Home Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
Article Open Access

Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization

  • Qing-hua Xiong , Lei Zhao , Guan-qun Wan , Yun-gang Hu and Xiao-lin Li EMAIL logo
Published/Copyright: January 4, 2023
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 18 Issue 1

Abstract

Inflammatory responses play a critical role in the progress of neurodegenerative disorders. MSC-Exos is considered to have an anti-inflammatory effect on the treatment strategy for brain injury. However, the therapeutic effect and possible mechanism of Exosomal miR-210 on microglia polarization-induced neuroinflammation and neurite outgrowth have not been reported. MSC-Exos were isolated by ultracentrifugation, identified by Nanosight NS300, transmission electron microscopy, and western bolt. In vitro, to explore the protective mechanism of MSC-Exos against neuroinflammation, the microglial BV2 cell was exposed to lipopolysaccharide to assess inflammatory changes. The intake of 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate (Dil)-MSC-Exos into microglia was observed by fluorescence microscopy. The results showed that Exosomal miR-210 treatment significantly inhibited the production of nitric oxide and pro-inflammatory cytokines. Exosomal miR-210 treatment also increased the number of M2 microglia cells and inhibited M1 microglia polarization. In addition, western blot demonstrated that Exosomal miR-210 reduced neuronal apoptosis. Thus, Exosomal miR-210 attenuated neuronal inflammation and promoted neurite outgrowth. Exosomal miR-210 from MSCs attenuated neuronal inflammation and contributed to neurogenesis possibly by inhibiting microglial M1 polarization.

Keywords: exosomes; mesenchymal stem cells; microglia polarization; miR-210

1 Introduction

Neuroinflammation is a term commonly used for inflammation of neural tissue, particularly the central nervous system [1]. Emerging evidence indicates that neuroinflammation is a significant pathological process triggering a series of molecular and cellular events following neurodegenerative disorders. Neuroinflammation plays an essential role in secondary damage to the brain [2,3]. In neuroinflammation, microglia mediate a series of immuno-modulating process [4,5] and release inflammatory mediators, such as cytokines and chemokines [6]. Molfino et al. further suggested that neuroinflammation is triggered and long-lasting through the activation of microglia [7].

The activation and regulation of microglia are involved in the pathological development of a variety of central nervous diseases [8–10]. Microglia can be activated to shift the M1/M2 phenotype to trigger different immune modulations [11,12]. M1 phenotype typically secretes pro-inflammatory cytokines and promotes neuroinflammation [13]. The alternative M2 phenotype secretes anti-inflammatory cytokines including TGF-β, IL-10, and IL-4, which are favorable to neurogenesis, while activation of the M2 phenotype promotes the production of anti-inflammatory cytokines such as IL-10 and TGF-β, resulting in anti-neuroinflammation and neurogenesis [14]. Therefore, the modulation of microglia polarization has been suggested as a promising therapeutic approach for neuroinflammation.

Lipopolysaccharide (LPS), an endotoxin, stimulates M1 microglia polarization, while IL-4 or IL-10 modulates the M2 phenotype [15]. M1 inhibitive agents have been used against neurodegenerative diseases and inhibited inflammatory. And the inhibitive agents have few beneficial effects. Therefore, the activation of the M2 phenotype might also play a vital role in improving the beneficial microenvironment in the brain [16].

In a recent study, the transplantation of mesenchymal stem cells (MSCs) has been studied in various neurodegenerative diseases for their immunomodulatory properties. It has been confirmed that paracrine mechanisms are more likely involved in anti-inflammation and immunomodulation. Especially, exosomes (EXOs) may play a vital role in the treatment of several neurodegenerative diseases [17]. MSC-Exos are released from cells with a size of 50–150 nm and pass through the blood–brain barrier freely [18]. MSC-Exos have been considered as essential modulators involved in intercellular communication. EXOs deliver cargos such as RNAs, microRNAs (miRNAs), proteins, and cytokines from the originating cells to the recipient cells, thereby modifying many diseases’ occurrence, progression, and prognosis [19–22]. MSC-Exos deliver their active molecules into microglia through ligand–receptor interaction patterns, direct membrane fusion, endocytosis, or phagocytosis. It has been shown that MSC-Exos have extremely anti-inflammatory and immunosuppressive effects on various neurological diseases through modulating microglia activation [23,24]. Therefore, MSC-Exos have broad possibilities in the treatment of neurodegenerative diseases.

It has been demonstrated that miRNAs might play an essential role in anti-inflammation and immunomodulation by EXOs [25,26]. In recent studies, miR-210 inhibited the inflammatory responses in LPS-induced microglia and regulated the shift of M1/M2 phenotypes.

The function of miR-210 on microglia-induced neuroinflammation has not been fully revealed [27,28]. Therefore, we have focused on EXOs derived from MSCs overexpressing miR-210 that could inhibit neuroinflammation and promote neurogenesis effectively. Furthermore, our study uncovered that Exosomal miR-210 could suppress neuroinflammation and contribute to neurite outgrowth by regulating microglia polarization, meaning Exosomal miR-210 may play an essential role in neuroinflammation.

2 Methods

2.1 Cell culture

MSCs were isolated and cultured in a culture medium. The murine microglial BV2 cell line was purchased from the China Center for Type Culture Collection. The mouse hippocampal neuron cell line HT22 was obtained from the Shanghai iCell Biotechnology Company. The cell culture media are described below: DMEM (for BV2 cells, Invitrogen, USA) or DMEM/F12 (for MSCs, Invitrogen, USA), 10% EXO-depleted fetal bovine serum (Invitrogen, USA), 100 U/mL penicillin–streptomycin solutions (Thermo Fisher Scientific, USA). Cells were seeded in a 25 cm2 cell culture flask at 37°C, 5% CO2. Then the medium was changed every 2 days. When cells reached 80% confluence, they were digested by 0.25% trypsin–ethylenediaminetetraacetic acid (EDTA) digestion (Sigma-Aldrich, USA). The passage 3–4 cells were used for further experiments.

