Home Medicine IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
Article Open Access

IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population

  • Alicja Zawiślak EMAIL logo , Krzysztof Woźniak , Beata Kawala , Satish Gupta , Anna Znamirowska-Bajowska , Joanna Janiszewska-Olszowska , Jan Lubiński , José Luis Calvo-Guirado , Katarzyna Grocholewicz and Anna Jakubowska
Published/Copyright: April 1, 2023
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 18 Issue 1

Abstract

Non-syndromic cleft lip with or without cleft palate (NSCL/P) is the most common developmental defect that significantly affects the morphology and function of the stomatognathic system in children. The etiology of these birth defects is multifactorial, and single nucleotide polymorphisms (SNPs) in IRF6 and FGF1 have been associated with NSCL/P. This study aimed to evaluate whether SNPs in IRF6, namely rs2013162, rs642961, rs2235373, and rs34010 in FGF1, are associated with NSCL/P occurrence in the Polish population. The study included 627 participants: 209 children with NSCL/P and 418 healthy controls. DNA was isolated from saliva in the study group and from umbilical cord blood in controls. Genotyping of polymorphisms was performed using quantitative PCR. There was no statistically significant association of IRF6 gene variants with NSCL/P occurrence, although for rs2013162, AA genotype, odds ratio (OR) = 1.16 and for AC genotype, OR = 0.83; for rs642961, AA genotype, OR = 0.84 and for AG genotype, OR = 1.41; and for rs2235373, AA genotype, OR = 0.79 and for AG, OR = 0.85. In the instance of rs34010 polymorphism in FGF1, the presence of the AA genotype was statistically significant in reducing the risk of NSCL/P (OR = 0.31, p = 0.001). Genetic variation in FGF1 is an important risk marker of NSCL/P in the Polish population, which cannot be stated for the polymorphisms in the IRF6 gene.

Keywords: birth defect; cleft lip; cleft palate; genetic variation; single nucleotide polymorphism; IRF6 ; FGF1

1 Introduction

Annually, more than 8 million children are born worldwide with various birth defects, 17% of which affect the facial part of the skull [1]. Orofacial clefts (OFCs) are the most common congenital anomaly affecting the facial part of the skull and the second most common birth defect in newborn children overall (after phimosis). The most common ORFs are non-syndromic cleft lip with or without cleft palate (NSCL/P), which occur with an average prevalence of 1 in 700 live births [2], and affect 135,000 newborns worldwide [3]. The prevalence of NSCL/P varies among ethnic groups and depends on the geographic origin. Infants with congenital malformations are born significantly more often in parts of South America and Asia, while the fewest are born in Israel, South Africa, and Southern Europe [4]. The cleft palate only (CPO) phenotype occurs less frequently, with a worldwide average of 1–25 in 10,000 children [5]. A higher incidence of isolated cleft palate is reported in Canada and Northern Europe, and significantly lower in parts of Latin America and South Africa [4].

The medical care of children with NSCL/P requires a comprehensive approach. The defect impairs many aspects of daily life, including eating, speech, and due to facial appearance, social interaction with peers [6]. The etiology of ORFs is quite complex, involving both genetic and environmental factors [7]. Many studies indicate that the genetic component has a very strong influence on the development of facial birth defects. The risk of NSCL/P is three times higher in siblings than in the general population and is 25–45% for monozygotic twins compared to 3–6% for heterozygotic twins. Moreover, the risk of birth defects for first-degree relatives is estimated at 4%; for second-degree relatives, 0.67%; and for third-degree relatives, 0.3% [8]. However, the lack of complete coincidence of the occurrence of NSCL/P in monozygotic twins shows that environmental factors also play important roles in the etiology of clefts [9].

Although the last few decades have seen tremendous progress in understanding the genetic basis of syndromic birth defects [10], the identification of specific genetic variants involved in the onset of NSCL/P has progressed at a slower pace, primarily due to the presence of a significant environmental component [2]. Numerous studies have shown that several genes are related to craniofacial deformities [11,12,13,14].

In recent years, advances in research techniques have accelerated the identification of genes and their polymorphisms correlating with NSCL/P occurrence through the use of genome-wide association studies (GWAS) and whole genome sequencing. Numerous studies have shown that a gene whose polymorphisms may be associated with NSCL/P is the IRF6 gene, mutations of which are responsible for van der Woude syndrome (VWS) [12,15,16]. Loss-of-function mutations in the IRF6 gene are responsible for approximately 70% of VWS syndrome cases (VWS1, MIM#119300) [17]. Multiple studies have indicated that polymorphisms of the IRF6 gene could be an important factor in the etiology of non-syndromic malformations [18,19,20]. Genes coding for fibroblast growth factors and their receptors, for instance, FGF1, are considered excellent candidate genes. Their proteins play important roles in craniofacial growth and their polymorphisms may influence the abnormal development of palatal and connective tissue structures [21].

The purpose of the present study was to replicate the association between four single nucleotide polymorphisms (SNPs; rs2013162, rs642961, rs2235375, and rs34010) in the IRF6 and the FGF1 gene and NSCL/P in Polish children. Therefore, we compared the frequencies of the four SNPs between children with and without NSCL/P.

2 Materials and methods

2.1 Study population

We studied unselected children with NSCL/P and healthy controls. The study included patients being treated for orthodontic conditions at the Pomeranian Medical University in Szczecin or the Wroclaw Medical University Department of Dentofacial Orthopeadics and Orthodontics.

In the NSCL/P group (n = 209), clinical diagnostics of existing congenital defects and differential diagnostics for monogenic syndromes related to NSCL/P were based on medical and anamnesis history followed by clinical examination. The type of cleft was assessed according to the World Health Organization classification – International Statistical Classification of Diseases and Related Health Problems – ICD 10; Congenital malformations, deformations, and chromosomal abnormalities section (Q35–Q37) [22].

In the control group, 418 unsanctioned children (average age: 14.0 + 10.2 years) were recruited and their genetic material was stored in the Szczecin Department of Genetics and Pathology’s biobank. Patients with NSCL/P and the control group were matched on age and geography. A total of 180 children were enrolled from Szczecin and 238 were enrolled from Wroclaw.

2.2 Sample preparation

In the group of children with NSCL/P, 2 ml of saliva samples were collected from each subject using Oragene collection kits (DNA Genotek Inc., Canada). Subjects were asked not to consume any solid food for 30 min before the collection of the biological material. Samples were stored in a dry place, protected from light, at room temperature. DNA was isolated using automatic Chemagen sets. The DNA extracted from the samples was stored in a freezer at −20°C. In the control group, DNA from the umbilical cord blood was extracted using the standard method described by Lahiri and Schnabel [23].

2.3 Genotyping

Genotyping of rs2013162, rs642961, rs2235373, and rs34010 was performed using the real-time PCR-based TaqMan technique with LightCycler 480 II (Roche Diagnostics). The mixture (5 µl total) consisted of 2.5 µl of LightCycler 480 Probes Master Mix (Roche Diagnostics), 0.0625 µl of each SNP TaqMan Genotyping Assay × 40 (Applied Biosystems), 1 µl of DNA (25 ng/µl), and 1.4375 µl of deionized water (Roche Diagnostics). On each plate, four negative controls without DNA were included to monitor potential contamination. Primers used for the detection of gene polymorphisms were as follows:

  1. rs2013162 forward: CACCTGCGAGCTTGTGTATC; reverse: CCATCATCCCCACTCACCAT,

  2. rs642961 forward: GCTTTGGATTGTTAATCTTACCCAAAGG; reverse: CTTCCCACCTCCAGGACAGGCAGATG,

  3. rs2235373 forward: AAGTAAGTGAGACTTTATCTTTC; reverse: TCCCTGGTGACTCATGGGCT, and

  4. rs34010 forward: GGCCTCTACCCACTAGATGCCAGTAG; reverse: CTGCTTTCATTATCAACCTGCACAGG.

2.4 Statistical analysis

A logistic regression test used for nonlinear analysis was used for statistical analysis to describe the effect of independent variables on the dichotomous dependent variable. The odds ratio (OR) with a 95% confidence interval (95% CI) was calculated to estimate the risk of a craniofacial cleft defect. The most common genotype was used as a reference. For each genetic variation, the risk carried by the occurrence of the given genotypes on the occurrence of the birth defect was evaluated with respect to the control group. The significance of individual logistic regression coefficients was evaluated using Wald’s test. The OFC risk was assessed for each genotype. The significance of particular logistic regression rates was assessed using Wald’s test. Statistica 10.0 (StatSoft, Tulsa OK, USA) and R 3.0.2 (The R Foundation for Statistical Computing) were used for statistical analysis. P-values of less than 0.05 were considered significant.

Biobank materials obtained from umbilical cord blood were used as the control group, and deposited in the Department of Genetics and Pathomorphology of Pomeranian Medical University in Szczecin. In the control group, individuals were selected based on their age and region of birth.

  1. Ethical approval: The Bioethics Committee of Pomeranian Medical University in Szczecin approved the research protocol as complying with GCP – Good Clinical Practice (KB-0012/77/10). Oncology biobank project approved by PAM Ethics Committee (BN-001/174/05 dated 11. 10. 2005). Informed consent was obtained from all patients or their legal guardians before participating in the study.

3 Results

The study group consisted of 209 individuals with NSCL/P (age range, 4–30 years; mean age, 17.4 ± 13.6 years). The control group consisted of 418 subjects matched for age and birthplace. Relatives in the ascending line up to the second generation in both groups were Polish. The NSCL/P group consisted of 91 women (43.5%) and 118 men (56.5%). In 113 cases (54.1%), unilateral cleft of the lip and the hard palate was observed; in 45 cases (21.5%), – bilateral cleft of the lip and hard palate; in 32 cases (15.3%), CPO; and in 19 cases (9.1%), isolated cleft lip. The characteristics of the NSCL/P patients are presented in Table 1.

Table 1

Characteristics of patients with NSCL/P [24]

No. and proportion of individuals
Sex Female 91 (43.5%)
Male 118 (56.5%)
Cleft type Unilateral cleft of the lip and the hard palate 113 (54.1%)
Bilateral cleft of the lip and the hard palate 45 (21.5%)
CPO 32 (15.3%)
Isolated cleft lip 19 (9.1%)

Table 2 summarizes the results obtained for the IRF6 gene. Statistical analysis showed that the rs2013162 polymorphism did not significantly predict the risk of the cleft defect (p = 0.455). The OR for genotypes AA and AC were, respectively, 1.16 (0.66–2.07) with a significance level of p = 0.604 and 0.83 (0.56–1.25) with a significance level of p = 0.382. A similarly statistically insignificant result was obtained for the rs642961 polymorphism (p = 0.189). In this case, the OR was 0.84 (0.34–2.08) for the AA genotype, with a significance level of p = 0.709, and 1.41 (0.95–2.07) for the AG genotype, with a significance level of p = 0.085. Also, the analysis of the rs2235373 polymorphism showed no significant (p = 0.716) change in the risk of the OR of congenital craniofacial malformations with OR = 0.79 (0.24–2.68), p = 0.71 (for the AA variant) and OR = 0.85 (0.55–1.31), p = 0.453 (for the AG variant). On the other hand, the presence of the rs34010 polymorphism statistically significant affects the risk of developing a cleft defect (p < 0.001, Table 3). A reduced risk (OR = 0.31 (0.18–0.54)) is carried out by the presence of the AA genotype ( p < 0.001) and the AC genotype, but in this case this was not confirmed by statistical significance (p = 0.219).

Table 2

NSCL/P risk and polymorphisms in the IRF6 gene (namely, rs2013162, rs642961, rs2235373)

Genotype OR (95% CI) P (Wald’s test) P (LR-test)
rs2013162 ref. = CC 0.455
AA 1.16 (0.66–2.07) 0.604
AC 0.83 (0.56–1.25) 0.382
rs642961 ref. = GG 0.189
AA 0.84 (0.34–2.08) 0.709
AG 1.41 (0.95–2.07) 0.085
rs2235373 ref. = GG 0.716
AA 0.79 (0.24–2.68) 0.71
AG 0.85 (0.55–1.31) 0.453
Table 3

NSCL/P risk and rs34010 polymorphism in the FGF1 gene

Genotype OR (95% CI) P (Wald’s test) P (LR-test)
rs34010 ref. = CC <0.001
AA 0.31 (0.18–0.54) <0.001
AC 0.77 (0.51–1.17) 0.219

The distribution of genotypes for rs34010 is shown in Figure 1. The presented result of the fluorescence analysis of the sample was performed using a LightCycler 480II. The blue color represents the AC allele (stained with VIC dye); the green color, if present, would represent the AA allele (stained with FAM dye); and the red color represents both alleles.

Figure 1 Graphical distribution of genotypes for rs34010.
Figure 1

Graphical distribution of genotypes for rs34010.

4 Discussion

In the present study, we found an association between the presence of SNP rs34010 within FGF1 and the risk of NSCL/P in a Polish population. The same results were obtained in a study conducted on Latvian, Lithuanian, and Estonian populations. It was shown that the occurrence of a rarer allele of the rs34010 polymorphism in the FGF1 gene is associated with a reduced incidence of the cleft defect. A particularly strong association with a decreased risk (OR = 0.689; 95% CI, 0.559–0.849; p = 4.56 × 10−4) was found for the protective rs250092/rs34010 GT haplotype, within the aforementioned gene [25].

The FGF gene family signaling pathway is responsible for the regulation and proper execution of many developmental processes as early as embryogenesis. It plays an important role in the formation of head structures, particularly the craniofacial region and palate development. Conducted studies in the FGF gene family have shown an overrepresentation of missense mutations in patients with cleft palates compared with healthy individuals. It has been shown that a group of missense and nonsense mutations (M369I, E467K, R609X, D138N, R84S, V329I, D73H de novo, S59F, K172) can account for up to 5% of NSCL/P cases. Taken together with the results for IRF6 −12%, FOXE1, GLI2, MSX2, SKI, and SPRY2 −6%, and MSX1 −2% [11,12,26], these genes may account for more than 25% of NSCL/P and represent a significant predictor of facial clefts [27]. The missense and nonsense FGFR1 mutations indicate problems with reduced penetrance when identifying mutations in ORFs. The R609X mutation was found in a father and his daughter. The M369I mutation correlates with the cleft phenotype in the family, but there were family members without a birth defect with this mutation, who may be examples of reduced penetrance. Some apparently nonpenetrating individuals in ORF families show other phenotypic features, such as discontinuity of the orbicularis oris muscle [28,29].

Human FGFs control a wide range of biological functions, and their biological activity is mediated by seven major FGF receptor tyrosine kinases encoded by four genes (FGFR1-4). In the presence of heparan sulfate proteoglycans, two FGFs bind to two FGFRs, inducing receptor dimerization and allowing intracellular tyrosine kinase domains to phosphorylate and activate [30]. As a result of impaired FGF signaling, craniofacial syndromes, craniofacial dysplasia, and Kallmann syndrome may result. The S252W and P253R mutations in the FGFR2 gene are responsible for almost all cases of Apert syndrome. The cleft type is associated with the S252W mutation in 59% of patients, with the P253R mutation in 17% of patients. Cleft palate is present in 44% of Apert syndrome cases [31,32,33]. Autosomal-dominant Kallmann syndrome, whose main features are anosmia and hypogonadism, is caused by loss-of-function mutations in FGFR1, and 5–10% of these patients have cleft [34,35,36].

In this study, we found no association between the presence of IRF6 gene SNPs and the occurrence of NSCL/P. Interferon regulatory factor (IRF6) plays an important role during embryonic development. This factor is responsible for immune system function and wound healing [37]. Unlike the other interferon regulatory factors, IRF6 is also crucial during fetal cranial growth and the development of ectodermal structures [38]. Lack of IRF6 expression may implicate birth defects such as VWS and popliteal pterygium syndrome [39]. These defects are characterized by the presence of a cleft palate and abnormalities of the teeth (20–40%) and skin and mucous membranes [40].

For the rs2013162 SNP located in the IRF6 gene in the present study, ORs were 1.16 for the AA genotype and 0.83 for the AC genotype, but these results were not statistically significant. Similarly, a statistically insignificant result was obtained by Huang et al. subjecting a Chinese population [41]. But these results are significantly different from those conducted previously on Italian, American, and Belgian populations [42,43,44], in which a strong association between the occurrence of rs2013162 polymorphism and the occurrence of isolated cleft facial defects was demonstrated, and by Park et al. [45] on the Chinese population. Also in each of the above-mentioned studies, in the haplotype analysis, it was noted that the C allele was present in all individuals affected by cleft lip or palate.

The literature data suggest a correlation of rs642961 with the occurrence of craniofacial cleft defects. The results of the studies present a contradictory view. The first study was conducted on the Brazilian population, but the researchers chose a small size of the control group, which, with MAF A = 0.017 (characterizes this variation), may not be a representative result for the entire population. In their study, 228 cleft patients and 126 healthy subjects were examined [46]. Another publication in which the results indicate that there is no association between rs642961 and the occurrence of isolated facial cleft defects is based on a study of a Honduran population [19]. However, other publications describe examples of positive correlations with the occurrence of cleft defects. A paper describing a Brazilian population presents a correlation between the polymorphisms and the occurrence of cleft, although only in a group of individuals with isolated cleft palate [47]. Researchers from China, in addition to finding a relationship between this genetic variation and the occurrence of congenital cleft defects, demonstrated that rs642961 can alter the expression of the IRF6 gene in vivo. They have surgically removed a small section of the lip skin with tissue adjacent to the region of the cleft lip present. They have indicated that the genotypes of this polymorphism are in correlation with different expression levels of IRF6 gene receptors [48]. Interestingly, studies conducted on a Polish group of patients show the result of a positive correlation with the occurrence of isolated facial cleft defects, which is statistically significant. The reported OR coefficient was 1.63, with a significance level of p = 0.05 [49]. Also, a high OR coefficient (1.79) at the retained level of significance is reported in the results of their work by Birnbaum et al. whose study was based on the examination of genetic material collected from 460 subjects with isolated cleft lips with or without cleft palate and from 952 control subjects, representatives of the Caucasian population [50].

An interesting finding was made by Murdoch et al., who examined the absence of tooth buds and palate type in association with a given genotype. As a result, it has been found that the first palatal folds on the right side were larger than on the left side in the group of individuals with the rs642961 polymorphism, although p = 0.06, indicating the need for further research. No correlation was found concerning hypodontia [51].

In the present study, the results obtained for the IRF6 rs2235373 gene polymorphism were not found to be statistically significant. In the literature, evidence showing a sevenfold increased predisposition to congenital malformations correlated with the co-occurrence of haplotypes: GC rs2235373-rs2235371 (V274I) and AAG rs599021-rs2235373-rs595918 can be found [45]. A study including a Norwegian population (377 patients with isolated cleft lip with or without cleft palate, 196 patients with isolated cleft palate, and 763 healthy subjects) showed a reduced risk (OR = 0.38, p < 0.001) of isolated cleft lip with or without cleft palate in the presence of the rs2235371 (V274I) genotype, also located in the IRF6 gene. However, no association between the aforementioned polymorphism and the presence of an isolated cleft palate was demonstrated [52].

Studies in the Han population have shown that the risk of having a child with an isolated cleft lip with or without a cleft palate is increased for mothers who were taking medication or were exposed to passive smoking during the first trimester of pregnancy. Folic acid supplementation at the recommended dose had a protective effect on fetal development. The concomitant presence of the TT genotype of the rs2235373 polymorphism and a history of previous miscarriage increase the risk of an isolated cleft defect more than sixfold (OR = 6.7) [53]. Studies demonstrate the interaction of IRF6 and TGFA gene polymorphisms and an increased risk of the craniofacial cleft with their simultaneous presence [54].

In the Polish population, Mostowska et al. analyzed 18 polymorphisms of FOXE1, IRF6, MSX1, PAX9, TBX10, FGF10, FGFR1, TGFa, TGFb3, and SUMO1, and chromosomal region 8q24 in a group of 175 children with NSCL/P and a matched control group. A strongly significant association with NSCL/P risk was observed for rs642961 in IRF6 (OR [AG + AA vs GG] = 1.635, 95% CI 1.153–2.319, p = 0.005) [49]. Mostowska et al. also examined variants located in chromosomal regions 1p22.1, 10q25.3, 17q22, and 20q12 in a group of 206 individuals with NSCL/P and a matched control group of 446 individuals. As a result, rs227731 (located on 17q22) increased the risk of NSCL/P in the analysis in the dominant model (OR = 1.732, 95% CI 0.184–2.253, p = 0.0044). The lack of convergence of results in the Mostowska et al. [55] study may reflect differences in the geographic origin of cases compared with our study.

Reports to date on the predisposition of genetic variations to isolated cleft defects are usually based on single studies and are not in accordance with different research centers. Often, these studies are based on populations that are ethnically distinct from the Polish ones. Furthermore, there are no studies that clearly state that the predisposition for isolated cleft defects is based on a single gene. It is difficult to find papers that unambiguously point in the direction of research aimed at creating a probabilistic model of the etiology of ORFs that could be established [56].

4.1 Limitations

There has been extensive research on the etiology of NSCL/P but the results have been inconsistent. A study based on the association between SNPs and the presence of different phenotypes may have limited power to detect relevant complex inheritance patterns (e.g., synergistic involvement of different polymorphisms or interactions between environmental factors). In fact, ORs tend to be low or moderate when we examine the association between single genes and the risk of a complex trait that is likely to be regulated by a large number of genes. As a result, phenotypes result from a combination of genes and environmental factors. The residual genetic risk of nonsyndromic craniofacial clefts must therefore be explained by gene–environment interactions.

At this point, it is also worth noting that the conducted case–control studies are less adept at showing a causal relationship than cohort studies. They are also more prone to bias. The same hypothesis could also be studied in population-based cohort studies. Case–control studies do not require a long follow-up period and are easier to conduct. This design is especially useful for rare diseases but not for rare causes.

5 Conclusions

This is the first study to investigate the association between IRF6 and FGF1 genotypes and NSCL/P in the Polish population. Our findings suggest that rs34010 in the FGF1 gene is associated with a decreased risk of NSCL/P, while rs2013162, rs642961, and rs2235373 in the IRF6 gene require further study due to lack of statistical significance. This study contributes to our understanding of genetic factors related to NSCL/P; however, further investigation in a larger population is warranted.

tel: +48-606153941

  1. Funding information: This research was supported by the National Science Centre, grant number 2169/B/P01/2011/40.

  2. Author contributions: Conceptualization, A.Z., and A.J.; methodology, A.Z. and A.J.; software, S.G.; validation, K.W., and A.J.; formal analysis, A.Z.; investigation, A.Z.; B.K., and A.Z.-B. resources, A.Z., K.W., and B.K., A.Z.-B.; data curation, A.Z.; writing – original draft preparation, A.Z.; writing – review and editing, A.Z., K.G., J.J.-O., and J.L.C-G.; visualization, S.G. and A.Z.; supervision, K.W., A.J., and J.L.; project administration, A.Z., K.W., A.J., and J.L.; funding acquisition, K.W. and J.L. All authors have read and agreed to the published version of the manuscript.

  3. Conflict of interest: The authors declare no conflict of interest.

  4. Data availability statement: All data are available from the corresponding author upon request.

References

[1] Baird PA, Anderson TW, Newcombe HB, Lowry RB. Genetic disorders in children and young adults: A population study. Am J Hum Genet. 1988 May;42(5):677–93.Search in Google Scholar

[2] Dixon MJ, Marazita ML, Beaty TH, Murray JC. Cleft lip and palate: Understanding genetic and environmental influences. Nat Rev Genet. 2011 Mar;12(3):167–78. 10.1038/nrg2933.Search in Google Scholar PubMed PubMed Central

[3] Yuan Q, Blanton SH, Hecht JT. Genetic causes of nonsyndromic cleft lip with or without cleft palate. Adv Otorhinolaryngol. 2011;70:107–13. 10.1159/000322486.Search in Google Scholar PubMed

[4] Mossey PA, Little J, Munger RG, Dixon MJ, Shaw WC. Cleft lip and palate. Lancet. 2009 Nov 21;374(9703):1773–85. 10.1016/S0140-6736(09)60695-4.Search in Google Scholar PubMed

[5] Burg ML, Chai Y, Yao CA, 3rd Magee W, Figueiredo JC. Epidemiology, etiology, and treatment of isolated cleft palate. Front Physiol. 2016 Mar 1;7:67. 10.3389/fphys.2016.00067.Search in Google Scholar PubMed PubMed Central

[6] Wehby GL, Cassell CH. The impact of orofacial clefts on quality of life and healthcare use and costs. Oral Dis. 2010 Jan;16(1):3–10. 10.1111/j.1601-0825.2009.01588.x.Search in Google Scholar PubMed PubMed Central

[7] Vieira AR, McHenry TG, Daack-Hirsch S, Murray JC, Marazita ML. Candidate gene/loci studies in cleft lip/palate and dental anomalies finds novel susceptibility genes for clefts. Genet Med. 2008 Sep;10(9):668–74. 10.1097/gim.0b013e3181833793.Search in Google Scholar PubMed PubMed Central

[8] Drewa G. Genetyka medyczna. Podręcznik dla studentów. Wrocław. Poland: Edra Urban & Partner; 2011. p. 301.Search in Google Scholar

[9] Gorlin RJ, Jr Cohen MM, Hennekam RCM. Syndromes of the head and neck. New York: Oxford University Press; 2001. p. 236.10.1093/oso/9780195118612.001.0001Search in Google Scholar

[10] Marazita ML. The evolution of human genetic studies of cleft lip and cleft palate. Annu Rev Genomics Hum Genet. 2012;13:263–83. 10.1146/annurev-genom-090711-163729.Search in Google Scholar PubMed PubMed Central

[11] Jezewski PA, Vieira AR, Nishimura C, Ludwig B, Johnson M, O’Brien SE, et al. Complete sequencing shows a role for MSX1 in non-syndromic cleft lip and palate. J Med Genet. 2003 Jun;40(6):399–407. 10.1136/jmg.40.6.399.Search in Google Scholar PubMed PubMed Central

[12] Zucchero TM, Cooper ME, Maher BS, Daack-Hirsch S, Nepomuceno B, Ribeiro L, et al. Interferon regulatory factor 6 (IRF6) gene variants and the risk of isolated cleft lip or palate. N Engl J Med. 2004 Aug 19;351(8):769–80. 10.1056/NEJMoa032909.Search in Google Scholar PubMed

[13] Chiquet BT, Lidral AC, Stal S, Mulliken JB, Moreno LM, Arcos-Burgos M, et al. CRISPLD2: A novel NSCLP candidate gene. Hum Mol Genet. 2007 Sep 15;16(18):2241–8. 10.1093/hmg/ddm176.Search in Google Scholar PubMed PubMed Central

[14] Zawiślak A, Woźniak K, Jakubowska A, Lubiński J, Kawala B, Znamirowska-Bajowska A. Polymorphic variants in VAX1 gene (rs7078160) and BMP4 gene (rs762642) and the risk of non-syndromic orofacial clefts in the Polish population. Dev Period Med. 2014;18(1):16–22.Search in Google Scholar

[15] Kerameddin S, Namipashaki A, Ebrahimi S, Ansari-Pour N. IRF6 Is a marker of severity in nonsyndromic cleft lip/palate. J Dent Res. 2015 Sep;94(9 Suppl):226S–32SS. 10.1177/0022034515581013.Search in Google Scholar PubMed

[16] Ray D, Venkataraghavan S, Zhang W, Leslie EJ, Hetmanski JB, Weinberg SM, et al. Pleiotropy method reveals genetic overlap between orofacial clefts at multiple novel loci from GWAS of multi-ethnic trios. PLoS Genet. 2021 Jul 9;17(7):e1009584. 10.1371/journal.pgen.1009584.Search in Google Scholar PubMed PubMed Central

[17] Burdick AB. Genetic epidemiology and control of genetic expression in van der Woude syndrome. J Craniofacial Genet Dev Biol Suppl. 1986;2:99–105.Search in Google Scholar

[18] Butali A, Mossey PA, Adeyemo WL, Eshete MA, Gaines LA, Even D, et al. Novel IRF6 mutations in families with Van Der Woude syndrome and popliteal pterygium syndrome from sub-Saharan Africa. Mol Genet Genomic Med. 2014 May;2(3):254–60. 10.1002/mgg3.66.Search in Google Scholar PubMed PubMed Central

[19] Larrabee YC, Birkeland AC, Kent DT, Flores C, Su GH, Lee JH, et al. Association of common variants, not rare mutations, in IRF6 with nonsyndromic clefts in a Honduran population. Laryngoscope. 2011 Aug;121(8):1756–9. 10.1002/lary.21870.Search in Google Scholar PubMed

[20] Wu-Chou YH, Lo LJ, Chen KT, Chang CS, Chen YR. A combined targeted mutation analysis of IRF6 gene would be useful in the first screening of oral facial clefts. BMC Med Genet. 2013 Mar 20;14:37. 10.1186/1471-2350-14-37.Search in Google Scholar PubMed PubMed Central

[21] Rafiqdoost Z, Rafiqdoost A, Rafiqdoost H, Hashemi M, Khayatzadeh J, Eskandari-Nasab E. Investigation of FGF1 and FGFR gene polymorphisms in a group of Iranian patients with nonsyndromic cleft lip with or without cleft palate. Int J Pediatr Otorhinolaryngol. 2014 May;78(5):731–6. 10.1016/j.ijporl.2014.01.024.Search in Google Scholar PubMed

[22] WHO. International Statistical Classification of Diseases and Related Health Problems 10th Revision, 2019. Available at https://icd.who.int/browse10/2019/en [accessed 28 January 2021].Search in Google Scholar

[23] Lahiri DK, Schnabel B. DNA isolation by a rapid method from human blood samples: Effects of MgCl2, EDTA, storage time, and temperature on DNA yield and quality. Biochem Genet. 1993 Aug;31(7-8):321–8. 10.1007/BF02401826.Search in Google Scholar PubMed

[24] Zawiślak A, Woźniak K, Agirre X, Gupta S, Kawala B, Znamirowska-Bajowska A, et al. Association of ABCA4 gene polymorphisms with cleft lip with or without cleft palate in the Polish population. Int J Env Res Public Health. 2021 Oct 31;18(21):11483. 10.3390/ijerph182111483.Search in Google Scholar PubMed PubMed Central

[25] Nikopensius T, Kempa I, Ambrozaitytė L, Jagomägi T, Saag M, Matulevičienė A, et al. Variation in FGF1, FOXE1, and TIMP2 genes is associated with nonsyndromic cleft lip with or without cleft palate. Birth Defects Res A Clin Mol Teratol. 2011 Apr;91(4):218–25. 10.1002/bdra.20791.Search in Google Scholar PubMed

[26] Vieira AR, Avila JR, Daack-Hirsch S, Dragan E, Félix TM, Rahimov F, et al. Medical sequencing of candidate genes for nonsyndromic cleft lip and palate. PLoS Genet. 2005 Dec;1(6):e64. 10.1371/journal.pgen.0010064.Search in Google Scholar PubMed PubMed Central

[27] Wang H, Zhang T, Wu T, Hetmanski JB, Ruczinski I, Schwender H, , et al. The FGF and FGFR gene family and risk of cleft lip with or without cleft palate. Cleft Palate Craniofacial J. 2013 Jan;50(1):96–103. 10.1597/11-132.Search in Google Scholar PubMed PubMed Central

[28] Weinberg SM, Neiswanger K, Martin RA, Mooney MP, Kane AA, Wenger SL, et al. The Pittsburgh oral-facial cleft study: Expanding the cleft phenotype: Background and justification. Cleft Palate Craniofacial J. 2006 Jan;43(1):7–20. 10.1597/04-122r1.1.Search in Google Scholar PubMed

[29] Riley BM, Mansilla MA, Ma J, Daack-Hirsch S, Maher BS, Raffensperger LM, et al. Impaired FGF signaling contributes to cleft lip and palate. Proc Natl Acad Sci U S A. 2007 Mar 13;104(11):4512–7. 10.1073/pnas.0607956104.Search in Google Scholar PubMed PubMed Central

[30] Mohammadi M, Olsen SK, Ibrahimi OA. Structural basis for fibroblast growth factor receptor activation. Cytokine Growth Factor Rev. 2005 Apr;16(2):107–37. 10.1016/j.cytogfr.2005.01.008.Search in Google Scholar PubMed

[31] Slaney SF, Oldridge M, Hurst JA, Moriss-Kay GM, Hall CM, Poole MD, et al. Differential effects of FGFR2 mutations on syndactyly and cleft palate in Apert syndrome. Am J Hum Genet. 1996 May;58(5):923–32.Search in Google Scholar

[32] Park WJ, Theda C, Maestri NE, Meyers GA, Fryburg JS, Dufresne C, et al. Analysis of phenotypic features and FGFR2 mutations in Apert syndrome. Am J Hum Genet. 1995 Aug;57(2):321–8.Search in Google Scholar

[33] Kreiborg S, Jr Cohen MM. The oral manifestations of Apert syndrome. J Craniofacial Genet Dev Biol. 1992 Jan-Mar;12(1):41–8.Search in Google Scholar

[34] Dodé C, Levilliers J, Dupont JM, De Paepe A, Le DûN, Soussi-Yanicostas N, et al. Loss-of-function mutations in FGFR1 cause autosomal dominant Kallmann syndrome. Nat Genet. 2003 Apr;33(4):463–5. 10.1038/ng1122.Search in Google Scholar PubMed

[35] Dodé C, Hardelin JP. Kallmann syndrome: Fibroblast growth factor signaling insufficiency? J Mol Med. 2004 Nov;82(11):725–34. 10.1007/s00109-004-0571-y.Search in Google Scholar PubMed

[36] Kim HG, Herrick SR, Lemyre E, Kishikawa S, Salisz JA, Seminara S, et al. Hypogonadotropic hypogonadism and cleft lip and palate caused by a balanced translocation producing haploinsufficiency for FGFR1. J Med Genet. 2005 Aug;42(8):666–72. 10.1136/jmg.2004.026989.Search in Google Scholar PubMed PubMed Central

[37] Savitsky D, Tamura T, Yanai H, Taniguchi T. Regulation of immunity and oncogenesis by the IRF transcription factor family. Cancer Immunol Immunother. 2010 Apr;59(4):489–510. 10.1007/s00262-009-0804-6.Search in Google Scholar PubMed

[38] Richardson RJ, Dixon J, Malhotra S, Hardman MJ, Knowles L, Boot-Handford RP, et al. Irf6 is a key determinant of the keratinocyte proliferation-differentiation switch. Nat Genet. 2006 Nov;38(11):1329–34. 10.1038/ng1894.Search in Google Scholar PubMed

[39] Gritli-Linde A. The etiopathogenesis of cleft lip and cleft palate: Usefulness and caveats of mouse models. Curr Top Dev Biol. 2008;84:37–138. 10.1016/S0070-2153(08)00602-9.Search in Google Scholar PubMed

[40] Kondo S, Schutte BC, Richardson RJ, Bjork BC, Knight AS, Watanabe Y, et al. Mutations in IRF6 cause Van der Woude and popliteal pterygium syndromes. Nat Genet. 2002 Oct;32(2):285–9. 10.1038/ng985.Search in Google Scholar PubMed PubMed Central

[41] Huang Y, Wu J, Ma J, Beaty TH, Sull JW, Zhu L, et al. Association between IRF6 SNPs and oral clefts in West China. J Dent Res. 2009 Aug;88(8):715–8. 10.1177/0022034509341040.Search in Google Scholar PubMed PubMed Central

[42] Blanton SH, Cortez A, Stal S, Mulliken JB, Finnell RH, Hecht JT. Variation in IRF6 contributes to nonsyndromic cleft lip and palate. Am J Med Genet A. 2005 Sep 1;137A(3):259–62. 10.1002/ajmg.a.30887.Search in Google Scholar PubMed

[43] Ghassibé M, Bayet B, Revencu N, Verellen-Dumoulin C, Gillerot Y, Vanwijck R, et al. Interferon regulatory factor-6: A gene predisposing to isolated cleft lip with or without cleft palate in the Belgian population. Eur J Hum Genet. 2005 Nov;13(11):1239–42. 10.1038/sj.ejhg.5201486.Search in Google Scholar PubMed

[44] Scapoli L, Palmieri A, Martinelli M, Pezzetti F, Carinci P, Tognon M, et al. Strong evidence of linkage disequilibrium between polymorphisms at the IRF6 locus and nonsyndromic cleft lip with or without cleft palate, in an Italian population. Am J Hum Genet. 2005 Jan;76(1):180–3. 10.1086/427344.Search in Google Scholar PubMed PubMed Central

[45] Park JW, McIntosh I, Hetmanski JB, Jabs EW, Vander Kolk CA, Wu-Chou YH, et al. Association between IRF6 and nonsyndromic cleft lip with or without cleft palate in four populations. Genet Med. 2007 Apr;9(4):219–27. 10.1097/gim.0b013e3180423cca.Search in Google Scholar PubMed PubMed Central

[46] Paranaíba LM, Bufalino A, Martelli-Júnior H, de Barros LM, Graner E, Coletta RD. Lack of association between IRF6 polymorphisms (rs2235371 and rs642961) and non-syndromic cleft lip and/or palate in a Brazilian population. Oral Dis. 2010 Mar;16(2):193–7. 10.1111/j.1601-0825.2009.01627.x.Search in Google Scholar PubMed

[47] Brito LA, Bassi CF, Masotti C, Malcher C, Rocha KM, Schlesinger D, et al. IRF6 is a risk factor for nonsyndromic cleft lip in the Brazilian population. Am J Med Genet A. 2012 Sep;158A(9):2170–5. 10.1002/ajmg.a.35526.Search in Google Scholar PubMed

[48] Pan Y, Ma J, Zhang W, Du Y, Niu Y, Wang M, et al. IRF6 polymorphisms are associated with nonsyndromic orofacial clefts in a Chinese Han population. Am J Med Genet A. 2010 Oct;152A(10):2505–11. 10.1002/ajmg.a.33624.Search in Google Scholar PubMed

[49] Mostowska A, Hozyasz KK, Wojcicki P, Biedziak B, Paradowska P, Jagodzinski PP. Association between genetic variants of reported candidate genes or regions and risk of cleft lip with or without cleft palate in the polish population. Birth Defects Res A Clin Mol Teratol. 2010 Jul;88(7):538–45. 10.1002/bdra.20687.Search in Google Scholar PubMed

[50] Birnbaum S, Ludwig KU, Reutter H, Herms S, de Assis NA, Diaz-Lacava A, et al. IRF6 gene variants in central European patients with non-syndromic cleft lip with or without cleft palate. Eur J Oral Sci. 2009 Dec;117(6):766–9. 10.1111/j.1600-0722.2009.00680.x.Search in Google Scholar PubMed

[51] Murdoch AM, Patir A, Seymen F, Vieira AR. Studies of palatine rugae and interferon regulatory factor 6 variations in a group of families with sporadic hypodontia. J Oral Sci. 2009 Dec;51(4):521–6. 10.2334/josnusd.51.521.Search in Google Scholar PubMed

[52] Jugessur A, Rahimov F, Lie RT, Wilcox AJ, Gjessing HK, Nilsen RM, et al. Genetic variants in IRF6 and the risk of facial clefts: Single-marker and haplotype-based analyses in a population-based case-control study of facial clefts in Norway. Genet Epidemiol. 2008 Jul;32(5):413–24. 10.1002/gepi.20314.Search in Google Scholar PubMed PubMed Central

[53] Jia ZL, Li Y, Li L, Wu J, Zhu LY, Yang C, et al. Association among IRF6 polymorphism, environmental factors, and nonsyndromic orofacial clefts in Western China. DNA Cell Biol. 2009 May;28(5):249–57. 10.1089/dna.2008.0837.Search in Google Scholar PubMed

[54] Sull JW, Liang KY, Hetmanski JB, Wu T, Fallin MD, Ingersoll RG, et al. Evidence that TGFA influences risk to cleft lip with/without cleft palate through unconventional genetic mechanisms. Hum Genet. 2009 Sep;126(3):385–94. 10.1007/s00439-009-0680-3.Search in Google Scholar PubMed PubMed Central

[55] Mostowska A, Hozyasz KK, Wojcicka K, Biedziak B, Jagodzinski PP. Polymorphic variants at 10q25.3 and 17q22 loci and the risk of non-syndromic cleft lip and palate in the Polish population. Birth Defects Res A Clin Mol Teratol. 2012 Jan;94(1):42–6. 10.1002/bdra.22862.Search in Google Scholar PubMed

[56] Candotto V, Oberti L, Gabrione F, Greco G, Rossi D, Romano M et al. Current concepts on cleft lip and palate etiology. J Biol Regul Homeost Agents. 2019 May-Jun;33(3 Suppl. 1):145–51.Search in Google Scholar
Received: 2022-08-06
Revised: 2022-12-26
Accepted: 2023-02-06
Published Online: 2023-04-01

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
https://doi.org/10.1515/med-2023-0677
Keywords for this article
birth defect; cleft lip; cleft palate; genetic variation; single nucleotide polymorphism; IRF6; FGF1
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2026 De Gruyter Brill
Downloaded on 5.1.2026 from https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0677/html
Scroll to top button