Abstract
Lung cancer is one of the malignant tumors, and genetic background is a risk factor in lung cancer that cannot be neglected. In this study, we aimed to find out the effect of MRPS30-DT and NINJ2 variants on lung cancer risk. In this study, the seven selected single-nucleotide polymorphisms (SNPs) of MRPS30-DT and NINJ2 were genotyped in 509 lung cancer patients and 501 healthy controls based on the Agena MassARRAY platform. Odds ratios and 95% confidence intervals were calculated by logistic regression analysis to evaluate association between gene polymorphisms and lung cancer risk. False-positive report probability was also used to assess false-positive results. Furthermore, the interaction between SNPs was analyzed by multifactor dimensionality reduction to predict lung cancer risk. We identified the genotype TA of rs16901963 (T < A) in MRPS30-DT as a protective factor against lung cancer, while rs16901963-TT was significantly associated with an increased risk of lung cancer. We also revealed that the effect of MRPS30-DT and NINJ2 variants on the risk of lung cancer was dependent on age, gender, smoking, and drinking status. In conclusion, this study first proved that MRPS30-DT and NINJ2 variants played important roles in affecting the susceptibility to lung cancer.
1 Introduction
Lung cancer is the most threatening malignancy worldwide, with the number of diagnosed cases increasing every year and the 5-year survival rate reaching 10% [1,2]. Risk factors, including smoking, biomass exposure, radiation, and air pollution, were considered to be significantly associated with an increased incidence of lung cancer [3]. However, studies on 10–25% of non-smoking lung cancer patients have demonstrated that internal gene mutations were correlated with abnormal regulation of lung cancer [4]. A large number of epidemiological studies have confirmed that genetic polymorphisms were key factors in the progression of lung cancer. Recently, genome-wide association studies have also identified various single-nucleotide polymorphisms (SNPs) in lung cancer susceptibility genes [5,6]. The discovery of these susceptibility loci, such as 3q28, 5p15.33, 13q12.12, 22q12.2, and 12q23.1, is a crucial step in revealing the genetic background of lung cancer in a specific population.
MRPS30-DT, also known as BRCAT54, is located on chromosome 5p12. It is a divergent transcript of MRPS30. In one article about breast cancer, Wu et al. [7] observed the overexpression of MRPS30-DT by microarray analysis. The higher the expression, the worse the prognosis of patients. Functional experiments have shown that knockdown of MRPS30-DT significantly inhibited the progression of breast cancer and promoted the apoptosis of breast cancer, indicating that MRPS30-DT may be an oncogene in breast cancer. On the contrary, Yang et al. have observed that overexpression of BRCAT54 significantly promoted the apoptosis of lung cancer cells [8]. Therefore, BRCAT54 may act as a tumor suppressor in non-small-cell lung carcinoma. The above results may be related to the heterogeneity of cancer. Furthermore, the genetic variants of MRPS30 region were found to be correlated with the risk of breast cancer [9,10]. However, the association between MRPS30 variants and lung cancer risk was not found. And the effect of polymorphisms in the divergent transcript (MRPS30-DT) on the risk of lung cancer has never been studied.
NINJ2 is located on chromosome 12p13.33 and encodes a transmembrane protein that mediated cell–cell and cell–extracellular matrix interactions during the development, differentiation, and regeneration of nervous system [11]. NINJ2 was observed to be overexpressed in colorectal cancer cells and can promote human colorectal cancer cell growth [12]. Moreover, its overexpression may accelerate the growth of glioma cells [13]. The effects of NINJ2 gene polymorphisms have been widely studied in stroke-related diseases and neurological disorders [14,15,16,17,18], while never in lung cancer. Choi et al. have applied array comparative genomic hybridization to human emphysema and identified NINJ2 with a higher fold change, thereby suggesting that NINJ2 was a potential gene involved in the pathogenesis of emphysema [19]. Thus, NINJ2 gene alterations may play an important role in lung disease, including lung cancer.
Therefore, we set up this case–control study and genotyped seven SNPs of candidate genes in patients with lung cancer and healthy controls. Our study first examined the potential influence of candidate genes on the risk of lung cancer, which provided a theoretical basis for deep understanding of the genetic background of lung cancer.
2 Materials and methods
2.1 Study population
This study enrolled 1,010 subjects from Shaanxi Cancer Hospital, including 509 lung cancer patients and 501 healthy controls. Lung cancer patients were all histopathologically diagnosed, and patients who underwent radiotherapy were not included in the case group. Patients with a family history of lung cancer, other cancers, other lung diseases, or immune diseases were excluded. During the same period, 501 healthy controls were recruited from the healthcare center and they had no history of cancer or chronic diseases. The information about clinical characteristics (age, gender, smoking and drinking status, etc.) of all subjects was collected from questionnaire.
-
Ethical approval: This study complied with Helsinki Declaration and was approved by theEthics Committee of the Second Affiliated Hospital of Shaanxi University of Chinese Medicine (201204). All participants were informed of the purpose and procedures of this study and signed the informed content.
2.2 SNP selection and genotyping
The SNPs of candidate were downloaded from the 1000 Genomes Project. Then, Haploview software was used to set parameters (Hardy–Weinberg equilibrium [HWE] > 0.01, minor allele frequency [MAF] > 0.05, call rate > 0.95 and r 2 < 0.80) to screen SNPs. In addition to ineffective and unspecific primers, MRPS30-DT (rs16901963 and rs2118763) and NINJ2 (rs118050317, rs75750647, rs7307242, rs10849390, and rs11610368) were screened out. The amplification primers and extension primers for these SNPs were designed through the Agena online platform, as displayed in Table A1. Genomic DNA of all subjects was isolated and extracted from the whole blood samples using the kit (Xi’an GoldMag Co. Ltd., Xi’an, China), and the spectrophotometer was used for the detection of genomic DNA concentration (NanoDrop2000, Thermo, MA, USA). SNP genotyping and data collection were done with the Agena MassARRAY platform and TYPER 4.0 (Agena Bioscience, CA, USA), respectively.
2.3 Statistical analysis
In this study, genotyping data were collated and processed in Excel, SPSS 18.0, and PLINK software for statistical analysis. T-test and chi-square test were used to analyze the differences in age, gender, and clinical indexes between the two groups, respectively. Chi-square test was utilized to determine whether the allele frequencies of SNPs in the control group conformed to HWE. Furthermore, the logistic regression analysis was introduced to evaluate the association between the genetic polymorphisms of candidate genes and the susceptibility to lung cancer under the allelic and genetic models, with the corresponding values of odds ratios (ORs) and 95% confidence intervals (CIs). After adjustment for age and gender, the corresponding OR and 95% CI were also calculated. False-positive report probability (FPRP) analysis was utilized to determine whether there were false positives in significant results. Besides, we carried out linkage disequilibrium (LD) analysis through Haploview 4.2 and used D′ to represent the LD degree of different loci on the same chromosome. We also conducted the logistic regression analysis to assess the correlation between haplotypes and lung cancer risk based on different stratified analyses. Multifactor dimensionality reduction (MDR) software package was utilized to predict the association between the selected SNPs and lung cancer risk. All p-values <0.05 indicated statistical significance.
3 Results
3.1 Demographic and clinical characteristics of subjects and SNP information
The clinical information of 509 patients with lung cancer (57.99 ± 10.56 years, 75% males and 25% females) and 501 healthy controls (60.29 ± 8.13 years, 71% males and 29% females) is summarized in Table 1. The statistical results showed that there were significant differences in age and smoking status between cases and controls (p < 0.001), while no significant differences in gender (p = 0.243) and drinking status (p = 0.096). In addition, we collected the clinical characteristics of participants, including lymph node metastasis, histological type, and clinical stage.
Demographic and clinical characteristics of subjects
| Variables | Case (n = 509) | Control (n = 501) | p-Value |
|---|---|---|---|
| Age (mean ± SD, years) | 57.99 ± 10.56 | 60.29 ± 8.13 | <0.001 a |
| ≤59 | 266 (52%) | 227 (45%) | |
| >59 | 243 (48%) | 274 (55%) | |
| Gender | 0.243b | ||
| Male | 383 (75%) | 354 (71%) | |
| Female | 126 (25%) | 147 (29%) | |
| Smoking status | <0.001 b | ||
| Yes | 313 (62%) | 116 (23%) | |
| No | 141 (28%) | 176 (35%) | |
| Alcohol consumption status | 0.096b | ||
| Yes | 146 (29%) | 108 (22%) | |
| No | 271 (53%) | 153 (31%) | |
| Lymph node metastasis | |||
| Yes | 192 (38%) | ||
| No | 114 (23%) | ||
| Histological type | |||
| Adenocarcinoma | 168 (33%) | ||
| Squamous | 164 (32%) | ||
| Clinical stage | |||
| I/II | 82 (16%) | ||
| III/IV | 188 (37%) |
SD, standard deviation. a p-value was calculated by t-test. b p-value was calculated by chi-square test. Bold data means significant difference (p < 0.05).
The information about seven selected SNPs is shown in Table 2. The analysis results revealed that allele frequencies of seven SNPs were in line with HWE (p > 0.05). No significant differences in allele frequencies were found between the cases and controls.
Information about selected SNPs in MRPS30-DT and NINJ2
| Gene | SNP | Chromosome | Position | Allele A/B | Role | MAF | HWE p-Value | OR (95% CI) | p-Value | |
|---|---|---|---|---|---|---|---|---|---|---|
| Case | Control | |||||||||
| MRPS30-DT | rs16901963 | 5 | 44783000 | T/A | Intron | 0.437 | 0.428 | 0.715 | 1.04 (0.87–1.24) | 0.674 |
| MRPS30-DT | rs2118763 | 5 | 44787444 | T/C | Intron | 0.059 | 0.060 | 0.695 | 0.98 (0.68–1.42) | 0.920 |
| NINJ2 | rs118050317 | 12 | 634980 | C/G | Intron | 0.108 | 0.105 | 0.635 | 1.03 (0.77–1.37) | 0.844 |
| NINJ2 | rs75750647 | 12 | 638831 | A/G | Intron | 0.344 | 0.334 | 0.841 | 1.04 (0.87–1.25) | 0.653 |
| NINJ2 | rs7307242 | 12 | 641529 | A/T | Intron | 0.126 | 0.132 | 0.695 | 0.95 (0.73–1.23) | 0.700 |
| NINJ2 | rs10849390 | 12 | 646086 | G/A | Intron | 0.359 | 0.341 | 0.689 | 1.08 (0.90–1.30) | 0.416 |
| NINJ2 | rs11610368 | 12 | 662624 | A/G | Intron | 0.116 | 0.124 | 0.838 | 0.93 (0.71–1.21) | 0.576 |
SNP, Single-nucleotide polymorphism; MAF, minor allele frequency; HWE, Hardy–Weinberg Equilibrium; OR, odds ratio; 95% CI, 95% confidence interval.
3.2 Association of MRPS30-DT and NINJ2 polymorphisms with lung cancer risk
To evaluate the association between MRPS30-DT and NINJ2 polymorphisms and lung cancer risk, we performed the logistic regression analysis under different genetic models (co-dominant, dominant, recessive, and additive models) and the results are listed in Table 3. The results suggested that the heterozygote TA of rs16901963 in MRPS30-DT was significantly associated with a reduced risk of lung cancer (OR = 0.67, 95% CI: 0.50–0.89, p = 0.006) in contrast with wide genotype AA. However, the genotype rs16901963-TT was found to be related to an increased risk of lung cancer (OR = 1.55, 95% CI: 1.14–2.12, p = 0.005) under the recessive model. In Table 4, the results of FPRP indicated that rs16901963 was still associated with lung cancer risk (TA vs AA: power = 0.978, FPRP = 0.017, 0.050; TT vs TA-AA: power = 0.945, FPRP = 0.019, 0.055).
Association of MRPS30-DT and NINJ2 genetic polymorphisms with lung cancer risk
| Gene | SNP | Model | Genotype | Case | Control | OR (95% CI) | p -Value |
|---|---|---|---|---|---|---|---|
| MRPS30-DT | rs16901963 | Co-dominant | TT vs AA | 126 | 89 | 1.24 (0.88–1.76) | 0.218 |
| TA vs AA | 193 | 249 | 0.67 (0.50–0.89) | 0.006 | |||
| Dominant | TT-TA vs AA | 319 | 338 | 0.82 (0.63–1.07) | 0.139 | ||
| Recessive | TT vs TA-AA | 126 | 89 | 1.55 (1.14–2.12) | 0.005 | ||
| Additive | — | — | — | 1.05 (0.89–1.25) | 0.544 | ||
| MRPS30-DT | rs2118763 | Co-dominant | TT vs CC | 2 | 2 | 0.97 (0.13–7.47) | 0.978 |
| TC vs CC | 56 | 56 | 0.94 (0.63–1.40) | 0.754 | |||
| Dominant | TT-TC vs CC | 58 | 58 | 0.94 (0.64–1.39) | 0.755 | ||
| Recessive | TT vs TC-CC | 2 | 2 | 0.98 (0.13–7.51) | 0.983 | ||
| Additive | — | — | — | 0.94 (0.65–1.37) | 0.763 | ||
| NINJ2 | rs118050317 | Co-dominant | CC vs GG | 9 | 4 | 2.02 (0.61–6.70) | 0.248 |
| CG vs GG | 91 | 97 | 0.90 (0.66–1.25) | 0.535 | |||
| Dominant | CC-CG vs GG | 100 | 101 | 0.95 (0.69–1.30) | 0.742 | ||
| Recessive | CC vs CG-GG | 9 | 4 | 2.06 (0.62–6.82) | 0.235 | ||
| Additive | — | — | — | 1.00 (0.75–1.33) | 0.992 | ||
| NINJ2 | rs75750647 | Co-dominant | AA vs GG | 70 | 57 | 1.22 (0.82–1.82) | 0.321 |
| AG vs GG | 210 | 221 | 0.94 (0.72–1.22) | 0.632 | |||
| Dominant | AA-AG vs GG | 280 | 278 | 1.00 (0.78–1.28) | 0.973 | ||
| Recessive | AA vs AG-GG | 70 | 57 | 1.26 (0.87–1.84) | 0.224 | ||
| Additive | — | — | — | 1.05 (0.88–1.26) | 0.572 | ||
| NINJ2 | rs7307242 | Co-dominant | AA vs TT | 9 | 7 | 1.13 (0.42–3.09) | 0.080 |
| AT vs TT | 110 | 118 | 0.92 (0.68–1.24) | 0.595 | |||
| Dominant | AA-AT vs TT | 119 | 125 | 0.93 (0.70–1.25) | 0.650 | ||
| Recessive | AA vs AT-TT | 9 | 7 | 1.15 (0.42–3.14) | 0.780 | ||
| Additive | — | — | — | 0.96 (0.73–1.24) | 0.736 | ||
| NINJ2 | rs10849390 | Co-dominant | GG vs AA | 76 | 59 | 1.27 (0.86–1.88) | 0.231 |
| GA vs AA | 208 | 217 | 0.93 (0.71–1.21) | 0.579 | |||
| Dominant | GG-GA vs AA | 284 | 276 | 1.00 (0.78–1.29) | 0.997 | ||
| Recessive | GG vs GA-AA | 76 | 59 | 1.32 (0.91–1.91) | 0.140 | ||
| Additive | — | — | — | 1.07 (0.89–1.28) | 0.466 | ||
| NINJ2 | rs11610368 | Co-dominant | AA vs GG | 7 | 8 | 0.84 (0.30–2.38) | 0.745 |
| AG vs GG | 104 | 108 | 0.91 (0.67–1.24) | 0.560 | |||
| Dominant | AA-AG vs GG | 111 | 116 | 0.91 (0.67–1.22) | 0.527 | ||
| Recessive | AA vs AG-GG | 7 | 8 | 0.86 (0.30–2.42) | 0.773 | ||
| Additive | — | — | — | 0.91 (0.70–1.20) | 0.516 |
SNP, single-nucleotide polymorphism; OR, odds ratio; 95% CI, 95% confidence interval. p-Value was calculated by logistic regression analysis with adjustment for age and gender. Bold data means significant difference (p < 0.05).
Results of FPRP analysis for significant findings
| Model | OR (95% CI) | Power | Prior probability | ||||
|---|---|---|---|---|---|---|---|
| 0.25 | 0.1 | 0.01 | 0.001 | 0.0001 | |||
| rs16901963 | |||||||
| TA vs AA | 0.67 (0.50–0.89) | 0.978 | 0.017* | 0.050* | 0.366 | 0.853 | 0.983 |
| TT vs TA-AA | 1.55 (1.14–2.12) | 0.945 | 0.019* | 0.055* | 0.390 | 0.866 | 0.985 |
*The level of FPRP threshold was set at 0.2 and noteworthy findings are presented.
3.3 Stratified analysis of the effect of MRPS30-DT and NINJ2 variants on lung cancer risk
We further performed the stratified analyses by age, gender, smoking, and alcohol consumption to explore the effect of MRPS30-DT and NINJ2 variants on lung cancer risk (Table 5). According to the gender-stratified analysis, heterozygote TA of MRPS30-DT rs16901963 was associated with lung cancer risk in males (heterozygote: adjusted OR = 0.66, 95% CI: 0.47–0.92, p = 0.013; recessive: adjusted OR = 1.48, 95% CI: 1.04–2.13, p = 0.032).
Stratified analysis of the association of MRPS30-DT and NINJ2 polymorphisms with lung cancer risk
| SNP | Subgroups | Allele | Homozygote | Heterozygote | Dominant | Recessive | Additive | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| OR (95%CI) | p -Value | OR (95% CI) | p -Value | OR (95% CI) | p -Value | OR (95% CI) | p -Value | OR (95% CI) | p -Value | OR (95% CI) | p -Value | ||
| MRPS30-DT | |||||||||||||
| rs16901963 | Age (>59) | 1.15 (0.90–1.48) | 0.256 | 1.47 (0.91–2.38) | 0.116 | 0.64 (0.43–0.96) | 0.030 | 0.85 (0.58–1.23) | 0.382 | 1.90 (1.25–2.91) | 0.003 | 1.15 (0.91–1.46) | 0.249 |
| Male | 1.02 (0.83–1.25) | 0.853 | 1.18 (0.79–1.77) | 0.421 | 0.66 (0.47–0.92) | 0.013 | 0.80 (0.59–1.08) | 0.144 | 1.48 (1.04–2.13) | 0.032 | 1.03 (0.84–1.25) | 0.808 | |
| Smoking | 1.09 (0.80–1.48) | 0.578 | 1.46 (0.76–2.80) | 0.255 | 0.63 (0.39–1.04) | 0.069 | 0.82 (0.51–1.29) | 0.385 | 1.89 (1.06–3.39) | 0.032 | 1.10 (0.82–1.48) | 0.517 | |
| NINJ2 | |||||||||||||
| rs75750647 | Age (≤59) | 1.31 (1.00–1.72) | 0.049 | 1.95 (1.04–3.65) | 0.036 | 1.14 (0.77–1.68) | 0.515 | 1.28 (0.88–1.84) | 0.195 | 1.84 (1.01–3.34) | 0.047 | 1.30 (0.99–1.71) | 0.058 |
| rs10849390 | Age (≤59) | 1.09 (0.84–1.42) | 0.524 | 1.64 (0.90–2.97) | 0.105 | 0.82 (0.55–1.22) | 0.324 | 0.96 (0.66–1.40) | 0.832 | 1.81 (1.03–3.18) | 0.039 | 1.13 (0.86–1.48) | 0.380 |
| rs11610368 | Age (>59) | 0.67 (0.45–0.99) | 0.043 | 0.32 (0.06–1.58) | 0.163 | 0.73 (0.47–1.14) | 0.165 | 0.69 (0.45–1.06) | 0.091 | 0.34 (0.07–1.68) | 0.187 | 0.69 (0.47–1.02) | 0.059 |
| Non-smoking | 0.54 (0.32–0.90) | 0.018 | 0.25 (0.03–2.50) | 0.239 | 0.53 (0.28–0.98) | 0.042 | 0.50 (0.27–0.92) | 0.025 | 0.29 (0.03–2.81) | 0.283 | 0.52 (0.30–0.91) | 0.021 | |
| Non-drinking | 0.66 (0.44–1.00) | 0.048 | 0.62 (0.16–2.46) | 0.499 | 0.57 (0.35–0.94) | 0.026 | 0.58 (0.36–0.93) | 0.023 | 0.70 (0.18–2.75) | 0.612 | 0.64 (0.42–0.96) | 0.033 | |
SNP, single-nucleotide polymorphism; OR, odds ratio; 95% CI, 95% confidence interval. p-Value was calculated by logistic regression analysis with adjustment for age and gender. Bold data means significant difference (p < 0.05).
We also selected the average age of 59 as the critical point for stratified analysis. Among patients aged ≤59 years, rs75750647 of NINJ2 was considered a risk factor for lung cancer in the homozygote (adjusted OR = 1.95, 95% CI: 1.04–3.65, p = 0.036) and recessive (adjusted OR = 1.84, 95% CI: 1.01–3.34, p = 0.047) models, while rs10849390 GG carriers had a 0.81-fold increased risk of lung cancer in the recessive model (95% CI: 1.03–3.18, p = 0.039). In patients over 59 years, rs11610368 A and rs16901963 TA were correlated with a decreased risk of lung cancer (adjusted OR = 0.67, 95% CI: 0.45–0.99, p = 0.043; adjusted OR = 0.64, 95% CI: 0.43–0.96, p = 0.030).
Besides, we conducted smoking- and drinking-stratified analysis to explore the association between MRPS30-DT and NINJ2 polymorphisms and the risk of lung cancer. MRPS30-DT rs16901963 was related to an increased risk of lung cancer in the recessive model (adjusted OR = 1.89, 95% CI: 1.06–3.39, p = 0.032) in smokers. However, in non-smoking and non-drinking patients, rs11610368 of NINJ2 was found to be significantly correlated with a reduced susceptibility to lung cancer under the allelic (p = 0.018 and p = 0.048, respectively), heterozygote (p = 0.042 and p = 0.026, respectively), dominant (p = 0.025 and p = 0.023, respectively), and additive (p = 0.021 and p = 0.033, respectively) models.
3.4 LD and haplotype analysis
In the results of LD analysis, we did not find linkage between MRPS30-DT (rs16901963 and rs2118763) and NINJ2 (rs118050317, rs75750647, rs7307242, rs10849390, and rs11610368). No haplotype was found to be associated with the risk of lung cancer (Table 6).
Haplotype analysis of the association between MRPS30-DT and NINJ2 polymorphisms and lung cancer risk
| Gene | SNP | Haplotype | Fre-case | Fre-control | p a | OR (95% CI) | p b |
|---|---|---|---|---|---|---|---|
| MRPS30-DT | rs16901963|rs2118763 | AT | 0.059 | 0.060 | 0.902 | 0.94 (0.65–1.37) | 0.747 |
| TC | 0.437 | 0.428 | 0.670 | 1.05 (0.89–1.25) | 0.540 | ||
| AC | 0.496 | 0.488 | 0.716 | 1.04 (0.88–1.24) | 0.639 | ||
| NINJ2 | rs75750647|rs7307242 | GA | 0.345 | 0.334 | 0.607 | 1.06 (0.88–1.27) | 0.537 |
| CG | 0.107 | 0.104 | 0.843 | 1.00 (0.75–1.33) | 0.989 | ||
| GG | 0.453 | 0.439 | 0.540 | 1.05 (0.89–1.25) | 0.553 | ||
| NINJ2 | rs10849390|rs11610368 | GA | 0.115 | 0.119 | 0.737 | 0.93 (0.70–1.23) | 0.621 |
| GG | 0.244 | 0.220 | 0.213 | 1.14 (0.93–1.40) | 0.206 | ||
| AG | 0.362 | 0.344 | 0.410 | 1.07 (0.90–1.29) | 0.444 |
SNP, single-nucleotide polymorphism; OR, odds ratio; 95% CI, 95% confidence interval; Fre, frequency. a p-value was calculated by chi-square test. b p-value was calculated by logistic regression analysis with adjustment for age and gender. p < 0.05 indicates statistical significance.
3.5 SNP–SNP interactions and lung cancer risk.
In Table 7, MDR analysis showed that the model consisting of four loci (rs16901963, rs2118763, rs7307242, and rs11610368) was considered the best model, with the training accuracy of 56.5%, the testing accuracy of 55.7%, and the cross-validation consistency of 10/10. In Figure 1, the dendrogram (left) and the circle graph (right) indicated that rs16901963 and rs75750647 might play a synergistic role in predicting lung cancer risk.
MDR analysis of SNP–SNP interactions of MRPS30-DT and NINJ2 variants
| Model | Training Bal. Acc. | Testing Bal. Acc. | CVC | OR (95% CI) | p-Value |
|---|---|---|---|---|---|
| rs16901963 | 0.547 | 0.530 | 10/10 | 1.52 (1.12–2.07) | 0.007 |
| rs16901963, rs2118763 | 0.556 | 0.537 | 10/10 | 1.65 (1.29–2.12) | <0.000 |
| rs16901963, rs75750647, rs7307242 | 0.562 | 0.540 | 10/10 | 2.18 (1.62–2.96) | <0.000 |
| rs16901963, rs2118763, rs7307242, rs11610368 | 0.565 | 0.557 | 10/10 | 2.11 (1.58–2.83) | <0.000 |
| rs16901963, rs118050317, rs75750647, rs10849390, rs11610368 | 0.551 | 0.525 | 10/10 | 3.15 (2.08–4.77) | <0.000 |
| rs16901963, rs2118763, rs118050317, rs75750647, rs10849390, rs11610368 | 0.558 | 0.531 | 10/10 | 3.77 (2.38–5.95) | <0.000 |
| rs16901963, rs2118763, rs118050317, rs75750647, rs7307242, rs10849390, rs11610368 | 0.545 | 0.519 | 10/10 | 4.39 (2.54–7.59) | <0.000 |
MDR: multi-factor dimensionality reduction; Bal. Acc.: balanced accuracy; CVC: cross-validation consistency; OR: odds ratio; 95% CI: 95% confidence interval. Bold data means significant difference (p < 0.05).

Potential SNP–SNP interactions for predicting the risk of lung cancer risk by MDR analysis.
4 Discussion
In the present study, we found that MRPS30-DT rs16901963 was related to lung cancer risk in people aged >59 years, males, and smokers. NINJ2 (rs75750647 and rs10849390) increased the risk of lung cancer in people aged ≤59 years, while NINJ2 rs11610368 was correlated with a reduced risk of lung cancer in people aged >59 years, non-drinkers, and non-smokers. The above results will provide a theoretical basis for elucidating the pathogenesis of lung cancer.
Recently, one research reported by Wu et al. has shown that MRPS30-DT was overexpressed in breast cancer through microarray analysis and MRPS30-DT knockdown could significantly inhibit the proliferation and invasion of breast cancer cells [7]. Meanwhile, Yang et al. have put forward that BRCAT54, also known as MRPS30-DT, could inhibit the proliferation of non-small-cell lung cancer [8]. Thus, MRPS30-DT played an important role in the development of cancers. To better study the specific mechanism of MRPS30-DT in specific diseases, researchers have recently adopted a case–control strategy to further explore the possible role of MRPS30-DT polymorphisms in disease progression. At present, Chen et al. have found the contribution of the MRPS30-DT genetic polymorphisms to IgA nephropathy in the Chinese Han population [20]. However, the contribution of the MRPS30-DT genetic polymorphisms to lung cancer has not been discovered in the Chinese Han population. We are the first to report the relationship between MRPS30-DT rs16901963 and lung cancer risk in the Han population in people aged >59 years, males, and smokers. The results still need to be confirmed by subsequent experiments.
