Home Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
Article Open Access

Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis

  • Hui Pan , Jing Peng , Xiaoni Qiao and Han Gao EMAIL logo
Published/Copyright: March 13, 2023
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 18 Issue 1

Abstract

Patients with non-small-cell lung cancer (NSCLC) have a low survival rate. Long non-coding RNA (LncRNA) LANCL1 antisense RNA 1 (LANCL1-AS1) was indicated to be downregulated in NSCLC; however, its detailed function in NSCLC is unanswered. Real-time quantitative polymerase chain reaction revealed the downregulation of LANCL1-AS1 in NSCLC cell lines and subcellular fractionation assay showed that LANCL1-AS1 was mainly located in the cytoplasm of NSCLC cells. Cell counting kit-8, Transwell, and tube formation assays displayed that overexpression of LANCL1-AS1 suppressed NSCLC cell proliferation, migration, invasiveness, and angiogenesis in vitro. Animal experiments validated the tumor-suppressive role of LANCL1-AS1 in tumor-bearing mice. Mechanistically, LANCL1-AS1 upregulated glia maturation factor gamma (GMFG) expression by competitively binding to miR-3680-3p. GMFG knockdown reversed LANCL1-AS1 overexpression-mediated inhibitory impact on NSCLC malignant behaviors. Collectively, LANCL1-AS1 upregulation inhibits the progression of NSCLC by modulating the miR-3680-3p/GMFG axis.

Keywords: non-small-cell lung cancer; LANCL1-AS1; miR-3680-3p; GMFG

1 Introduction

Lung cancer (LC) is the second most prevalent malignancy and the major cause of cancer-related deaths [1]. It is estimated in 2022 that LC accounts for 21% of all cancer-related deaths in men and women in the United States [2]. Emerging evidence has indicated that smoking is the main predisposing factor of LC [3]. Small-cell lung cancer (SCLC) and non-small-cell lung cancer (NSCLC) are two major types of LC, and NSCLC mainly incudes lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC), accounting for more than 80% of all LC cases [4]. Despite the declines in the incidence and mortality of LC owing to therapeutic advances and cessation, the 5-year relative survival rate of LC patients is 21%, while that of patients with metastatic disease is only 6% [5]. Hence, finding a more effective biomarker for the diagnosis and therapy of LC is urgent.

Long non-coding RNAs (lncRNAs) are RNA segments consisting of over 200 nucleotides which have no potential to encode proteins but have critical functions in various cellular processes by interacting with downstream molecules [6]. Plentiful studies have verified the involvement of lncRNAs in the tumorigenesis, pathogenesis, and angiogenesis of cancers, including NSCLC [7,8]. For example, LINC01599 is considered as an oncogene in LUAD by promoting autophagy [1]. LINC01296 knockdown inhibits the progression of NSCLC via the miR-143-3p/ATG2B [9]. Furthermore, the regulatory functions of lncRNAs are determined differently by their subcellular location. Numerous studies demonstrated that in the cytoplasm, lncRNAs work as competing endogenous RNAs (ceRNAs) to regulate downstream RNA expression [10]. LANCL1 antisense RNA 1 (LANCL1-AS1) is a novel lncRNA which was reported to be downregulated in NSCLC [11]. Additionally, LANCL1-AS1 was indicated to be an autophagy-related RNA in LUAD [1]. Bioinformatics analysis elucidated the downregulation of LANCL1-AS1 in lung tumors compared with adjacent normal tissues, indicating that LANCL1-AS1 might be a tumor suppressor of LC. In addition, lncLocator (http://www.csbio.sjtu.edu.cn/bioinf/lncLocator/) predicted that LANCL1-AS1 is largely distributed in the cytoplasm. Nevertheless, the detailed function of LANCL1-AS1 in NSCLC is unanswered.

This study aimed to probe the role as well as the regulatory mechanism of LANCL1-AS1 in NSCLC. We hypothesized that LANCL1-AS1 might act as a ceRNA to affect the pathogenesis of NSCLC by modulating downstream molecule expression. Our findings might help to develop a new idea for the diagnosis and therapy of NSCLC.

2 Materials and methods

2.1 Cell culture and transfection

Human normal bronchial epithelial cell line (HBE) and NSCLC cell lines (A549, H1299, and H460) were obtained from the Cell Bank of Chinese Academy of Sciences (Shanghai, China) and incubated in RPMI-1640 medium (Gibco, Waltham, MA, USA) containing 10% fetal bovine serum (FBS; Invitrogen, Carlsbad, CA, USA), 100 U/mL penicillin, and 100 mg/mL streptomycin (Gibco) at 37°C with 5% CO2 in a humidified incubator. For cell transfection, pcDNA3.1/LANCL1-AS1 and empty pcDNA3.1 vector were synthesized by GenePharma (Shanghai, China) for overexpression assays. For the downregulation of miR-3680-3p and glia maturation factor gamma (GMFG), miR-3680-3p inhibitor or the negative control (NC inhibitor) and short hairpin RNAs targeting GMFG (sh-GMFG#1/2) or sh-NC were also obtained from RiboBio (Guangzhou, China). The above vectors were transfected into A549 and H460 cells, respectively using Lipofectamine 2000 (Invitrogen). Cells transfected for 48 h were used for subsequent analysis.

2.2 Real-time quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated from NSCLC cells or tumor tissues of mice using TRIzol reagent (Invitrogen). The cDNA was synthesized by reverse transcription of 1 μg RNA samples using SuperScript II (Vazyme, Nanjing, China). RT-qPCR was implemented with SYBR Premix Ex Taq II (Takara, Dalian, China) on a 7500 Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA). Quantification of LANCL1-AS1, mRNAs, and miRNAs was conducted with the 2−ΔΔCt method, normalized to GAPDH and U6, respectively. Primer sequences are listed in Table 1.

Table 1

Primer sequence used for RT-qPCR

Gene Sequence (5′→3′)
LANCL1-AS1 forward TGGATCTTCAGCAGCCACCT
LANCL1-AS1 reverse TCCAGGCCTGATAGTGTAGCT
miR-6748-3p forward ACACTCCAGCTGGGTCCTGTCCCTGTCTC
miR-6748-3p reverse TGGTGTCGTGGAGTCG
miR-3680-3p forward ACACTCCAGCTGGGTTTTGCATGACCCTGGG
miR-3680-3p reverse TGGTGTCGTGGAGTCG
miR-214-5p forward ACACTCCAGCTGGGTGCCTGTCTACACTTG
miR-214-5p reverse TGGTGTCGTGGAGTCG
miR-4732-5p forward ACACTCCAGCTGGGTGTAGAGCAGGGAGCAG
miR-4732-5p reverse TGGTGTCGTGGAGTCG
KCNMB2 forward GCACCGGATCGCTGTCATTA
KCNMB2 reverse TGGCAAAAAGACCTCCGGTA
TFRC forward GGTTATGTGGCGTATAGTAAG
TFRC reverse CTGAGTGTGATTGAAGGAAG
GMFG forward AAAGAAGAGGCCTGTGGACAG
GMFG reverse TGGTTGTTCAGGTCCTAGGG
GAPDH forward TATGATGATATCAAGAGGGTAGT
GAPDH reverse TGTATCCAAACTCATTGTCATAC
U6 forward GTGCGTGTCGTGGAGTCG
U6 reverse AACGCTTCACGAATTTGCGT

2.3 Subcellular fractionation assay

Nuclear/Cytosol Fractionation Kit (Biovision, Shenzhen, China) was used for nuclear and cytoplasmic fraction extraction from A549 and H460 cells. LANCL1-AS1 were isolated from the two fractions and quantified with RT-qPCR. GAPDH and U6 were used as endogenous controls for cytoplasm and nucleus, respectively.

2.4 Cell counting kit-8 (CCK-8) assay

NSCLC cells were placed into 96-well plates (1 × 103 cells/well). At 24, 48, and 72 h, CCK-8 solution (10 μL, Dojindo, Kumamoto, Japan) was added, and the cells were cultured for further 2 h at 37°C. Afterwards, the absorbance at 450 nm was assessed with a microplate reader (Thermo Scientific, Waltham, MA, USA). For cell sensitivity assessment, NSCLC cells were treated with IC50 of gefitinib (a tyrosine kinase inhibitor, TKI drug; MedChemExpress, Shanghai, China) for 24 h, followed by adding CCK-8 solution.

2.5 Transwell assay

Transwell assays were implemented for measuring cell migratory or invasive capabilities. NSCLC cells (2 × 104) were added to the upper chamber of the Transwell chamber (8 μm pore size; Corning, Lowell, MA, USA). The lower or upper chamber was added with complete medium or serum-free medium, respectively. After 48 h of incubation, the non-migratory cells in the upper chamber were swabbed and the migratory cells were subjected to 0.1% crystal violet staining. The invasion assay was similar except that the upper chamber was precoated with Matrigel (BD Biosciences, San Jose, CA, USA). Stained cells were imaged under a microscope (Nikon, Tokyo, Japan).

2.6 Tube formation assay

Human umbilical vein endothelial cell line (HUVEC) was obtained from American Type Culture Collection (ATCC, Manassas, VA, USA) and incubated in Endothelial Cell Growth Medium BulletKit (EGM, Lonza, Switzerland) at 37°C with 5% CO2 in a humidified atmosphere. HUVECs (2 × 104) in 200 μL conditional medium from A549 and H460 cells were inoculated into a 24-well plate which was precoated with Matrigel (Corning) followed by incubation with 5% CO2 at 37°C for 6 h. Tube structures were photographed under a bright-field microscope (Nikon). The mesh and length of the completed tubes were measured to quantify tube formation using Image View 3.7 (Jingtong, China).

2.7 Western blotting

Proteins were isolated from cells using RIPA lysis buffer (Thermo Scientific) and quantified with a BCA assay kit (Bio‐Rad, Hercules, CA, USA). Equal amounts of protein samples (20 μg) were dissolved by 10% SDS-PAGE (Bio-Rad) and blotted onto polyvinylidene fluoride (PVDF) membranes (GE Healthcare, Beijing, China). Membranes were blocked with 5% defatted milk and incubated at 4°C overnight with primary antibodies against fibroblast growth factor 2 (FGF2, ab208687), vascular endothelial growth factor (VEGF, ab46154), angiopoietin 1 (Ang1, ab183701), β-actin (ab115777) (all from Abcam, Cambridge, MA, USA) and GMFG (13625-1-AP; Proteintech, Chicago, IL, USA), followed by incubation with the secondary antibody (ab7090, Abcam) at room temperature for 2 h. The blots were visualized with the ECL kit (Vazyme, Nanjing, China) and quantified with ImageJ software (GE Healthcare).

2.8 Luciferase reporter assay

Putative binding site between LANCL1-AS1 and miR-3680-3p or miR-3680-3p and GMFG was predicted by DIANA (http://carolina.imis.athena-innovation.gr/diana_tools/web/) and TargetScan (http://www.targetscan.org/vert_71/), respectively. Putative binding site was mutated by Phusion Site-Directed Mutagenesis Kits (Thermo Scientific). Wild type (Wt) or mutant (Mut) miR-3680-3p or GMFG was synthesized and subcloned into pmirGLO vectors (Promega, Madison, WI, USA) to construct miR-3680-3p-Wt/Mut and GMFG-Wt/Mut. Then, miR-3680-Wt/Mut and GMFG-Wt/Mut were co-transfected with pcDNA3.1/LANCL1-AS1 (or empty pcDNA3.1) and miR-3680-3p inhibitor, respectively, into A549 and H460 cells using Lipofectamine 2000 (Invitrogen). Forty-eight hours later, the luciferase activity was measured with a dual luciferase® reporter assay system (Promega).

2.9 In vivo xenograft experiments

BALB/c nude mice (male, 5–6 weeks) were obtained from Vital River (Beijing, China) and randomly divided into two groups (n = 5 per group). Recombinant lentivirus carrying LANCL1-AS1 (Lv-LANCL1-AS1) and empty control vector (Lv-con) were synthesized by GenePharma. Mice were injected subcutaneously with H460 cells (2 × 105) expressing Lv-LANCL1-AS1 or Lv-con. Tumor volume was monitored every 3 days and computed by the formula: volume = ½(length × width2). On 18th day, the mice were sacrificed under anesthesia and tumor weight was measured. All animal experiments implemented were approved by the Ethics Committee of Gansu Provincial Hospital.

2.10 Statistical analysis

Data are expressed as the mean value ± standard deviation (SD). Statistical analysis was conducted using SPSS 21.0 (IBM Corp., Armonk, NY, USA). Student’s t-test was utilized for two group comparison, while analysis of variance (ANOVA) was utilized for multiple group comparison followed by Tukey’s post hoc analysis. p < 0.05 was regarded to be statistically significant.

3 Results

3.1 LANCL1-AS1 is downregulated in NSCLC

LANCL1-AS1 expression was examined with GEPIA (http://gepia.cancer-pku.cn/) which reveals LANCL1-AS1 downregulation in LUAD (Figure 1a). Kaplan–Meier Plotter (https://kmplot.com/analysis/) indicates that LANCL1-AS1 downregulation is associated with the poor prognosis of patients with LUAD (Figure 1b). Consistent with the above results, RT-qPCR disclosed a decreased level of LANCL1-AS1 in NSCLC cell lines (A549, H1299, and H460) in comparison to the normal cell line (HBE) (Figure 1c). In accord with the prediction of lncLocator in Figure 1d, the results of subcellular fractionation demonstrated that LANCL1-AS1 was largely located in the cytoplasm of NSCLC cells (Figure 1e). These results showed that a low level of LANCL1-AS1 is related to a poor prognosis of NSCLC.

Figure 1 LANCL1-AS1 is downregulated in NSCLC. (a) LANCL1-AS1 expression in LUAD (n = 483) and normal tissues (n = 347) displayed by GEPIA database. (b) The relationship between LANCL1-AS1 expression and LUAD patient prognoses shown by Kaplan–Meier plotter website. (c) RT-qPCR analysis of LANCL1-AS1 level in NSCLC and normal cell lines. (d) The location of LANCL1-AS1 in cells predicted by lncLocator website. (e) Subcellular fractionation assay of LANCL1-AS1 location in NSCLC cells. * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 1

LANCL1-AS1 is downregulated in NSCLC. (a) LANCL1-AS1 expression in LUAD (n = 483) and normal tissues (n = 347) displayed by GEPIA database. (b) The relationship between LANCL1-AS1 expression and LUAD patient prognoses shown by Kaplan–Meier plotter website. (c) RT-qPCR analysis of LANCL1-AS1 level in NSCLC and normal cell lines. (d) The location of LANCL1-AS1 in cells predicted by lncLocator website. (e) Subcellular fractionation assay of LANCL1-AS1 location in NSCLC cells. * p < 0.05, ** p < 0.01, *** p < 0.001.

3.2 Overexpression of LANCL1-AS1 restrains cell migration, invasiveness, and angiogenesis of NSCLC

To reveal the role of LANCL1-AS1 in NSCLC, A549 and H460 cells were stably administrated with pcDNA3.1 or pcDNA3.1/LANCL1-AS1. LANCL1-AS1 level was significantly elevated in LANCL1-AS1-overexpressed cells (Figure 2a). Then, we tested whether LANCL1-AS1 affected NSCLC cell sensitivity to the TKI drug gefitinib. Notably, under gefitinib treatment, NSCLC cells in the control group exhibited higher survival rate that those in LANCL1-AS1-overexpressed group, indicating that LANCL1-AS1 promoted NSCLC cell sensitivity to gefitinib (Figure 2b). CCK-8 assay revealed that upregulation of LANCL1-AS1 restrained NSCLC cell proliferation (Figure 2c). As displayed by Transwell assays, the migratory and invasive capabilities of NSCLC cells were suppressed after overexpressing LANCL1-AS1 (Figure 2d and e). Tube formation assay was conducted to evaluate LANCL1-AS1 impact on angiogenesis of HUVECs. The results displayed marked suppression of mesh formation using condition medium from A549 or H460 cells with LANCL1-AS1 overexpression (Figure 2f). Furthermore, expression levels of angiogenesis-related proteins (VEGF, Ang1, and FGF2) were markedly lessened in LANCL1-AS1-overexpressed A549 and H460 cells (Figure 2g). Collectively, LANCL1-AS1 restrains the migration, invasiveness, and angiogenesis of NSCLC cells.

Figure 2 LANCL1-AS1 upregulation restrains cell migration, invasiveness, and angiogenesis of NSCLC. (a) RT-qPCR for evaluating the transfection efficiency of pcDNA3.1/LANCL1-AS1 in A549 and H460 cells. (b) The survival rate of NSCLC cells with or without LANCL1-AS1 overexpression under gefitinib treatment. (c) CCK-8 assay for evaluating the viability of LANCL1-AS1-overexpressed A549 and H460 cells. (d and e) Transwell assays for evaluating cell migratory and invasive capabilities after LANCL1-AS1 overexpression. (f) Tube formation assay for assessing angiogenic ability of HUVECs with LANCL1-AS1 upregulation. (g) Western blotting for evaluating levels of angiogenesis-related proteins. ** p < 0.01, *** p < 0.001.
Figure 2

LANCL1-AS1 upregulation restrains cell migration, invasiveness, and angiogenesis of NSCLC. (a) RT-qPCR for evaluating the transfection efficiency of pcDNA3.1/LANCL1-AS1 in A549 and H460 cells. (b) The survival rate of NSCLC cells with or without LANCL1-AS1 overexpression under gefitinib treatment. (c) CCK-8 assay for evaluating the viability of LANCL1-AS1-overexpressed A549 and H460 cells. (d and e) Transwell assays for evaluating cell migratory and invasive capabilities after LANCL1-AS1 overexpression. (f) Tube formation assay for assessing angiogenic ability of HUVECs with LANCL1-AS1 upregulation. (g) Western blotting for evaluating levels of angiogenesis-related proteins. ** p < 0.01, *** p < 0.001.

3.3 LANCL1-AS1 binds to miR-3680-3p

DIANA website was used for screening downstream miRNAs that can interact with LANCL1-AS1. With the screening condition of score˃0.97, four miRNAs were singled out (Figure 3a). As displayed by RT-qPCR, only miR-3680-3p was significantly downregulated in LANCL1-AS1-overexpressed A549 and H460 cells (Figure 3b). Additionally, miR-3680-3p exhibited a high level in NSCLC cell lines in comparison to the normal cells (Figure 3c). DIANA predicts putative binding site between LANCL1-AS1 and miR-3680-3p (Figure 3d). Moreover, overexpression of LANCL1-AS1 was shown to decrease the luciferase activity of miR-3680-3p-Wt rather than miR-3680-3p-Mut in A549 and H460 cells (Figure 3e), verifying the binding relation between LANCL1-AS1 and miR-3680-3p. Additionally, high expression of miR-3680-3p is closely associated with the adverse prognosis of LUAD patients, as shown by ENCORI (https://starbase.sysu.edu.cn/index.php) website (Figure 3f).

Figure 3 LANCL1-AS1 binds to miR-3680-3p. (a) LANCL1-AS1 downstream miRNAs predicted by DIANA. (b) RT-qPCR analysis of the miRNA levels in LANCL1-AS1-upregulated A549 and H460 cells. (c) RT-qPCR of miR-3680-3p level in NSCLC and normal cell lines. (d) Putative binding site between LANCL1-AS1 and miR-3680-3p shown by DIANA. (e) The relation between LANCL1-AS1 and miR-3680-3p verified by luciferase reporter assay. (f) The association between miR-3680-3p expression and LUAD patient prognoses shown by ENCORI. *** p < 0.001.
Figure 3

LANCL1-AS1 binds to miR-3680-3p. (a) LANCL1-AS1 downstream miRNAs predicted by DIANA. (b) RT-qPCR analysis of the miRNA levels in LANCL1-AS1-upregulated A549 and H460 cells. (c) RT-qPCR of miR-3680-3p level in NSCLC and normal cell lines. (d) Putative binding site between LANCL1-AS1 and miR-3680-3p shown by DIANA. (e) The relation between LANCL1-AS1 and miR-3680-3p verified by luciferase reporter assay. (f) The association between miR-3680-3p expression and LUAD patient prognoses shown by ENCORI. *** p < 0.001.

3.4 GMFG is a target of miR-3680-3p

To further reveal the regulatory mechanism of LANCL1-AS1 in NSCLC, TargetScan was used for prediction of the downstream gene of miR-3680-3p. Three candidate mRNAs were screened out with the condition of cumulative weighted context++ score >0.7 (Figure 4a). RT-qPCR revealed the downregulation of miR-3680-3p in A549 and H460 cells treated with miR-3680-3p inhibitor (Figure 4b). Additionally, only GMFG was upregulated in miR-3680-3p-depleted A549 and H460 cells (Figure 4c). Western blotting disclosed that depletion of miR-3680-3p increased the protein level of GMFG in A549 and H460 cells (Figure 4d and e). Then, we overexpressed miR-3680-3p in NSCLC cells using miR-3680-3p mimics (Figure 4e). As shown in Figure 4f, upregulation of LANCL1-AS1 elevated GMFG protein expression in NSCLC cells, while overexpression of miR-3680-3p reversed the effect of LANCL1-AS1 upregulation. TargetScan predicts the existence of miR-3680-3p complementary site on GMFG 3'UTR and luciferase reporter assay further elucidated the binding relation between miR-3680-3p and GMFG (Figure 4g and h). GEPIA database shows the downregulation of GMFG in LUAD tissues compared with the normal samples (Figure 4i). In comparison to that in the normal cells, GMFG expression in NSCLC cells was markedly decreased (Figure 4j). Moreover, Kaplan–Meier Plotter exhibits a strong correlation between GMFG low expression and poor prognoses of LUAD patients (Figure 4k). Hence, GMFG is targeted by miR-3680-3p, and its expression is closely related to patient prognoses.

Figure 4 miR-3680-3p targets GMFG. (a) TargetScan predicts three candidate downstream genes of miR-3680-3p. (b) RT-qPCR for assessing miR-3680-3p inhibitor transfection efficiency. (c) RT-qPCR of mRNA expression in miR-3680-30-depleted NSCLC cells. (d) Western blotting of GMFG protein level in miR-3680-3p-depleted NSCLC cells. (e) RT-qPCR for examining miR-3680-3p overexpression efficiency. (f) Western blotting of GMFG protein level in NSCLC cells with transfection of pcDNA3.1/LANCL1-AS1 or pcDNA3.1/LANCL1-AS1 + miR-3680-3p mimics. (g) miR-3680-3p complementary site on GMFG predicted by TargetScan. (h) The binding relation between miR-3680-3p and GMFG identified by luciferase reporter assay. (i) GMFG expression in LUAD and normal tissues shown by GEPIA. (j) RT-qPCR of GMFG level in NSCLC and normal cell lines. (k) Kaplan–Meier plotter displays the association between GMFG expression and LUAD patient prognoses. * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 4

miR-3680-3p targets GMFG. (a) TargetScan predicts three candidate downstream genes of miR-3680-3p. (b) RT-qPCR for assessing miR-3680-3p inhibitor transfection efficiency. (c) RT-qPCR of mRNA expression in miR-3680-30-depleted NSCLC cells. (d) Western blotting of GMFG protein level in miR-3680-3p-depleted NSCLC cells. (e) RT-qPCR for examining miR-3680-3p overexpression efficiency. (f) Western blotting of GMFG protein level in NSCLC cells with transfection of pcDNA3.1/LANCL1-AS1 or pcDNA3.1/LANCL1-AS1 + miR-3680-3p mimics. (g) miR-3680-3p complementary site on GMFG predicted by TargetScan. (h) The binding relation between miR-3680-3p and GMFG identified by luciferase reporter assay. (i) GMFG expression in LUAD and normal tissues shown by GEPIA. (j) RT-qPCR of GMFG level in NSCLC and normal cell lines. (k) Kaplan–Meier plotter displays the association between GMFG expression and LUAD patient prognoses. * p < 0.05, ** p < 0.01, *** p < 0.001.

3.5 GMFG silencing rescues LANCL1-AS1 overexpression-mediated inhibitory effect on NSCLC cellular activities

Rescue experiments were conducted to further identify the LANCL1-AS1/miR-3680-3p/GMFG axis-mediated effect on the progression of NSCLC. The transfection efficiency of sh-GMFG#1/2 was detected by RT-qPCR (Figure 5a). As revealed by CCK-8 assay, LANCL1-AS1 overexpression-induced suppression on cell viability was partially reversed by GMFG depletion (Figure 5b). Similarly, downregulating GMFG rescued the suppression in NSCLC cell migration and invasiveness which was caused by LANCL1-AS1 upregulation (Figure 5c and d). Moreover, tube formation assay and western blotting displayed that LANCL1-AS1 overexpression-induced inhibitory impact on angiogenesis of HUVECs was significantly attenuated by GMFG knockdown (Figure 5e and f). Collectively, LANCL1-AS1 inhibits NSCLC progression via the miR-3680-3p/GMFG axis.

Figure 5 GMFG silencing rescues LANCL1-AS1 overexpression-mediated inhibitory effect on NSCLC cellular activities. (a) RT-qPCR for evaluating the transfection efficiency of sh-GMFG#1/2 in A549 and H460 cells. (b) CCK-8 assay for assessing viabilities of A549 and H460 cells treated with pcDNA3.1, pcDNA3.1/LANCL1-AS1, or pcDNA3.1/LANCL1-AS1 + sh-GMFG#1. (c and d) Transwell assays for analyzing the migration and invasiveness of NSCLC cells with above treatment. (e) Tube formation assay for detecting the mesh formed by HUVECs. (f) Western blotting for evaluating angiogenesis-related protein levels in NSCLC cells with above transfection. * p < 0.05, ** p < 0.01, *** p < 0.001.
Figure 5

GMFG silencing rescues LANCL1-AS1 overexpression-mediated inhibitory effect on NSCLC cellular activities. (a) RT-qPCR for evaluating the transfection efficiency of sh-GMFG#1/2 in A549 and H460 cells. (b) CCK-8 assay for assessing viabilities of A549 and H460 cells treated with pcDNA3.1, pcDNA3.1/LANCL1-AS1, or pcDNA3.1/LANCL1-AS1 + sh-GMFG#1. (c and d) Transwell assays for analyzing the migration and invasiveness of NSCLC cells with above treatment. (e) Tube formation assay for detecting the mesh formed by HUVECs. (f) Western blotting for evaluating angiogenesis-related protein levels in NSCLC cells with above transfection. * p < 0.05, ** p < 0.01, *** p < 0.001.

3.6 Overexpression of LANCL1-AS1 inhibits tumorigenesis of NSCLC in vivo

To further elucidate LANCL1-AS1 effect on NSCLC, in vivo experiments were carried out. Results displayed that the tumors in LANC1-AS1-overexpressed group grew much more slowly and smaller than those in the control group (Figure 6a–c). Notably, overexpression of LANCL1-AS1 markedly inhibited the expression of angiogenesis-associated proteins in tumors (Figure 6d). These indicated that LANCL1-AS1 exerts an inhibitory effect on tumorigenesis of NSCLC. Additionally, we detected the expression levels of LANCL1-AS1, miR-3680-3p, and GMFG in the tumors of each group. As depicted by the results, LANCL1-AS1 displayed a significantly higher level in Lv-LANCL1-AS1-treated group than that in the control group, confirming the successful overexpression of LNACL1-AS1 in the tumor xenograft mouse model (Figure 6e). Moreover, miR-3680-3p was downregulated and GMFG was markedly upregulated in LANCL1-AS1-overexpressed group (Figure 6f and g). These data indicated that LANCL1-AS1 upregulated GMFG expression by interacting with miR-3680-3p in vivo.

Figure 6 LANCL1-AS1 overexpression inhibits tumorigenesis of NSCLC in vivo. (a) BALB/c nude mice were implanted with H460 cells stably expressing Lv-pcDNA3.1 or Lv-LANCL1-AS1. n = 5 per group. (b) Tumor volumes were detected every 3 days. (c) Tumor weight was measured on the 18th day. (d) Western blotting for examining levels of angiogenesis-related proteins in tumors. (e–g) RT-qPCR analysis for evaluating LANCL1-AS1, miR-3680-3p, and GMFG expression in tumor tissues. ** p < 0.01, *** p < 0.001.
Figure 6

LANCL1-AS1 overexpression inhibits tumorigenesis of NSCLC in vivo. (a) BALB/c nude mice were implanted with H460 cells stably expressing Lv-pcDNA3.1 or Lv-LANCL1-AS1. n = 5 per group. (b) Tumor volumes were detected every 3 days. (c) Tumor weight was measured on the 18th day. (d) Western blotting for examining levels of angiogenesis-related proteins in tumors. (e–g) RT-qPCR analysis for evaluating LANCL1-AS1, miR-3680-3p, and GMFG expression in tumor tissues. ** p < 0.01, *** p < 0.001.

4 Discussion

In the present study, we found that lncRNA LANCL1-AS1 acted as a tumor suppressor in NSCLC by regulating the miR-3680-3p/GMFG axis. Our data showed that overexpression of LANCL1-AS1 inhibited NSCLC cell proliferation, migration, invasion as well as angiogenesis. This suppressive effect on the tumorigenesis of NSCLC was also verified in tumor-bearing mouse models.

Despite the progress made in the diagnoses and treatments, the incidence of NSCLC is still high, with the overall 5-year survival rate lower than 17% [12]. Emerging evidence has illustrated the prominent effects of lncRNAs involved in regulation of cancers, including NSCLC. Multiple lncRNAs are considered as a prognostic biomarker and therapeutic target in NSCLC. For example, RP11-909N17.2 facilitates the cellular processes of NSCLC and predicts an adverse prognosis of patients [13]. PCAT29 inhibits NSCLC progression via the miR-494/PTEN axis and NSCLC patients with a higher level of PCAT29 have a better prognosis [14]. These suggest that lncRNAs can be a tumor suppressor gene or an oncogene. Here we probed the function of LANCL1-AS1 in NSCLC. LANCL1-AS1 is a novel gene that has been indicated to be downregulated in NSCLC; however, to our knowledge, the detailed functions of LANCL1-AS1 have not been studied yet. Currently, LANCL1-AS1 was shown to be downregulated in NSCLC cell lines and bioinformatics analysis revealed that its downregulation is associated with the adverse survival of LUAD patients, indicating the tumor suppressor role of LANCL1-AS1 in NSCLC. Moreover, gain-of-function assays demonstrated that LANCL1-AS1 overexpression restrained the proliferation, motion, and angiogenesis of NSCLC cells in vitro. Importantly, in vivo experiments displayed that upregulated LANC1-AS1 restrained tumorigenesis and angiogenesis in mice. These results elucidated that LANCL1-AS1 suppresses NSCLC progression.

Numerous studies have elucidated that in the cytoplasm, lncRNAs function as a ceRNA to competitively absorb microRNAs (miRNAs) and subsequently regulate messenger RNA (mRNA) expression [15]. For example, in prostate cancer, LINC01679 suppresses tumor progression by regulating miR-3150a-3p/SLC17A9 axis [16]. Additionally, in thyroid cancer, MIAT contributes to tumor progression by absorbing miR-150-5p and modulate EZH2 [17]. Bioinformatics analysis and our assays confirmed that LANCL1-AS1 was largely distributed in the cytoplasm of NSCLC cells, indicating the potential of LANCL1-AS1 as a ceRNA in NSCLC. With the use of bioinformatic tools and a series of experiments, we finally identified miR-3680-3p that could bind with LANCL1-AS1 in NSCLC cells. miR-3680-3p was shown to be sponged by circ-PRKCI to regulate AKT3 expression in esophageal squamous cell carcinoma [18]. Presently, it was shown that miR-3680-3p was upregulated in NSCLC cells and its upregulation correlates with the adverse survival of LUAD patients.

It is recognized that miRNAs can bind to mRNA 3'UTRs by base-pairing, consequently leading to either mRNA degradation or translation suppression [19]. To better understand the mechanism of LANCL1-AS1, we screened the downstream gene of miR-3680-3p. Eventually, GMFG was singled out which displayed downregulated expression in NSCLC and strongly associated with the prognosis of LUAD patients. GMFG has been indicated to play a part in several cancers. For example, a high level of GMFG is related to adverse prognosis and facilitates the progression of epithelial ovarian cancer [20]. Moreover, GMFG exerts an antitumor role in breast cancer and is considered as a promising biomarker for the diagnosis and prognosis [21]. Intriguingly, GMFG was indicated to be downregulated in LUAD [22]. In this study, GMFG silencing was shown to reverse LANCL-AS1 overexpression-mediated inhibitory impact on NSCLC cell malignant behaviors, indicating the antitumor effect of the LANCL1-AS1/miR-3680-3p/GMFG axis in NSCLC.

In conclusion, we probed the role of LANCL1-AS1 in NSCLC. LANCL1-AS1 suppresses the migration, invasiveness, and angiogenesis of NSCLC cells and inhibits tumorigenesis in vivo. Mechanistically, LANCL1-AS1 exerts its antitumor effect by functioning as a ceRNA via the miR-3680-3p/GMFG axis. The findings might develop a novel idea for the therapy of NSCLC.

# These authors contributed equally to this work.

Acknowledgement

Not applicable.

  1. Funding information: None

  2. Conflict of interest: The authors have no conflict of interest to declare.

  3. Data availability statement: The datasets used or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Zhao Z, Wan J, Guo M, Yang Z, Li Z, Wang Y, et al. Long non-coding RNA LINC01559 exerts oncogenic role via enhancing autophagy in lung adenocarcinoma. Cancer Cell Int. 2021;21(1):624.10.1186/s12935-021-02338-4Search in Google Scholar PubMed PubMed Central

[2] Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer statistics, 2022. CA Cancer J Clin. 2022;72(1):7–33.10.3322/caac.21708Search in Google Scholar PubMed

[3] Cruz CRV, Ferrer JLM, Garcia RL. Concomitant and decoupled effects of cigarette smoke and SCAL1 upregulation on oncogenic phenotypes and ROS detoxification in lung adenocarcinoma cells. Sci Rep. 2021;11(1):18345.10.1038/s41598-021-97869-1Search in Google Scholar PubMed PubMed Central

[4] Liu S, Zhan N, Gao C, Xu P, Wang H, Wang S, et al. Long noncoding RNA CBR3-AS1 mediates tumorigenesis and radiosensitivity of non-small cell lung cancer through redox and DNA repair by CBR3-AS1/miR-409-3p/SOD1 axis. Cancer Lett. 2021;526:1–11.10.1016/j.canlet.2021.11.009Search in Google Scholar PubMed

[5] Siegel RL, Miller KD, Fuchs HE, Jemal A. Cancer Statistics, 2021. CA Cancer J Clin. 2021;71(1):7–33.10.3322/caac.21654Search in Google Scholar PubMed

[6] Bútová R, Vychytilová-Faltejsková P, Gregorová J, Radová L, Almáši M, Bezděková R, et al. LncRNAs LY86-AS1 and VIM-AS1 distinguish plasma cell leukemia patients from multiple myeloma patients. Biomedicines. 2021;9(11):1637.10.3390/biomedicines9111637Search in Google Scholar PubMed PubMed Central

[7] Chen X, Song J, Wang X, Sun D, Liu Y, Jiang Y. LncRNA LINC00460: Function and mechanism in human cancer. Thorac cancer. 2021;13(1):3–14.10.1111/1759-7714.14238Search in Google Scholar PubMed PubMed Central

[8] Zhu B, Finch.-Edmondson M, Leong KW, Zhang X, V M, Lin QXX, et al. LncRNA SFTA1P mediates positive feedback regulation of the Hippo-YAP/TAZ signaling pathway in non-small cell lung cancer. Cell Death Discovery. 2021;7(1):369.10.1038/s41420-021-00761-0Search in Google Scholar PubMed PubMed Central

[9] Li Y, Zhang H, Guo J, Li W, Wang X, Zhang C, et al. Downregulation of LINC01296 suppresses non-small-cell lung cancer via targeting miR-143-3p/ATG2B. Acta Biochim Biophys Sin. 2021;53(12):1681–90.10.1093/abbs/gmab149Search in Google Scholar PubMed

[10] Bai Y, Long J, Liu Z, Lin J, Huang H, Wang D, et al. Comprehensive analysis of a ceRNA network reveals potential prognostic cytoplasmic lncRNAs involved in HCC progression. J Cell Physiol. 2019;234(10):18837–48.10.1002/jcp.28522Search in Google Scholar PubMed PubMed Central

[11] Acha-Sagredo A, Uko B, Pantazi P, Bediaga NG, Moschandrea C, Rainbow L, et al. Long non-coding RNA dysregulation is a frequent event in non-small cell lung carcinoma pathogenesis. Br J Cancer. 2020;122(7):1050–8.10.1038/s41416-020-0742-9Search in Google Scholar PubMed PubMed Central

[12] He Y, Jiang X, Duan L, Xiong Q, Yuan Y, Liu P, et al. LncRNA PKMYT1AR promotes cancer stem cell maintenance in non-small cell lung cancer via activating Wnt signaling pathway. Mol Cancer. 2021;20(1):156.10.1186/s12943-021-01469-6Search in Google Scholar PubMed PubMed Central

[13] Tuo Z, Zhang A, Ma L, Zhou Z. Long noncoding RNA RP11-909N17.2 presages a poor prognosis of non-small cell lung cancer. Cancer Biomark Sect A Dis Markers. 2022;34(2):211–9.10.3233/CBM-203263Search in Google Scholar PubMed

[14] Lu B, Lv H, Yang Z, Shu J, Zhang H. LncRNA PCAT29 up-regulates the expression of PTEN by down-regulating miR-494 in non-small-cell lung cancer to suppress tumor progression. Crit Rev Eukaryot Gene Expr. 2021;31(6):9–15.10.1615/CritRevEukaryotGeneExpr.2021039081Search in Google Scholar PubMed

[15] Fernandes M, Marques H, Teixeira AL, Medeiros R. Competitive endogenous RNA network involving miRNA and lncRNA in non-hodgkin lymphoma: Current advances and clinical perspectives. Biomedicines. 2021;9(12):1934.10.3390/biomedicines9121934Search in Google Scholar PubMed PubMed Central

[16] Mi YY, Sun CY, Zhang LF, Wang J, Shao HB, Qin F, et al. Long non-coding RNAs LINC01679 as a competitive endogenous RNAs inhibits the development and progression of prostate cancer via regulating the miR-3150a-3p/SLC17A9 axis. Front Cell Dev Biol. 2021;9:737812.10.3389/fcell.2021.737812Search in Google Scholar PubMed PubMed Central

[17] Guo K, Qian K, Shi Y, Sun T, Wang Z. LncRNA-MIAT promotes thyroid cancer progression and function as ceRNA to target EZH2 by sponging miR-150-5p. Cell Death Dis. 2021;12(12):1097.10.1038/s41419-021-04386-0Search in Google Scholar PubMed PubMed Central

[18] Shi N, Shan B, Gu B, Song Y, Chu H, Qian L. Circular RNA circ-PRKCI functions as a competitive endogenous RNA to regulate AKT3 expression by sponging miR-3680-3p in esophageal squamous cell carcinoma. J Cell Biochem. 2019;120(6):10021–30.10.1002/jcb.28285Search in Google Scholar PubMed

[19] Marima R, Francies FZ, Hull R, Molefi T, Oyomno M, Khanyile R, et al. MicroRNA and alternative mRNA splicing events in cancer drug response/resistance: Potent therapeutic targets. Biomedicines. 2021;9(12):1818.10.3390/biomedicines9121818Search in Google Scholar PubMed PubMed Central

[20] Zuo P, Ma Y, Huang Y, Ye F, Wang P, Wang X, et al. High GMFG expression correlates with poor prognosis and promotes cell migration and invasion in epithelial ovarian cancer. Gynecol Oncol. 2014;132(3):745–51.10.1016/j.ygyno.2014.01.044Search in Google Scholar PubMed

[21] Yang Y, He X, Tang QQ, Shao YC, Song WJ, Gong PJ, et al. GMFG has potential to be a novel prognostic marker and related to immune infiltrates in breast cancer. Front Oncol. 2021;11:629633.10.3389/fonc.2021.629633Search in Google Scholar PubMed PubMed Central

[22] Lan A, Ren C, Wang X, Tong G, Yang G. Bioinformatics and survival analysis of glia maturation factor-γ in pan-cancers. BMC Cancer. 2021;21(1):423.10.1186/s12885-021-08163-2Search in Google Scholar PubMed PubMed Central

Received: 2022-10-12
Revised: 2022-12-15
Accepted: 2023-01-30
Published Online: 2023-03-13

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
https://doi.org/10.1515/med-2023-0666
Keywords for this article
non-small-cell lung cancer; LANCL1-AS1; miR-3680-3p; GMFG
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 16.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0666/html
Scroll to top button