2.2 Isolation and identification of bone mesenchymal stem cells EXO

MSCs cell culture medium was collected every 48 h. First, the collected culture medium was centrifuged at 300×g for 10 min to eliminate the cell pellets at 4°C. Then, the supernatant was centrifuged at 2,000×g for 10 min to further remove the cell debris. Next, the supernatant was again centrifuged at 10,000×g for 30 min. Finally, the cell supernatant was filtered through a 0.22 μm filter (Merck Millipore, Germany) to remove the cell debris.

Next, the supernatant was collected and transferred to new tubes (Beckman, USA). Then the supernatant was ultracentrifuged at 120,000×g in an SW70Ti rotor (Beckman, Pasadena, CA) for 140 min. Next, the phosphate-buffered saline (PBS) resuspended the EXO-enriched pellet and was ultracentrifuged again. Finally, 200 μL cold PBS buffer was used to resuspend the EXOs.

The BCA protein assay kit (Thermo Fisher Scientific, USA) was used to determine the protein content of EXOs. The solution was stored at −80°C.

To analyze the particle size of EXOs, MSC-Exos was detected by NanoSight NS300 (Malvern Instruments, UK). The transmission electron microscopy (TEM) (FEI Tecnai 12, Philips, USA) identified the obtained EXOs. Exosomal surface markers such as CD63, TSG101, and cytochrome C were identified by western blotting.

2.3 miRNA mimic transfection

The resuspended MSCs EXOs were diluted in Gene Pulser® electroporation buffer (Bio-Rad) at a ratio of 1:1. A final amount of 150 pmol of miR-210 mimic or NC mimic (GenePharma) was added to 0.5 μg/mL MSCs EXO sample. The mixture was transferred to a cold 0.2 cm electroporation cuvette and incubated at 100 μF at 0.150 kV. EXOs were treated with one unit of RNase H to eliminate free floating miR-210 mimics outside the EXOs and were re-isolated using Exoquick TC™.

2.4 EXOs uptake assay

Following the manufacturer’s instructions, the MSCs-Exo was labeled with the PKH26 Fluorescent (Thermo Fisher Scientific, USA) (1 µL 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate (DIL) for 100 µL solution). MSCs-Exo was incubated at room temperature for 20 min. Next, the supernatant was abandoned, and the new cold PBS was used to resuspend PKH26-labeled EXOs. According to the protocol, the EXO sample was ultracentrifuged at 100,000×g for 70 min to wash the dye. PKH26-MSCs-Exo/NC mimic or PKH26-MSCs-Exo/miR-210 mimic was co-cultured with microglia for 24 h, and the location of PKH26-MSCs-Exo was observed by fluorescence microscopy (Carl Zeiss, Germany).

2.5 Immunofluorescence staining

The 4% paraformaldehyde fixed cells for 10 min at room temperature. Next, cells were blocked with 5% bovine serum albumin (BSA) for 1 h at room temperature. After that, the antibody of Ym1/2 (ab192029, 1:100; Abcam, UK) and Cox2 (ab179800, 1:100; Abcam, UK) or β-tubulin III (ab18207, 1:2,000: Abcam, UK) was used to incubate the cells for 12 h at 4°C. Next, the cells were washed three times with PBS. Next, the Cy3-conjugated AffiniPure IgG (HL) secondary antibody (1:800, Abcam, UK) was used to treat cells for 1 h in the dark and was washed three times with PBS. Next, the sections were stained by 4′,6-diamidino-2-phenylindole (DAPI) for 5 min and were detected using an Afv10i confocal microscope (Keyence, Japan) at 495, 565, and 400 nm. The expressions of COX2 and Ym1/2, the axon length, and neurite branches of neuronal cells were quantitatively analyzed using ImageJ (ImageJ 1.48v, NIH).

2.6 Flow cytometry

After LPS treatment, neuronal cells were cultured with Exo/NC mimic or Exo/miR-210 mimic. Then, the cells were suspended using trypsin–EDTA and centrifuged at 1,000 rpm for 5 min. Next, the cells were washed using cooled PBS. Thereafter, the cells were stained with fluorescein isothiocyanate-conjugated annexin-V and phycoerythrin-conjugated propidium iodide from the Annexin-V staining kit (BD Pharmingen™, USA) [29]. After incubation, the samples were detected by BD FACSuite (BD Life Sciences, USA).

2.7 Western blotting

The protein extraction kit (KeyGEN, China) extracted proteins from the EXOs or cells. Then, a BCA assay kit (Thermo Fisher Scientific, USA) detected the concentrations of proteins. The antibody of β-actin (#3700, 1:5,000, CST, USA) was used as a loading control. About 15 μg of protein was separated by 10% SDS-PAGE and transferred to PVDF membranes (EpiZyme, China). Next, the membranes blocked the non-specific antigen in 5% BSA for 1 h at room temperature. After that, the membranes were incubated with specific antibodies at 4°C for 12 h. Then, the membranes were washed with tris buffered saline with Tween-20 three times, and followed by incubation with secondary antibodies (1:5,000, Abcam, USA) for 2 h. After washing, the bands were detected using Gel-Pro Analyzer software (Media Cybernetics, USA).

2.8 Quantitative real-time PCR

According to the manufacturer’s instructions, total RNA was extracted from the cells or EXOs using RNAiso (Takara, Otsu, Japan). SYBR-Green qPCR Mix (Nanjing, China) was used for qPCR mRNA quantification. The abundance of miR-210, TNF-α, IL-1β, iNOS, IL-4, CD206, Arg1, TGF-β normalized to U6 small nuclear RNA or GAPDH. Moreover, we analyzed the data using the formula of 2−ΔΔCt. Appropriate primers are listed in Table A1.

2.9 CCK-8 assay

The 96-well cell culture plate was used in the CCK-8 assay. First, microglia were plated into a cell culture plate with 2,500 cells per well. Next, the CCK-8 solution (Sigma-Aldrich, USA) was added to the plate and incubated at 37°C for 1 h. After that, cells were measured at 450 nm OD values using a Microplate Reader (Bio-Rad, USA).

2.10 Analysis of total nitric oxide (NO) concentration

As we all know, the stable products of NO metabolism are nitrite ( NO 2 − ) and nitrate ( NO 3 − ) [30]. Therefore, NO 2 − and NO 3 − are used to detect the concentration of NO. The supernatant of LPS-stimulated microglia was collected, and the nitrite concentration was measured according to Griess (Sigma-Aldrich, Germany) reaction. NO concentrations were detected by spectrophotometric analysis at 540 nm (Biogenet, Austria).

2.11 Enzyme-linked immunosorbent assay (ELISA)

Biomarkers were quantified using commercial ELISA kits following the manufacturer’s instructions (Sino Biological Inc., China), and a four-parameter logistic curve was used to fit the standard curve. ELISA kits were used to determine the different IL-6, IL-10, IL-1, and TNF-α levels. A well for samples to be determined, a standard well, and a blank well were set. No enzyme-labeled reagent or sample was added, and 100 µL of samples and 100 µL of standards were added into the well for samples to be determined and standard well, respectively, and mixed well. The supernatant was incubated at 37°C for 1 h. Next, the liquid was discarded, the plate was patted dry, and 100 µL each of fluid A and fluid B was added. Within the last 5 min of the reaction, the OD value of each well was measured sequentially under a standard enzyme instrument (MB-530, China) at a wavelength of 450 nm.

2.12 Statistical analysis

We expressed the data as mean ± SD. The results were performed using GraphPad Prism (GraphPad Software, USA). ANOVA was used for comparisons among multiple groups and unpaired t-test was used for comparisons between two groups. We detected the differences between the two groups via Student’s t-tests. Differences were considered statistically significant at a value of P < 0.05. Each experiment was repeated three times.

3 Results

3.1 Isolation and identification of EXOs

EXOs were detached from the cultured media of MSCs. First, the EXOs purified were investigated by TEM, nanoparticle tracking analysis, and western blotting. As shown in Figure 1a, typical spherical structures were observed by TEM. Then, nanoparticle tracking analysis showed that these exosomals ranged from 50 and 180 nm in diameter (Figure 1b). Finally, western blotting analysis detected that the EXOs expressed specific surface markers such as TSG101 and CD63, but no expression of the cell-specific marker cytochrome C was detected (Figure 1c).

Figure 1 Isolation and identification of MSC-Exos. (a) EXOs morphology revealed by TEM. (b) Particle size distribution measured by nanoparticle tracking analysis. (c) Western blot analysis of EXO surface markers CD63, TSG101, and cytochrome C (n = 3). (d) qRT-PCR analysis of miR-210 in MSCs and EXOs: MSCs/NC mimic, MSCs/miR-210 mimic, Exo/NC mimic, Exo/miR-210 mimic (n = 3). **P < 0.01, ***P < 0.001 vs MSC/NC mimic.
Figure 1

Isolation and identification of MSC-Exos. (a) EXOs morphology revealed by TEM. (b) Particle size distribution measured by nanoparticle tracking analysis. (c) Western blot analysis of EXO surface markers CD63, TSG101, and cytochrome C (n = 3). (d) qRT-PCR analysis of miR-210 in MSCs and EXOs: MSCs/NC mimic, MSCs/miR-210 mimic, Exo/NC mimic, Exo/miR-210 mimic (n = 3). **P < 0.01, ***P < 0.001 vs MSC/NC mimic.

To detect the microRNA expression of miR-210 in miR-210 transfected MSCs, we used qRT-PCR analysis to determine the miR-210 content in MSCs/NC mimic or MSCs/miR-210 mimic group. Next, we used the qRT-PCR method to detect miR-210 content in the two groups, including Exo/NC mimic and Exo/miR-210 mimic. The qRT-PCR analysis showed that the expression level of miR-210 increased in Exo/miR-210 mimic group compared with Exo/NC mimic group (Figure 1d) (P < 0.01)

3.2 MSC-Exos localization in microglia

To determine if microglia can take MSC-Exos, we used PKH26-MSC-Exos to co-culture with target microglia for 24 h in vitro. Fluorescence microscopy observed that PKH26-MSC-Exos had been taken up by BV2 microglia, indicating the uptake of PKH26-labeled EXOs into the recipient microglia (Figure 2a).

Figure 2 MSC-Exos localization in microglia. Dil-MSC-Exos were co-cultured with microglia for 24 h. (a) Representative immunofluorescence image showing Dil-labeled (red) MSC-Exos inside microglia and with the nuclei stained with DAPI (blue) (n = 3). Scale bar: 50 μm. (b) Gene expression of miR-210 as measured by qRT-PCR (n = 3). ***P < 0.001 vs Exo/NC mimic.
Figure 2

MSC-Exos localization in microglia. Dil-MSC-Exos were co-cultured with microglia for 24 h. (a) Representative immunofluorescence image showing Dil-labeled (red) MSC-Exos inside microglia and with the nuclei stained with DAPI (blue) (n = 3). Scale bar: 50 μm. (b) Gene expression of miR-210 as measured by qRT-PCR (n = 3). ***P < 0.001 vs Exo/NC mimic.

After that, qRT-PCR analysis was applied to analyze expression level of miR-210. As we expected, the expression level of miR-210 increased in the Exo/miR-210 mimic group compared with Exo/miR-NC mimic group (Figure 2b).

3.3 Exosomal miR-210 inhibited the production of NO and pro-inflammatory cytokines

A CCK‐8 assay detected that LPS treatment down-regulated neuronal cell viability compared to the control group (P < 0.05). Compared with the LPS group, Exo/miR-210 mimic treatment promoted neuronal cell viability (P < 0.05) (Figure 3a). In addition, LPS treatment promoted M1-related NO production, which plays an essential role in inflammatory regulation [31]. Therefore, we determined the inhibitory effect of Exo/miR-210 mimic on NO concentration in LPS-stimulated microglia. LPS treatment significantly promoted the production of NO in the LPS group (P < 0.05), and treatment with Exo/miR-210 mimic significantly reduced the NO production (Figure 3b) (P < 0.05).