NINJ2 has also been observed by Li et al. and Zhou et al. to play a carcinogenic role in colorectal cancer and glioma [12,13]. Cheng et al. have investigated the relationship between NINJ2 variants (rs118050317, rs75750647, rs7307242, rs10849390, and rs11610368) and endometrial cancer susceptibility [21], showing that the rs118050317 mutant allele C was associated with an increased risk of endometrial cancer. In this case–control study, the relationship between rs118050317 and the risk of lung cancer was not found. Nevertheless, NINJ2 (rs75750647 and rs10849390) increased the risk of lung cancer in people aged ≤59 years, while NINJ2 rs11610368 was correlated with a reduced risk of lung cancer in people aged >59 years. Although this relationship was not found in drinkers and smokers, it would still be of great significance to explore the contribution of smoking and alcohol consumption to this correlation. Admittedly, this study has certain limitations. First of all, study subjects were all Han Chinese, and thus, it is necessary to validate our results in different ethnic populations in later studies. In addition, the influence of gene–environment interactions on lung cancer was less investigated due to the insufficient information about participants. Third, the sample size in this study was not large enough to stratify all subtypes of lung cancer. In the following studies, a larger sample size is needed to verify the current results, and related experiments will be conducted to explore the underlying molecular mechanisms of MRPS30-DT and NINJ2 in the regulation of lung cancer.
5 Conclusion
To conclude, we observed the relationship between genetic polymorphisms of MRPS30-DT and NINJ2 and the risk of lung cancer and proved that the effect of variants on lung cancer susceptibility was dependent on age, gender, smoking, and drinking status. Our findings provided a theoretical support for revealing the mechanisms of lung cancer.
Acknowledgments
We thank all those who contributed to this article.
-
Funding information: The project was supported by Doctoral Research Start-up Fund Project of Shaanxi University of Chinese Medicine (303-17102032046) and National Natural Science Foundation of China (81860600).
-
Author contributions: SCY and SZW completed genotyping and performed the manuscript; JW and QLZ participated in the data management, statistical analysis. SCY and YJH revised the manuscript. CJ collected samples. CJ and TBJ designed the study, co-supervised the research and modified the manuscript. All authors have approved the final manuscript.
-
Conflict of interest: All authors declared no conflict of interest.
-
Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on a reasonable request.
Appendix
Information about primers in this study
| SNP | 1st-PCRP (5'-3') | 2nd-PCRP (5′−3′) | UEP_DIR | UEP (5′−3′) |
|---|---|---|---|---|
| rs16901963 | ACGTTGGATGACACTGGATTCACACACTGC | ACGTTGGATGTTGAGGACCGCAAAGCATAG | R | TGTAAATACCATTTCATGAAAAG |
| rs2118763 | ACGTTGGATGCAGTATGCTAATGTAAAGGTG | ACGTTGGATGAGCCCAAAGAAAGCCAATTT | F | ccccTATGTGACAATGTTTCCTTTA |
| rs118050317 | ACGTTGGATGACAGGAGCTGGTCATGTTGC | ACGTTGGATGGTGTAGTGATTGACACCTG | R | ggggtGCCGATGGGGAAGGATTAG |
| rs75750647 | ACGTTGGATGCCCCCACAAAATTACAAACC | ACGTTGGATGTGTTCGCTGTGTACTGGATG | R | CTAAAGCAGGGTGGAG |
| rs7307242 | ACGTTGGATGGCCCTAGCCTGTTTCTTTAG | ACGTTGGATGAAATGCTTCTCCTGGAAGTC | F | CCAGATCACTAGCTCTGA |
| rs10849390 | ACGTTGGATGGAAATCAGTACTGCCTGTGC | ACGTTGGATGTCACACAATCTCACAGGGAC | F | tcgccCAGGGACAGCCCGCTGCC |
| rs11610368 | ACGTTGGATGCTCTGCAATGTTACACAGCC | ACGTTGGATGTCTGTGACTCCTTGCCAATG | R | CCTTGCCAATGGATAGAATAGAA |
SNP, single nucleotide polymorphism; PCRP, polymerase chain reaction primer; UEP_DIR, unique base extension primer direction; F, forward; R, reverse; UEP, unique base extension primer.
References
[1] Yan S, Sun R, Wu S, Jin T, Zhang S, Niu F, et al. Single nucleotide polymorphism in the 3’ untranslated region of LPP is a risk factor for lung cancer: a case-control study. BMC Cancer. 2019;19(1):35.10.1186/s12885-018-5241-5Search in Google Scholar PubMed PubMed Central
[2] Bade BC, Dela Cruz CS. Lung Cancer 2020: Epidemiology, etiology, and prevention. Clin Chest Med. 2020;41(1):1–24.10.1016/j.ccm.2019.10.001Search in Google Scholar PubMed
[3] Malhotra J, Malvezzi M, Negri E, La Vecchia C, Boffetta P. Risk factors for lung cancer worldwide. Eur Respir J. 2016;48(3):889–902.10.1183/13993003.00359-2016Search in Google Scholar PubMed
[4] Zhuo M, Zhuang X, Tang W, Xu J, Zhang C, Qian X, et al. The impact of IL-16 3’UTR polymorphism rs859 on lung carcinoma susceptibility among Chinese Han individuals. Biomed Res Int. 2018;2018:8305745.10.1155/2018/8305745Search in Google Scholar PubMed PubMed Central
[5] Zhang J, Zhao T, Xu C, Huang J, Yu H. Genetic susceptibility of lung cancer in Chinese population: An overview of systematic reviews and meta-analyses. J Evid Based Med. 2017;10(3):207–11.10.1111/jebm.12269Search in Google Scholar PubMed
[6] Bossé Y, Amos CI. A decade of GWAS results in lung cancer. Cancer Epidemiol Biomarkers Prev. 2018;27(4):363–79.10.1158/1055-9965.EPI-16-0794Search in Google Scholar PubMed PubMed Central
[7] Wu B, Pan Y, Liu G, Yang T, Jin Y, Zhou F, et al. MRPS30-DT knockdown inhibits breast cancer progression by targeting Jab1/Cops5. Front Oncol. 2019;9:1170.10.3389/fonc.2019.01170Search in Google Scholar PubMed PubMed Central
[8] Yang W, Qian Y, Gao K, Zheng W, Wu G, He Q, et al. LncRNA BRCAT54 inhibits the tumorigenesis of non-small cell lung cancer by binding to RPS9 to transcriptionally regulate JAK-STAT and calcium pathway genes. Carcinogenesis. 2021;42(1):80–92.10.1093/carcin/bgaa051Search in Google Scholar PubMed
[9] Huang Y, Ballinger DG, Dai JY, Peters U, Hinds DA, Cox DR, et al. Genetic variants in the MRPS30 region and postmenopausal breast cancer risk. Genome Med. 2012;4(3):19.10.1186/gm318Search in Google Scholar PubMed PubMed Central
[10] Ghoussaini M, French JD, Michailidou K, Nord S, Beesley J, Canisus S, et al. Evidence that the 5p12 Variant rs10941679 confers susceptibility to estrogen-receptor-positive breast cancer through FGF10 and MRPS30 regulation. Am J Hum Genet. 2016;99(4):903–11.10.1016/j.ajhg.2016.07.017Search in Google Scholar PubMed PubMed Central
[11] Sayad A, Ghafouri-Fard S, Omrani MD, Taheri M. Associations between two single-nucleotide polymorphisms in NINJ2 gene and risk of psychiatric disorders. J Mol Neurosci. 2020;70(2):236–45.10.1007/s12031-019-01462-1Search in Google Scholar PubMed
[12] Li G, Zhou LN, Yang H, He X, Duan Y, Wu F. Ninjurin 2 overexpression promotes human colorectal cancer cell growth in vitro and in vivo. Aging. 2019;11(19):8526–41.10.18632/aging.102336Search in Google Scholar PubMed PubMed Central
[13] Zhou LN, Li P, Cai S, Li G, Liu F. Ninjurin2 overexpression promotes glioma cell growth. Aging. 2019;11(23):11136–47.10.18632/aging.102515Search in Google Scholar PubMed PubMed Central
[14] Wan XH, Li SJ, Cheng P, Zhang Q, Yang XC, Zhong GZ, et al. NINJ2 polymorphism is associated with ischemic stroke in Chinese Han population. J Neurol Sci. 2011;308(1-2):67–71.10.1016/j.jns.2011.06.011Search in Google Scholar PubMed
[15] Bis JC, DeStefano A, Liu X, Brody JA, Choi SH, Verhaaren BF, et al. Associations of NINJ2 sequence variants with incident ischemic stroke in the Cohorts for Heart and Aging in Genomic Epidemiology (CHARGE) consortium. PLoS One. 2014;9(6):e99798.10.1371/journal.pone.0099798Search in Google Scholar PubMed PubMed Central
[16] Kim DE, Noh SM, Jeong SW, Cha MH. NINJ2 SNP may affect the onset age of first-ever ischemic stroke without increasing silent cerebrovascular lesions. BMC Res Notes. 2012;5:155.10.1186/1756-0500-5-155Search in Google Scholar PubMed PubMed Central
[17] Li W, Hu B, Li GL, Zhao XQ, Xin BZ, Lin JX, et al. Heterozygote genotypes at rs2222823 and rs2811712 SNP loci are associated with cerebral small vessel disease in Han Chinese population. CNS Neurosci Ther. 2012;18(7):558–65.10.1111/j.1755-5949.2012.00322.xSearch in Google Scholar PubMed PubMed Central
[18] Lin KP, Chen SY, Lai LC, Huang YL, Chen JH, Chen TF, et al. Genetic polymorphisms of a novel vascular susceptibility gene, Ninjurin2 (NINJ2), are associated with a decreased risk of Alzheimer’s disease. PLoS One. 2011;6(6):e20573.10.1371/journal.pone.0020573Search in Google Scholar PubMed PubMed Central
[19] Choi JS, Lee WJ, Baik SH, Yoon HK, Lee KH, Kim YH, et al. Array CGH reveals genomic aberrations in human emphysema. Lung. 2009;187(3):165–72.10.1007/s00408-009-9142-xSearch in Google Scholar PubMed
[20] Chen X, Li H, Liu Y, Liu J, Sun Y, Wu J, et al. The contribution of the LOC105371267 and MRPS30-DT genetic polymorphisms to IgA nephropathy in the Chinese Han population. Am J Transl Res. 2021;13(10):11718–27.10.21203/rs.3.rs-92602/v1Search in Google Scholar
[21] Cheng Y, Yang L, Shi G, Chen P, Li L, Fang H, et al. Ninjurin 2 rs118050317 gene polymorphism and endometrial cancer risk. Cancer Cell Int. 2021;21(1):1.10.1186/s12935-020-01646-5Search in Google Scholar PubMed PubMed Central
© 2023 the author(s), published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Articles in the same Issue
- Research Articles
- Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
- Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
- circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
- circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
- WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
- Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
- Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
- 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
- Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
- PVT1/miR-16/CCND1 axis regulates gastric cancer progression
- Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
- Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
- SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
- Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
- lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
- SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
- Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
- Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
- Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
- circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
- Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
- UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
- Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
- Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
- UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
- LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
- Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
- Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
- circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
- Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
- Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
- A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
- WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
- Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
- Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
- Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
- Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
- Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
- Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
- Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
- CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
- Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
- Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
- HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
- The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
- Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
- A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
- Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
- Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
- TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
- The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
- miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
- Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
- IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
- Comprehensive analysis of the role of SFXN family in breast cancer
- Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
- Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
- AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
- Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
- Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
- Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
- The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
- Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
- Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
- F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
- Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
- Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
- Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
- Cholesterol induces inflammation and reduces glucose utilization
- circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
- NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
- The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
- miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
- Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
- α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
- Changes of microbiota level in urinary tract infections: A meta-analysis
- Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
- Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
- Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
- Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
- Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
- Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
- Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
- An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
- Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
- Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
- PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
- miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
- lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
- Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
- Subjective well-being in informal caregivers during the COVID-19 pandemic
- Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
- Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
- Bladder cancer screening: The new selection and prediction model
- circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
- Prone position effect in intensive care patients with SARS-COV-2 pneumonia
- Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
- Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
- Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
- Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
- Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
- Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
- Clinical significance of serum MBD3 detection in girls with central precocious puberty
- Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
- Collagen treatment of complex anorectal fistula: 3 years follow-up
- LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
- Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
- SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
- A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
- circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
- hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
- Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
- lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
- Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
- Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
- Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
- Analysis of somatic mutations and key driving factors of cervical cancer progression
- Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
- Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
- Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
- Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
- Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
- Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
- Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
- Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
- The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
- Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
- Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
- The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
- Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
- Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
- Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
- The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
- Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
- Clinical characteristics of current COVID-19 rehabilitation outpatients in China
- Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
- miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
- The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
- Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
- The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
- Identification of cuproptosis-related genes for predicting the development of prostate cancer
- Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
- Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
- A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
- Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
- Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
- Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
- A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
- A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
- Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
- The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
- Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
- AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
- Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
- Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
- LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
- Factors associated with gastrointestinal dysmotility in critically ill patients
- Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
- Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
- Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
- Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
- Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
- The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
- Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
- Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
- Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
- Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
- Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
- Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
- D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
- WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
- Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
- Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
- Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
- Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
- Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
- Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
- A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
- Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
- A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
- Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
- The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
- Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
- CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
- Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
- KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
- Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
- The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
- Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
- Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
- Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
- Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
- Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
- Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
- lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
- Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
- The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
- The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
- Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
- MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
- Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
- Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
- Predictors of gastrointestinal complaints in patients on metformin therapy
- Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
- A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
- Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
- miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
- Clinical features and management of lymphoepithelial cyst
- Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
- ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
- Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
- The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
- Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
- Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
- Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
- miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
- Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
- Review Articles
- Prenatal diagnosis of fetal defects and its implications on the delivery mode
- Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
- Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
- Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
- Vitamin C and epigenetics: A short physiological overview
- Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
- Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
- Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
- Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
- The progress of autoimmune hepatitis research and future challenges
- METTL16 in human diseases: What should we do next?
- New insights into the prevention of ureteral stents encrustation
- VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
- Case Reports
- Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
- Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
- Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
- Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
- Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
- Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
- Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
- Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
- Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
- Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
- CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
- Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
- Anesthetic management of fetal pulmonary valvuloplasty: A case report
- Rapid Communication
- Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
- Erratum
- Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
- Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
- Retraction
- Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
- Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
- Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
- Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
- Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
- Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
- Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
- Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
- Special issue The evolving saga of RNAs from bench to bedside - Part I
- FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
- Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Articles in the same Issue
- Research Articles
- Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
- Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
- circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
- circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
- WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
- Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
- Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
- 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
- Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
- PVT1/miR-16/CCND1 axis regulates gastric cancer progression
- Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
- Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
- SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
- Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
- lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
- SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
- Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
- Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
- Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
- circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
- Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
- UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
- Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
- Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
- UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
- LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
- Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
- Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
- circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
- Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
- Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
- A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
- WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
- Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
- Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
- Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
- Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
- Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
- Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
- Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
- CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
- Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
- Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
- HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
- The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
- Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
- A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
- Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
- Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
- TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
- The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
- miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
- Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
- IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
- Comprehensive analysis of the role of SFXN family in breast cancer
- Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
- Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
- AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
- Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
- Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
- Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
- The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
- Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
- Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
- F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
- Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
- Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
- Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
- Cholesterol induces inflammation and reduces glucose utilization
- circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
- NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
- The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
- miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
- Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
- α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
- Changes of microbiota level in urinary tract infections: A meta-analysis
- Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
- Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
- Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
- Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
- Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
- Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
- Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
- An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
- Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
- Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
- PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
- miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
- lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
- Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
- Subjective well-being in informal caregivers during the COVID-19 pandemic
- Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
- Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
- Bladder cancer screening: The new selection and prediction model
- circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
- Prone position effect in intensive care patients with SARS-COV-2 pneumonia
- Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
- Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
- Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
- Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
- Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
- Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
- Clinical significance of serum MBD3 detection in girls with central precocious puberty
- Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
- Collagen treatment of complex anorectal fistula: 3 years follow-up
- LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
- Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
- SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
- A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
- circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
- hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
- Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
- lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
- Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
- Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
- Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
- Analysis of somatic mutations and key driving factors of cervical cancer progression
- Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
- Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
- Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
- Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
- Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
- Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
- Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
- Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
- The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
- Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
- Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
- The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
- Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
- Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
- Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
- The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
- Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
- Clinical characteristics of current COVID-19 rehabilitation outpatients in China
- Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
- miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
- The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
- Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
- The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
- Identification of cuproptosis-related genes for predicting the development of prostate cancer
- Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
- Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
- A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
- Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
- Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
- Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
- A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
- A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
- Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
- The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
- Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
- AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
- Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
- Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
- LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
- Factors associated with gastrointestinal dysmotility in critically ill patients
- Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
- Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
- Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
- Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
- Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
- The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
- Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
- Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
- Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
- Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
- Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
- Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
- D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
- WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
- Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
- Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
- Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
- Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
- Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
- Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
- A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
- Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
- A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
- Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
- The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
- Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
- CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
- Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
- KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
- Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
- The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
- Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
- Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
- Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
- Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
- Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
- Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
- lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
- Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
- The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
- The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
- Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
- MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
- Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
- Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
- Predictors of gastrointestinal complaints in patients on metformin therapy
- Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
- A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
- Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
- miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
- Clinical features and management of lymphoepithelial cyst
- Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
- ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
- Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
- The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
- Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
- Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
- Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
- miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
- Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
- Review Articles
- Prenatal diagnosis of fetal defects and its implications on the delivery mode
- Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
- Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
- Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
- Vitamin C and epigenetics: A short physiological overview
- Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
- Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
- Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
- Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
- The progress of autoimmune hepatitis research and future challenges
- METTL16 in human diseases: What should we do next?
- New insights into the prevention of ureteral stents encrustation
- VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
- Case Reports
- Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
- Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
- Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
- Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
- Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
- Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
- Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
- Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
- Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
- Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
- CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
- Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
- Anesthetic management of fetal pulmonary valvuloplasty: A case report
- Rapid Communication
- Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
- Erratum
- Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
- Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
- Retraction
- Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
- Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
- Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
- Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
- Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
- Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
- Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
- Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
- Special issue The evolving saga of RNAs from bench to bedside - Part I
- FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
- Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer