phosphate dehydrogenase.

3.2 NF-κB inhibitor blocked TM-induced apoptosis but enhanced TM-induced necroptosis

To verify whether the regulation of MIHA cells by TM was related to the NF-κB pathway, MIHA cells were pretreated with the NF-κB inhibitor BAY-117082 and then treated with TM. The results showed that BAY-117082 alone had no significant effect on cell viability and apoptosis, but it partially reversed the regulation of TM on cell viability and apoptosis (Figure 2a–c, P < 0.05). Furthermore, BAY-117082 decreased the p-p65/p65 ratio and BMI1 protein level and also reversed the regulation of TM on p-p65/p65 ratio and BMI1 protein expression (Figure 2d–f, P < 0.01). Interestingly, BAY-117082 did not significantly affect KAT2B expression level and p-MLKL/MLKL ratio, but it enhanced the promoting effect of TM on KAT2B expression level and p-MLKL/MLKL ratio (Figure 2g–i, P < 0.001).

Figure 2 TM induced apoptosis and necroptosis of MIHA cells through NF-κB pathway. The experiment was divided into four groups: cells in the control group were cultured normally; cells in the BAY-117082 group were treated with BAY-117082 (10 µM) for 1 h; cells in the TM group were treated with TM (5 µg/ml) for different times; and cells in the TM + BAY-117082 group were pretreated with BAY-117082 (10 µM) for 1 h and then treated with TM (5 µg/ml) for different times. (a) The viability of treated MIHA cells was analyzed at 0, 12, 24, and 48 h by CCK-8 assay. (b and c) The apoptosis of treated MIHA cells was analyzed by flow cytometry. (d–f) The protein levels of p65, p-p65, and BMI1 in treated MIHA cells were determined by Western blot. (g–i) The protein levels of KAT2B, p-MLKL, and MLKL in treated MIHA cells were examined by Western blot. GAPDH was applied as the internal control. ** P < 0.01, *** P < 0.001 vs control. ^^ P < 0.01, ^^^ P < 0.001 vs BAY-117082. # P < 0.05, ### P < 0.001 vs TM. Quantified values were presented as mean ± standard deviation of at least three independent experiments. TM: Tunicamycin. CCK-8: cell counting kit-8. GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
Figure 2

TM induced apoptosis and necroptosis of MIHA cells through NF-κB pathway. The experiment was divided into four groups: cells in the control group were cultured normally; cells in the BAY-117082 group were treated with BAY-117082 (10 µM) for 1 h; cells in the TM group were treated with TM (5 µg/ml) for different times; and cells in the TM + BAY-117082 group were pretreated with BAY-117082 (10 µM) for 1 h and then treated with TM (5 µg/ml) for different times. (a) The viability of treated MIHA cells was analyzed at 0, 12, 24, and 48 h by CCK-8 assay. (b and c) The apoptosis of treated MIHA cells was analyzed by flow cytometry. (d–f) The protein levels of p65, p-p65, and BMI1 in treated MIHA cells were determined by Western blot. (g–i) The protein levels of KAT2B, p-MLKL, and MLKL in treated MIHA cells were examined by Western blot. GAPDH was applied as the internal control. ** P < 0.01, *** P < 0.001 vs control. ^^ P < 0.01, ^^^ P < 0.001 vs BAY-117082. # P < 0.05, ### P < 0.001 vs TM. Quantified values were presented as mean ± standard deviation of at least three independent experiments. TM: Tunicamycin. CCK-8: cell counting kit-8. GAPDH: glyceraldehyde-3-phosphate dehydrogenase.

3.3 BMI1 overexpression reversed the effects of TM on apoptosis and necroptosis

To determine whether the effect of TM on MIHA cells is related to BMI1, we overexpressed and silenced BMI1 in MIHA cells. As per the detection results of qRT-PCR, shBMI1 presented the most obvious transfection efficiency among shBMI1, shBMI1#2, and shBMI1#3 (Figure 3a, P < 0.01). Also, it was found that oe-BMI1 reversed the effects of TM on the viability and apoptosis of MIHA cells, while shBMI1 further potentiated the inhibiting or promoting the impact of TM upon cell viability or apoptosis (Figure 3b–d, P < 0.05). In addition, the protein level of BMI1 increased by TM was further strengthened by oe-BMI1 but was reversed by shBMI1 (Figure 4a and b, P < 0.001). Furthermore, KAT2B protein level and p-MLKL/MLKL ratio regulated by TM were also reversed by oe-BMI1 but were strengthened by shBMI1 (Figure 4c–e, P < 0.05). Through the detection of apoptosis-related proteins, we found that TM inhibited the expression of Bcl-2, but increased the levels of Bax and cleaved caspase-3 (Figure 4f and g, P < 0.01). Similarly, the effects of TM on apoptosis-related proteins were also negated by oe-BMI1 and strengthened by shBMI1 (Figure 4f and g, P < 0.01).

Figure 3 BMI1 overexpression reversed the effects of TM on the viability and apoptosis of MIHA cells. (a) The transfection efficiency of BMI1 overexpression plasmid, shBMI1, shBMI1#2, and shBMI1#3 was determined by qRT-PCR. GAPDH was employed as the internal control. (b–d) MIHA cells were transfected with NC, BMI1 overexpression plasmid, shBMI1, or shNC and then were treated with TM (5 µg/ml) for different times. (b) The viability of treated MIHA cells was analyzed at 0, 12, 24, and 48 h by CCK-8 assay. (c and d) The apoptosis of treated MIHA cells was analyzed by flow cytometry. +++ P < 0.001 vs NC. ** P < 0.01, *** P < 0.001 vs control. & P < 0.05, && P < 0.01 vs shNC. ‡‡ P < 0.01, ‡‡‡ P < 0.001 vs TM + NC. ω P < 0.05, ωω P < 0.01, ωωω P < 0.001 vs TM + shNC. Quantified values were presented as mean ± standard deviation of at least three independent experiments. ShBMI1: BMI1-specific short hairpin RNA. NC: negative control. GAPDH: glyceraldehyde-3-phosphate dehydrogenase. TM: Tunicamycin. CCK-8: cell counting kit-8. qRT-PCR: quantitative reverse transcription polymerase chain reaction.
Figure 3

BMI1 overexpression reversed the effects of TM on the viability and apoptosis of MIHA cells. (a) The transfection efficiency of BMI1 overexpression plasmid, shBMI1, shBMI1#2, and shBMI1#3 was determined by qRT-PCR. GAPDH was employed as the internal control. (b–d) MIHA cells were transfected with NC, BMI1 overexpression plasmid, shBMI1, or shNC and then were treated with TM (5 µg/ml) for different times. (b) The viability of treated MIHA cells was analyzed at 0, 12, 24, and 48 h by CCK-8 assay. (c and d) The apoptosis of treated MIHA cells was analyzed by flow cytometry. +++ P < 0.001 vs NC. ** P < 0.01, *** P < 0.001 vs control. & P < 0.05, && P < 0.01 vs shNC. ‡‡ P < 0.01, ‡‡‡ P < 0.001 vs TM + NC. ω P < 0.05, ωω P < 0.01, ωωω P < 0.001 vs TM + shNC. Quantified values were presented as mean ± standard deviation of at least three independent experiments. ShBMI1: BMI1-specific short hairpin RNA. NC: negative control. GAPDH: glyceraldehyde-3-phosphate dehydrogenase. TM: Tunicamycin. CCK-8: cell counting kit-8. qRT-PCR: quantitative reverse transcription polymerase chain reaction.

Figure 4 BMI1 overexpression reversed the effects of TM on KAT2B/MLKL pathway-related proteins and apoptosis-related proteins in MIHA cells. MIHA cells were transfected with NC, BMI1 overexpression plasmid, shBMI1, or shNC and then were treated with TM (5 µg/ml) for 48 h. (a–e) The protein levels of BMI1, KAT2B, p-MLKL, and MLKL in treated MIHA cells were determined by Western blot. (f and g) The expression levels of apoptosis-related proteins (Bcl-2, Bax, and cleaved caspase-3) were determined by Western blot. GAPDH was exploited as the internal control. ** P < 0.01, *** P < 0.001 vs control. ‡ P < 0.05, ‡‡ P < 0.01, ‡‡‡ P < 0.001 vs TM + NC. ωωω P < 0.001 vs TM + shNC. Quantified values were presented as mean ± standard deviation of at least three independent experiments. ShBMI1: BMI1-specific short hairpin RNA. NC: negative control. GAPDH: glyceraldehyde-3-phosphate dehydrogenase. TM: Tunicamycin.
Figure 4

BMI1 overexpression reversed the effects of TM on KAT2B/MLKL pathway-related proteins and apoptosis-related proteins in MIHA cells. MIHA cells were transfected with NC, BMI1 overexpression plasmid, shBMI1, or shNC and then were treated with TM (5 µg/ml) for 48 h. (a–e) The protein levels of BMI1, KAT2B, p-MLKL, and MLKL in treated MIHA cells were determined by Western blot. (f and g) The expression levels of apoptosis-related proteins (Bcl-2, Bax, and cleaved caspase-3) were determined by Western blot. GAPDH was exploited as the internal control. ** P < 0.01, *** P < 0.001 vs control. ‡ P < 0.05, ‡‡ P < 0.01, ‡‡‡ P < 0.001 vs TM + NC. ωωω P < 0.001 vs TM + shNC. Quantified values were presented as mean ± standard deviation of at least three independent experiments. ShBMI1: BMI1-specific short hairpin RNA. NC: negative control. GAPDH: glyceraldehyde-3-phosphate dehydrogenase. TM: Tunicamycin.

3.4 MLKL knockdown reversed the effects of TM on apoptosis and necroptosis

To investigate whether MLKL plays a leading role in BMI1/KAT2B-involved necroptosis, shMLKL transfection, and TM treatment were performed in MIHA cells. Besides, the most prominent transfection efficiency of shMLKL was verified by qRT-PCR (Figure 5a, P < 0.001). Notably, MLKL knockdown reversed the effects of TM on the viability (Figure 5b, P < 0.05) and apoptosis (Figure 5c and d, P < 0.001) of MIHA cells. However, MLKL knockdown did not affect the effects of TM on the protein level of KAT2B but reduced p-MLKL/MLKL ratio (Figure 6a–c, P < 0.001). Furthermore, we found that TM inhibited the expression of Bcl-2 but promoted the expression levels of Bax and cleaved caspase-3 (Figure 6d and e, P < 0.001). Similarly, the effects of TM on apoptosis-related proteins (Bcl-2, Bax, and cleaved caspase-3) were also neutralized by MLKL knockdown (Figure 6d and e, P < 0.01).

Figure 5 MLKL knockdown reversed the effects of TM on viability and apoptosis of MIHA cells. (a) The transfection efficiency of shMLKL, shMLKL#2, and shMLKL#3 was determined by qRT-PCR. GAPDH was employed as the internal control. (b) The viability of treated MIHA cells was analyzed at 0, 12, 24, and 48 h by CCK-8 assay. (c and d) The apoptosis of treated MIHA cells was analyzed by flow cytometry. &&& P < 0.001 vs shNC. * P < 0.05, ** P < 0.01, *** P < 0.001 vs control. ω P < 0.05, ωωω P < 0.001 vs TM + shNC. Quantified values were presented as mean ± standard deviation of at least three independent experiments. MLKL: mixed lineage kinase domain-like pseudokinase. ShMLKL: MLKL-specific short hairpin RNA. shNC: shRNA negative control. GAPDH: glyceraldehyde-3-phosphate dehydrogenase. TM: Tunicamycin. CCK-8: cell counting kit-8. qRT-PCR: quantitative reverse transcription polymerase chain reaction.
Figure 5

MLKL knockdown reversed the effects of TM on viability and apoptosis of MIHA cells. (a) The transfection efficiency of shMLKL, shMLKL#2, and shMLKL#3 was determined by qRT-PCR. GAPDH was employed as the internal control. (b) The viability of treated MIHA cells was analyzed at 0, 12, 24, and 48 h by CCK-8 assay. (c and d) The apoptosis of treated MIHA cells was analyzed by flow cytometry. &&& P < 0.001 vs shNC. * P < 0.05, ** P < 0.01, *** P < 0.001 vs control. ω P < 0.05, ωωω P < 0.001 vs TM + shNC. Quantified values were presented as mean ± standard deviation of at least three independent experiments. MLKL: mixed lineage kinase domain-like pseudokinase. ShMLKL: MLKL-specific short hairpin RNA. shNC: shRNA negative control. GAPDH: glyceraldehyde-3-phosphate dehydrogenase. TM: Tunicamycin. CCK-8: cell counting kit-8. qRT-PCR: quantitative reverse transcription polymerase chain reaction.

Figure 6 MLKL knockdown reversed the effects of TM on apoptosis-related proteins in MIHA cells. (a–c) The protein levels of KAT2B, p-MLKL, and MLKL in treated MIHA cells were determined by Western blot. (d–e) The expression levels of apoptosis-related proteins (Bcl-2, Bax, and cleaved caspase-3) were determined by Western blot. GAPDH was exploited as the internal control. *** P < 0.001 vs control. ωω P < 0.01, ωωω P < 0.001 vs TM + shNC. Quantified values were presented as mean ± standard deviation of at least three independent experiments. ShMLKL: MLKL-specific short hairpin RNA. NC: negative control. GAPDH: glyceraldehyde-3-phosphate dehydrogenase. TM: Tunicamycin.
Figure 6

MLKL knockdown reversed the effects of TM on apoptosis-related proteins in MIHA cells. (a–c) The protein levels of KAT2B, p-MLKL, and MLKL in treated MIHA cells were determined by Western blot. (d–e) The expression levels of apoptosis-related proteins (Bcl-2, Bax, and cleaved caspase-3) were determined by Western blot. GAPDH was exploited as the internal control. *** P < 0.001 vs control. ωω P < 0.01, ωωω P < 0.001 vs TM + shNC. Quantified values were presented as mean ± standard deviation of at least three independent experiments. ShMLKL: MLKL-specific short hairpin RNA. NC: negative control. GAPDH: glyceraldehyde-3-phosphate dehydrogenase. TM: Tunicamycin.

3.5 BMI1 affected the ubiquitination of KAT2B in MIHA cells

The interaction between KAT2B and BMI1 was predicted by ubibrowser (Figure 7a) and subsequently confirmed by co-IP experiments (Figure 7b). In addition, Western blot results showed that oe-BMI1 inhibited the protein expression of KAT2B (Figure 7c and d, P < 0.05). After treatment with protease inhibitor MG132, the inhibitory effect of oe-BMI1 on KAT2B was found to be blocked (Figure 7c and d). Moreover, BMI1 silencing increased the expression level of KAT2B but decreased the ubiquitination level of KAT2B, whereas BMI1 overexpression generated opposite results (Figure 7e and f, P < 0.01). Therefore, BMI1 affected the ubiquitination of KAT2B in MIHA cells.

Figure 7 BMI1 mediated the ubiquitination of KAT2B. (a) The interaction between KAT2B and BMI1 was predicted by ubibrowser. R, RING (Really Interesting New Gene); C, C-terminal SOCS box; SO, single other; F, F-box; D, DWD box. The width of the red edge reflects the confidence of the interaction. (b) The interaction between KAT2B and BMI1 was determined by co-IP assay. (c and d) MIHA cells were transfected with NC or BMI1 overexpression plasmid and then were treated with 20 μM MG132 for 4 h. The protein level of KAT2B was determined by Western blot. (e and f) MIHA cells were transfected with shNC or shBMI1. After 24 h, the ubiquitination level of KAT2B was detected by ubiquitination assay. + P < 0.05, ++ P < 0.01 vs NC; &&& P < 0.001 vs shNC. NC: negative control. GAPDH: glyceraldehyde-3-phosphate dehydrogenase. shBMI1, BMI1-specific short hairpin RNA. shNC, negative control of shBMI1.
Figure 7

BMI1 mediated the ubiquitination of KAT2B. (a) The interaction between KAT2B and BMI1 was predicted by ubibrowser. R, RING (Really Interesting New Gene); C, C-terminal SOCS box; SO, single other; F, F-box; D, DWD box. The width of the red edge reflects the confidence of the interaction. (b) The interaction between KAT2B and BMI1 was determined by co-IP assay. (c and d) MIHA cells were transfected with NC or BMI1 overexpression plasmid and then were treated with 20 μM MG132 for 4 h. The protein level of KAT2B was determined by Western blot. (e and f) MIHA cells were transfected with shNC or shBMI1. After 24 h, the ubiquitination level of KAT2B was detected by ubiquitination assay. + P < 0.05, ++ P < 0.01 vs NC; &&& P < 0.001 vs shNC. NC: negative control. GAPDH: glyceraldehyde-3-phosphate dehydrogenase. shBMI1, BMI1-specific short hairpin RNA. shNC, negative control of shBMI1.

4 Discussion

In this study, we found that UPR in hepatocytes protect hepatocytes by upregulating BMI1 level to ubiquitinate KAT2B, thereby blocking MLKL-mediated necroptosis.

TM is a natural nucleoside antibiotic, which can hinder the glycosylation modification of new proteins in ER and mediate cell apoptosis. Multiple studies induce ER stress in hepatocytes by TM [18,19]. As a previous study illustrated, TM-induced ER stress results in decreased hepatocyte viability and increased apoptosis [20]. In addition, TM can upregulate the expression levels of proteins related to UPR and necroptosis in hepatocytes [21]. Consistent with previous studies, we found that TM not only promoted UPR, apoptosis, and necroptosis in hepatocytes but also upregulated the expression levels of BMI1 and KAT2B and activated NF-κB pathway.

The activation of the NF-κB pathway induced by TM was due to crosstalk between the UPR and NF-κB pathway. UPR is synergistically mediated by IRE1, ATF6, and PERK. In addition, activated IRE1, activated PERK, and eIF2α phosphorylation have been revealed to activate NF-κB [22]. NF-κB can promote ER stress by upregulating the transcription and activity of protein in JNK pathway or by promoting the expression levels of inflammatory mediators [23,24]. Fu et al. proposed that ER stress in diabetic cardiomyopathy cells can be effectively reduced by inhibiting NF-κB signal [25]. Here, we reported that inhibition of NF-κB signal effectively reversed not only the regulation of TM on the vitality and apoptosis of MIHA cells but also the regulation of TM on BMI1, indicating that the increase in BMI1 expression was related to the activation of NF-κB induced by TM, which was also analogous to a previous report [10]. Interestingly, we found that inhibition of NF-κB signal promoted the regulation of KAT2B and p-MLKL by TM, signifying that blocking NF-κB could promote necroptosis of hepatocytes. This is actually not novel, as a previously published study has elucidated that inhibition of NF-κB can lead to RIPK1-mediated necroptosis in keratinocytes [26]. Since the inhibition of BMI1 promotes the occurrence of necroptosis, blocking NF-κB-induced necroptosis in hepatocytes may be related to the blocking of NF-κB-induced inhibition of BMI1 [27].

Existing research indicates that BMI1 helps maintain the self-renewal characteristics of normal stem cells and cancer cells [27,28]. In addition, BMI1 is an important gene for the expansion of hepatic progenitor cells [29], which indicates that BMI1 is also of great significance for the self-renewal of liver. Through loss- and gain-of-function assays, we found that oe-BMI1 inhibited TM-induced apoptosis and necroptosis of MIHA cells, while shBMI1 was the opposite, suggesting that BMI1 was the key gene to regulate MIHA cell apoptosis and necroptosis. This conclusion is also supported by the existing research. For instance, BMI1 can inhibit apoptosis and promote the survival of auditory hair cells by regulating oxidative stress and mitochondrial function [30]. Yuan et al. pinpointed that upregulation of BMI1 can inhibit the expression of cleaved caspase-3 yet promote the expression of Bcl-2, thus inhibiting hepatocyte apoptosis and reducing liver lipotoxicity [31]. Barabino et al. unraveled that the absence of BMI1 could lead to necroptosis in the retina of mice, thereby affecting retinal development [32]. These evidences collectively mirror that BMI1 protects hepatocytes from ER stress by inhibiting apoptosis and necroptosis.

This study also clarified the interaction between BMI1 and KAT2B. Specifically, BMI1 promoted the ubiquitination of KAT2B. Notably, BMI1 binds to the catalyzed RING2/RING1b subunit to form a functional E3 ubiquitin ligase that promotes protein degradation through the proteasome degradation pathway [33,34]. Although there is no research on ubiquitination of KAT2B by BMI1, KAT2B has been proved to be ubiquitinated by UBE2D2 [35]. Since KAT2B was able to mediate MLKL-dependent necroptosis, BMI1 might inhibit necrptosis in MIHA cells by promoting the ubiquitination of KAT2B, which was consistent with the result that oe-BMI1 reversed the promoting impacts of TM upon KAT2B and p-MLKL. Of note, TM-induced increases in BMI1 and KAT2B in MIHA cells were not inconsistent with the effect of BMI1 on the ubiquitination of KAT2B. Previous studies reported that KAT2B is helpful to maintain the effective UPR level in β cells [36]. Therefore, in TM-induced hepatocytes, the ubiquitination regulation of KAT2B by BMI1 is not enough to offset the promotion of KAT2B expression by other pathways. Hence, promoting the expression of BMI1 may be contributive to improving TM-induced ER stress.

Although this study clarified the potential mechanism of UPR on hepatocyte death, there is still a limitation, namely the exclusive use of the human normal hepatocyte line. Furthermore, the present findings in vitro need to be further validated in appropriate animal experiments in the future.

5 Conclusions

This study demonstrates that UPR activates the NF-κB pathway to promote BMI1 expression, which leads to the ubiquitination of KAT2B and thus blocks MLKL-mediated necroptosis. The present findings shed new insights into the underlying molecular mechanisms that control liver diseases.

# These authors contributed equally to this work.

tel: +86-0594-2293910

Acknowledgments

Not applicable.

  1. Funding information: This work is supported by Fujian Provincial Young and Middle-Aged Teachers Education and Research Project [JAT200510].

  2. Author contributions: Substantial contributions to conception and design: Xiaogang Huang and Xiongzhi He; Data acquisition, data analysis, and interpretation: Rongxian Qiu, Xuemei Xie, Fengfeng Zheng, Feihua Chen, and Zhenting Hu; Drafting the article or critically revising it for important intellectual content: Xiaogang Huang; Final approval of the version to be published: all authors; Agreement to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of the work are appropriately investigated and resolved: Xiaogang Huang, Xiongzhi He, Rongxian Qiu, Xuemei Xie, Fengfeng Zheng, Feihua Chen, and Zhenting Hu.

  3. Conflict of interest: The authors declare no conflicts of interest.

  4. Data availability statement: The datasets generated during the current study are available from the corresponding author on reasonable request.

References

[1] Michalopoulos GK, Bhushan B. Liver regeneration: Biological and pathological mechanisms and implications. Nat Rev Gastroenterol Hepatol. 2021;18(1):40–55.10.1038/s41575-020-0342-4Search in Google Scholar PubMed

[2] Albillos A, de Gottardi A, Rescigno M. The gut-liver axis in liver disease: Pathophysiological basis for therapy. J Hepatol. 2020;72(3):558–77.10.1016/j.jhep.2019.10.003Search in Google Scholar PubMed

[3] Shojaie L, Iorga A, Dara L. Cell death in liver diseases: A review. Int J Mol Sci. 2020;21(24):9682.10.3390/ijms21249682Search in Google Scholar PubMed PubMed Central

[4] Malhi H, Kaufman RJ. Endoplasmic reticulum stress in liver disease. J Hepatol. 2011;54(4):795–809.10.1016/j.jhep.2010.11.005Search in Google Scholar PubMed PubMed Central

[5] So JS. Roles of endoplasmic reticulum stress in immune responses. Mol Cell. 2018;41(8):705–16.Search in Google Scholar

[6] Almanza A, Carlesso A, Chintha C, Creedican S, Doultsinos D, Leuzzi B, et al. Endoplasmic reticulum stress signalling - from basic mechanisms to clinical applications. FEBS J. 2019;286(2):241–78.10.1111/febs.14608Search in Google Scholar PubMed PubMed Central

[7] Oakes SA, Papa FR. The role of endoplasmic reticulum stress in human pathology. Annu Rev Pathol. 2015;10:173–94.10.1146/annurev-pathol-012513-104649Search in Google Scholar PubMed PubMed Central

[8] Tian RD, Chen YQ, He YH, Tang YJ, Chen GM, Yang FW, et al. Phosphorylation of eIF2α mitigates endoplasmic reticulum stress and hepatocyte necroptosis in acute liver injury. Ann Hepatol. 2020;19(1):79–87.10.1016/j.aohep.2019.05.008Search in Google Scholar PubMed

[9] Li W, Cao T, Luo C, Cai J, Zhou X, Xiao X, et al. Crosstalk between ER stress, NLRP3 inflammasome, and inflammation. Appl Microbiol Biotechnol. 2020;104(14):6129–40.10.1007/s00253-020-10614-ySearch in Google Scholar PubMed

[10] Qu HW, Jin Y, Cui ZL, Jin XB. MicroRNA-212 participates in the development of prostate cancer by upregulating BMI1 via NF-κB pathway. Eur Rev Med Pharmacol Sci. 2018;22(11):3348–56.Search in Google Scholar

[11] Park IK, Qian D, Kiel M, Becker MW, Pihalja M, Weissman IL, et al. Bmi-1 is required for maintenance of adult self-renewing haematopoietic stem cells. Nature. 2003;423(6937):302–5.10.1038/nature01587Search in Google Scholar PubMed

[12] Huang Y, Chen N, Miao D. Biological effects of pyrroloquinoline quinone on liver damage in Bmi-1 knockout mice. Exp Ther Med. 2015;10(2):451–8.10.3892/etm.2015.2532Search in Google Scholar PubMed PubMed Central

[13] Li Y, Guo X, Hu C, Du Y, Guo C, Di W, et al. Type I IFN operates pyroptosis and necroptosis during multidrug-resistant A. baumannii infection. Cell Death Differ. 2018;25(7):1304–18.10.1038/s41418-017-0041-zSearch in Google Scholar PubMed PubMed Central

[14] Li Y, Zhu D, Hou L, Hu B, Xu M, Meng X. TRB3 reverses chemotherapy resistance and mediates crosstalk between endoplasmic reticulum stress and AKT signaling pathways in MHCC97H human hepatocellular carcinoma cells. Oncol Lett. 2018;15(1):1343–9.10.3892/ol.2017.7361Search in Google Scholar PubMed PubMed Central

[15] Li H, Huang X, Chang X, Yao J, He Q, Shen Z, et al. S100-A9 protein in exosomes derived from follicular fluid promotes inflammation via activation of NF-κB pathway in polycystic ovary syndrome. J Cell Mol Med. 2020;24(1):114–25.10.1111/jcmm.14642Search in Google Scholar PubMed PubMed Central

[16] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif). 2001;25(4):402–8.10.1006/meth.2001.1262Search in Google Scholar PubMed

[17] Chu Y, Jiang M, Wu N, Xu B, Li W, Liu H, et al. O-GlcNAcylation of SIX1 enhances its stability and promotes Hepatocellular Carcinoma Proliferation. Theranostics. 2020;10(21):9830–42.10.7150/thno.45161Search in Google Scholar PubMed PubMed Central

[18] Liu C, Zhou B, Meng M, Zhao W, Wang D, Yuan Y, et al. FOXA3 induction under endoplasmic reticulum stress contributes to non-alcoholic fatty liver disease. J Hepatol. 2021;75(1):150–62.10.1016/j.jhep.2021.01.042Search in Google Scholar PubMed

[19] Jegal KH, Kim EO, Kim JK, Park SM, Jung DH, Lee GH, et al. Luteolin prevents liver from tunicamycin-induced endoplasmic reticulum stress via nuclear factor erythroid 2-related factor 2-dependent sestrin 2 induction. Toxicol Appl Pharmacol. 2020;399:115036.10.1016/j.taap.2020.115036Search in Google Scholar PubMed

[20] Kim SH, Kwon DY, Kwak JH, Lee S, Lee YH, Yun J, et al. Tunicamycin-induced ER stress is accompanied with oxidative stress via abrogation of sulfur amino acids metabolism in the liver. Int J Mol Sci. 2018;19(12):4114.10.3390/ijms19124114Search in Google Scholar PubMed PubMed Central

[21] Huang MY, Wan DW, Deng J, Guo WJ, Huang Y, Chen H, et al. Downregulation of RIP3 improves the protective effect of ATF6 in an acute liver injury model. BioMed Res Int. 2021;2021:8717565.10.1155/2021/8717565Search in Google Scholar PubMed PubMed Central

[22] Schmitz ML, Shaban MS, Albert BV, Gökçen A, Kracht M. The Crosstalk of Endoplasmic Reticulum (ER) stress pathways with NF-κB: Complex mechanisms relevant for cancer, inflammation and infection. Biomedicines. 2018;6(2):58.10.3390/biomedicines6020058Search in Google Scholar PubMed PubMed Central

[23] Vico TA, Marchini T, Ginart S, Lorenzetti MA, Adán Areán JS, Calabró V, et al. Mitochondrial bioenergetics links inflammation and cardiac contractility in endotoxemia. Basic Res Cardiol. 2019;114(5):38.10.1007/s00395-019-0745-ySearch in Google Scholar PubMed

[24] Duvigneau JC, Luís A, Gorman AM, Samali A, Kaltenecker D, Moriggl R, et al. Crosstalk between inflammatory mediators and endoplasmic reticulum stress in liver diseases. Cytokine. 2019;124:154577.10.1016/j.cyto.2018.10.018Search in Google Scholar PubMed

[25] Fu Z, Mui D, Zhu H, Zhang Y. Exenatide inhibits NF-κB and attenuates ER stress in diabetic cardiomyocyte models. Aging. 2020;12(9):8640–51.10.18632/aging.103181Search in Google Scholar PubMed PubMed Central

[26] Kumari S, Van TM, Preukschat D, Schuenke H, Basic M, Bleich A, et al. NF-κB inhibition in keratinocytes causes RIPK1-mediated necroptosis and skin inflammation. Life Sci Alliance. 2021;4(6):e202000956.10.26508/lsa.202000956Search in Google Scholar PubMed PubMed Central

[27] Dey A, Mustafi SB, Saha S, Kumar Dhar Dwivedi S, Mukherjee P, Bhattacharya R. Inhibition of BMI1 induces autophagy-mediated necroptosis. Autophagy. 2016;12(4):659–70.10.1080/15548627.2016.1147670Search in Google Scholar PubMed PubMed Central

[28] Jia L, Zhang W, Wang CY. BMI1 inhibition eliminates residual cancer stem cells after PD1 blockade and activates antitumor immunity to prevent metastasis and relapse. Cell Stem Cell. 2020;27(2):238–53e6.10.1016/j.stem.2020.06.022Search in Google Scholar PubMed PubMed Central

[29] Fan L, Xu C, Wang C, Tao J, Ho C, Jiang L, et al. Bmi1 is required for hepatic progenitor cell expansion and liver tumor development. PLoS one. 2012;7(9):e46472.10.1371/journal.pone.0046472Search in Google Scholar PubMed PubMed Central

[30] Chen Y, Li L, Ni W, Zhang Y, Sun S, Miao D, et al. Bmi1 regulates auditory hair cell survival by maintaining redox balance. Cell Death Dis. 2015;6(1):e1605.10.1038/cddis.2014.549Search in Google Scholar PubMed PubMed Central

[31] Yuan W, Zhang M, Wang C, Li B, Li L, Ye F, et al. Resveratrol attenuates high-fat diet-induced hepatic lipotoxicity by upregulating Bmi-1 expression. J Pharmacol Exp Ther. 2022;381(2):96–105.10.1124/jpet.121.001018Search in Google Scholar PubMed

[32] Barabino A, Plamondon V, Abdouh M, Chatoo W, Flamier A, Hanna R, et al. Loss of Bmi1 causes anomalies in retinal development and degeneration of cone photoreceptors. Development (Cambridge, England). 2016;143(9):1571–84.Search in Google Scholar

[33] Lin X, Ojo D, Wei F, Wong N, Gu Y, Tang D. A novel aspect of tumorigenesis-BMI1 functions in regulating DNA damage response. Biomolecules. 2015;5(4):3396–415.10.3390/biom5043396Search in Google Scholar PubMed PubMed Central

[34] Su WJ, Fang JS, Cheng F, Liu C, Zhou F, Zhang J. RNF2/Ring1b negatively regulates p53 expression in selective cancer cell types to promote tumor development. Proc Natl Acad Sci U S A. 2013;110(5):1720–5.10.1073/pnas.1211604110Search in Google Scholar PubMed PubMed Central

[35] Qi X, Wang H, Xia L, Lin R, Li T, Guan C, et al. miR-30b-5p releases HMGB1 via UBE2D2/KAT2B/HMGB1 pathway to promote pro-inflammatory polarization and recruitment of macrophages. Atherosclerosis. 2021;324:38–45.10.1016/j.atherosclerosis.2021.02.016Search in Google Scholar PubMed

[36] Rabhi N, Denechaud PD, Gromada X, Hannou SA, Zhang H, Rashid T, et al. KAT2B is required for pancreatic beta cell adaptation to metabolic stress by controlling the unfolded protein response. Cell Rep. 2016;15(5):1051–61.10.1016/j.celrep.2016.03.079Search in Google Scholar PubMed

Received: 2022-08-10
Revised: 2023-04-21
Accepted: 2023-04-25
Published Online: 2023-06-16

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
https://doi.org/10.1515/med-2023-0718
Keywords for this article
hepatocytes; necroptosis; unfolded protein response; B cell-specific Moloney MLV insertion site-1; KAT2B
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 12.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0718/html
Scroll to top button