Figure 3 Exosomal miR-210 inhibited LPS-induced NO production and the secretion of pro-inflammatory cytokines. Microglia were stimulated with LPS, followed by Exo/NC mimic or Exo/miR-210 mimic. (a) Viability of microglia assessed using the CCK‐8 method (n = 3). (b) NO assay in the supernatant of microglia (n = 3). (c) Concentrations of TNF-α, IL-6, IL-1β, and IL-10 were determined by ELISA analysis (n = 3). ***P < 0.001 vs Control; #P < 0.05, ###P < 0.001 vs LPS + Exo/NC mimic.
Figure 3

Exosomal miR-210 inhibited LPS-induced NO production and the secretion of pro-inflammatory cytokines. Microglia were stimulated with LPS, followed by Exo/NC mimic or Exo/miR-210 mimic. (a) Viability of microglia assessed using the CCK‐8 method (n = 3). (b) NO assay in the supernatant of microglia (n = 3). (c) Concentrations of TNF-α, IL-6, IL-1β, and IL-10 were determined by ELISA analysis (n = 3). ***P < 0.001 vs Control; #P < 0.05, ###P < 0.001 vs LPS + Exo/NC mimic.

After that, we evaluated the effects of Exo/miR-210 mimic on the LPS-induced expression of inflammatory factors such as TNF-α, IL-1β, IL-6, and IL-10, which play a vital role in neuroinflammation diseases. The results showed that LPS treatment significantly promoted the expression of TNF-α, IL-6, and IL-1β, while the production of IL-10 decreased in the supernatants of the cells (Figure 3c) (P < 0.05). However, Exo/miR-210 mimic were more effective in inhibiting the production of TNF-α, IL-1β, and IL-6 (Figure 3c). Whereas, Exo/miR-210 mimic restores LPS-induced decrease of the production of IL-10 (Figure 3c). In addition, we used an ELISA assay to determine the levels of a pro-inflammatory factor in the microglia supernatant (Figure 3c). The results showed that Exosomal miR-210 significantly reduced the LPS-induced production of pro-inflammatory factors. Exo/miR-210 mimic inhibited the expression of pro-inflammatory cytokines such as IL-6, TNF-α, and IL-1β (P < 0.05). The results also showed that Exosomal miR-210 treatment increased the anti-inflammatory cytokines IL-10 compared to the microglia supernatant (P < 0.01).

3.4 Exosomal miR-210 promoted M1 to M2 phenotypic shift of BV2 microglia cells

Once the stimuli occur in microglia, the cells show two different polarization states after activation. M1 phenotype promote the production of pro-inflammatory cytokines. In addition, the M2 phenotype increases the expression of anti-inflammatory factors [32,33].

Edaravone plays protective effects on LPS-induced microglia by switching M1/M2 phenotypes and regulating NLRP3 inflammasome activation. TNF-α, iNOS, and IL-1β are specific markers of M1 phenotypes. The specific markers of M2 microglia are IL-4, CD206, Arg1, and TGF-β. To determine the beneficial functions of Exosomal miR-210 on the phenotypic conversion of microglia, we measured TNF-α, iNOS, IL-1β, IL-4, CD206, Arg1, and TGF-β expressions by qRT-PCR. As shown in Figure 4, the mRNA expression of TNF-α, iNOS, and IL-1β increased in activated microglia. Conversely, Exosomal miR-210 could inhibit LPS-induced microglia activation and the mRNA expression of M1-specific membrane markers such as TNF-α, iNOS, and IL-1β decreased (Figure 4a) (P < 0.01).

Figure 4 Exosomal miR-210 promoted M1 to M2 phenotypic conversion of microglia. Microglia were stimulated with LPS, followed by treatment with Exo/NC mimic or Exo/miR-210 mimic. (a, b) Expression of M1/M2 markers were determined by qRT-PCR (n = 3). (c) Representative images immunostained for M1 microglia and M2 microglia. Cox2 and Ym1/2 expressions per cell were quantified (n = 3). **P < 0.05, ***P < 0.001 vs Control; ##P < 0.01, ###P < 0.001 vs LPS + Exo/NC mimic.
Figure 4

Exosomal miR-210 promoted M1 to M2 phenotypic conversion of microglia. Microglia were stimulated with LPS, followed by treatment with Exo/NC mimic or Exo/miR-210 mimic. (a, b) Expression of M1/M2 markers were determined by qRT-PCR (n = 3). (c) Representative images immunostained for M1 microglia and M2 microglia. Cox2 and Ym1/2 expressions per cell were quantified (n = 3). **P < 0.05, ***P < 0.001 vs Control; ##P < 0.01, ###P < 0.001 vs LPS + Exo/NC mimic.

In contrast, the mRNA expression of M2-specific markers such as IL-4, CD206, Arg1, and TGF-β decreased in LPS-induced microglia, while the mRNA expression of M2 phenotype increased in the Exo/miR-210 mimic treatment group (Figure 4b) (P < 0.01). Immunofluorescent staining was used to determine the protein expression of M1-associated Cox2 and M2-associated Ym1/2 markers. After Exosomal miR-210 treatment, the number of Cox2 positive microglia decreased, and Ym1/2 positive microglia increased (Figure 4c). In summary, the data showed that Exosomal miR-210 may promote the transition of microglia from a pro-inflammatory M1 phenotype to an anti-inflammatory M2 phenotype in vitro.

3.5 Exosomal miR-210 enhances the cellular activity of LPS-induced neurons and inhibits apoptosis

Neuronal inflammation plays a vital role in neuronal cell dysfunction and apoptosis. A CCK‐8 assay revealed that Exosomal miR-210 promoted the viability of neuronal HT22 cells when compared to cells in the LPS + Exo/NC mimic group (Figure 5a) (P < 0.05).

Figure 5 Exosomal miR-210 inhibited microglia-mediated neuroinflammation and reduced neuronal apoptosis. (a) Viability of neuronal HT22 cells was assessed using the CCK‐8 method. (b) Percentage of apoptotic neuronal HT22 cells was assessed using flow cytometry (n = 3). (c) Representative immunoblots were probed with antibodies against Cleaved‐caspase-3, caspase-3, and β‐actin (n = 3). Quantification of the level of Cleaved‐caspase-3 normalized to β‐actin. Quantification of the level of caspase-3 normalized to β‐actin. ***P < 0.001 vs Control; #P < 0.05, ##P < 0.01, ###P < 0.001 vs LPS + Exo/NC mimic.
Figure 5

Exosomal miR-210 inhibited microglia-mediated neuroinflammation and reduced neuronal apoptosis. (a) Viability of neuronal HT22 cells was assessed using the CCK‐8 method. (b) Percentage of apoptotic neuronal HT22 cells was assessed using flow cytometry (n = 3). (c) Representative immunoblots were probed with antibodies against Cleaved‐caspase-3, caspase-3, and β‐actin (n = 3). Quantification of the level of Cleaved‐caspase-3 normalized to β‐actin. Quantification of the level of caspase-3 normalized to β‐actin. ***P < 0.001 vs Control; #P < 0.05, ##P < 0.01, ###P < 0.001 vs LPS + Exo/NC mimic.

To detect the effects of Exosomal miR-210 on LPS-stimulated neuronal apoptosis, we used flow cytometry to identify apoptotic neurons. After Exo/miR-210 mimic treatment, the number of apoptotic cells decreased compared with the LPS + Exo/NC mimic group (Figure 5b) (P < 0.05). Furthermore, as shown in Figure 5c, western blotting showed that LPS promoted proapoptotic proteins, including cleaved caspase-3 and caspase-3, and the treatment of Exosomal miR-210 inhibited the protein expression of cleaved caspase-3 and caspase-3 (Figure 5c) (P < 0.05). Taken together, these data indicated that Exosomal miR-210 may be involved in inhibiting the development of neuroinflammatory response.

3.6 Exosomal miR-210 promoted neurogenesis

To detect the effects of Exosomal miR-210 on neurogenesis, we observed the therapeutic effect on neuronal cells. Compared with the control group, LPS treatment decreased β3-tubulin favorable neurite elongation. In addition, the treatment of Exosomal miR-210 extraordinarily increased the length of the β3-tubulin-positive neuronal cell (Figure 6a) (P < 0.05). These neurons were stained with a β3-tubulin antibody. The number of neurite branches is defined as the number of neurites on the neurons’ somatic cells. Select three neurons with the largest number of neurites in each group of visual fields, count their number of neurite branches, and calculate the average value. In addition, the length of the neurite is defined as the length from the somatic cell of the neuron to the end of the neurite. Three neurons with the longest neurites in each group were selected, and the length of neurites was measured using the ruler function of imageJ. The treatment of LPS significantly decreased the length of neuronal cells and the number of branches (P < 0.05). Exosomal miR-210 treatment rescued the reduction in the neurite length and neurite branching (Figure 6b) (P < 0.05). A recent study determined that the p-Tau protein played a vital role in neuronal apoptosis. Aberrant expression and denaturation of Tau and APP can lead to neuronal cell death [34]. Compared with the control group, LPS increased RhoA, APP, and p-Tau protein. To evaluate the Exosomal miR-210 effect on the formation of RhoA, APP, and p-Tau, western blots confirmed that Exosomal miR-210 decreased RhoA, APP, and p-tau protein levels (Figure 6c).

Figure 6 Exosomal miR-210 promoted neurogenesis. (a) Representative images of cultured neuronal cells immunostained with anti-β-tubulin III antibody (n = 3). Scale bars: 50 and 100 μm. (b) Effect of Exosomal miR-210 on the axonal length and neurite branching in neuronal cells. Axonal length in different groups measured via imageJ. The average of three counts was calculated for the axonal length, and all the samples were analyzed over 30 cells per experiment (n = 3). (c) Detection of RhoA, APP, and p-Tau in the brain by western blot (n = 3). **P < 0.01, ***P < 0.001 vs Control; #P < 0.05, ##P < 0.01, ###P < 0.001 vs LPS + Exo/NC mimic.
Figure 6

Exosomal miR-210 promoted neurogenesis. (a) Representative images of cultured neuronal cells immunostained with anti-β-tubulin III antibody (n = 3). Scale bars: 50 and 100 μm. (b) Effect of Exosomal miR-210 on the axonal length and neurite branching in neuronal cells. Axonal length in different groups measured via imageJ. The average of three counts was calculated for the axonal length, and all the samples were analyzed over 30 cells per experiment (n = 3). (c) Detection of RhoA, APP, and p-Tau in the brain by western blot (n = 3). **P < 0.01, ***P < 0.001 vs Control; #P < 0.05, ##P < 0.01, ###P < 0.001 vs LPS + Exo/NC mimic.

4 Discussion

This study showed that EXOs from MSCs overexpressing miR-210 play an essential role in inhibiting neuroinflammation. In addition, we analyzed the mechanism of the anti-inflammatory effect of neuroinflammation. The main findings from our study are listed as follows: (1) Exosomal miR-210 inhibited LPS-induced production of NO and pro-inflammatory factors. (2) Exosomal miR-210 derived from MSCs could promote M1/M2 phenotype conversion and transform the pro-inflammatory M1 microglia into beneficial anti-inflammatory M2 microglia. (3) Exosomal miR-210 suppressed microglia-mediated neuroinflammation and reduced neuronal apoptosis. (4) Exosomal miR-210 increased the neurite length and the number of branches. Thus, exosomal miR-210 derived from MSCs promoted neurogenesis.

Our findings reported that Exosomal miR-210 inhibited neuronal inflammation and contributed to neurogenesis through inhibiting microglia M1/M2 phenotype conversion-mediated inflammatory response. In a recent study, MSC-Exos have been determined as an essential factor in the development of neuronal inflammation [23,35]. Furthermore, in the traumatic brain injury model, it has been confirmed that MSCs-derived EXOs significantly promoted neuronal recovery by inhibiting the development of neuroinflammation [36]. They are certain paracrine factors in a nanoscale size and great content (lipids, proteins, mRNA, and miRNAs), enabling them to mediate information exchange between cells and tissues at close and long distances. EXOs are one of the particular paracrine factors in a nanometer size (50–150 nm). Their great contents, including lipids, proteins, and miRNAs, transform the information between cells and tissues. In addition, the EXOs protect during transportation. The recent studies confirmed that microglia could efficiently take in fluorescence-labeled MSCs-Exos in vitro [37]. Furthermore, microglia could take up EXOs by various endocytic pathways, including macropinocytosis and caveolin-mediated uptake [38], even by plasma membrane fusion [39].

As an essential component in MSC-Exos, miRNAs have attracted the attention of researchers [40]. miRNA is a kind of small RNA that combines with target RNA to silence the genes. Therefore, miRNAs may participate in regulating complex signaling networks and have therapeutic potential in neuronal disease. In addition, several miRNAs participate in modulating microglia polarization and regulating M1/M2 phenotype conversion. Zaccagnini et al. found that miR-210 overexpression inhibited inflammation and promoted muscle damage recovery in vivo [41]. In murine macrophages, the treatment of LPS promotes the expression of miR-210, which reduces the secretion of pro-inflammatory cytokine [27]. In the articular cartilage of osteoarthritis rats, miR-210 could inhibit the production of pro-inflammatory factors by regulating the NF-κB signaling pathway.

In summary, these findings suggested that miR-210 could inhibit inflammation. However, MiR-210 has been shown to promote the development of inflammation in acute colitis [42]. In addition, miR-210 inhibits the STAT6/IL-4 anti-inflammatory pathway in cytotrophoblasts and promotes maternal inflammation activation [43]. Thus, in different inflammatory diseases, the regulatory effects of miR-210 may be different.

Generally, we found that the anti-inflammatory properties of Exosomal miR-210 were associated with modulating microglia polarization. Exosomal miR-210 ameliorated the secretion of pro-inflammatory factors and promoted anti-inflammatory factors in LPS-induced BV2 microglia cells. Immunofluorescence staining and the qRT-PCR method showed that Exosomal miR-210 promoted pro-inflammatory M1 phenotype conversion to anti-inflammatory M2 phenotype. Therefore, Exosomal miR-210 may inhibit neuronal inflammation effects through modulating microglia polarization. We determined that miR-210 could reduce microglia-associated inflammation and also extraordinarily protect against the apoptosis of neural cells.

In summary, miR-210 inhibited neuronal inflammation and promoted neurogenesis. However, it modulates these processes through many other mechanisms that are yet to be identified. Therefore, we will explore other mechanisms that may participate in the future regulatory network of microglia polarization and inflammation.

All in all, our findings demonstrate that EXOs derived from MSCs overexpressing miR-210 reduced microglia-associated inflammation and promoted neurogenesis. Therefore, our study provides new insight into a potential therapeutic target of miR-210 in the modulation of microglia-mediated neuroinflammation, which may be beneficial for treating cerebrovascular and neurodegenerative disorders.

However, our study still has some limitations. For example, whether miR-210 mimic can affect the inflammatory level of nerve cells through the polarization of microglia has not been verified at the in vivo level. In addition, miR-210 influences neuronal or microglial polarization by regulating downstream target genes, which still needs further study.

5 Conclusion

Our study found that Exosomal miR-210 inhibited neuroinflammation and contributes to neurite outgrowth possibly by modulating microglia polarization.

  1. Funding information: Not applicable.

  2. Author contributions: X.L.L. conceived and designed the study. Q.H.X., L.Z., G.Q.W., and Y.G.H. performed the literature search and data extraction. Q.H.X. and X.L.L. drafted the manuscript. All authors read and approved the final manuscript.

  3. Conflict of interest: The authors declare that they have no conflict of interest.

  4. Data availability statement: The raw data supporting the conclusions of this manuscript will be made available by the authors, without undue reservation, to any qualified researcher.

Appendix

Table A1

Primers used in RT-PCR experiments

Primer Forward (5′–3′) Reverse (5′–3′)
Tgf-β GGCACCATCCATGACATGAACCG GCCGTACACAGCAGTTCTTCTCTG
Arg1 GTCTGAACAAGCACTGTGAAAG GGAAGCCAA ATACGACACTAAG
CD206 CCACTCTATCCACCTTCAC GCCTCAATCCAACCAAAC
Il-4 GTAAACGAGGCTTCCTGTC CCCAGAATCCAGTCTTTCC
iNOS TCCTACACCACACCAAAC CTCCAATCTCTGCCTATCC
Il-1β ATCTCACAGCAGCATCTCGACAAG CACACTAGCAGGTCGTCATCATCC
Tnf-α GCATGATCCGAGATGTGGAACTGG CGCCACGAGCAGGAATGAGAAG
Gapdh ATGGGGAAGGTGAAGGTCG GGGGTCATTGATGGCAATA
miR-210 CGCCTGTGCGTGTGACAGCG GTGCAGGGTCCGAGGT
U6 CTCGCTTCGGCAGCACATATACTA ACGAATTTGCGTGTCATCCTTGC

References

[1] Asslih S, Damri O, Agam G. Neuroinflammation as a common denominator of complex diseases (cancer, diabetes type 2, and neuropsychiatric disorders). Int J Mol Sci. 2021;22(11):6138. 10.3390/ijms22116138.Search in Google Scholar PubMed PubMed Central

[2] Yang QQ, Zhou JW. Neuroinflammation in the central nervous system: symphony of glial cells. Glia. 2019;67(6):1017–35. 10.1002/glia.23571.Search in Google Scholar PubMed

[3] Tan L, Li J, Wang Y, Tan R. Anti-neuroinflammatory effect of alantolactone through the suppression of the NF-kappaB and MAPK signaling pathways. Cells. 2019;8(7):739. 10.3390/cells8070739.Search in Google Scholar PubMed PubMed Central

[4] Orihuela R, McPherson CA, Harry GJ. Microglial M1/M2 polarization and metabolic states. Br J Pharmacol. 2016;173(4):649–65. 10.1111/bph.13139.Search in Google Scholar PubMed PubMed Central

[5] Mosser CA, Baptista S, Arnoux I, Audinat E. Microglia in CNS development: shaping the brain for the future. Prog Neurobiol. 2017;149–150:1–20. 10.1016/j.pneurobio.2017.01.002.Search in Google Scholar PubMed

[6] Arroyo DS, Gaviglio EA, Peralta Ramos JM, Bussi C, Rodriguez-Galan MC, Iribarren P. Autophagy in inflammation, infection, neurodegeneration and cancer. Int Immunopharmacol. 2014;18(1):55–65. 10.1016/j.intimp.2013.11.001.Search in Google Scholar PubMed PubMed Central

[7] Molfino A, Gioia G, Rossi Fanelli F, Laviano A. Contribution of neuroinflammation to the pathogenesis of cancer cachexia. Mediators Inflamm. 2015;2015:801685. 10.1155/2015/801685.Search in Google Scholar PubMed PubMed Central

[8] Tang Y, Le W. Differential roles of M1 and M2 microglia in neurodegenerative diseases. Mol Neurobiol. 2016;53(2):1181–94. 10.1007/s12035-014-9070-5.Search in Google Scholar PubMed

[9] Salter MW, Stevens B. Microglia emerge as central players in brain disease. Nat Med. 2017;23(9):1018–27. 10.1038/nm.4397.Search in Google Scholar PubMed

[10] Perry VH, Nicoll JA, Holmes C. Microglia in neurodegenerative disease. Nat Rev Neurol. 2010;6(4):193–201. 10.1038/nrneurol.2010.17.Search in Google Scholar PubMed

[11] Saijo K, Glass CK. Microglial cell origin and phenotypes in health and disease. Nat Rev Immunol. 2011;11(11):775–87. 10.1038/nri3086.Search in Google Scholar PubMed

[12] Geloso MC, Corvino V, Marchese E, Serrano A, Michetti F, D’Ambrosi N. The dual role of microglia in ALS: mechanisms and therapeutic approaches. Front Aging Neurosci. 2017;9:242. 10.3389/fnagi.2017.00242.Search in Google Scholar PubMed PubMed Central

[13] Mantovani A, Biswas SK, Galdiero MR, Sica A, Locati M. Macrophage plasticity and polarization in tissue repair and remodelling. J Pathol. 2013;229(2):176–85. 10.1002/path.4133.Search in Google Scholar PubMed

[14] Hu X, Leak RK, Shi Y, Suenaga J, Gao Y, Zheng P, et al. Microglial and macrophage polarization-new prospects for brain repair. Nat Rev Neurol. 2015;11(1):56–64. 10.1038/nrneurol.2014.207.Search in Google Scholar PubMed PubMed Central

[15] Miron VE, Boyd A, Zhao JW, Yuen TJ, Ruckh JM, Shadrach JL, et al. M2 microglia and macrophages drive oligodendrocyte differentiation during CNS remyelination. Nat Neurosci. 2013;16(9):1211–8. 10.1038/nn.3469.Search in Google Scholar PubMed PubMed Central

[16] Miguel-Álvarez M, Santos-Lozano A, Sanchis-Gomar F, Fiuza-Luces C, Pareja-Galeano H, Garatachea N, et al. Non-steroidal anti-inflammatory drugs as a treatment for Alzheimer’s disease: a systematic review and meta-analysis of treatment effect. Drugs Aging. 2015;32(2):139–47. 10.1007/s40266-015-0239-z.Search in Google Scholar PubMed

[17] Yang X, Yang J, Lei P, Wen T. LncRNA MALAT1 shuttled by bone marrow-derived mesenchymal stem cells-secreted exosomes alleviates osteoporosis through mediating microRNA-34c/SATB2 axis. Aging (Albany NY). 2019;11(20):8777–91. 10.18632/aging.102264.Search in Google Scholar PubMed PubMed Central

[18] Guo S, Perets N, Betzer O, Ben-Shaul S, Sheinin A, Michaelevski I, et al. Intranasal delivery of mesenchymal stem cell derived exosomes loaded with phosphatase and tensin homolog siRNA repairs complete spinal cord injury. ACS Nano. 2019;13(9):10015–28. 10.1021/acsnano.9b01892.Search in Google Scholar PubMed

[19] Zhang D, Lee H, Wang X, Rai A, Groot M, Jin Y. Exosome-mediated small RNA delivery: a novel therapeutic approach for inflammatory lung responses. Mol Ther. 2018;26(9):2119–30. 10.1016/j.ymthe.2018.06.007.Search in Google Scholar PubMed PubMed Central

[20] Yuan FL, Wu QY, Miao ZN, Xu MH, Xu RS, Jiang DL, et al. Osteoclast-derived extracellular vesicles: novel regulators of osteoclastogenesis and osteoclast-osteoblasts communication in bone remodeling. Front Physiol. 2018;9:628. 10.3389/fphys.2018.00628.Search in Google Scholar PubMed PubMed Central

[21] Mears R, Craven RA, Hanrahan S, Totty N, Upton C, Young SL, et al. Proteomic analysis of melanoma-derived exosomes by two-dimensional polyacrylamide gel electrophoresis and mass spectrometry. Proteomics. 2004;4(12):4019–31. 10.1002/pmic.200400876.Search in Google Scholar PubMed

[22] Marote A, Teixeira FG, Mendes-Pinheiro B, Salgado AJ. MSCs-derived exosomes: cell-secreted nanovesicles with regenerative potential. Front Pharmacol. 2016;7:231. 10.3389/fphar.2016.00231.Search in Google Scholar PubMed PubMed Central

[23] Thomi G, Surbek D, Haesler V, Joerger-Messerli M, Schoeberlein A. Exosomes derived from umbilical cord mesenchymal stem cells reduce microglia-mediated neuroinflammation in perinatal brain injury. Stem Cell Res Ther. 2019;10(1):105. 10.1186/s13287-019-1207-z.Search in Google Scholar PubMed PubMed Central

[24] Mathew B, Ravindran S, Liu X, Torres L, Chennakesavalu M, Huang CC, et al. Mesenchymal stem cell-derived extracellular vesicles and retinal ischemia-reperfusion. Biomaterials. 2019;197:146–60. 10.1016/j.biomaterials.2019.01.016.Search in Google Scholar PubMed PubMed Central

[25] Zilun W, Shuaihua Q, Jinxuan Z, Yihai L, Qiaoling L, Zhonghai W, et al. Corrigendum to “miRNA-181a over-expression in mesenchymal stem cell-derived exosomes influenced inflammatory response after myocardial ischemia-reperfusion injury” [Life Sci. 232 (2019) 116632]. Life Sci. 2020;256:118045. 10.1016/j.lfs.2020.118045.Search in Google Scholar PubMed

[26] Toh WS, Lai RC, Hui JHP, Lim SK. MSC exosome as a cell-free MSC therapy for cartilage regeneration: implications for osteoarthritis treatment. Semin Cell Dev Biol. 2017;67:56–64. 10.1016/j.semcdb.2016.11.008.Search in Google Scholar PubMed

[27] Zhang D, Cao X, Li J, Zhao G. MiR-210 inhibits NF-kappaB signaling pathway by targeting DR6 in osteoarthritis. Sci Rep. 2015;5:12775. 10.1038/srep12775.Search in Google Scholar PubMed PubMed Central

[28] Li B, Dasgupta C, Huang L, Meng X, Zhang L. MiRNA-210 induces microglial activation and regulates microglia-mediated neuroinflammation in neonatal hypoxic-ischemic encephalopathy. Cell Mol Immunol. 2020;17(9):976–91. 10.1038/s41423-019-0257-6.Search in Google Scholar PubMed PubMed Central

[29] Woo JS, Yoo ES, Kim SH, Lee JH, Han SH, Jung SH, et al. Anticancer effects of oleanolic acid on human melanoma cells. Chem Biol Interact. 2021;347:109619. 10.1016/j.cbi.2021.109619.Search in Google Scholar PubMed

[30] Petkovic AM, Jakovljevic VL, Bradic JV, Jeremic JN, Jeremic NS, Nikolic Turnic TR, et al. The effects of potassium cyanide on the functional recovery of isolated rat hearts after ischemia and reperfusion: the role of oxidative stress. Oxid Med Cell Longev. 2018;2018:5979721. 10.1155/2018/5979721.Search in Google Scholar PubMed PubMed Central

[31] Jang E, Lee S, Kim JH, Kim JH, Seo JW, Lee WH, et al. Secreted protein lipocalin-2 promotes microglial M1 polarization. FASEB J: Off Publ Fed Am Soc Exp Biol. 2013;27(3):1176–90. 10.1096/fj.12-222257.Search in Google Scholar PubMed

[32] Tian X, Liu H, Xiang F, Xu L, Dong Z. Beta-caryophyllene protects against ischemic stroke by promoting polarization of microglia toward M2 phenotype via the TLR4 pathway. Life Sci. 2019;237:116915. 10.1016/j.lfs.2019.116915.Search in Google Scholar PubMed

[33] Hoshi T, Toyama T, Shinozaki Y, Koizumi S, Lee JY, Naganuma A, et al. Evaluation of M1-microglial activation by neurotoxic metals using optimized organotypic cerebral slice cultures. J Toxicol Sci. 2019;44(7):471–9. 10.2131/jts.44.471.Search in Google Scholar PubMed

[34] van der Kant R, Goldstein LSB, Ossenkoppele R. Amyloid-beta-independent regulators of tau pathology in Alzheimer disease. Nat Rev Neurosci. 2020;21(1):21–35. 10.1038/s41583-019-0240-3.Search in Google Scholar PubMed

[35] Xian P, Hei Y, Wang R, Wang T, Yang J, Li J, et al. Mesenchymal stem cell-derived exosomes as a nanotherapeutic agent for amelioration of inflammation-induced astrocyte alterations in mice. Theranostics. 2019;9(20):5956–75. 10.7150/thno.33872.Search in Google Scholar PubMed PubMed Central

[36] Zhang Y, Chopp M, Meng Y, Katakowski M, Xin H, Mahmood A, et al. Effect of exosomes derived from multipluripotent mesenchymal stromal cells on functional recovery and neurovascular plasticity in rats after traumatic brain injury. J Neurosurg. 2015;122(4):856–67. 10.3171/2014.11.JNS14770.Search in Google Scholar PubMed PubMed Central

[37] Mulcahy LA, Pink RC, Carter DR. Routes and mechanisms of extracellular vesicle uptake. J Extracell Vesicles. 2014;3:1. 10.3402/jev.v3.24641.Search in Google Scholar PubMed PubMed Central

[38] Zhao Y, Gan Y, Xu G, Yin G, Liu D. MSCs-derived exosomes attenuate acute brain injury and inhibit microglial inflammation by reversing CysLT2R-ERK1/2 mediated microglia M1 polarization. Neurochem Res. 2020;45(5):1180–90. 10.1007/s11064-020-02998-0.Search in Google Scholar PubMed

[39] Samanta S, Rajasingh S, Drosos N, Zhou Z, Dawn B, Rajasingh J. Exosomes: new molecular targets of diseases. Acta Pharmacol Sin. 2018;39(4):501–13. 10.1038/aps.2017.162.Search in Google Scholar PubMed PubMed Central

[40] Ailawadi S, Wang X, Gu H, Fan GC. Pathologic function and therapeutic potential of exosomes in cardiovascular disease. Biochim Biophys Acta. 2015;1852(1):1–11. 10.1016/j.bbadis.2014.10.008.Search in Google Scholar PubMed PubMed Central

[41] Zaccagnini G, Maimone B, Fuschi P, Maselli D, Spinetti G, Gaetano C, et al. Overexpression of miR-210 and its significance in ischemic tissue damage. Sci Rep. 2017;7(1):9563. 10.1038/s41598-017-09763-4.Search in Google Scholar PubMed PubMed Central

[42] Bakirtzi K, Law IK, Xue X, Iliopoulos D, Shah YM, Pothoulakis C. Neurotensin promotes the development of colitis and intestinal angiogenesis via Hif-1alpha-miR-210 signaling. J immunol (Baltimore, MD: 1950). 2016;196(10):4311–21. 10.4049/jimmunol.1501443.Search in Google Scholar PubMed PubMed Central

[43] Kopriva SE, Chiasson VL, Mitchell BM, Chatterjee P. TLR3-induced placental miR-210 down-regulates the STAT6/interleukin-4 pathway. PLoS One. 2013;8(7):e67760. 10.1371/journal.pone.0067760.Search in Google Scholar PubMed PubMed Central

Received: 2022-03-28
Revised: 2022-10-26
Accepted: 2022-11-18
Published Online: 2023-01-04

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
https://doi.org/10.1515/med-2022-0618
Keywords for this article
exosomes; mesenchymal stem cells; microglia polarization; miR-210
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 8.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2022-0618/html
Scroll to top button