Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
Abstract
KIAA1199, a major glycosaminoglycan component of the extracellular matrix, was reported to induce a fibrosis-like process. However, the relationship between KIAA1199 and liver fibrosis remains unclear. The liver fibrosis mouse model was established with carbon tetrachloride (CCl4). Here, we found that KIAA1199 was upregulated in CCl4-induced liver fibrosis. The expression of KIAA1199 was also increased in TGF-β-stimulated LX-2 cells. To clarify the impact of KIAA1199 in hepatic stellate cells (HSCs), we downregulated the expression of KIAA1199 in LX-2 cells by RNA interference. Cell proliferation, apoptosis, and migration were determined by CCK-8, flow cytometry, and transwell assay. We found that KIAA1199 knockdown reduced the expression of fibrosis markers α-SMA and COL1A1. Depletion of KIAA1199 inhibited cell proliferation by downregulating cyclin B1 and cyclin D1 and promoted cell apoptosis by upregulating Bax and downregulating Bcl-2. Moreover, KIAA1199 knockdown decreased matrix metalloproteinase-2 (MMP-2) and MMP-9 expression to inhibit the migration ability of LX-2 cells. Silencing KIAA1199 also suppressed the epithelial–mesenchymal transition phenomenon. Collectively, our study revealed that KIAA1199 knockdown alleviated the activation, proliferation, and migration of HSCs, while promoting apoptosis of HSCs, which suggests that KIAA1199 may be a potential regulator of liver fibrosis.
1 Introduction
Liver fibrosis is a common pathological alteration under persistent liver injury, which may eventually lead to cirrhosis or even liver cancer [1]. The excessive deposition of the extracellular matrix (ECM) is a typical characteristic of liver fibrosis [2]. Hepatic stellate cells (HSCs), which are “quiescent” in the normal liver, become “activated” after liver injury, acquire a myofibroblast phenotype, and result in the accumulation of ECM [3]. Understanding the mechanism of HSC activation is of great value for the development of novel strategies that prevent the progression of liver fibrosis.
KIAA1199, also known as cell migration inducing protein (CEMIP) and hyaluronan binding protein (HYBID), is an important member of the KIAA family in the Human Unidentified Gene-Encoded (HUGE) database [4]. KIAA1199 was first identified as an inner ear-specific protein in 2003 [5]. Subsequently, the increased expression of KIAA1199 was detected in many tumor tissues and strongly related to tumorigenesis and poor prognosis [6,7,8]. Moreover, gain- and loss-of-function studies demonstrated a potential biological role of KIAA1199 in the regulation of cell proliferation, invasion, and migration [8,9]. Further studies demonstrated that KIAA1199 may be a regulator of the epithelial–mesenchymal transition (EMT). KIAA1199 silencing induced the expression of epithelial markers (E-cadherin and claudins) and decreased the expression of mesenchymal markers (N-cadherin, vimentin, and snail1) [10,11]. EMT plays an important role in liver fibrosis, and abnormal activated EMT promotes the activation and migration of HSCs, thus contributing to the deposition of ECM in the liver [12,13]. Recently, KIAA1199 was reported to induce a fibrosis-like process in osteoarthritic chondrocytes [14]. However, the role of KIAA1199 in liver fibrosis has not been investigated so far.
In this study, we found that the expression of KIAA1199 was increased in the CCl4-induced liver fibrosis mouse model and TGF-β-stimulated LX-2 cells. Depletion of KIAA1199 inhibited activation, proliferation, and migration, while promoting apoptosis of HSCs. Further studies revealed that KIAA1199 knockdown also suppressed EMT. These findings unveil a novel role of KIAA1199 in liver fibrosis.
2 Materials and methods
2.1 Establishment of a liver fibrosis mouse model
Male C57BL/6 wild‐type (WT) mice, aged 6–8 weeks, were used in this study. Mice were divided into the following three groups: (i) Sham (n = 6), (ii) CCl4 for 4 weeks (n = 6), and (iii) CCl4 for 8 weeks (n = 6). Mice in the CCl4 group were intraperitoneally injected with CCl4 (1:20 dissolved in corn oil) twice a week. WT mice that received an equal volume of corn oil at the same time point served as controls. After 8 weeks, mice were killed and liver tissues were isolated for subsequent experiments. All animal studies were approved by the Institution Ethics Committee of Tongji Medical College, Huazhong University of Science and Technology.
2.2 Immunohistochemistry
Mouse liver tissue samples were fixed with 4% paraformaldehyde at room temperature for 48 h, embedded in paraffin, and cut into 5 µm thick sections. The 5 µm thick sections were used for hematoxylin and eosin (H&E), Masson and Sirius red stain. KIAA1199 (21129-1-AP, Proteintech) and α-SMA antibodies (Ab124961, Abcam) were used to detect the expression of KIAA1199 and α-SMA in mouse fibrotic liver tissues.
2.3 Cell culture and transfection
The human hepatic stellate cell line LX-2 was acquired from the Institute of Liver and Gastrointestinal Diseases, Huazhong University of Science and Technology, and cultured in DMEM with 10% FBS (Gibco, Invitrogen, USA). For transfection, small interfering RNA (siRNA) against KIAA1199 (KIAA1199-siRNA) and control siRNA were synthesized by RiboBio (Guangzhou, China). KIAA1199 siRNA sequences were as follows: GATCCTTACTATGGTCTGA and GGAGTGGTTCGATCATGAT.
The siRNAs were transfected into cells using Lipofectamine® 3000 (Invitrogen, Carlsbad, USA) according to the manufacturer’s instructions.
2.4 Quantitative real‐time PCR
Total RNA was extracted using the TRIzol reagent (Invitrogen, CA, USA), and cDNA was synthesized using the PrimeScript RT reagent kit (Abclonal, China). The real-time PCR was performed using SYBR Premix ExTaq (Abclonal, China) on an ABI QuantaStudio Real-Time System (Applied Biosystems, Carlsbad, CA, USA). The sequences of the primers are listed in Table 1.
Primer sequences for PCR
Gene | Forward (5′-3′) | Reverse (3′-5′) |
---|---|---|
mKIAA1199 | TGATGGGAGTCGAGGTCAC | GAGCACTATGGAATTGTCAGGG |
mα-SMA | GCGTGGCTATTCCTTCGTGACTAC | CGTCAGGCAGTTCGTAGCTCTTC |
mβ-actin | TGCTGTCCCTGTATGCCTCTG | TGATGTCACGCACGATTTCC |
hKIAA1199 | CACGGTCTATTCCATCCACATC | GGTTCGCAAAACAATCGGCT |
hα-SMA | AAAAGACAGCTACGTGGGTGA | GCCATGTTCTATCGGGTACTTC |
hCOL1A1 | GAGGGCCAAGACGAAGACATC | CAGATCACGTCATCGCACAAC |
hCCNB1 | AATAAGGCGAAGATCAACATGGC | TTTGTTACCAATGTCCCCAAGAG |
hBax | CCCGAGAGGTCTTTTTCCGAG | CCAGCCCATGATGGTTCTGAT |
hBcl-2 | GGTGGGGTCATGTGTGTGG | CGGTTCAGGTACTCAGTCATCC |
hCCND1 | GCTGCGAAGTGGAAACCATC | CCTCCTTCTGCACACATTTGAA |
hMMP2 | CCAGATGTGGCCAACTACAA | GGTCAGGTGTGTAACCAATGA |
hMMP9 | CAGTACCGAGAGAAAGCCTATT | CAGGATGTCATAGGTCACGTAG |
hE-cadherin | TGATGAGGAAGGCGGTGGAGAAG | CGGTCGAGGTCTGTACTGAGGTG |
hN-cadherin | CGATAAGGATCAACCCCATACA | TTCAAAGTCGATTGGTTTGACC |
hSnai11 | CCTCGCTGCCAATGCTCATCTG | GCTCTGCCACCCTGGGACTC |
hVimentin | TGAATGACCGCTTCGCCAACTAC | CTCCCGCATCTCCTCCTCGTAG |
hClaudin-1 | TCTTGCAGGTCTGGCTATTTTA | TTGGGTAAGAGGTTGTTTTTCG |
hβ-actin | CATGTACGTTGCTATCCAGGC | CTCCTTAATGTCACGCACGAT |
2.5 Western blot
The total protein of cells was extracted with cell lysis buffer (Pierce, Rockford, IL, USA). Cell lysates were separated by 10% SDS-PAGE and then transferred to a polyvinylidene fluoride membrane (Millipore, Bedford, MA, USA). The membrane was blocked with 5% non-fat milk for 2 h and incubated with corresponding antibodies overnight at 4°C. The primary antibodies used were as follows: α-SMA (1:10,000, ab124964; Abcam), KIAA1199 (1:1,000, 21129-1-AP; Proteintech), COL1A1 (1:1,000, 67288-1-Ig; Proteintech), cyclin B1 (1:1,000, 12231; CST), cyclinD1 (1:1,000, 2978; CST), Bax (1:1,000, 5023; CST), Bcl-2 (1:1,000, 4223; CST), E-cadherin (1:1,000, 20874-1-AP; Proteintech), N-cadherin (1:1,000, 22018-1-AP; Proteintech), claudin-1 (1:1,000, A2196; Abclonal), Snai1 (1:1,000, 13099-1-AP; Proteintech), vimentin (1:1,000, 10366-1-AP; Proteintech), MMP2 (1:1,000, 4022; CST), MMP9 (1:1,000, 3852; CST), and β-actin (1:5,000, 66009-1-AP; Proteintech). The membranes were incubated with diluted secondary antibody for 2 h. Protein bands were visualized using an ECL kit (Pierce). Image J software was used to quantify the results.
2.6 Cell proliferation assay
Cells were seeded in a 96-well plate at 3,000 cells per well. Cell proliferation was evaluated using the Cell Counting Kit-8 (CCK-8; Dojindo Molecular Technologies, Tokyo, Japan) according to the manufacturer’s protocols.
2.7 Cell apoptosis analysis
The Annexin V-FITC apoptosis kit was purchased from BD Pharmingen (San Diego, CA, USA). Cell apoptosis analysis was performed using a FACS Calibur flow cytometer (Becton Dickinson, San Diego, CA) according to the manufacturer’s protocol. Briefly, LX-2 cells were washed twice with PBS and then resuspended in 200 µL of the binding buffer. Then, they were stained with 5 µL of Annexin V for 5 min and 5 µL of propidium iodide (PI) for 10 min in the dark at 37°C. Later, cells were examined using flow cytometry.
2.8 Transwell assay
Briefly, 3 × 104 LX-2 cells were resuspended in the serum-free DMEM and plated in the upper chamber, and the lower chamber was inoculated with the DMEM containing 10% FBS. After 24 h, migrated cells were fixed with 4% paraformaldehyde, stained with crystal violet, and then photographed under a light microscope.
2.9 Statistical analysis
All statistical analysis was performed using GraphPad Prism 8.0. Data are presented as mean ± standard deviation. Student’s t-test was performed to assess the significance of differences between the two groups. P-value <0.05 was considered statistically significant.
-
Ethical approval: The research related to animal use has complied with all the relevant national regulations and institutional policies for the care and use of animals.
3 Results
3.1 KIAA1199 was upregulated in the liver fibrosis mouse model
To explore the role of KIAA1199 in the development of liver fibrosis, we first successfully established a mouse model of liver fibrosis with CCl4 (Figure 1a). Immunohistochemistry showed that KIAA1199 and α-SMA were upregulated in mouse fibrotic liver tissues (Figure 1b). Similarly, PCR and western blot analysis also revealed that the KIAA1199 level was significantly increased in mouse fibrotic liver tissues (Figure 1c and d). Moreover, the expression of α-SMA, a marker of HSCs activation, was significantly higher in fibrotic liver tissues compared to the control liver tissues (Figure 1c and d). Collectively, our results indicated that KIAA1199 participates in the development of liver fibrosis.

KIAA1199 was upregulated in the liver fibrosis mouse model. (a) Representative H&E, Masson and Sirius Red staining (100×) of the CCl4-induced liver fibrosis mouse model. (b) Immunohistochemistry (100×) for α-SMA and KIAA1199 in the liver fibrosis mouse model. (c) The mRNA levels of α-SMA and KIAA1199 in the liver fibrosis mouse model. (d) Representative image showing the protein levels of α-SMA and KIAA1199 in the liver fibrosis mouse model. β-Actin was used as a loading control. Each bar represents mean ± standard deviation of three separate experiments. ** P < 0.01.
3.2 KIAA1199 was involved in the activation of HSCs
To further explore the role of KIAA1199 in the activation of HSCs, we first treated LX-2 cells with different concentrations of TGF-β, a key cytokine in HSC activation [15]. As expected, the expression of fibrosis markers α-SMA and type 1 collagen (COL1A1) were elevated in a dose-dependent manner (Figure 2a and b). Interestingly, KIAA1199 mRNA and protein levels were also upregulated in TGF-β-stimulated LX-2 cells (Figure 2a and b). Furthermore, we used RNA interference to downregulate the expression of KIAA1199 in LX-2 cells. Compared to the control siRNA, the expression of α-SMA and CoL1A1 were significantly decreased in LX-2 cells transfected with KIAA1199 siRNAs. Moreover, KIAA1199 siRNAs inhibited the elevation of α-SMA and CoL1A1 induced by TGF-β (Figure 2c and d). These results indicated that KIAA1199 was involved in HSC activation.

KIAA1199 was involved in the activation of HSCs. (a) The mRNA levels of α-SMA, COL1A1, and KIAA1199 in LX-2 cells after TGF-β stimulation. (b) The protein levels of α-SMA, COL1A1, and KIAA1199 in LX-2 cells after TGF-β stimulation. (c) RT-qPCR and (d) western blot analysis of α-SMA, COL1A1, and KIAA1199 expression in LX-2 cells transfected with siRNAs (si NC or si KIAA1199), pretreated with or without TGF-β. β-Actin was used as a loading control. Each bar represents mean ± standard deviation of three separate experiments.** P < 0.01 and *** P < 0.001.
3.3 KIAA1199 knockdown inhibits proliferation and promotes apoptosis of HSCs
Next, we wondered whether KIAA1199 was associated with the proliferation and apoptosis of HSCs. The results of the CCK-8 assay demonstrated that KIAA1199 deficiency inhibited the proliferation of LX-2 cells (Figure 3a). To elucidate the underlying mechanism, we analyzed the expression of proliferation-related proteins. As shown, the expression of cyclin B1(CCNB1) and cyclin D1(CCND1) was decreased by KIAA1199 silencing (Figure 3b and c). In addition, the flow cytometry assay showed that the apoptosis rate of LX-2 cells transfected with KIAA1199 siRNAs was notably increased (Figure 3d). Compared to the control siRNA, pro-apoptotic protein Bax expression was remarkably increased, while anti-apoptotic protein Bcl-2 expression was decreased in KIAA1199 siRNAs-transfected LX-2 cells (Figure 3e and f). Collectively, these results suggested that downregulated KIAA1199 inhibited the proliferation and promoted apoptosis of HSCs.

KIAA1199 knockdown inhibits proliferation and promotes apoptosis of HSCs. (a) The proliferation rates of LX-2 cells transfected with siRNAs (si NC or si KIAA1199) were determined by the CCK-8 assay. (b) RT-qPCR and (c) western blot analysis of cyclin B1(CCNB1) and cyclin D1(CCND1) expression in LX-2 cells transfected with siRNAs (si NC or si KIAA1199). (d) Flow cytometry shows the apoptosis of LX-2 cells transfected with siRNAs (si NC or si KIAA1199). (e) RT-qPCR and (f) western blot analysis of Bax and Bcl-2 expression in LX-2 cells transfected with siRNAs (si NC or si KIAA1199). β-Actin was used as a loading control. Each bar represents mean ± standard deviation of three separate experiments.** P < 0.01 and *** P < 0.001.
3.4 KIAA1199 knockdown inhibited HSC migration and suppressed EMT
We further investigated the role of KIAA1199 in the cell migration of HSCs. The Transwell assay demonstrated that LX-2 cells transfected with KIAA1199 siRNAs resulted in a decrease of the migration ability (Figure 4a). In addition, the expression of matrix metalloproteinases-2 (MMP-2) and MMP-9, which can promote cell migration [16], was remarkably decreased with the treatment of KIAA1199 siRNAs (Figure 4b and c). EMT is suggested to be one of the mechanisms in the activation and migration of HSCs [13]. We further explored the effect of KIAA1199 on EMT. The results demonstrated that the expression levels of the epithelial cell markers, E-cadherin and Claudin-1, were upregulated in LX-2 cells transfected with KIAA1199 siRNAs, while those of the mesenchymal cell markers such as N-cadherin, Snail1, and vimentin, were downregulated (Figure 4d and e). These results demonstrated that KIAA1199 knockdown inhibited HSC migration and suppressed EMT.

KIAA1199 knockdown inhibited HSC migration and suppressed EMT. (a) Cell migration in LX-2 cells (100×) was analyzed using the Transwell assay. (b) RT-qPCR and (c) western blot analysis of MMP-2 and MMP-9 expression in LX-2 cells transfected with siRNAs (si NC or si KIAA1199). (d) RT-qPCR and (e) western blot analysis of E-cadherin, Claudin-1, N-cadherin, Snail1, and vimentin expression in LX-2 cells transfected with siRNAs (si NC or si KIAA1199). β-Actin was used as a loading control. Each bar represents mean ± standard deviation of three separate experiments. ** P < 0.01 and *** P < 0.001.
4 Discussion
Liver fibrosis is a progressive pathological disease in response to chronic liver injury [1]. Activation of HSCs is essential for the pathogenesis of liver fibrosis, which can transform into myofibroblasts and lead to excessive accumulation of ECM [3]. In this study, we focused on the role of KIAA1199 in liver fibrosis. The results revealed that KIAA1199 was upregulated in CCl4-induced mouse fibrotic liver tissues and TGF-β-stimulated LX-2 cells. Depletion of KIAA1199 inhibited activation, proliferation, and migration, while it promoted HSC apoptosis. Moreover, the KIAA1199 knockdown also suppressed the EMT. These findings suggested that KIAA1199 may be a therapeutic strategy for liver fibrosis.
KIAA1199, as a protein of emerging interest, is overexpressed in various cancers [6,7]. A recent study demonstrated that KIAA1199 induced a fibrosis-like process in osteoarthritic chondrocytes [14]. Our study found that KIAA1199 was overexpressed in the liver fibrosis animal model. As known, transforming growth factor-β (TGF-β) plays a pivotal role in liver fibrosis by regulating HSC activation and their transformation to myofibroblasts [15]. Consistent with a previous study [17], our study found that TGF-β treatment increased the expression of α-SMA and COL1A1 in LX-2 cells. Moreover, KIAA1199 expression was also upregulated by TGF-β stimulation. To elucidate the effect of KIAA1199 on HSC activation in-depth, we transiently downregulated KIAA1199 expression in LX-2 cells by RNA interference (RNAi). The results showed that KIAA1199 knockdown reduced the expression of α-SMA and COL1A1 and inhibited TGF-β-induced HSC activation, which indicated that KIAA1199 was involved in HSC activation.
In the pathological progression of liver fibrosis, the proliferation of activated HSCs amplifies the fibrotic response while the apoptosis of activated HSCs is thought to alleviate or reverse liver fibrosis [18,19]. Accumulating evidence has shown that KIAA1199 can regulate cell growth, migration, and invasion [8]. We observed that silencing KIAA1199 significantly suppressed the proliferation of LX-2 cells as indicated by the CCK8 assay, accompanied by decreased expression of two proliferation-related proteins, CCNB1 and CCND1. The flow cytometry assay showed that the apoptosis rate of KIAA1199 siRNA transfected LX-2 cells was significantly higher than that of control cells. Moreover, the level of the anti-apoptotic factor Bcl-2 in KIAA1199-siRNA transfected LX-2 cells was decreased, and the expression of the pro-apoptotic factor Bax was increased, indicating that KIAA1199 knockdown can promote the apoptosis of LX-2 cells. Taken together, KIAA1199 also participated in the proliferation and apoptosis of HSCs.
Recent studies have confirmed that the migration of activated HSCs is also important in the development of liver fibrosis [2,19]. Matrix metalloproteinases (MMPs), particularly MMP-2 and MMP-9, are upregulated in activated HSCs, which are pivotal to cell migration and responsible for liver fibrosis [20]. In this study, we found that silencing KIAA1199 inhibited LX-2 cell migration, which was accompanied by decreased MMP-2 and MMP-9 expression. Emerging evidence indicates that MMPs are related to the induction of EMT [21,22]. Moreover, KIAA1199 promotes gastric cancer cell migration and invasion by MMP-mediated EMT progression [10]. We further analyzed the effect of KIAA1199 on EMT in LX-2 cells. The results showed that silencing of KIAA1199 significantly increased the expression of epithelial biomarkers (E-cadherin, claudin-1) and decreased the expression of mesenchymal markers (N-cadherin, vimentin, Snail1) in LX-2 cells. Therefore, KIAA1199 knockdown inhibited EMT and HSC migration.
In conclusion, our study demonstrated that repression of KIAA1199 inhibited activation, proliferation, and migration of HSCs and promoted apoptosis of HSCs in vitro. Further studies should be carried out to clarify the role and molecular mechanism of KIAA1199 in liver fibrosis in vivo.
Acknowledgments
Not applicable.
-
Funding information: This study is supported by the National Natural Science Foundation of China (No. 81800547).
-
Conflict of interest: The authors state no conflict of interest.
-
Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
References
[1] Bataller R, Brenner DA. Liver fibrosis. J Clin Invest. 2005;115(2):209–18.10.1172/JCI24282Suche in Google Scholar PubMed PubMed Central
[2] Acharya P, Chouhan K, Weiskirchen S, Weiskirchen R. Cellular mechanisms of liver fibrosis. Front Pharmacol. 2021;12:671640.10.3389/fphar.2021.671640Suche in Google Scholar PubMed PubMed Central
[3] Cai X, Wang J, Wang J, Zhou Q, Yang B, He Q, et al. Intercellular crosstalk of hepatic stellate cells in liver fibrosis: New insights into therapy. Pharmacol Res. 2020;155:104720.10.1016/j.phrs.2020.104720Suche in Google Scholar PubMed
[4] Liu J, Yan W, Han P, Tian D. The emerging role of KIAA1199 in cancer development and therapy. Biomed Pharmacother. 2021;138:111507.10.1016/j.biopha.2021.111507Suche in Google Scholar PubMed
[5] Abe S, Usami S, Nakamura Y. Mutations in the gene encoding KIAA1199 protein, an inner-ear protein expressed in Deiters’ cells and the fibrocytes, as the cause of nonsyndromic hearing loss. J Hum Genet. 2003;48(11):564–70.10.1007/s10038-003-0079-2Suche in Google Scholar PubMed
[6] Xu J, Liu Y, Wang X, Huang J, Zhu H, Hu Z, et al. Association between KIAA1199 overexpression and tumor invasion, TNM stage, and poor prognosis in colorectal cancer. Int J Clin Exp Pathol. 2015;8(3):2909–18.Suche in Google Scholar
[7] Liu J, Han P, Gong J, Wang Y, Chen B, Liao J, et al. Knockdown of KIAA1199 attenuates growth and metastasis of hepatocellular carcinoma. Cell Death Discovery. 2018;4:102.10.1038/s41420-018-0099-5Suche in Google Scholar PubMed PubMed Central
[8] Zhang Y, Jia S, Jiang WG. KIAA1199 and its biological role in human cancer and cancer cells (review). Oncol Rep. 2014;31(4):1503–8.10.3892/or.2014.3038Suche in Google Scholar PubMed
[9] Jami MS, Hou J, Liu M, Varney ML, Hassan H, Dong J, et al. Functional proteomic analysis reveals the involvement of KIAA1199 in breast cancer growth, motility and invasiveness. BMC Cancer. 2014;14:194.10.1186/1471-2407-14-194Suche in Google Scholar PubMed PubMed Central
[10] Jia S, Qu T, Wang X, Feng M, Yang Y, Feng X, et al. KIAA1199 promotes migration and invasion by Wnt/beta-catenin pathway and MMPs mediated EMT progression and serves as a poor prognosis marker in gastric cancer. PLoS One. 2017;12(4):e0175058.10.1371/journal.pone.0175058Suche in Google Scholar PubMed PubMed Central
[11] Liang G, Fang X, Yang Y, Song Y. Silencing of CEMIP suppresses Wnt/beta-catenin/Snail signaling transduction and inhibits EMT program of colorectal cancer cells. Acta Histochem. 2018;120(1):56–63.10.1016/j.acthis.2017.11.002Suche in Google Scholar PubMed
[12] Pinzani M. Epithelial-mesenchymal transition in chronic liver disease: Fibrogenesis or escape from death? J Hepatol. 2011;55(2):459–65.10.1016/j.jhep.2011.02.001Suche in Google Scholar PubMed
[13] Yu K, Li Q, Shi G, Li N. Involvement of epithelial-mesenchymal transition in liver fibrosis. Saudi J Gastroenterol. 2018;24(1):5–11.10.4103/sjg.SJG_297_17Suche in Google Scholar PubMed PubMed Central
[14] Céline D, Edith C, Sophie N, Olivier M, Philippe G, William K, et al. CEMIP (KIAA1199) induces a fifibrosis-like process in osteoarthritic chondrocytes. Cell Death Dis. 2019;10(2):103.10.1038/s41419-019-1377-8Suche in Google Scholar PubMed PubMed Central
[15] Dewidar B, Meyer C, Dooley S, Meindl-Beinker AN. TGF-beta in hepatic stellate cell activation and liver fibrogenesis-updated 2019. Cells. 2019;8(11):1419.10.3390/cells8111419Suche in Google Scholar PubMed PubMed Central
[16] Ayoub AE, Cai TQ, Kaplan RA, Luo J. Developmental expression of matrix metalloproteinases 2 and 9 and their potential role in the histogenesis of the cerebellar cortex. J Comp Neurol. 2005;481(4):403–15.10.1002/cne.20375Suche in Google Scholar PubMed
[17] Fu J, Wu B, Zhong S, Deng W, Lin F. MiR-29a-3p suppresses hepatic fibrosis pathogenesis by modulating hepatic stellate cell proliferation via targeting PIK3R3 gene expression. Biochem Biophys Res Commun. 2020;529(4):922–9.10.1016/j.bbrc.2020.06.102Suche in Google Scholar PubMed
[18] Seki E, Schwabe RF. Hepatic inflammation and fibrosis: Functional links and key pathways. Hepatology. 2015;61(3):1066–79.10.1002/hep.27332Suche in Google Scholar PubMed PubMed Central
[19] Kisseleva T, Brenner D. Molecular and cellular mechanisms of liver fibrosis and its regression. Nat Rev Gastroenterol Hepatol. 2021;18(3):151–66.10.1038/s41575-020-00372-7Suche in Google Scholar PubMed
[20] Baig MS, Yaqoob U, Cao S, Saqib U, Shah VH. Non-canonical role of matrix metalloprotease (MMP) in activation and migration of hepatic stellate cells (HSCs). Life Sci. 2016;155:155–60.10.1016/j.lfs.2016.04.031Suche in Google Scholar PubMed
[21] Chen S, Shen Z, Gao L, Yu S, Zhang P, Han Z, et al. TPM3 mediates epithelial-mesenchymal transition in esophageal cancer via MMP2/MMP9. Ann Transl Med. 2021;9(16):1338.10.21037/atm-21-4043Suche in Google Scholar PubMed PubMed Central
[22] Scheau C, Badarau IA, Costache R, Caruntu C, Mihai GL, Didilescu AC, et al. The role of matrix metalloproteinases in the epithelial-mesenchymal transition of hepatocellular carcinoma. Anal Cell Pathol. 2019;2019:9423907.10.1155/2019/9423907Suche in Google Scholar PubMed PubMed Central
© 2023 the author(s), published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Artikel in diesem Heft
- Research Articles
- Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
- Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
- circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
- circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
- WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
- Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
- Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
- 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
- Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
- PVT1/miR-16/CCND1 axis regulates gastric cancer progression
- Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
- Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
- SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
- Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
- lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
- SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
- Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
- Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
- Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
- circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
- Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
- UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
- Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
- Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
- UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
- LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
- Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
- Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
- circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
- Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
- Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
- A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
- WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
- Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
- Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
- Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
- Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
- Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
- Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
- Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
- CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
- Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
- Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
- HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
- The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
- Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
- A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
- Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
- Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
- TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
- The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
- miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
- Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
- IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
- Comprehensive analysis of the role of SFXN family in breast cancer
- Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
- Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
- AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
- Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
- Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
- Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
- The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
- Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
- Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
- F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
- Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
- Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
- Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
- Cholesterol induces inflammation and reduces glucose utilization
- circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
- NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
- The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
- miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
- Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
- α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
- Changes of microbiota level in urinary tract infections: A meta-analysis
- Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
- Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
- Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
- Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
- Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
- Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
- Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
- An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
- Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
- Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
- PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
- miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
- lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
- Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
- Subjective well-being in informal caregivers during the COVID-19 pandemic
- Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
- Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
- Bladder cancer screening: The new selection and prediction model
- circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
- Prone position effect in intensive care patients with SARS-COV-2 pneumonia
- Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
- Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
- Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
- Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
- Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
- Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
- Clinical significance of serum MBD3 detection in girls with central precocious puberty
- Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
- Collagen treatment of complex anorectal fistula: 3 years follow-up
- LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
- Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
- SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
- A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
- circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
- hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
- Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
- lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
- Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
- Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
- Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
- Analysis of somatic mutations and key driving factors of cervical cancer progression
- Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
- Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
- Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
- Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
- Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
- Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
- Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
- Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
- The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
- Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
- Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
- The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
- Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
- Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
- Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
- The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
- Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
- Clinical characteristics of current COVID-19 rehabilitation outpatients in China
- Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
- miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
- The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
- Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
- The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
- Identification of cuproptosis-related genes for predicting the development of prostate cancer
- Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
- Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
- A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
- Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
- Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
- Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
- A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
- A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
- Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
- The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
- Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
- AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
- Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
- Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
- LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
- Factors associated with gastrointestinal dysmotility in critically ill patients
- Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
- Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
- Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
- Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
- Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
- The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
- Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
- Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
- Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
- Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
- Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
- Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
- D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
- WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
- Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
- Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
- Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
- Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
- Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
- Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
- A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
- Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
- A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
- Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
- The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
- Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
- CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
- Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
- KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
- Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
- The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
- Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
- Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
- Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
- Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
- Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
- Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
- lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
- Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
- The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
- The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
- Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
- MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
- Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
- Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
- Predictors of gastrointestinal complaints in patients on metformin therapy
- Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
- A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
- Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
- miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
- Clinical features and management of lymphoepithelial cyst
- Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
- ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
- Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
- The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
- Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
- Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
- Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
- miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
- Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
- Review Articles
- Prenatal diagnosis of fetal defects and its implications on the delivery mode
- Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
- Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
- Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
- Vitamin C and epigenetics: A short physiological overview
- Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
- Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
- Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
- Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
- The progress of autoimmune hepatitis research and future challenges
- METTL16 in human diseases: What should we do next?
- New insights into the prevention of ureteral stents encrustation
- VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
- Case Reports
- Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
- Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
- Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
- Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
- Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
- Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
- Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
- Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
- Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
- Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
- CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
- Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
- Anesthetic management of fetal pulmonary valvuloplasty: A case report
- Rapid Communication
- Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
- Erratum
- Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
- Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
- Retraction
- Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
- Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
- Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
- Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
- Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
- Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
- Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
- Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
- Special issue The evolving saga of RNAs from bench to bedside - Part I
- FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
- Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Artikel in diesem Heft
- Research Articles
- Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
- Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
- circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
- circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
- WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
- Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
- Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
- 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
- Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
- PVT1/miR-16/CCND1 axis regulates gastric cancer progression
- Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
- Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
- SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
- Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
- lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
- SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
- Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
- Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
- Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
- circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
- Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
- UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
- Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
- Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
- UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
- LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
- Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
- Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
- circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
- Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
- Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
- A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
- WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
- Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
- Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
- Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
- Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
- Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
- Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
- Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
- CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
- Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
- Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
- HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
- The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
- Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
- A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
- Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
- Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
- TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
- The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
- miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
- Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
- IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
- Comprehensive analysis of the role of SFXN family in breast cancer
- Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
- Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
- AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
- Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
- Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
- Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
- The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
- Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
- Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
- F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
- Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
- Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
- Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
- Cholesterol induces inflammation and reduces glucose utilization
- circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
- NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
- The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
- miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
- Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
- α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
- Changes of microbiota level in urinary tract infections: A meta-analysis
- Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
- Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
- Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
- Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
- Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
- Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
- Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
- An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
- Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
- Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
- PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
- miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
- lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
- Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
- Subjective well-being in informal caregivers during the COVID-19 pandemic
- Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
- Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
- Bladder cancer screening: The new selection and prediction model
- circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
- Prone position effect in intensive care patients with SARS-COV-2 pneumonia
- Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
- Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
- Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
- Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
- Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
- Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
- Clinical significance of serum MBD3 detection in girls with central precocious puberty
- Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
- Collagen treatment of complex anorectal fistula: 3 years follow-up
- LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
- Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
- SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
- A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
- circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
- hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
- Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
- lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
- Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
- Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
- Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
- Analysis of somatic mutations and key driving factors of cervical cancer progression
- Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
- Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
- Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
- Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
- Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
- Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
- Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
- Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
- The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
- Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
- Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
- The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
- Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
- Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
- Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
- The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
- Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
- Clinical characteristics of current COVID-19 rehabilitation outpatients in China
- Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
- miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
- The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
- Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
- The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
- Identification of cuproptosis-related genes for predicting the development of prostate cancer
- Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
- Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
- A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
- Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
- Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
- Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
- A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
- A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
- Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
- The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
- Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
- AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
- Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
- Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
- LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
- Factors associated with gastrointestinal dysmotility in critically ill patients
- Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
- Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
- Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
- Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
- Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
- The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
- Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
- Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
- Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
- Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
- Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
- Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
- D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
- WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
- Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
- Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
- Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
- Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
- Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
- Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
- A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
- Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
- A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
- Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
- The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
- Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
- CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
- Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
- KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
- Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
- The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
- Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
- Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
- Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
- Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
- Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
- Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
- lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
- Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
- The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
- The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
- Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
- MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
- Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
- Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
- Predictors of gastrointestinal complaints in patients on metformin therapy
- Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
- A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
- Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
- miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
- Clinical features and management of lymphoepithelial cyst
- Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
- ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
- Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
- The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
- Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
- Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
- Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
- miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
- Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
- Review Articles
- Prenatal diagnosis of fetal defects and its implications on the delivery mode
- Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
- Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
- Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
- Vitamin C and epigenetics: A short physiological overview
- Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
- Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
- Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
- Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
- The progress of autoimmune hepatitis research and future challenges
- METTL16 in human diseases: What should we do next?
- New insights into the prevention of ureteral stents encrustation
- VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
- Case Reports
- Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
- Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
- Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
- Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
- Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
- Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
- Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
- Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
- Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
- Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
- CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
- Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
- Anesthetic management of fetal pulmonary valvuloplasty: A case report
- Rapid Communication
- Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
- Erratum
- Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
- Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
- Retraction
- Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
- Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
- Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
- Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
- Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
- Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
- Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
- Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
- Special issue The evolving saga of RNAs from bench to bedside - Part I
- FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
- Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer