Zum Hauptinhalt springen
Artikel Open Access

WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4

  • EMAIL logo , und
Veröffentlicht/Copyright: 16. Januar 2023

Abstract

Pancreatic cancer (PC) is an aggressive malignant disease. Pancreatic ductal adenocarcinoma (PDAC) is a main type of PDAC. The inhibition of aerobic glycolysis in PC cells is one of the approaches to treat PDAC. WD repeat protein 79 (WDR79) acts as a scaffold protein and is involved in several physiological processes. Since WDR79 affects the progression of several types of cancers, whereas its role in PDAC remains unclear. This study was aimed to investigate the role of WDR79 in the progression of PDAC and clarify the mechanism. We found that WDR79 was highly expressed in PDAC cells. Knockdown of WDR79 inhibited the growth as well as the motility of PDAC cells, while overexpression of WDR79 contributed to the growth and motility. The ablation of WDR79 restrained aerobic glycolysis of PDAC cells. Mechanically, we found that WDR79 depletion increased SIRT4 expression by suppressing UHRF1 expression, which counteracted the function of WDR79 in PDAC. We thought that WDR79 could serve as a target for treating PDAC.

1 Introduction

Pancreatic cancer (PC) is an aggressive malignant disease with a poor prognosis and has an overall 5-year survival rate of about 6% [1,2]. Pancreatic ductal adenocarcinoma (PDAC) is a main type of PDAC. The poor prognosis of PDAC is attributed to its early metastasis and invasion [3]. In addition, PDAC tumors exhibit metabolic changes to meet the need for unlimited proliferation [4,5,6]. Among them, metabolomic studies have shown that the Warburg effect (i.e., aerobic glycolysis) occurred in PC tissues and influenced its malignant progression [7].

WD repeat protein 79 (WDR79) (also known as WRAP53/TCAB1) acts as a scaffold protein and is involved in the physiological processes of telomerase localization, telomere and Cajal body assembly, and DNA double-strand break repair [8,9,10]. Abnormal expression of WDR79 was found in several types of cancers including colorectal cancer, head and neck cancer, breast cancer, ovarian cancer, etc. [8,11,12]. WDR79 was also overexpressed in esophageal cancer and promotes the proliferation of esophageal cancer cells [13]. WDR79 regulates USP7 activity, thereby promoting the ubiquitination and degradation of P53 and MDM2 and promoting the cell proliferation of non-small-cell lung cancer [14]. These studies suggest that WDR79 plays a key role in cancer progression.

The Cancer Genome Atlas (TCGA) analysis shows that WDR79 is highly expressed in PC patients. In addition, WDR79 can increase the stability and expression of UHRF1 [15]. UHRF1 is an oncogene that was overexpressed in many cancers and promotes cancer progression. Importantly, UHRF1 is overexpressed in PC and promotes the aerobic glycolysis process and proliferation of PC by inhibiting SIRT4 expression [16]. Among them, SIRT4 is a mitochondrial negative regulator of aerobic glycolysis, and its high expression can inhibit tumor proliferation or increase the sensitivity of tumor cells to chemotherapy drugs in PC [16,17]. In addition, the UHRF1/SIRT4/HIF1α axis regulated the glycolysis process of PDAC cells, thereby promoting their malignant proliferation [16]. It is interesting to uncover whether WDR79 could affect PDAC progression via SIRT4.

In this study, we investigated the expression of WDR79 in PC and unraveled the possible mechanisms. Our data confirmed that WDR79 could act as a potential target for treating PC.

2 Materials and methods

2.1 Bioinformation analysis

We conducted bioinformation analysis through GEPIA (http://gepia.cancer-pku.cn/) to analyze expression level and survival in TCGA database.

2.2 Antibodies and plasmids

Antibody Dilution Company, article number
WDR79 1:500 ab224444, Abcam
E-cadherin 1:1,000 ab40772, Abcam
N-cadherin 1:500 ab245117, Abcam
SIRT4 1:500 ab231137, Abcam
UHRF1 1:500 ab213223, Abcam
GLUT1 1:500 ab115730, Abcam
HK2 1:500 ab209847, Abcam
LDHA 1:500 ab52488, Abcam
GAPDH 1:3,000 ab9485, Abcam

The p-Super shRNA plasmids were bought from Addgene and constructed by our lab. The plasmids including pcDNA3.1 and pcDNA3.1-WDR79 were constructed in our lab.

2.3 Cell culture and transfection

The HPAC, Capan-1, SW1990, and CFPAC-1, and normal pancreatic cell line such as hTERT-HPNE, were purchased from American Type Culture Collection and maintained in Dulbecco’s modified Eagle’s medium (with 10% of fetal bovine serum) at 37°C in a 5% CO2 incubator.

2.4 Immunoblot assay

Samples were lysed by RIPA buffer (9800; Cell Signaling). All the cell and tissue samples were isolated to extract the proteins, separated by 10% SDS-polyacrylamide gel electrophoresis, then transferred onto polyvinylidene fluoride membranes and blocked with 10% fat-free milk in TBS with Tween-20 buffer. All membranes were subsequently incubated with the indicated primary antibodies targeted a series of proteins for 2 h. Subsequently, the membranes were incubated with secondary antibodies for 1 h. Blots were then measured.

2.5 qPCR

qPCR was performed with the SYBR-Green Master Mix (Roche, USA) and respective primers. The used primers were listed as below: WDR79: F: 5′-AATCAGCGCATCTACTTCGAT-3′, R: 5′-AAATCGAAGTAGATGCGCTGA-3′, GAPDH: F: AGAAGGCTGGGGCTCATTTG, R: AGGGGCCATCCACAGTCTTC′.

2.6 Cell counting kit-8 (CCK-8) assay

PDAC cells were plated into the 96-well plates with a density of 1,000 cell per well and maintained for 24, 48, 72, and 96 h. Cells were then incubated with CCK-8 for 4 h and the OD value at the wavelength of 450 nm was measured.

2.7 Transwell assays

Cells transfected with indicated plasmids were plated into the upper chamber of transwell chambers in culture medium without serum. Then, medium containing 10% FBS was added into the bottom to stimulate motility. After 24 h, cells in the upper chamber were removed, and the remaining cells were fixed, as well as stained with 0.2% crystal violet.

2.8 Glucose intake test

The glycolysis levels of cells were detected according to the glucose intake (ab136955), which was measured by the corresponding kits bought from Abcam according to the relevant instructions.

2.9 Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) test

OCR and ECAR were detected by an XF24 Extracellular Flux Analyzer (Seahorse Bioscience, Billerica, MA, USA) following the manufacture’s guidelines. OCR and ECAR measurement was performed after the exchange of medium for 90 min. The inhibitors of electron transport chain and oxidative phosphorylation (OXPHOS), including oligomycin A (1 μM), CCCP (1.5 μM), rotenone (0.5 μM), and antimycin A (0.5 μM), were injected.

2.10 Statistics

GraphPad 5.0 software was used for the statistical analysis. Data were expressed as mean ± SEM. Student’s t-test was used for the comparisons, and p < 0.05 was considered significant difference.

3 Results

3.1 WDR79 was highly expressed in human PDAC tissues and cells

We first detected the expression of WDR79 in tumor tissues and cells. We detected the expression of WDR79 in PDAC tissues (n = 179) and normal tissues (171) according to the TCGA database. We found that the expression of WDR79 was high in PDAC tissues of patients (Figure 1a). Subsequently, we detected the mRNA levels and protein levels of WDR79 in PDAC cells including HPAC, Capan-1, SW1990, and CFPAC-1, and normal pancreatic cell line hTERT-HPNE. The qPCR and immunoblot results revealed that the expression of WDR79 was high in both mRNA and protein levels in PDAC cells compared to normal pancreatic cells (Figure 1b and c). Therefore, WDR79 was highly expressed in human PDAC tissues and cells.

Figure 1 
                  WDR79 was highly expressed in pancreatic cancer tissues and cells. (a) TCGA database showed the expression of WDR79 in pancreatic cancer tissues and normal tissues. (b) qPDACR assays showed the mRNA levels of WDR79 in cell lines including hTERT-HPNE, HPAC, Capan-1, SW1990, and CFPAC-1. (c) Immunoblot showed the protein levels of WDR79 in cell lines including hTERT-HPNE, HPAC, Capan-1, SW1990, and CFPAC-1. **p < 0.05, ***p < 0.01. WDR79 vs control; #
                     p < 0.01, ##
                     p < 0.05, ###
                     p < 0.01. shWDR79 vs shControl.
Figure 1

WDR79 was highly expressed in pancreatic cancer tissues and cells. (a) TCGA database showed the expression of WDR79 in pancreatic cancer tissues and normal tissues. (b) qPDACR assays showed the mRNA levels of WDR79 in cell lines including hTERT-HPNE, HPAC, Capan-1, SW1990, and CFPAC-1. (c) Immunoblot showed the protein levels of WDR79 in cell lines including hTERT-HPNE, HPAC, Capan-1, SW1990, and CFPAC-1. **p < 0.05, ***p < 0.01. WDR79 vs control; # p < 0.01, ## p < 0.05, ### p < 0.01. shWDR79 vs shControl.

3.2 WDR79 depletion suppressed viability as well as the motility of PDAC cells

Subsequently, we detected the effects of WDR79 on the viability as well as the motility of PDAC cells. The plasmids and shRNAs of WDR79 were transfected into two types of PDAC cells, including HPAC and Capan-1, to alter the expression of WDR79 in PDAC cells. Immunoblot results revealed the transfection of WDR79 plasmids obviously increased its expression in HPAC and Capan-1 cells, whereas the transfection of WDR79 shRNAs (shRNA 1# and 2#) significantly suppressed the expression of WDR79 in PDAC cells (Figure 2a).

Figure 2 
                  Effects of WDR79 on the viability and motility of pancreatic cancer cells. (a) Immunoblot showed the expression of WDR79 in HPAC and Capan-1 cells upon the indicated transfection. (b) CCK-8 assays showed the OD value at 450 nm wavelength of HPAC and Capan-1 cells upon the indicated transfection at 24, 48, 72, and 96 h. (c) Transwell showed the invasive HPAC and Capan-1 cells upon the transfection of indicated plasmids or shRNAs. (d) Immunoblot showed the expression of E-cadherin and N-cadherin in HPAC and Capan-1 cells upon the indicated transfection. **p < 0.01, ***p < 0.01, WDR79 vs control; #
                     p < 0.01, ##
                     p < 0.05, ###
                     p < 0.01. shWDR79 vs shControl.
Figure 2

Effects of WDR79 on the viability and motility of pancreatic cancer cells. (a) Immunoblot showed the expression of WDR79 in HPAC and Capan-1 cells upon the indicated transfection. (b) CCK-8 assays showed the OD value at 450 nm wavelength of HPAC and Capan-1 cells upon the indicated transfection at 24, 48, 72, and 96 h. (c) Transwell showed the invasive HPAC and Capan-1 cells upon the transfection of indicated plasmids or shRNAs. (d) Immunoblot showed the expression of E-cadherin and N-cadherin in HPAC and Capan-1 cells upon the indicated transfection. **p < 0.01, ***p < 0.01, WDR79 vs control; # p < 0.01, ## p < 0.05, ### p < 0.01. shWDR79 vs shControl.

CCK-8 assays showed thatWDR79 overexpression promoted the viability of HPAC and Capan-1 cells, and its depletion suppressed the viability of cells (Figure 2b). Transwell assays suggested that WDR79 overexpression contributed to the migration of HPAC and Capan-1 cells, whereas its knockdown decreased invasive cell numbers of PDAC cells (Figure 2c). Subsequently, immunostaining assays were performed to detect the expression of E-cadherin and N-cadherin, which were two biomarkers of cell motility. We noticed that WDR79 overexpression decreased expression of E-cadherin and increased N-cadherin expression, whereas its depletion (sh 2#) increased E-cadherin and decreased N-cadherin expression in HPAC and Capan-1 cells (Figure 2d). Therefore, WDR79 depletion suppressed viability as well as the motility of PDAC cells.

3.3 WDR79 knockdown inhibited aerobic glycolysis of PDAC cells

Then, the effect of WDR79 on the aerobic glycolysis of PDAC cells was detected. Immunoblot assays were carried out to detect the expression of markers of aerobic glycolysis, including GLUT1, HK2, as well as LDHA in HPAC and Capan-1 cells upon the overexpression and depletion of WDR79. We found that WDR79 overexpression increased the expression of GLUT1, HK2, as well as LDHA, and the depletion of WDR79 suppressed the expression of these proteins in HPAC and Capan-1 cells (Figure 3a). We subsequently performed glucose uptake assays, and the data confirmed that WDR79 overexpression promoted the glucose uptake in HPAC and Capan-1 cells, whereas its depletion suppressed the glucose uptake (Figure 3b). We then performed OCR and ECAR assays and found that WDR79 overexpression contributed to the OCR and suppressed ECAR in HPAC and Capan-1 cells, which was reversed by the depletion of WDR79 (Figure 3c). Therefore, WDR79 knockdown inhibited the aerobic glycolysis of PDAC cells.

Figure 3 
                  WDR79 knockdown inhibited aerobic glycolysis of pancreatic cancer cells. (a) Immunoblot showed the expression of GLUT1, HK2, LDHA in HPAC, and Capan-1 cells upon the indicated transfection. (b) Glucose uptake assays showed the relative glucose uptake capacity of HPAC and Capan-1 cells upon the indicated transfection. (c) OCR and ECAR levels of HPAC and Capan-1 cells upon the indicated transfection. *p < 0.05, **p < 0.01, ***p < 0.01, WDR79 vs control; #
                     p < 0.01, ##
                     p < 0.05, ###
                     p < 0.01. shWDR79 vs shControl.
Figure 3

WDR79 knockdown inhibited aerobic glycolysis of pancreatic cancer cells. (a) Immunoblot showed the expression of GLUT1, HK2, LDHA in HPAC, and Capan-1 cells upon the indicated transfection. (b) Glucose uptake assays showed the relative glucose uptake capacity of HPAC and Capan-1 cells upon the indicated transfection. (c) OCR and ECAR levels of HPAC and Capan-1 cells upon the indicated transfection. *p < 0.05, **p < 0.01, ***p < 0.01, WDR79 vs control; # p < 0.01, ## p < 0.05, ### p < 0.01. shWDR79 vs shControl.

3.4 Depletion of WDR79 increased SIRT4 expression by suppressing UHRF1

Immunoblot assays revealed that WDR79 overexpression increased the expression of UHRF1 and decreased the expression of SIRT4 in HPAC and Capan-1 cells (Figure 4a). The depletion of WDR79 suppressed UHRF1 expression and increased SIRT4 expression in HPAC and Capan-1 cells (Figure 4a). Subsequently, we performed rescue assays. Our data confirmed that UHRF1 overexpression reversed the increase of SIRT4 induced by WDR79 depletion in both HPAC and Capan-1 cells (Figure 4b). We therefore thought that ablation of WDR79 increased SIRT4 expression by suppressing UHRF1 expression.

Figure 4 
                  WDR79 depletion increased SIRT4 expression by inhibiting UHRF1 in pancreatic cancer cells. (a) Immunoblot showed the expression of UHRF1 and SIRT4 in HPAC and Capan-1 cells upon the indicated transfection. (b) Immunoblot showed the expression of UHRF1 and SIRT4 in HPAC and Capan-1 cells upon the indicated transfection. *p < 0.05, **p < 0.01, ***p < 0.01, WDR79 vs control; #
                     p < 0.01, ##
                     p < 0.05, ###
                     p < 0.01. shWDR79 vs shControl. &
                     p < 0.05, &&&
                     p < 0.01, UHRF1 vs NC.
Figure 4

WDR79 depletion increased SIRT4 expression by inhibiting UHRF1 in pancreatic cancer cells. (a) Immunoblot showed the expression of UHRF1 and SIRT4 in HPAC and Capan-1 cells upon the indicated transfection. (b) Immunoblot showed the expression of UHRF1 and SIRT4 in HPAC and Capan-1 cells upon the indicated transfection. *p < 0.05, **p < 0.01, ***p < 0.01, WDR79 vs control; # p < 0.01, ## p < 0.05, ### p < 0.01. shWDR79 vs shControl. & p < 0.05, &&& p < 0.01, UHRF1 vs NC.

3.5 Depletion of SIRT4 expression reversed the effect of WDR79

We then performed immunoblot assays to detect the effects of SIRT4 on the anti-tumor effect of WDR79 in PDAC. We found that WDR79 overexpression decreased SIRT4 expression, whereas SIRT4 shRNA transfection increased SIRT4 expression in WDR79 overexpressed HPAC and Capan-1 cells (Figure 5a). We further performed CCK-8 assays and found that WDR79 depletion suppressed the proliferation of PDAC cells, which was reversed by SIRT4 depletion in WDR79 depleted cells (Figure 5b). Furthermore, transwell assay results suggested that WDR79 depletion suppressed cell motility, which was also reversed by SIRT4 depletion (Figure 5c). In addition, WDR79 depletion suppressed the expression of GLUT1, HK2, as well as LDHA, and the depletion of SIRT4 further reversed the inhibition expression of these proteins (Figure 5d). Therefore, depletion of SIRT4 expression reversed the anti-tumor effect of WDR79.

Figure 5 
                  Depletion of SIRT4 expression reversed the effects of WDR79. (a) Immunoblot showed the expression of SIRT4 in HPAC and Capan-1 cells upon the indicated transfection. (b) CCK-8 assays showed the OD value at 450 nm wavelength of HPAC and Capan-1 cells upon the indicated transfection at 24, 48, 72, and 96 h. (c) Transwell showed the invasive pancreatic cancer cells upon the transfection of indicated plasmids or shRNAs. (d) Immunoblot showed the expression of E-cadherin and N-cadherin in HPAC and Capan-1 cells upon the indicated transfection. *p < 0.05, **p < 0.01, ***p < 0.01, shWDR79 vs shControl; #
                     p < 0.01, ##
                     p < 0.05, ###
                     p < 0.01. shWDR79 + shSIRT4 vs shWDR79 + shControl.
Figure 5

Depletion of SIRT4 expression reversed the effects of WDR79. (a) Immunoblot showed the expression of SIRT4 in HPAC and Capan-1 cells upon the indicated transfection. (b) CCK-8 assays showed the OD value at 450 nm wavelength of HPAC and Capan-1 cells upon the indicated transfection at 24, 48, 72, and 96 h. (c) Transwell showed the invasive pancreatic cancer cells upon the transfection of indicated plasmids or shRNAs. (d) Immunoblot showed the expression of E-cadherin and N-cadherin in HPAC and Capan-1 cells upon the indicated transfection. *p < 0.05, **p < 0.01, ***p < 0.01, shWDR79 vs shControl; # p < 0.01, ## p < 0.05, ### p < 0.01. shWDR79 + shSIRT4 vs shWDR79 + shControl.

4 Discussion

Up to now, there have been a lot of studies on the pathogenesis of PC, and it is still needed to improve the treatment method [3]. Currently, several therapeutic targets have been discovered, but drugs developed from these therapeutic targets have little significant effect [18]. To further improve patient survival, a better understanding of its heterogeneity and pathogenesis is needed, as well as further identification of more effective molecular targets [19]. In this study, we revealed that a member of WDR family, WDR79, was highly expressed in human PDAC tissues as well as cells. WDR79 depletion inhibited the growth, motility, and restrained aerobic glycolysis of PDAC cells. We found that WDR79 depletion increased SIRT4 expression by suppressing UHRF1 expression in PC and thought it could act as a molecular target for treating PDAC.

Through a series of in vitro assays, including CCK-8, transwell, and immunoblot, we confirmed the overexpression of WDR79 contributed to the growth and motility of PDAC cells. Furthermore, the immunoblot assay glucose intake, OCR, as well as ECAR assays revealed the effects of WDR79 on the aerobic glycolysis of PDAC cells. Collectively, we thought that WDR79 could affect the glycolysis of PDAC cells, thereby affecting cell viability, motility, and tumor growth. The role of WDR79 in cancer progression has been investigated [8,10]. WDR79 was associated with its mutation as well as prognosis of lung cancer [8,12]. Its mutation in breast cancer has also been reported [8].

PDAC is characterized by a high glycolysis rate that ensures cancer cell survival, resulting in a nutrient deficient and highly hypoxic microenvironment [20]. The glycolysis process of PDAC cells produces a large number of substrates and promotes PDAC cell growth as well as metastasis through the interaction of glycolysis enzyme, thereby supporting tumor growth [21]. In addition, the core enzymes and intermediates of aerobic glycolysis influence the growth and metastasis of PDAC by participating in EMT as well as proliferation signal transduction or epigenetic regulation [22,23]. These studies confirmed the key role of aerobic glycolysis and the related proteins in the progression of PDAC. Our data further confirmed that targeting the aerobic glycolysis was a promising method to combat PDAC.

Our data further confirmed that the depletion of WDR79 increased SIRT4 expression by suppressing UHRF1. UHRF1 is an epigenetic modifier whose SRA domain can specifically recognize and bind to CpG sites of hemimethylation to recruit DNMT1 to DNA and ensure the stability of DNA methylation [24,25]. It is overexpressed in some types of PC, but its precise role is unclear. One study showed that the UHRF1/SIRT4/HIF1α axis regulated the glycolysis process of PDAC cells, thereby promoting their malignant proliferation [16]. In this study, we confirmed that WDR79 could mediate the expression of UHRF1 and SIRT4 and affected the aerobic glycolysis of PDAC cells. In addition, the regulatory role of SIRT4 in the glycolysis of different types of cancers has been widely demonstrated.

In summary, we revealed that WDR79 was highly expressed in PDAC cells as well as tissues. WDR79 knockdown inhibited the growth, motility, and restrained aerobic glycolysis of PDAC cells. We found that WDR79 depletion increased SIRT4 expression by suppressing UHRF1 expression, and inhibition of SIRT4 expression reversed the anti-tumor effect of WDR79 in PC. We thought that WDR79 could serve as a target for treating PDAC.


tel: +86-13890781589

Acknowledgments

Not applicable.

  1. Funding information: Not applicable.

  2. Author contributions: All authors contributed to the study conception and design. Material preparation and the experiments were performed by Wenke Yin. Data collection and analysis were performed by Xiaoyan Song. The first draft of the article was written by Yue Xiang and all authors commented on previous versions of the article. All authors read and approved the final article.

  3. Conflict of interest: The authors state that there are no conflicts of interest to disclose.

  4. Data availability statement: All data will be made available on reasonable request from corresponding authors.

References

[1] Carmona-Carmona CA, Dalla Pozza E, Ambrosini G, Errico A, Dando I. Divergent roles of mitochondria dynamics in pancreatic ductal adenocarcinoma. Cancers (Basel). 2022;14(9):2155. 10.3390/cancers14092155.Suche in Google Scholar PubMed PubMed Central

[2] Odisho T, Joseph S, Shahait A, Choi-Kim L, McGee J, Kim S. Potentially curative resection of an abdominal wall metastasis from pancreatic adenocarcinoma: a case report. J Surg Case Rep. 2022;2022(4):rjac138. 10.1093/jscr/rjac138.Suche in Google Scholar PubMed PubMed Central

[3] Singh A, Malik D, Singh S, Vyas VJ. Choroidal metastasis in pancreatic adenocarcinoma. J Cancer Res Ther. 2022;18(1):263–5. 10.4103/jcrt.JCRT_45_20.Suche in Google Scholar PubMed

[4] Zhang Y, Huang ZX, Song B. Role of imaging in evaluating the response after neoadjuvant treatment for pancreatic ductal adenocarcinoma. World J Gastroenterol. 2021;27(22):3037–49. 10.3748/wjg.v27.i22.3037.Suche in Google Scholar PubMed PubMed Central

[5] Camilloni A, Nati G, Maggiolini P, Romanelli A, Latina R. Chronic non-cancer pain in primary care: an Italian cross-sectional study. Signa Vitae. 2021;7(2):54–62.Suche in Google Scholar

[6] Ni WW, Zhang QM, Zhang X, Li Y, Yu SS, Wu HY, et al. Modulation effect of Lactobacillus acidophilus KLDS 1.0738 on gut microbiota and TLR4 expression in β-lactoglobulin-induced allergic mice model. Allergol Immunopathol. 2020;48(2):149–57. 10.1016/j.aller.2019.06.002.Suche in Google Scholar PubMed

[7] Liu W, Zhang B, Hu Q, Qin Y, Xu W, Shi S, et al. A new facet of NDRG1 in pancreatic ductal adenocarcinoma: Suppression of glycolytic metabolism. Int J Oncol. 2017;50(5):1792–800. 10.3892/ijo.2017.3938.Suche in Google Scholar PubMed

[8] Garcia-Closas M, Kristensen V, Langerod A, Qi Y, Yeager M, Burdett L, et al. Common genetic variation in TP53 and its flanking genes, WDR79 and ATP1B2, and susceptibility to breast cancer. Int J Cancer. 2007;121(11):2532–8. 10.1002/ijc.22985.Suche in Google Scholar PubMed

[9] Jady BE, Ketele A, Kiss T. Human intron-encoded Alu RNAs are processed and packaged into Wdr79-associated nucleoplasmic box H/ACA RNPs. Genes Dev. 2012;26(17):1897–910. 10.1101/gad.197467.112.Suche in Google Scholar PubMed PubMed Central

[10] Henriksson S, Rassoolzadeh H, Hedstrom E, Coucoravas C, Julner A, Goldstein M, et al. The scaffold protein WRAP53beta orchestrates the ubiquitin response critical for DNA double-strand break repair. Genes Dev. 2014;28(24):2726–38. 10.1101/gad.246546.114.Suche in Google Scholar PubMed PubMed Central

[11] Cao HY, Wang S, Zhang ZY, Lou JY. Association between the WRAP53 gene rs2287499 C > G polymorphism and cancer risk: A meta-analysis. Genet Mol Res. 2016;15(3):25. 10.4238/gmr.15037976.Suche in Google Scholar PubMed

[12] Peng J, Zhan Y, Feng J, Fan S, Zang H. Expression of WDR79 is associated with TP53 mutation and poor prognosis in surgically resected non-small cell lung cancer. J Cancer. 2019;10(13):3046–53. 10.7150/jca.30587.Suche in Google Scholar PubMed PubMed Central

[13] Niu J, Gao RQ, Cui MT, Zhang CG, Li ST, Cheng S, et al. Suppression of TCAB1 expression induced cellular senescence by lessening proteasomal degradation of p21 in cancer cells. Cancer Cell Int. 2021;21(1):26. 10.1186/s12935-020-01745-3.Suche in Google Scholar PubMed PubMed Central

[14] Sun Y, Cao L, Sheng X, Chen J, Zhou Y, Yang C, et al. WDR79 promotes the proliferation of non-small cell lung cancer cells via USP7-mediated regulation of the Mdm2-p53 pathway. Cell Death Dis. 2017;8(4):e2743. 10.1038/cddis.2017.162.Suche in Google Scholar PubMed PubMed Central

[15] Chen Z, Yang D, Peng X, Lin J, Su Z, Li J, et al. Beneficial effect of atorvastatin-modified dendritic cells pulsed with myelin oligodendrocyte glycoprotein autoantigen on experimental autoimmune encephalomyelitis. Neuroreport. 2018;29(4):317–27.10.1097/WNR.0000000000000962Suche in Google Scholar PubMed

[16] Hu Q, Qin Y, Ji S, Xu W, Liu W, Sun Q, et al. UHRF1 promotes aerobic glycolysis and proliferation via suppression of SIRT4 in pancreatic cancer. Cancer Lett. 2019;452:226–36. 10.1016/j.canlet.2019.03.024.Suche in Google Scholar PubMed

[17] Xing J, Li J, Fu L, Gai J, Guan J, Li Q. SIRT4 enhances the sensitivity of ER-positive breast cancer to tamoxifen by inhibiting the IL-6/STAT3 signal pathway. Cancer Med. 2019;8(16):7086–97. 10.1002/cam4.2557.Suche in Google Scholar PubMed PubMed Central

[18] Zhong Z, Zhou F, Wang D, Wu M, Zhou W, Zou Y, et al. Expression of KLF9 in pancreatic cancer and its effects on the invasion, migration, apoptosis, cell cycle distribution, and proliferation of pancreatic cancer cell lines. Oncol Rep. 2018;40(6):3852–60. 10.3892/or.2018.6760.Suche in Google Scholar PubMed

[19] Szymonski K, Milian-Ciesielska K, Lipiec E, Adamek D. Current Pathology Model of Pancreatic Cancer. Cancers (Basel). 2022;14(9):2321. 10.3390/cancers14092321.Suche in Google Scholar PubMed PubMed Central

[20] Yang J, Liu DJ, Zheng JH, He RZ, Xu DP, Yang MW, et al. IRAK2-NF-kappaB signaling promotes glycolysis-dependent tumor growth in pancreatic cancer. Cell Oncol (Dordr). 2022;45:367–79. 10.1007/s13402-022-00670-z.Suche in Google Scholar PubMed

[21] Chang X, Liu X, Wang H, Yang X, Gu Y. Glycolysis in the progression of pancreatic cancer. Am J Cancer Res. 2022;12(2):861–72.Suche in Google Scholar

[22] Bian X, Jiang H, Meng Y, Li YP, Fang J, Lu Z. Regulation of gene expression by glycolytic and gluconeogenic enzymes. Trends Cell Biol. 2022;32(9):786–99. 10.1016/j.tcb.2022.02.003.Suche in Google Scholar PubMed

[23] Cai K, Chen S, Zhu C, Li L, Yu C, He Z, et al. FOXD1 facilitates pancreatic cancer cell proliferation, invasion, and metastasis by regulating GLUT1-mediated aerobic glycolysis. Cell Death Dis. 2022;13(9):765. 10.1038/s41419-022-05213-w.Suche in Google Scholar PubMed PubMed Central

[24] Ashraf W, Ahmad T, Almalki NAR, Krifa M, Zaayter L, Pizzi A, et al. Tannin extract from maritime pine bark exhibits anticancer properties by targeting the epigenetic UHRF1/DNMT1 tandem leading to the re-expression of TP73. Food Funct. 2022;13(1):316–26. 10.1039/d1fo01484f.Suche in Google Scholar PubMed

[25] Qian C, Li S, Jakoncic J, Zeng L, Walsh MJ, Zhou MM. Structure and hemimethylated CpG binding of the SRA domain from human UHRF1. J Biol Chem. 2008;283(50):34490–4. 10.1074/jbc.C800169200.Suche in Google Scholar PubMed PubMed Central

Received: 2022-05-27
Revised: 2022-11-15
Accepted: 2022-11-28
Published Online: 2023-01-16

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Heruntergeladen am 5.5.2026 von https://www.degruyterbrill.com/document/doi/10.1515/med-2022-0624/html?lang=de
Button zum nach oben scrollen