Home Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
Article Open Access

Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation

  • Xinyuan Han , Shunda Wang , Zhijun Yong , Xueting Zhang , Xuanqi Wang and Penghua You EMAIL logo
Published/Copyright: May 12, 2023
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 18 Issue 1

Abstract

Atrial fibrosis is involved in the progression of atrial fibrillation (AF). miR-499-5p is the most downregulated microRNA in arrhythmogenic cardiomyopathy hearts. Sry-related high-mobility-group box 6 (SOX6) is associated with apoptosis, inflammatory responses, and fibrosis. This study investigated the mechanism of miR-499-5p in ameliorating AF rats by regulating SOX6. AF rat models were established by injecting Ach–CaCl2 mixture, and the rats were treated with Lv-miR-499-5p/oe-SOX6/si-SOX6 before modeling. AF duration was recorded using electrocardiogram. miR-499-5p and SOX6 expression levels in the myocardium were determined by reverse transcription-quantitative polymerase chain reaction. The binding of miR-499-5p and SOX6 was validated. The atrial fibrosis degree and cardiomyocyte apoptosis were assessed using the Masson and terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling staining methods. Levels of SOX6, atrial fibrosis markers (collage I/α-SMA/TGFβ1), cell cycle-related proteins (p21/CDC25/Cyclin B1), and cell senescence markers (SA-β-gal/γ-H2AX) were measured using Western blotting and immunohistochemistry. miR-499-5p was downregulated and SOX6 was upregulated in AF rats. miR-499-5p overexpression shortened the AF duration, alleviated atrial fibrosis, and decreased collage I/α-SMA/TGFβ1. miR-499-5p targeted SOX6 to ameliorate atrial fibrosis. AF rats exhibited increased p21/CDC25/Cyclin B1/SA-β-gal/γ-H2AX levels and raised cardiomyocyte apoptosis. SOX6 silencing downregulated p21 and alleviated cardiomyocyte cycle arrest, cell senescence, and apoptosis in AF rats. Shortly, miR-499-5p suppresses atrial fibrosis and cardiomyocyte senescence by targeting SOX6 and downregulating p21, thus mitigating AF in rats.

Graphical abstract

Keywords: atrial fibrillation; atrial fibrosis; miR-499-5p; SOX6; p21; cell senescence; apoptosis; microRNA

1 Introduction

Atrial fibrillation (AF) is a complicated cardiomyopathy based on arrhythmia substrates, which undermines the quality of life and functional status and increases mortality due to atrioventricular dyssynchrony, altered hemodynamics, progressive atrial and ventricular mechanical dysfunction, and thromboembolic complications [1,2]. AF roughly affects more than 33 million people worldwide, and its attack rate increases with age, with an estimated lifetime risk exceeding 30% [3]. In mechanism, atrial remodeling occupies the central link in AF pathogenesis, and atrial fibrosis, the most pivotal pathological change of atrial remodeling, severely disrupts the continuity of myocardial electrical conduction, results in local conduction disorders, and promotes the occurrence and maintenance of AF, making its degree a paramount indicator for evaluating AF [4,5]. Intrinsically, atrial fibrosis consists of numerous individual and multifactorial processes caused by complicated interactions between various neurohormonal and cellular mediators and is manifested in response to diverse cardiac injurious stimuli, which is featured primarily by the enormous deposition of extracellular matrix [6,7]. Consequently, novel and effective molecules targeting atrial fibrosis are of considerable importance for the treatment and management of AF.

microRNAs (miRNAs) are short, single-stranded RNAs with roughly 22 nucleotides in length that anneal with sequences primarily located in 3′-UTR of mRNA, which contribute to mRNA degradation and translation inhibition to suppress protein expression, and exert prominent roles in cardiovascular disorders [8]. miRNAs emerge as potent biomarkers for AF diagnosis owing to their strong stability and easy availability in atrial tissues and circulating blood, and they are exceedingly involved in AF etiology by regulating atrial remodeling and atrial fibrosis [9,10]. Interestingly, a transcriptomic analysis of atrial samples from human AF individuals has uncovered the 2-fold upregulation of miR-223, miR-328, and miR-664, but at least 50% downregulation of miR-499 [11]. Calore et al. also have reported that miR-708-5p and miR-217-5p are the most upregulated miRNAs, whereas miR-499-5p is the most downregulated miRNA in arrhythmogenic cardiomyopathy hearts [12]. More importantly, the imperative role of miR-499-5p in fibrosis is unveiled: for instance, Wharton’s jelly-derived mesenchymal stem cells can reduce fibrosis in mouse models of Duchenne muscular dystrophy by upregulating miR-499-5p [13]. miR-499-5p can mitigate pulmonary fibrosis in mice with sepsis-induced lung injury by targeting Sry-related high-mobility-group box 6 (SOX6) [14]. Additionally, there is evidence to illustrate that a myriad of SOX proteins, especially SOX6, is implicated in heart functions [15,16,17]. From the aforementioned findings, it is reasonable to speculate that miR-499-5p may affect AF and regulate atrial fibrosis through SOX6.

It is noteworthy that cardiomyocyte senescence represents a vital contributor to AF and facilitates detrimental atrial remodeling during AF progression [18]. Cell senescence is mainly characterized by increased levels of cell cycle inhibitors p16, p21, and p53 [19,20]. The upregulation of p21 is noted in chronic AF individuals, and p21 is also tightly associated with cardiomyocyte apoptosis [21]. Of utmost interest, previous research has documented an association between p21 and SOX6 in tumors [22,23]. However, the interaction between SOX6 and p21 in AF remains largely an unknown domain. Therefore, with AF rats as the animal models, this study probed into the action of miR-499-5p/SOX6 axis in atrial fibrosis through p21, hoping to provide paramount reference values for AF therapy.

2 Materials and methods

2.1 AF rat modeling and grouping

A total of 48 male Sprague–Dawley rats (weighing 230–250 g) purchased from Vital River (SYXK [Beijing] 2016-0011, Beijing, China) were reared at 22–26°C under 40–60% humidity, with 12 h/12 h light/dark cycles and ad libitum to food and water.

Randomly, 42 rats were selected to establish AF rat models: the rats were subjected to a daily injection of 1 mL/kg mixed solution of acetylcholine (Ach; 60 μL/mL, B50001, leaf source creatures; Beijing Wuyejia Technology, Beijing, China) and CaCl2 (10 mg/mL) through tail veins for 7 days. The presence of standard f-waves and the absence of P-waves during an electrocardiogram (ECG) test can reflect the successful modeling of AF animals [24,25,26]. The remaining six rats were injected with 1 mL/kg normal saline daily via tail veins for 7 days and served as the control group.

The 42 AF rats were randomized to the following seven groups, with six rats per group: (1) AF group; (2) AF + Lv-miR group: subjected to a single injection of lentivirus (Lv)-miR-499-5p [27]; (3) AF + Lv-negative control (NC) group: subjected to a single injection of Lv-NC; (4) AF + Lv-miR + oe-SOX6 group: subjected to a single and simultaneous injection of Lv-miR-499-5p and lentiviral vector-constructed SOX6 overexpression plasmid oe-SOX6; (5) AF + Lv-miR + oe-NC group: subjected to a single and simultaneous injection of Lv-miR-499-5p and oe-NC; (6) AF + si-SOX6 group: subjected to a single injection of SOX6 interference plasmid si-SOX6; and (7) AF + si-NC group: subjected to a single injection of lentiviral vector-constructed si-NC. Lv-miR-499-5p, Lv-NC, oe-SOX6, oe-NC, si-SOX6, and si-NC plasmids were designed and tested for quality by Bio Scientific (Shanghai, China) and injected into rats through the tail vein (all at 2 × 1011 plasmids/rat) at day 14 prior to AF modeling.

After experimentation, AF state in rats was evaluated through ECG. Afterward, experimental rats were euthanized with an intraperitoneal injection of 150 mg/kg of 2% pentobarbital sodium, and the hearts were rapidly removed, rinsed with phosphate-buffered saline (PBS), and preserved in a −80°C freezer for subsequent usage.

2.2 ECG recording and analyzing

Rats were anesthetized with 40 mg/kg pentobarbital sodium. Subsequently, the ECG of the rats was recorded with a standard lead II utilizing the MedLab-U/4C501H biological signal collection system. After the injection of Ach–CaCl2 mixed solution for 7 days, the typical AF ECG showing the absence of P-waves and presence of f-waves was considered the sign of AF occurrence, while the restoration of sinus rhythm, presence of P-waves, and absence of f-waves indicated the AF termination, with the period from occurrence to termination as the duration of AF. The induction time and duration of AF were recorded.

2.3 Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA from rat myocardial tissues was extracted with TRIzol reagents (Invitrogen, Carlsbad, CA, USA). After measuring the RNA concentration with NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA), cDNA synthesis and reaction were performed in a polymerase chain reaction (PCR) amplifier (Thermo Fisher Scientific). RT-qPCR was processed using an ABI7500 qPCR instrument (Thermo Fisher Scientific) under the following conditions: pre-denaturation at 95°C for 10 min and then 45 PCR cycles of denaturation at 95°C for 15 s, annealing at 60°C for 1 min, and extension at 72°C for 10 s. Primers are listed in Table 1 [28,29]. Quantification was performed with the 2−ΔΔCt method [30], with the relative expression normalized to U6 or glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

Table 1

Primer sequences

Gene Forward (5′-3′) Reverse (5′-3′)
miR-499-5p TTAAGACTTGCAGTGATGTTT GTGCAGGGTCCGAGGT
U6 TAAAATCTATACACGACGGCTTCG TACTGTGCGTTTAAGCACTTCGC
SOX6 CCCCTCTGAACATGGTGGTGGC TGAGACTGCCCCTGCCGAGT
GAPDH TCTCCCTCACAATTTCCATCCC TTTTTGTGGGTGCAGCGAAC

2.4 Western blotting

Total protein was extracted from heart tissue using radioimmunoprecipitation assay lysis buffer (Millipore Corporation, Billerica, MA, USA), and total protein concentration in tissues was determined using bicinchoninic acid kits (Beyotime, Shanghai, China). Protein lysate was separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and later transferred onto polyvinylidene fluoride membranes. After 2 h of storage in 5% skim milk, membranes were probed overnight with primary antibodies such as anti-SOX6 (1:500, ab64946; Abcam, Cambridge, MA, USA), anti-collage I (1:1,000, ab138492; Abcam), anti-α-smooth muscle actin (α-SMA; 1:1,000, ab108424; Abcam), anti-transforming growth factor-β1 (TGFβ1; 0.5 μg/mL, ab92486; Abcam), anti-p21 (ab109199, 1/1,000; Abcam), anti-cell division cycle 25 (CDC25; 1:1,000, ab111830; Abcam), and anti-Cyclin B1 (1:200, ab215436; Abcam). Following washing with Tris-buffered saline/Tween 20, the membranes were then incubated with secondary antibody goat anti-rabbit IgG H&L horse radish peroxidase (1:2,000, ab205718; Abcam) for 1 h. Immunoreactive bands were subsequently visualized by enhanced chemiluminescence and later quantified through densitometric analysis (Quantity One; Bio-Rad, Hercules, CA, USA), with GAPDH (1:10,000, ab8245; Abcam) as an internal control.

2.5 Masson staining

The hearts were cut into coronal plane segments, fixed with 4% paraformaldehyde at 4°C, then dried in graded ethanol, and paraffin-embedded, followed by cutting into 4 μm thick sections. The sections were stained with Masson’s trichrome and subsequently imaged using a digital camera on a microscope (Olympus, Tokyo, Japan). ImageJ software (NIH, Bethesda, MD, USA) was used to quantify the percentage of blue-positive stained areas to the total tissue area, to reflect the degree of fibrosis.

2.6 Dual luciferase assay

The targeted binding sites of miR-499-5p and SOX6 3′-UTR were predicted via TargerScan7.2 database (http://www.targetscan.org/vert_72/). HEK293T cells at the exponential phase were put in 96-well plates. When reaching 70% confluence, the cells were subjected to transfection using Lipofectamine 2000. The SOX6-wild type (WT) and SOX6-mutant (MUT) plasmids (GenePharma, Shanghai, China) were co-transfected into HEK293T cells with mimics NC and miR-499-5p mimics (GenePharma), respectively. After 48 h, the cells were collected and lysed, followed by the detection of luciferase activity using luciferase assay kits (BioVision, San Francisco, CA, USA) and a Glomax 20/20 luminometer (Promega, Madison, WI, USA).

2.7 Immunohistochemistry

The paraffin-embedded myocardial tissues were cut into 4 μm thick sections, deparaffinized with xylene (Sigma-Aldrich, Merck KGaA, Darmstadt, Germany), and next treated with 3% H2O2 for quenching endogenous peroxidase actions. Following incubation with citrate buffer for 30 min in a steamer, the sections were stained with primary antibodies anti-senescence-associated β-galactosidase (SA-β-gal; 1:500, ab203749; Abcam) and anti-γ-histone 2AX (γ-H2AX; 1:500, ab124781; Abcam) overnight at 4°C, and later with secondary antibody goat anti-rabbit IgG (1:1,000, ab6721; Abcam) for 2 h. Subsequently, the sections were stained again with diaminobenzidine and then counterstained with hematoxylin. With rabbit anti-IgG (1:500, ab172730; Abcam) as an isotype control, the sections were scrutinized under a microscope (Olympus), and levels of SA-β-gal and γ-H2AX were measured using Image J software (NIH).

2.8 Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) staining

The paraffin-embedded myocardial tissues were cut into 3 μm thick sections, dehydrated through routine deparaffinization, and next incubated with PBS containing 10% fetal bovine serum (SND-X0108; Sinoda Biotechnology, Nanjing, Jiangsu, China) for 30 min. Following addition with 50 μL of TUNEL reaction mixture (Roche, Basel, Switzerland), the sections were incubated thrice in a wet box at 37°C and subsequently supplemented with 50 μL of conversion agent peroxidase (Roche), followed by another 30 min incubation in the wet box. The sections were supplemented with diaminobenzidine reagent, followed by the observation of color development status under a microscope. After stopping the color development by adding water, the sections were placed in hematoxylin for 2 min and successively immersed in 95% ethanol I–II, in anhydrous ethanol I–II for 3–5 min, and in xylene I–II for 3–5 min. Subsequently, the sections were mounted with neutral gel and observed under a fluorescence microscope (Olympus).

2.9 Statistical analysis

Data analyses and plotting were processed using GraphPad Prism 8.0.1 (GraphPad Software Inc., San Diego, CA, USA). Measurement data were described as mean ± standard deviation. The t-test was conducted for comparisons between two groups, with one-way analysis of variance (ANOVA) for multiple groups. Tukey’s multiple comparison test was used for the post hoc test. The p value was acquired by a two-sided test, and p < 0.05 indicated statistical significance.

  1. Ethics approval and consent to participate: All animal experiments were conducted in concert with the instructions of Animal Ethics Committee of Shaanxi Provincial People s Hospital. Significant efforts were made to minimize the animal number and their suffering. The animal experiments have been carried out in accordance with the ARRIVE guidelines.

3 Results

3.1 miR-499-5p was underexpressed and SOX6 was upregulated in myocardial tissues of AF rats

We first injected the Ach–CaCl2 mixture into rats daily via tail veins for 7 days. The ECG analysis showed the regular P-waves in the control group (indicating normality of sinus rhythm), but the absence of P-waves and the presence of irregular R–R intervals in the AF group, with the induction time and duration of AF of (4.79 ± 0.62) s and (6.72 ± 0.68) s, respectively (Figure 1a), suggesting that Ach–CaCl2 mixture successfully induced AF in rats. Subsequently, the levels of miR-499-5p and SOX6 in myocardial tissues were determined using RT-qPCR, which indicated that miR-499-5p was notably downregulated and SOX6 was prominently upregulated in the AF group compared with the control group (Figure 1b, p < 0.01). Western blotting revealed that the AF group had a higher SOX6 protein level in rat myocardial tissues than the control group (Figure 1c, p < 0.01). The aforementioned results evinced that miR-499-5p was weakly expressed and SOX6 was highly expressed in myocardial tissues of AF rats.

Figure 1 miR-499-5p was underexpressed in myocardial tissues of AF rats and inversely correlated with SOX6. Rats were injected daily with Ach–CaCl2 mixture via tail veins for 7 days. (a) ECG analysis; (b) RT-qPCR determined the levels of miR-499-5p and SOX6 in rat myocardial tissues; (c) Western blotting determined the SOX6 protein levels in rat myocardial tissues. N = 6. An independent sample t-test was used for comparisons between groups in panels b and c. **p < 0.01.
Figure 1

miR-499-5p was underexpressed in myocardial tissues of AF rats and inversely correlated with SOX6. Rats were injected daily with Ach–CaCl2 mixture via tail veins for 7 days. (a) ECG analysis; (b) RT-qPCR determined the levels of miR-499-5p and SOX6 in rat myocardial tissues; (c) Western blotting determined the SOX6 protein levels in rat myocardial tissues. N = 6. An independent sample t-test was used for comparisons between groups in panels b and c. **p < 0.01.

3.2 miR-499-5p alleviated AF in rats by inhibiting atrial fibrosis

To further investigate the roles of miR-499-5p in AF rats, Lv-miR-499-5p or Lv-NC plasmids were injected into rats via the tail vein, followed by AF modeling 14 days later. RT-qPCR revealed the significant upregulation of miR-499-5p in myocardial tissues of the AF + Lv-miR group relative to the AF + Lv-NC group (Figure 2a, p < 0.01), indicating the successful transfection of Lv-miR-499-5p plasmids. Subsequently, ECG analysis suggested that the AF + Lv-miR group has a longer induction time of AF and a shorter duration than the AF + Lv-NC group (Figure 2b, p < 0.05). It is fully acknowledged that atrial fibrosis is the most paramount pathological alternation of atrial remodeling and is a vital indicator for assessing AF development [4,5], so we further used the Masson staining to evaluate the atrial fibrosis in rats. As indicated, the control rats had normal amounts of collagen fibers and dark-red cytoplasm and muscle fibers, but no punctate or patchy necrosis in the atrial myocardium interstitium; AF rats exhibited large areas of confluent necrosis, abnormally proliferated collagen fibers, and high degree and extended areas of atrial fibrosis; however, the injection of Lv-miR-499-5p plasmids prominently alleviated the fibrosis in AF rats (Figure 2c, p < 0.01). Western blotting unraveled that AF rats presented higher protein levels of atrial fibrosis markers such as collage I, α-SMA, and TGFβ1 in myocardial tissues than control rats; however, treatment with Lv-miR-499-5p plasmids noticeably reduced the collage I, α-SMA, and TGFβ1 levels in AF rats (Figure 2d, p < 0.01). Altogether, miR-499-5p repressed atrial fibrosis to mitigate AF in rats.

Figure 2 miR-499-5p alleviated AF in rats by inhibiting atrial fibrosis. Rats were injected with Lv-miR-499-5p/Lv-NC plasmids via tail veins, followed by AF modeling 14 days later. (a) RT-qPCR measured miR-499-5p level in rat myocardial tissues; (b) ECG analysis; (c) Masson staining evaluated atrial fibrosis in rats; (d) Western blotting measured the protein levels of atrial fibrosis markers collage I, α-SMA, and TGFβ1; N = 6. An independent sample t-test was used for comparisons between two groups in panel (a), and one-way ANOVA was used for comparisons among multiple groups in panels (b)/(c)/(d), followed by Tukey’s test. *p < 0.05, **p < 0.01.
Figure 2

miR-499-5p alleviated AF in rats by inhibiting atrial fibrosis. Rats were injected with Lv-miR-499-5p/Lv-NC plasmids via tail veins, followed by AF modeling 14 days later. (a) RT-qPCR measured miR-499-5p level in rat myocardial tissues; (b) ECG analysis; (c) Masson staining evaluated atrial fibrosis in rats; (d) Western blotting measured the protein levels of atrial fibrosis markers collage I, α-SMA, and TGFβ1; N = 6. An independent sample t-test was used for comparisons between two groups in panel (a), and one-way ANOVA was used for comparisons among multiple groups in panels (b)/(c)/(d), followed by Tukey’s test. *p < 0.05, **p < 0.01.

3.3 miR-499-5p attenuated atrial fibrosis by targeting SOX6 in AF rats

Based on previous studies, we speculated that miR-499-5p might relieve atrial fibrosis in AF rats by targeting SOX6 expression. To validate the speculation, the targeted binding sites of miR-499-5p and SOX6 were predicted using TargerScan7.2 (http://www.targetscan.org/vert_72/) (Figure 3a) and subsequently verified through a dual luciferase assay. The results unveiled that the cellular luciferase activity was decreased after concomitant transfection of miR-499-5p mimics and SOX6-WT plasmids (p < 0.01), but showed no significant difference after concomitant transfection of miR-499-5p mimics and SOX6-MUT plasmids (Figure 3b, p > 0.05), indicative of the targeted binding relationship between miR-499-5p and SOX6. Furthermore, RT-qPCR and Western blotting revealed reduced SOX6 levels in the AF + Lv-miR group compared with the AF + Lv-NC group (Figure 3c and d, p < 0.01), suggesting that miR-499-5p targeted and inhibited SOX6 expression. Finally, Lv-miR-499-5p and lentiviral vector-constructed oe-SOX6 plasmids were concomitantly injected into rats via the tail vein, followed by AF modeling 14 days later. Relative to the AF + Lv-miR + oe-NC group, the AF + Lv-miR + oe-SOX6 group had increased SOX6 levels (Figure 3c and d, p < 0.01); aggravated atrial fibrosis (Figure 3e, p < 0.05); and raised collage I, α-SMA, and TGFβ1 protein levels in myocardial tissues (Figure 3f, p < 0.05). In summary, miR-499-5p mitigated atrial fibrosis in AF rats by targeting SOX6.

Figure 3 miR-499-5p attenuated atrial fibrosis by targeting SOX6 in AF rats. (a) TargerScan7.2 database predicted the targeted binding sites of miR-499-5p and SOX6; (b) the dual-luciferase assay; (c) RT-qPCR determined SOX6 mRNA level in rat myocardial tissues; (d) Western blotting determined SOX6 protein level in rat myocardial tissues; (e) Masson staining evaluated atrial fibrosis in rats; (f) Western blotting determined collage I, α-SMA, and TGFβ1 protein levels in rat myocardial tissues. N = 6. An independent sample t-test was conducted for comparisons between groups in panels (b)/(e)/(f), and one-way ANOVA was used for multiple groups in panels c/d, followed by Tukey’s test. *p < 0.05, **p < 0.01.
Figure 3

miR-499-5p attenuated atrial fibrosis by targeting SOX6 in AF rats. (a) TargerScan7.2 database predicted the targeted binding sites of miR-499-5p and SOX6; (b) the dual-luciferase assay; (c) RT-qPCR determined SOX6 mRNA level in rat myocardial tissues; (d) Western blotting determined SOX6 protein level in rat myocardial tissues; (e) Masson staining evaluated atrial fibrosis in rats; (f) Western blotting determined collage I, α-SMA, and TGFβ1 protein levels in rat myocardial tissues. N = 6. An independent sample t-test was conducted for comparisons between groups in panels (b)/(e)/(f), and one-way ANOVA was used for multiple groups in panels c/d, followed by Tukey’s test. *p < 0.05, **p < 0.01.

3.4 AF upregulated p21 to trigger cell cycle arrest, senescence, and apoptosis in rat cardiomyocytes

Previous research has evinced the close association between p21-dependent G2 cell cycle arrest and fibrotic diseases [31]. In addition, the upregulation of cyclin-dependent kinase inhibitors p21 and p16 is sufficient to promote premature aging and senescence of atrial endothelial cells [32]. Therefore, we conducted Western blotting to determine the levels of cyclin proteins in myocardial tissues and found raised protein levels of p21, CDC25, and Cyclin B1 in AF rats (Figure 4a, p < 0.01). Immunohistochemistry assay illustrated that AF rats had higher levels of SA-β-gal and γ-H2AX (markers of cell senescence) in myocardial tissues than control rats (Figure 4b, p < 0.01). TUNEL staining revealed increased cardiomyocyte apoptosis in AF rats compared with control rats (Figure 4c, p < 0.01). Briefly, AF upregulated p21 levels to facilitate cell cycle arrest, senescence, and apoptosis in rat cardiomyocytes.

Figure 4 AF upregulated p21 to trigger cell cycle arrest, senescence, and apoptosis in rat cardiomyocytes. (a) Western blotting determined p21, CDC25, and Cyclin B1 protein levels in myocardial tissues; (b) immunohistochemistry assay determined SA-β-gal and γ-H2AX levels in myocardial tissues; (c) TUNEL staining evaluated cell apoptosis. N = 6. An independent sample t-test was used for comparisons between two groups. **p < 0.01.
Figure 4

AF upregulated p21 to trigger cell cycle arrest, senescence, and apoptosis in rat cardiomyocytes. (a) Western blotting determined p21, CDC25, and Cyclin B1 protein levels in myocardial tissues; (b) immunohistochemistry assay determined SA-β-gal and γ-H2AX levels in myocardial tissues; (c) TUNEL staining evaluated cell apoptosis. N = 6. An independent sample t-test was used for comparisons between two groups. **p < 0.01.

3.5 SOX6 silencing downregulated p21 and mitigated cell cycle arrest, senescence, and apoptosis in rat cardiomyocytes

SOX proteins, key transcription factors for various and frequent diseases during developmental processes, mediate transcriptional activation or activity repression [33] and p21 upregulation [22,23]. To investigate whether SOX6 affects cardiomyocyte behaviors in AF rats by regulating p21 expression, we injected the si-SOX6 plasmids into rats through the tail vein on day 14 before AF modeling. The results unraveled that compared with the AF + si-NC group, the AF + si-SOX6 group exhibited reduced SOX6 levels in myocardial tissues (Figure 5a and b, p < 0.01); diminished p21, CDC25, and Cyclin B1 levels (Figure 5b, p < 0.01); decreased SA-β-gal and γ-H2AX levels (Figure 5c, p < 0.01); and lowered cell apoptosis (Figure 5d, p < 0.01). In short, the inhibition of SOX6 expression downregulated p21 and alleviated cardiomyocyte cycle arrest, senescence, and apoptosis in AF rats.

Figure 5 SOX6 silencing downregulated p21 and mitigated cell cycle arrest, senescence, and apoptosis in rat cardiomyocytes. Rats were injected with si-SOX6 plasmids via tail veins on day 14 before AF modeling. (a) RT-qPCR measured SOX6 mRNA level in rat myocardial tissues; (b) Western blotting measured SOX6, p21, CDC25, and Cyclin B1 protein levels in rat myocardial tissues; (c) immunohistochemistry assay determined SA-β-gal and γ-H2AX protein levels; (d) TUNEL staining assessed cell apoptosis. N = 6. An independent sample t-test was conducted for comparisons between two groups. **p < 0.01.
Figure 5

SOX6 silencing downregulated p21 and mitigated cell cycle arrest, senescence, and apoptosis in rat cardiomyocytes. Rats were injected with si-SOX6 plasmids via tail veins on day 14 before AF modeling. (a) RT-qPCR measured SOX6 mRNA level in rat myocardial tissues; (b) Western blotting measured SOX6, p21, CDC25, and Cyclin B1 protein levels in rat myocardial tissues; (c) immunohistochemistry assay determined SA-β-gal and γ-H2AX protein levels; (d) TUNEL staining assessed cell apoptosis. N = 6. An independent sample t-test was conducted for comparisons between two groups. **p < 0.01.

4 Discussion

AF, featured by an irregular and commonly rapid heart rate, is a common and fatal arrhythmia, with growing incidences and public health burdens [34]. In particular, fibrosis exerts a causative role in various heart diseases and is a vital contributor to AF episodes [35]. miRNAs are dominantly responsible for manipulating the expression of genes that are involved in cardiac fibrosis, conduction, automaticity, and excitability, thus regulating AF development [36]. Moreover, SOX proteins exert an essential function in normal heart morphogenesis [15]. In this study, our findings demonstrated that miR-499-5p suppressed early cardiomyocyte senescence and atrial fibrosis by targeting SOX6 and downregulating p21, thereby improving AF in rats.

miR-499 is a muscle-specific miRNA that is extensively enriched in cardiac tissues, which can trigger the differentiation of human cardiomyocyte progenitor cells into cardiomyocytes in vitro [37]. SOX6, regulated by miRNAs, is a pivotal mediator in adult tissue regeneration, homeostasis, and physiology, and aberrant expression of SOX6 is implicated in diverse diseases, including cardiomyopathy [38]. First, our results revealed downregulated miR-499-5p and upregulated SOX6 in the myocardium of AF rats. Genome-wide RNA-Seq analysis has unveiled the reduction of miR-499-5p in arrhythmogenic cardiomyopathy transgenic hearts, and miR-499-5p contributes to in vitro cardiac cell proliferation and differentiation by directly targeting SOX6 [12]. Intriguingly, Trbp manipulates heart function via miRNA-mediated SOX6 repression, and SOX6 overexpression leads to a decrease in cardiac function [17]. The aforementioned evidence supported the involvement of miR-499-5p and SOX6 in AF development.

Compelling evidence suggests that atrial fibrosis is crucial for AF maintenance and perpetuation [39]. α-SMA and TGFβ1 are acknowledged pro-fibrotic biomarkers, and the accumulation of collagen I and collagen III is accountable for enhancing tissue stiffness and causing cardiac diastolic dysfunction [40]. Therefore, we further explored the roles of miR-499-5p in AF, especially in atrial fibrosis. Our results unraveled that miR-499-5p overexpression shortened the AF duration; ameliorated pathological alternations of atrial fibrosis; and reduced levels of collage I, α-SMA, and TGFβ1 in AF rats. Much in line with previous studies [41,42], our findings also highlighted that miR-499-5p targeted SOX6 and SOX6 overexpression counteracted the mitigative effects of miR-499-5p upregulation on atrial fibrosis. Consistently, miR-499-5p alleviates hypoxia/reoxygenation-induced cardiomyocyte injury via targeting SOX6 [43], indicating the cardioprotective effect of miR-499-5p. Although research illustrating the effects of miR-499-5p in atrial fibrosis is limited, among other fibrosis, restoring miR-499-5p decreases collagen fibers and pulmonary fibrosis degree in sepsis-induced lung injury mice by depleting SOX6 [14]. Notably, another SOX protein, SOX9, is capable of facilitating cardiac fibrosis [15]. To sum up, miR-499-5p palliated atrial fibrosis by targeting SOX6, thereby improving AF in rats.

As broadly acknowledged, accelerated senescence can contribute to AF, manifested by increased SA-β-gal activity and elevated p53, p21, and p16 levels in the atrium of AF individuals under 60 years old, and additionally, SA-β-gal activity and p16 are positively associated with the degree of atrial fibrosis [18]. Importantly, cell senescence is considered a stable cell cycle arrest [44], and p21, a vital cyclin-dependent kinase inhibitor, facilitates cell cycle arrest by responding to various stimuli [45]. There is also evidence suggesting that the cardioprotective role of histone deacetylase inhibitors largely relies on the suppression of cardiac fibrosis and regulation of cell cycle arrest, apoptosis, and autophagy [46]. Unsurprisingly, AF rats in our study exhibited increased levels of p21, CDC25, Cyclin B1, SA-β-gal, and γ-H2AX in the myocardium and raised cardiomyocyte apoptosis. However, there is no research investigating the relationship between SOX6 and p21 in AF, and only several studies have unraveled that SOX6 can suppress tumor cell proliferation via upregulation of p21 and augment cell senescence [22,47,48]. Additionally, SOX6 potentiates cardiomyocyte apoptosis through lipopolysaccharide-elicited miR-499 repression [49]. Innovatively, our findings elucidated that SOX6 knockdown reduced p21 levels and attenuated cardiomyocyte cycle arrest, senescence, and apoptosis in AF rats.

To conclude, this study demonstrated that miR-499-5p palliated atrial fibrosis and cardiomyocyte senescence by targeting SOX6 and downregulating p21 in AF rats. The rat has a high degree of physiological similarity to humans and is an ideal choice for many experiments, especially those involving cardiovascular, brain, and spinal cord. The rat genome contains approximately 25,000 genes, 90% of which match those of mice as well as humans. Almost all the human genes associated with diseases find a counterpart in the rat genome, and they appear highly conserved during mammalian evolution. Previous research reveals that miR-499 is a myocardial-specific miRNA and is the most downregulated miRNA in arrhythmogenic cardiomyopathy [12]. Conserved miRNAs play an important regulatory role during development [50], and their target genes are also conserved in vertebrates [51]. Additionally, SOX6 is highly conserved in many mammalian species [52]. To this end, we hypothesized that miR-499-5p and the recognition site of miR-499-5p/SOX are highly conserved in humans and rats. We will verify their conserved nature in future research.

However, there still exist several limitations. The precise molecular mechanism of SOX6 in regulating p21 in myocardial tissues of AF rats remains elusive. Equally importantly, the specific cell phase in which cell cycle arrest occurs during cardiomyocyte senescence warrants in-depth investigation. In addition, this study only explored the mechanism of miR-499-5p/SOX6 in AF at the animal level and did not validate it at the clinical level.

Acknowledgements

Not applicable.

  1. Funding information: Not applicable.

  2. Author contributions: XYH is the guarantor of integrity of the entire study; XYH contributed to the study design; SDW contributed to the literature research and data acquisition; ZJY contributed to the study concepts and statistical analysis; XTZ contributed to the experimental studies; XQW contributed to the definition of intellectual content; PHY contributed to the data analysis and manuscript editing; all authors read and approved the final manuscript.

  3. Conflict of interest: All authors declare that there is no conflict of interests in this study.

  4. Data availability statement: The data that support the findings of this study are available from the corresponding author upon a reasonable request.

References

[1] Sohns C, Marrouche NF. Atrial fibrillation and cardiac fibrosis. Eur Heart J. 2020;41(10):1123–31.10.1093/eurheartj/ehz786Search in Google Scholar PubMed

[2] Andrade J, Khairy P, Dobrev D, Nattel S. The clinical profile and pathophysiology of atrial fibrillation: Relationships among clinical features, epidemiology, and mechanisms. Circ Res. 2014;114(9):1453–68.10.1161/CIRCRESAHA.114.303211Search in Google Scholar PubMed

[3] Himmelreich JCL, Veelers L, Lucassen WAM, Schnabel RB, Rienstra M, van Weert H, et al. Prediction models for atrial fibrillation applicable in the community: A systematic review and meta-analysis. Europace. 2020;22(5):684–94.10.1093/europace/euaa005Search in Google Scholar PubMed PubMed Central

[4] Akoum N, McGann C, Vergara G, Badger T, Ranjan R, Mahnkopf C, et al. Atrial fibrosis quantified using late gadolinium enhancement MRI is associated with sinus node dysfunction requiring pacemaker implant. J Cardiovasc Electrophysiol. 2012;23(1):44–50.10.1111/j.1540-8167.2011.02140.xSearch in Google Scholar PubMed PubMed Central

[5] Jalife J. Mechanisms of persistent atrial fibrillation. Curr Opin Cardiol. 2014;29(1):20–7.10.1097/HCO.0000000000000027Search in Google Scholar PubMed

[6] Sygitowicz G, Maciejak-Jastrzebska A, Sitkiewicz D. A review of the molecular mechanisms underlying cardiac fibrosis and atrial fibrillation. J Clin Med. 2021;10(19):4430.10.3390/jcm10194430Search in Google Scholar PubMed PubMed Central

[7] Li L, Zhao Q, Kong W. Extracellular matrix remodeling and cardiac fibrosis. Matrix Biol. 2018;68–69:490–506.10.1016/j.matbio.2018.01.013Search in Google Scholar PubMed

[8] van Rooij E, Olson EN. MicroRNA therapeutics for cardiovascular disease: opportunities and obstacles. Nat Rev Drug Discov. 2012;11(11):860–72.10.1038/nrd3864Search in Google Scholar PubMed PubMed Central

[9] Komal S, Yin JJ, Wang SH, Huang CZ, Tao HL, Dong JZ, et al. MicroRNAs: Emerging biomarkers for atrial fibrillation. J Cardiol. 2019;74(6):475–82.10.1016/j.jjcc.2019.05.018Search in Google Scholar PubMed

[10] van den Berg NWE, Kawasaki M, Berger WR, Neefs J, Meulendijks E, Tijsen AJ, et al. MicroRNAs in atrial fibrillation: From expression signatures to functional implications. Cardiovasc Drugs Ther. 2017;31(3):345–65.10.1007/s10557-017-6736-zSearch in Google Scholar PubMed PubMed Central

[11] Lu Y, Zhang Y, Wang N, Pan Z, Gao X, Zhang F, et al. MicroRNA-328 contributes to adverse electrical remodeling in atrial fibrillation. Circulation. 2010;122(23):2378–87.10.1161/CIRCULATIONAHA.110.958967Search in Google Scholar PubMed

[12] Calore M, Lorenzon A, Vitiello L, Poloni G, Khan MAF, Beffagna G, et al. A novel murine model for arrhythmogenic cardiomyopathy points to a pathogenic role of Wnt signalling and miRNA dysregulation. Cardiovasc Res. 2019;115(4):739–51.10.1093/cvr/cvy253Search in Google Scholar PubMed

[13] Park SE, Jeong JB, Oh SJ, Kim SJ, Kim H, Choi A, et al. Wharton’s jelly-derived mesenchymal stem cells reduce fibrosis in a mouse model of duchenne muscular dystrophy by upregulating microRNA 499. Biomedicines. 2021;9(9):1089.10.3390/biomedicines9091089Search in Google Scholar PubMed PubMed Central

[14] Zhang W, Li J, Yao H, Li T. Restoring microRNA-499-5p protects sepsis-induced lung injury mice via targeting Sox6. Nanoscale Res Lett. 2021;16(1):89.10.1186/s11671-021-03534-xSearch in Google Scholar PubMed PubMed Central

[15] Liu CF, Ni Y, Thachil V, Morley M, Moravec CS, Tang WHW. Differential expression of members of SOX family of transcription factors in failing human hearts. Transl Res. 2022;242:66–78.10.1016/j.trsl.2021.10.002Search in Google Scholar PubMed PubMed Central

[16] Liu Y, Jiang B, Cao Y, Chen W, Yin L, Xu Y, et al. High expression levels and localization of Sox5 in dilated cardiomyopathy. Mol Med Rep. 2020;22(2):948–56.10.3892/mmr.2020.11180Search in Google Scholar PubMed PubMed Central

[17] Ding J, Chen J, Wang Y, Kataoka M, Ma L, Zhou P, et al. Trbp regulates heart function through microRNA-mediated Sox6 repression. Nat Genet. 2015;47(7):776–83.10.1038/ng.3324Search in Google Scholar PubMed PubMed Central

[18] Adili A, Zhu X, Cao H, Tang X, Wang Y, Wang J, et al. Atrial fibrillation underlies cardiomyocyte senescence and contributes to deleterious atrial remodeling during disease progression. Aging Dis. 2022;13(1):298–312.10.14336/AD.2021.0619Search in Google Scholar PubMed PubMed Central

[19] Baker DJ, Childs BG, Durik M, Wijers ME, Sieben CJ, Zhong J, et al. Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan. Nature. 2016;530(7589):184–9.10.1038/nature16932Search in Google Scholar PubMed PubMed Central

[20] Noren Hooten N, Evans MK. Techniques to induce and quantify cellular senescence. J Vis Exp. 2017;1:(123):55533.10.3791/55533Search in Google Scholar PubMed PubMed Central

[21] Kim NH, Ahn Y, Oh SK, Cho JK, Park HW, Kim YS, et al. Altered patterns of gene expression in response to chronic atrial fibrillation. Int Heart J. 2005;46(3):383–95.10.1536/ihj.46.383Search in Google Scholar PubMed

[22] Wang J, Ding S, Duan Z, Xie Q, Zhang T, Zhang X, et al. Role of p14ARF-HDM2-p53 axis in SOX6-mediated tumor suppression. Oncogene. 2016;35(13):1692–702.10.1038/onc.2015.234Search in Google Scholar PubMed PubMed Central

[23] Qin YR, Tang H, Xie F, Liu H, Zhu Y, Ai J, et al. Characterization of tumor-suppressive function of SOX6 in human esophageal squamous cell carcinoma. Clin Cancer Res. 2011;17(1):46–55.10.1158/1078-0432.CCR-10-1155Search in Google Scholar PubMed

[24] Xu L, Fan Y, Wu L, Zhang C, Chu M, Wang Y, et al. Exosomes from bone marrow mesenchymal stem cells with overexpressed Nrf2 inhibit cardiac fibrosis in rats with atrial fibrillation. Cardiovasc Ther. 2022;2022:2687807.10.1155/2022/2687807Search in Google Scholar PubMed PubMed Central

[25] Lv X, Li J, Hu Y, Wang S, Yang C, Li C, et al. Overexpression of miR-27b-3p targeting Wnt3a regulates the signaling pathway of Wnt/beta-catenin and attenuates atrial fibrosis in rats with atrial fibrillation. Oxid Med Cell Longev. 2019;2019:5703764.10.1155/2019/5703764Search in Google Scholar PubMed PubMed Central

[26] Zou D, Geng N, Chen Y, Ren L, Liu X, Wan J, et al. Ranolazine improves oxidative stress and mitochondrial function in the atrium of acetylcholine-CaCl2 induced atrial fibrillation rats. Life Sci. 2016;156:7–14.10.1016/j.lfs.2016.05.026Search in Google Scholar PubMed

[27] Lv X, Lu P, Hu Y, Xu T. Overexpression of MiR-29b-3p inhibits atrial remodeling in rats by targeting PDGF-B signaling pathway. Oxid Med Cell Longev. 2021;2021:3763529.10.1155/2021/3763529Search in Google Scholar PubMed PubMed Central

[28] Jia H, Qu M, Fan G, Wu H, Wang L. miR-499-5p suppresses C-reactive protein and provides neuroprotection in hypoxic-ischemic encephalopathy in neonatal rat. Neurosci Res. 2020;161:44–50.10.1016/j.neures.2019.12.002Search in Google Scholar PubMed

[29] Zeng Z, Liu Y, Zheng W, Liu L, Yin H, Zhang S, et al. MicroRNA-129-5p alleviates nerve injury and inflammatory response of Alzheimer’s disease via downregulating SOX6. Cell Cycle. 2019;18(22):3095–110.10.1080/15384101.2019.1669388Search in Google Scholar PubMed PubMed Central

[30] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–8.10.1006/meth.2001.1262Search in Google Scholar PubMed

[31] Koyano T, Namba M, Kobayashi T, Nakakuni K, Nakano D, Fukushima M, et al. The p21 dependent G2 arrest of the cell cycle in epithelial tubular cells links to the early stage of renal fibrosis. Sci Rep. 2019;9(1):12059.10.1038/s41598-019-48557-8Search in Google Scholar PubMed PubMed Central

[32] Hasan H, Park SH, Auger C, Belcastro E, Matsushita K, Marchandot B, et al. Thrombin induces angiotensin II-mediated senescence in atrial endothelial cells: Impact on pro-remodeling patterns. J Clin Med. 2019;8(10):1570.10.3390/jcm8101570Search in Google Scholar PubMed PubMed Central

[33] Zhang Y, Hou L. Alternate roles of sox transcription factors beyond transcription initiation. Int J Mol Sci. 2021;22(11):5949.10.3390/ijms22115949Search in Google Scholar PubMed PubMed Central

[34] Ponamgi SP, Siontis KC, Rushlow DR, Graff-Radford J, Montori V, Noseworthy PA. Screening and management of atrial fibrillation in primary care. BMJ. 2021;373:n379.10.1136/bmj.n379Search in Google Scholar PubMed

[35] Reese-Petersen AL, Olesen MS, Karsdal MA, Svendsen JH, Genovese F. Atrial fibrillation and cardiac fibrosis: A review on the potential of extracellular matrix proteins as biomarkers. Matrix Biol. 2020;91–92:188–203.10.1016/j.matbio.2020.03.005Search in Google Scholar PubMed

[36] Galenko O, Jacobs V, Knight S, Taylor M, Cutler MJ, Muhlestein JB, et al. The role of microRNAs in the development, regulation, and treatment of atrial fibrillation. J Interv Card Electrophysiol. 2019;55(3):297–305.10.1007/s10840-018-0495-zSearch in Google Scholar PubMed

[37] Sluijter JP, van Mil A, van Vliet P, Metz CH, Liu J, Doevendans PA, et al. MicroRNA-1 and -499 regulate differentiation and proliferation in human-derived cardiomyocyte progenitor cells. Arterioscler Thromb Vasc Biol. 2010;30(4):859–68.10.1161/ATVBAHA.109.197434Search in Google Scholar PubMed

[38] Saleem M, Rahman S, Elijovich F, Laffer CL, Ertuglu LA, Masenga SK, et al. Sox6, a potential target for microRNAs in cardiometabolic disease. Curr Hypertens Rep. 2022;24(5):145–56.10.1007/s11906-022-01175-8Search in Google Scholar PubMed

[39] Quah JX, Dharmaprani D, Tiver K, Lahiri A, Hecker T, Perry R, et al. Atrial fibrosis and substrate based characterization in atrial fibrillation: Time to move forwards. J Cardiovasc Electrophysiol. 2021;32(4):1147–60.10.1111/jce.14987Search in Google Scholar PubMed

[40] Zhu J, Zhu N, Xu J. miR101a3p overexpression prevents acetylcholineCaCl2induced atrial fibrillation in rats via reduction of atrial tissue fibrosis, involving inhibition of EZH2. Mol Med Rep. 2021;24(4):740.10.3892/mmr.2021.12380Search in Google Scholar PubMed PubMed Central

[41] Zhou X, Zheng B, Pang L, Che Y, Qi X. Suppression of MALAT1 alleviates neurocyte apoptosis and reactive oxygen species production through the miR-499-5p/SOX6 axis in subarachnoid hemorrhage. J Mol Histol. 2022;53(1):85–96.10.1007/s10735-021-10033-xSearch in Google Scholar PubMed

[42] Wang XY, Chen XL, Huang ZQ, Chen DW, Yu B, He J, et al. MicroRNA-499-5p regulates porcine myofiber specification by controlling Sox6 expression. Animal. 2017;11(12):2268–74.10.1017/S1751731117001008Search in Google Scholar PubMed

[43] Shi Y, Han Y, Niu L, Li J, Chen Y. MiR-499 inhibited hypoxia/reoxygenation induced cardiomyocytes injury by targeting SOX6. Biotechnol Lett. 2019;41(6–7):837–47.10.1007/s10529-019-02685-3Search in Google Scholar PubMed PubMed Central

[44] Kumari R, Jat P. Mechanisms of cellular senescence: Cell cycle arrest and senescence associated secretory phenotype. Front Cell Dev Biol. 2021;9:645593.10.3389/fcell.2021.645593Search in Google Scholar PubMed PubMed Central

[45] Karimian A, Ahmadi Y, Yousefi B. Multiple functions of p21 in cell cycle, apoptosis and transcriptional regulation after DNA damage. DNA Repair (Amst). 2016;42:63–71.10.1016/j.dnarep.2016.04.008Search in Google Scholar PubMed

[46] Chun P. Therapeutic effects of histone deacetylase inhibitors on heart disease. Arch Pharm Res. 2020;43(12):1276–96.10.1007/s12272-020-01297-0Search in Google Scholar PubMed

[47] Lv L, Zhou M, Zhang J, Liu F, Qi L, Zhang S, et al. SOX6 suppresses the development of lung adenocarcinoma by regulating expression of p53, p21(CIPI), cyclin D1 and beta-catenin. FEBS Open Bio. 2020;10(1):135–46.10.1002/2211-5463.12762Search in Google Scholar PubMed PubMed Central

[48] Kurtsdotter I, Topcic D, Karlen A, Singla B, Hagey DW, Bergsland M, et al. SOX5/6/21 prevent oncogene-driven transformation of brain stem cells. Cancer Res. 2017;77(18):4985–97.10.1158/0008-5472.CAN-17-0704Search in Google Scholar PubMed

[49] Li X, Wang J, Jia Z, Cui Q, Zhang C, Wang W, et al. MiR-499 regulates cell proliferation and apoptosis during late-stage cardiac differentiation via Sox6 and cyclin D1. PLoS One. 2013;8(9):e74504.10.1371/journal.pone.0074504Search in Google Scholar PubMed PubMed Central

[50] Lu J, Fu Y, Kumar S, Shen Y, Zeng K, Xu A, et al. Adaptive evolution of newly emerged micro-RNA genes in Drosophila. Mol Biol Evol. 2008;25(5):929–38.10.1093/molbev/msn040Search in Google Scholar PubMed PubMed Central

[51] Friedman RC, Farh KK, Burge CB, Bartel DP. Most mammalian mRNAs are conserved targets of microRNAs. Genome Res. 2009;19(1):92–105.10.1101/gr.082701.108Search in Google Scholar PubMed PubMed Central

[52] Jiang ZH, Tang YZ, Song HN, Yang M, Li B, Ni CL. miRNA342 suppresses renal interstitial fibrosis in diabetic nephropathy by targeting SOX6. Int J Mol Med. 2020;45(1):45–52.10.3892/ijmm.2019.4388Search in Google Scholar PubMed PubMed Central

Received: 2022-08-31
Revised: 2022-12-09
Accepted: 2023-01-07
Published Online: 2023-05-12

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
https://doi.org/10.1515/med-2023-0654
Keywords for this article
atrial fibrillation; atrial fibrosis; miR-499-5p; SOX6; p21; cell senescence; apoptosis; microRNA
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 18.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0654/html
Scroll to top button