Abstract
Circular RNAs have been demonstrated to act as vital participants in various diseases, including preeclampsia (PE). This study aimed to research the effects of circ_0004904 on PE. The contents of circ_0004904, microRNA-19b-3p (miR-19b-3p) and arrestin domain containing 3 (ARRDC3) were quantified by quantitative real-time PCR and western blot. The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and 5-ethynyl-2′-deoxyuridine assays were enforced to assess cell proliferation. The transwell assay and flow cytometry were applied to detect the cell migration, invasion, and apoptosis. The liaison between miR-19b-3p and circ_0004904 or ARRDC3 was demonstrated by dual-luciferase reporter assay. Thereafter, circ_0004904 and ARRDC3 were augmented, and miR-19b-3p was restrained in PE. Circ_0004904 silencing contributed to cell proliferation, migration, and invasion, but restrained cell apoptosis in trophoblast cells. Further, miR-19b-3p was a target of circ_0004904, and miR-19b-3p could target ARRDC3. Additionally, circ_0004904 accelerated PE evolution via changing ARRDC3 level by binding to miR-19b-3p. In all, circ_0004904 encouraged PE progress via miR-19b-3p/ARRDC3 axis.
1 Introduction
Preeclampsia (PE) is a clinical condition characterized by hypertension, proteinuria, and edema, often occurring in the last trimester of pregnancy [1,2]. Its incidence is usually 3–7% of all pregnant women [3]. PE can be caused by many factors, such as high blood pressure, proteinuria, obesity, multiple pregnancies, and age at the time of conception [4]. If left untreated, PE can lead to maternal and newborn deaths [5]. At present, there are many doubts about the pathogenesis and regulatory mechanism of PE, and further research is needed.
Circular RNAs (circRNAs) are one of the endogenous RNAs with stable closed-loop structure, which have attracted extensive attention in disease regulation [6,7]. More importantly, some studies have found the abnormal expression of some circRNAs in the placenta of PE patients, which may be closely related to the pathogenesis of PE [8]. For instance, hsa_circ_0004904 and hsa_circ_0001855 were conspicuously intensified in PE, which might be the markers for PE forecasting [9]. However, the regulation mechanism of circ_0004904 in PE is still unclear, which will be the focus of this research. Moreover, hsa_circ_0036877 acted as a possible plasma biomarker for PE [10]. Besides, circHIPK3 participated in cell migration and tube formation in PE [11]. In addition, circ_0001438 took part in cell migration and apoptosis in PE [12]. In this work, we mainly studied the role of circ_0004904 in PE and its regulatory mechanism.
MicroRNAs (miRNAs) are diminutive noncoding RNAs and are concerned with numerous cell biological functions [13]. For example, miR-203a-3p and miR-548c-5p were essential participants in inflammatory response of PE [14,15]. Besides, miR-125a-5p repressed cell migration and proliferation in PE [16]. In addition, Sandrim et al. proved that microRNA-19b-3p (miR-19b-3p) expression was downregulated in PE [17]. But, the meaning and mechanism of miR-19b-3p in PE is not completely addressed.
Arrestin domain containing 3 (ARRDC3) is a member of the α-arrestin family [18]. Shen et al. reported that ARRDC3 contributed to YAP degradation, then accelerated colorectal cancer development [19]. Besides, ARRDC3 took part in the regulation of breast cancer [20]. Furthermore, ARRDC3 level was elevated and upregulated ARRDC3 lessened tube formation in PE [21]. Whereas, the regulation mechanism of ARRDC3 in PE is still unclear.
Here our results displayed that circ_0004904 was amplified in PE tissues and cells, and circ_0004904 silencing contributed to cell proliferation, migration, and invasion, but restrained cell apoptosis in trophoblast cells. Hence, we designed to recognize whether circ_0004904 could adjust PE growth via miR-19b-3p/ARRDC3 axis.
2 Materials and methods
2.1 Samples, cell culture, and transfection
The research was supervised by the Affiliated Hospital of Hebei University. 41 pairs PE placental tissues and normal placental tissues were gathered from The Affiliated Hospital of Hebei University. All volunteers signed the informed consent, and the present study was authorized by the Ethics Committee of The Affiliated Hospital of Hebei University.
Human trophoblast cell line (HTR-8/SVneo) was obtained from American Type Culture Collection (ATCC, Manassas, VA, USA). The detailed process of cell culture was as the process reported by Gai et al. [22].
The si-circ_0004904, si-NC, miR-19b-3p mimic, miR-497-5p inhibitor, and controls, the pcDNA3.0-ARRDC3 and pcDNA3.0-NC, were from Sangon (Shanghai, China). The transfection was enforced by Lipofectamine 3000 (Solarbio, Beijing, China).
2.2 Quantitative real-time PCR (qRT-PCR) and RNA degradation assay
The TRIzol (Takara, Dalian, China) was utilized for RNA extraction. Then, the RNA was used for reverse transcription. After that, the qRT-PCR was enforced in line with the previous report [22]. GAPDH was utilized to standardize circ_0004904 and ARRDC3 levels, and U6 was employed to normalize miR-19b-3p content. All statistics were figured by 2−ΔΔCt method. RNase R (Solarbio) and Act D were applied to manifest the circular form of circ_0004904. The primers are listed in Table 1.
Primers for qRT-PCR
| Name | Primers for qRT-PCR (5′−3′) | |
|---|---|---|
| circ_0004904 | Forward | GAGGACCCACAGGCATGAAT |
| Reverse | AGCGTGGAATATCAAATGCTCC | |
| ARRDC3 | Forward | GGCACAAAAAGGGAGCGAAG |
| Reverse | TGCAAATTCCCCTGAACGGA | |
| miR-19b-3p | Forward | GCCGAGTGTGCAAATCCATGCT |
| Reverse | CTCAACTGGTGTCGTGGA | |
| GAPDH | Forward | TCCCATCACCATCTTCCAGG |
| Reverse | GATGACCCTTTTGGCTCCC | |
| U6 | Forward | CTCGCTTCGGCAGCACATATACT |
| Reverse | ACGCTTCACGAATTTGCGTGTC | |
| 18S rRNA | Forward | CAGCCACCCGAGATTGAGCA |
| Reverse | TAGTAGCGACGGGCGGTGTG | |
| POLE2 | Forward | TGCCTCTGCATAAACCCTGG |
| Reverse | TCTCAAAAGCCTTGAAGTTTGCT |
2.3 Western blot
The technique of western blot was conducted as reported in a previous study [23]. The antibodies used for western blot were as follows: anti-ARRDC3 (ab64817; 1:500; Abcam, Cambridge, MA, USA), anti-cyclin E (ab33911; 1:1,000; Abcam), anti-vimentin (ab92547; 1:1,000; Abcam), anti-MMP2 (ab92536; 1:1,000; Abcam), anti-Bcl-2 (ab32124; 1:500; Abcam), anti-Bax (ab32503; 1:1,000; Abcam), and anti-GAPDH (ab8245; 1:5,000; Abcam).
2.4 Cell proliferation assay
HTR-8/SVneo cells (1 × 105/well) were loaded on 96-well plates. The MTT (Sigma) solution was employed as reported previously by Chen et al. [24]. Finally, the absorbance at 490 nm was observed with a microplate reader. Cell proliferation was also measured by Cell-Light™ Edu Kit (RiboBio, China) as stated in the directions.
2.5 Transwell assay
After transfection, the HTR-8/SVneo cells were supplemented into the above chamber of the transwell (Corning Inc., Corning, NY, USA) pre-coated with or without Matrigel (Corning) to assess the ability of cell invasion and migration, respectively. Then, the 200 µL of complete medium was added into the lower chamber. After 48 h, the moved cells were stained and calculated with a microscope.
2.6 Flow cytometry assay
HTR-8/SVneo cells were loaded on 6-well plates. The apoptotic cells were quantified via Annexin V-FITC Apoptosis Detection Kit (Sigma) and investigated using a flow cytometer.
2.7 ELISA assay
The activity of Caspase-3 was measured through human active Caspase-3 ELISA kit (ab181418; Abcam) in accordance with the specification.
2.8 Dual-luciferase reporter assay
The test was carried out based on the procedure reported by Gai et al. [22]. The connection between miR-19b-3p and circ_0004904 or ARRDC3 was predicted by starBase (http://starbase.sysu.edu.cn). Then, the circ_0004904 and ARRDC3 wild and mutant vectors were procured from Sangon (circ_0004904 WT, ARRDC3 3′UTR WT or circ_0004904 MUT, ARRDC3 3′UTR MUT).
2.9 RNA pull down assay
Bio-miR-19b-3p and Bio-miR-NC were from Sangon. HTR-8/SVneo cells were sonicated. The circ_0004904 probe was applied for cultivation with beads (Sigma) to produce probe-coated beads. Next cell lysates were incubated with circ_0004904 probe or oligo probe for 12 h. Then, the RNA stained with the beads was extracted for qRT-PCR.
2.10 Statistical assay
The tests were carried out in triplicate and the results were analyzed using SPSS 23.0 software (SPSS, USA). Student’s t-test and ANOVA were enforced to examine the differences. P < 0.05 was considered to be statistically significant.
-
Ethics approval: The present study was approved by the ethical review committee of The Affiliated Hospital of Hebei University. Written informed consent was obtained from all enrolled patients.
-
Consent for publication: Patients agree to participate in this work.
3 Results
3.1 Circ_0004904 was intensified in PE
Primarily, the outcomes displayed that in contrast to the normal tissues, circ_0004904 was intensified in PE placental tissues (Figure 1a). Circ_0004904 originates from the POLE2 gene and is located at chr14. Besides, circ_0004904 was formed by the exon 4–6 patchwork (Figure 1b). Moreover, the main distribution site of circ_0004904 was the cytoplasm (Figure 1c). Meanwhile, circ_0004904 content was not altered after RNase R or Act D treatment, while the POLE2 mRNA or GAPDH level was dropped (Figure 1d and e). In addition, circ_0004904 level was lower when Oligo (dT)18 primers were used compare with random primers, while the POLE2 mRNA was almost unchanged (Figure 1f). On the whole, these data demonstrated that circ_0004904 with a great steadiness structure was intensified in PE.

The relative level of circ_0004904 was enhanced in PE. (a) Relative levels of circ_0004904 in PE tissues and normal tissues were detected. (b) Location of circ_0004904 in genes and chromosomes. (c) Distribution of circ_0004904 in nucleus and cytoplasm. (d–f) Relative levels of circ_0004904 and POLE2 mRNA in HTR-8/SVneo cells. ***, P < 0.001.
3.2 Circ_0004904 controlled trophoblast cell functions
The results exhibited that circ_0004904 expression was hampered in si-circ_0004904 group than in si-NC group (Figure 2a). Downregulated circ_0004904 encouraged cell proliferation in HTR-8/SVneo cells (Figure 2b and c). Moreover, silencing circ_0004904 expedited cell migration and invasion in HTR-8/SVneo cells (Figure 2d and e). Furthermore, cell proliferation, migration, and invasion -related proteins were detected. Circ_0004904 deficiency elevated the contents of cyclin E, vimentin, and MMP2 (Figure 2f). On the contrary, knockdown of circ_0004904 constrained cell apoptosis (Figure 2g). After that, the apoptosis-related proteins were measured, and the outcomes revealed that si-circ_0004904 transfection curbed the Caspase-3 activity and Bax levels, but elevated Bcl-2 expression (Figure 2h and i). These data exemplified that si-circ_0004904 was connected with the modulation of PE.

Circ_0004904 knockdown promoted HTR-8/SVneo cells development. HTR-8/SVneo cells were transfected with si-circ_0004904 or si-NC. (a) Knockdown competence of si-circ_0004904 was appraised by qRT-PCR. (b and c) MTT and EdU assays were enforced to evaluate cell proliferation. (d and e) Transwell assay was applied to assess cell migration and invasion. (f) Western blot assay was utilized to scrutinize the cyclin E, vimentin, and MMP2 contents. (g) Flow cytometry was conducted to assess the cell apoptosis. (h) The Caspase-3 activity was detected. (i) Western blot assay was utilized to scrutinize the Bax and Bcl2 contents. ***, P < 0.001.
3.3 miR-19b-3p was targeted by circ_0004904
The circ_0004904 included the bond sequences of miR-19b-3p, implying that miR-19b-3p might be a target of circ_0004904 (Figure 3a). Furthermore, with respect to the normal tissues, miR-19b-3p was decreased in PE placental tissues (Figure 3b). Subsequently, the luciferase activity of circ_0004904 WT in HTR-8/SVneo cells was lessened by miR-19b-3p, but there was no alteration in the circ_0004904 MUT group (Figure 3c). In addition, the targeted relationship of miR-19b-3p and circ_0004904 was also indicated by RNA pull down assay (Figure 3d). Collectively, these results proved that circ_0004904 repressed miR-19b-3p level by directly binding to miR-19b-3p.

Interaction between miR-19b-3p and circ_0004904. (a) The complementary sites between miR-19b-3p and circ_0004904. (b) Relative levels of miR-19b-3p in PE tissues and normal tissues were detected. (c) HTR-8/SVneo cells were co-transfected with circ_0004904 WT or circ_0004904 MUT and miR-NC or miR-19b-3p, and the luciferase activity was detected. (d) Relative level of circ_0004904 was quantified by RNA pull down assay in HTR-8/SVneo cells. ***, P < 0.001.
3.4 The influence of circ_0004904 deficiency on cell functions was abrogated by miR-19b-3p inhibitor in trophoblast cells
The data unveiled that miR-19b-3p level was hampered in anti-miR-19b-3p group than in anti-NC group (Figure 4a). Then, the cell behaviors were detected. The data showed that reintroduction of anti-miR-19b-3p overturned the acceleration effect of circ_0004904 deficiency on cell proliferation in HTR-8/SVneo cells (Figure 4b and c). Moreover, anti-miR-19b-3p co-transfection abolished the promoting impacts of circ_0004904 knockdown on cell migration and invasion in HTR-8/SVneo cells (Figure 4d and e). Furthermore, downregulation of circ_0004904 elevated the contents of cyclin E, vimentin, and MMP2, while anti-miR-19b-3p could relieve the influence (Figure 4f). Additionally, knockdown of circ_0004904 constrained cell apoptosis; however, this impact was neutralized by anti-miR-19b-3p in HTR-8/SVneo cells (Figure 4g). Finally, anti-miR-19b-3p transfection counteracted the impact of si-circ_0004904 on the Caspase-3 activity, Bax, and Bcl-2 levels (Figure 4h and i). These outcomes disclosed that miR-19b-3p has a vital role in circ_0004904 deficiency-induced regulation in trophoblast cells.

Circ_0004904 knockdown promoted HTR-8/SVneo cells development by regulating miR-19b-3p. (a) Knockdown competence of anti-miR-19b-3p was appraised by qRT-PCR. (b and c) MTT and EdU assays were enforced to evaluate cell proliferation. (d and e) Transwell assay was applied to assess cell migration and invasion. (f) Western blot assay was utilized to scrutinize the cyclin E, vimentin, and MMP2 contents. (g) Flow cytometry was conducted to assess the cell apoptosis. (h) The Caspase-3 activity was detected. (i) Western blot assay was utilized to scrutinize the Bax and Bcl2 contents. ***, P < 0.001.
3.5 ARRDC3 was a target of miR-19b-3p
As presented in Figure 5a, starBase forecasted that ARRDC3 might be targeted by miR-19b-3p. Next relative to the normal tissues, ARRDC3 was enhanced in PE placental tissues (Figure 5b). Afterwards, the luciferase activity of ARRDC3 3′UTR WT in HTR-8/SVneo cells was lessened by miR-19b-3p, but there was no alteration in the ARRDC3 3′UTR MUT group (Figure 5c). Besides, anti-miR-19b-3p could enhance ARRDC3 content in HTR-8/SVneo cells (Figure 5d). Meanwhile, the ARRDC3 level was harmed by circ_0004904 deficiency, but elevated by anti-miR-19b-3p transfection (Figure 5e). These statistics disclosed that ARRDC3 was straightly targeted by miR-19b-3p in trophoblast cells.

Interaction between miR-19b-3p and ARRDC3. (a) The complementary sites between miR-19b-3p and ARRDC3. (b) Relative levels of ARRDC3 in PE tissues and normal tissues were detected. (c) HTR-8/SVneo cells were co-transfected with ARRDC3 3′UTR WT or ARRDC3 3′UTR MUT and miR-NC or miR-19b-3p, and the luciferase activity was detected. (d and e) Relative levels of ARRDC3 in PE cells were quantified. ***, P < 0.001.
3.6 Circ_0004904 regulated the trophoblast cell behaviors via ARRDC3
The records exposed that ARRDC3 was upregulated in pcDNA3.0-ARRDC3 group than in pcDNA3.0-NC group (Figure 6a). The co-transfection of pcDNA3.0-ARRDC3 reversed the acceleration effect of circ_0004904 silencing on cell proliferation in HTR-8/SVneo cells (Figure 6b and c). Moreover, ARRDC3 overexpression abolished the elevation impacts of si-circ_0004904 on cell migration and invasion in HTR-8/SVneo cells (Figure 6d and e). Furthermore, downregulation of circ_0004904 elevated the contents of cyclin E, vimentin, and MMP2, while pcDNA3.0-ARRDC3 could relieve this influence (Figure 6f). In addition, silencing of circ_0004904 inhibited cell apoptosis, but this clogged impact was neutralized by ARRDC3 in HTR-8/SVneo cells (Figure 6g). Finally, ARRDC3 overexpression lessened the impact of si-circ_0004904 on the Caspase-3 activity, Bax, and Bcl-2 levels (Figure 6h and i). Furthermore, Figure 7 exhibited the regulation mechanism of circ_0004904/miR-19b-3p/ARRDC3 axis.

Circ_0004904 knockdown promoted HTR-8/SVneo cells development by regulating ARRDC3. (a) Upregulation competence of pcDNA3.0-ARRDC3 was appraised by qRT-PCR. (b and c) MTT and EdU assays were enforced to evaluate cell proliferation. (d and e) Transwell assay was applied to assess cell migration and invasion. (f) Western blot assay was utilized to scrutinize the cyclin E, vimentin, and MMP2 contents. (g) Flow cytometry was conducted to assess the cell apoptosis. (h) The Caspase-3 activity was detected. (i) Western blot assay was utilized to scrutinize the Bax and Bcl2 contents. ***, P < 0.001.

The regulation mechanism of circ_0004904/miR-19b-3p/ARRDC3.
4 Discussion
According to the current results of clinical studies, it is not difficult to find that the treatment of PE is more difficult than prevention [25]. The symptoms of PE do not stop completely pathologically. Therefore, the current treatment approach is mainly aimed to prolong pregnancy by slowing down the pathological process [26,27]. In recent years, noninvasive methods, such as nucleic acids detection, have been proposed and developed for the early diagnosis of PE due to the release of molecules of the placental compartment [28,29]. Hence, we aimed to investigate the new molecules for PE treatment.
In accordance with this work, the circ_0004904 levels in PE tissues were remarkably elevated, which was similar to that reported by Jiang et al. [9]. These records speculated that circ_0004904 might play a vital role in PE. In this work, loss of function technique was applied to assess the underlying effects of circ_0004904 on trophoblast cells. The outcomes showed that circ_0004904 downregulation contributed to cell proliferation, migration, and invasion, but restrained cell apoptosis in trophoblast cells.
CircRNAs could act as miRNA sponge to control their biological role [13]. Previous studies have revealed that altered expression of some miRNAs plays important role in the onset and development of placental-induced diseases, such as fetal growth restriction [30] and PE [31]. Here the data displayed that circ_0004904 included the target sites of miR-19b-3p. Li et al. uncovered that miR-19b-3p inhibited osteoarthritis development [32]. Moreover, miR-19b-3p could regulate cell proliferation in human pancreatic cancer [33]. In this work, it was found that miR-19b-3p levels in PE tissues were remarkably restrained, which was similar to that described by Sandrim et al. [17]. Meanwhile, miR-19b-3p could target ARRDC3 to hamper PE development. Therefore, it was suggested that circ_0004904 exercised its function by the miR-19b-3p/ARRDC3 axis.
ARRDC3 has been shown to be involved in regulating the progression of many cancers, like colorectal cancer and breast cancer [19,20]. The information in this work presented that ARRDC3 level was abnormally intensified in PE, which was alike to Lei et al. description [21]. Moreover, ARRDC3 could promote trophoblast cell dysfunction.
In short, we presented that circ_0004904 acted as a sponge of miR-19b-3p to positively adjust ARRDC3, thus accelerating PE progression. These conclusions delivered a fresh train of thought for PE handling.
Acknowledgement
Not applicable.
-
Funding information: No funding was received.
-
Author contributions: conceptualization and methodology: Jie Cui and Guiling Liu; formal analysis and data curation: Chenyuan Cao and Jie Cui; validation and investigation: Chenyuan Cao and Guiling Liu; writing – original draft preparation and writing – review and editing: Chenyuan Cao, Jie Cui, and Guiling Liu; Approval of final manuscript: all authors.
-
Conflict of interest: The authors declare that they have no competing interests.
-
Data availability statements: The analyzed datasets generated during the present study are available from the corresponding author on reasonable request.
References
[1] Stillman IE, Karumanchi SA. The glomerular injury of preeclampsia. J Am Soc Nephrol. 2007;18(8):2281–4.10.1681/ASN.2007020255Suche in Google Scholar PubMed
[2] Filipek A, Jurewicz E. Preeclampsia – a disease of pregnant women. Postepy Biochem. 2018;64(4):232–29.10.18388/pb.2018_146Suche in Google Scholar PubMed
[3] Al-Jameil N, Aziz Khan F, Fareed Khan M, Tabassum H. A brief overview of preeclampsia. J Clin Med Res. 2014;6(1):1–7.10.4021/jocmr1682wSuche in Google Scholar PubMed PubMed Central
[4] Redman CW, Sargent IL. Latest advances in understanding preeclampsia. Science. 2005;308(5728):1592–4.10.1126/science.1111726Suche in Google Scholar PubMed
[5] Bokslag A, van Weissenbruch M, Mol BW, de Groot CJ. Preeclampsia; short and long-term consequences for mother and neonate. Early Hum Dev. 2016;102:47–50.10.1016/j.earlhumdev.2016.09.007Suche in Google Scholar PubMed
[6] Jeck WR, Sorrentino JA, Wang K, Slevin MK, Burd CE, Liu J, et al. Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA. 2013;19(2):141–57.10.1261/rna.035667.112Suche in Google Scholar PubMed PubMed Central
[7] Suzuki H, Tsukahara T. A view of pre-mRNA splicing from RNase R resistant RNAs. Int J Mol Sci. 2014;15(6):9331–42.10.3390/ijms15069331Suche in Google Scholar PubMed PubMed Central
[8] Qian Y, Lu Y, Rui C, Qian Y, Cai M, Jia R. Potential significance of circular RNA in human placental tissue for patients with preeclampsia. Cell Physiol Biochem. 2016;39(4):1380–90.10.1159/000447842Suche in Google Scholar PubMed
[9] Jiang M, Lash GE, Zhao X, Long Y, Guo C, Yang H. CircRNA-0004904, CircRNA-0001855, and PAPP-A: potential novel biomarkers for the prediction of preeclampsia. Cell Physiol Biochem. 2018;46(6):2576–86.10.1159/000489685Suche in Google Scholar PubMed
[10] Hu X, Ao J, Li X, Zhang H, Wu J, Cheng W. Competing endogenous RNA expression profiling in pre-eclampsia identifies hsa_circ_0036877 as a potential novel blood biomarker for early pre-eclampsia. Clin Epigenet. 2018;10:48.10.1186/s13148-018-0482-3Suche in Google Scholar PubMed PubMed Central
[11] Zhang Y, Cao L, Jia J, Ye L, Wang Y, Zhou B, et al. CircHIPK3 is decreased in preeclampsia and affects migration, invasion, proliferation, and tube formation of human trophoblast cells. Placenta. 2019;85:1–8.10.1016/j.placenta.2019.07.010Suche in Google Scholar PubMed
[12] Li X, Yang R, Xu Y, Zhang Y. Circ_0001438 participates in the pathogenesis of preeclampsia via the circ_0001438/miR-942/NLRP3 regulatory network. Placenta. 2021;104:40–50.10.1016/j.placenta.2020.11.005Suche in Google Scholar PubMed
[13] Hua Y, Duan S, Murmann AE, Larsen N, Kjems J, Lund AH, et al. miRConnect: identifying effector genes of miRNAs and miRNA families in cancer cells. PLoS One. 2011;6(10):e26521.10.1371/journal.pone.0026521Suche in Google Scholar PubMed PubMed Central
[14] Ma HY, Cu W, Sun YH, Chen X. MiRNA-203a-3p inhibits inflammatory response in preeclampsia through regulating IL24. Eur Rev Med Pharmacol Sci. 2020;24(10):5223–30.Suche in Google Scholar
[15] Wang Z, Wang P, Wang Z, Qin Z, Xiu X, Xu D, et al. MiRNA-548c-5p downregulates inflammatory response in preeclampsia via targeting PTPRO. J Cell Physiol. 2019;234(7):11149–55.10.1002/jcp.27758Suche in Google Scholar PubMed
[16] Xueya Z, Yamei L, Sha C, Dan C, Hong S, Xingyu Y, et al. Exosomal encapsulation of miR-125a-5p inhibited trophoblast cell migration and proliferation by regulating the expression of VEGFA in preeclampsia. Biochem Biophys Res Commun. 2020;525(3):646–53.10.1016/j.bbrc.2020.02.137Suche in Google Scholar PubMed
[17] Sandrim VC, Luizon MR, Palei AC, Tanus-Santos JE, Cavalli RC. Circulating microRNA expression profiles in pre-eclampsia: evidence of increased miR-885-5p levels. BJOG. 2016;123(13):2120–8.10.1111/1471-0528.13903Suche in Google Scholar PubMed
[18] Patwari P, Lee RT. An expanded family of arrestins regulate metabolism. Trends Endocrinol Metab. 2012;23(5):216–22.10.1016/j.tem.2012.03.003Suche in Google Scholar PubMed PubMed Central
[19] Shen X, Sun X, Sun B, Li T, Wu G, Li Y, et al. ARRDC3 suppresses colorectal cancer progression through destabilizing the oncoprotein YAP. FEBS Lett. 2018;592(4):599–609.10.1002/1873-3468.12986Suche in Google Scholar PubMed
[20] Lin S, Zhang G, Zhao Y, Shi D, Ye Q, Li Y, et al. Methylation and serum response factor mediated in the regulation of gene ARRDC3 in breast cancer. Am J Transl Res. 2020;12(5):1913–27.Suche in Google Scholar
[21] Lei D, Deng N, Wang S, Huang J, Fan C. Upregulated ARRDC3 limits trophoblast cell invasion and tube formation and is associated with preeclampsia. Placenta. 2020;89:10–9.10.1016/j.placenta.2019.10.009Suche in Google Scholar PubMed
[22] Gai S, Sun L, Wang H, Yang P. Circular RNA hsa_circ_0007121 regulates proliferation, migration, invasion, and epithelial-mesenchymal transition of trophoblast cells by miR-182-5p/PGF axis in preeclampsia. Open Med (Wars). 2020;15(1):1061–71.10.1515/med-2020-0230Suche in Google Scholar PubMed PubMed Central
[23] Hou W, Zhang Y. Circ_0025033 promotes the progression of ovarian cancer by activating the expression of LSM4 via targeting miR-184. Pathol Res Pract. 2021;217:153275.10.1016/j.prp.2020.153275Suche in Google Scholar PubMed
[24] Chen B, Ji F, Wen X, Jin Z. Circular RNA circ_ASAP2 promotes cell viability, migration, and invasion of gastric cancer cells by regulating the miR-770-5p/CDK6 axis. Int J Clin Exp Pathol. 2020;13(11):2806–19.Suche in Google Scholar
[25] El-Sayed AAF. Preeclampsia: A review of the pathogenesis and possible management strategies based on its pathophysiological derangements. Taiwan J Obstet Gynecol. 2017;56(5):593–8.10.1016/j.tjog.2017.08.004Suche in Google Scholar PubMed
[26] Rahman R, Murthi P, Singh H, Gurusinghe S, Mockler JC, Lim R, et al. The effects of hydroxychloroquine on endothelial dysfunction. Pregnancy Hypertens. 2016;6(4):259–62.10.1016/j.preghy.2016.09.001Suche in Google Scholar PubMed
[27] Gong P, Liu M, Hong G, Li Y, Xue P, Zheng M, et al. Curcumin improves LPS-induced preeclampsia-like phenotype in rat by inhibiting the TLR4 signaling pathway. Placenta. 2016;41:45–52.10.1016/j.placenta.2016.03.002Suche in Google Scholar PubMed
[28] Laganà AS, Giordano D, Loddo S, Zoccali G, Vitale SG, Santamaria A, et al. Decreased endothelial progenitor cells (EPCs) and increased natural killer (NK) cells in peripheral blood as possible early markers of preeclampsia: a case-control analysis. Arch Gynecol Obstet. 2017;295(4):867–72.10.1007/s00404-017-4296-xSuche in Google Scholar PubMed
[29] Laganà AS, Favilli A, Triolo O, Granese R, Gerli S. Early serum markers of pre-eclampsia: are we stepping forward? J Maternal-fetal Neonatal Medicine. 2016;29(18):3019–23.10.3109/14767058.2015.1113522Suche in Google Scholar PubMed
[30] Chiofalo B, Laganà AS, Vaiarelli A, La Rosa VL, Rossetti D, Palmara V, et al. Do miRNAs play a role in fetal growth restriction? A fresh look to a busy corner. BioMed Res Int. 2017;2017:6073167.10.1155/2017/6073167Suche in Google Scholar PubMed PubMed Central
[31] Laganà AS, Vitale SG, Sapia F, Valenti G, Corrado F, Padula F, et al. miRNA expression for early diagnosis of preeclampsia onset: hope or hype? J Maternal-fetal Neonatal Medicine. 2018;31(6):817–21.10.1080/14767058.2017.1296426Suche in Google Scholar PubMed
[32] Li Y, Yuan F, Song Y, Guan X. miR-17-5p and miR-19b-3p prevent osteoarthritis progression by targeting EZH2. Exp Ther Med. 2020;20(2):1653–63.10.3892/etm.2020.8887Suche in Google Scholar PubMed PubMed Central
[33] Song M, Sun M, Xia L, Chen W, Yang C. miR-19b-3p promotes human pancreatic cancer Capan-2 cells proliferation by targeting phosphatase and tension homolog. Ann Transl Med. 2019;7(11):236.10.21037/atm.2019.04.61Suche in Google Scholar PubMed PubMed Central
© 2023 the author(s), published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Artikel in diesem Heft
- Research Articles
- Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
- Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
- circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
- circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
- WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
- Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
- Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
- 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
- Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
- PVT1/miR-16/CCND1 axis regulates gastric cancer progression
- Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
- Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
- SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
- Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
- lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
- SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
- Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
- Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
- Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
- circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
- Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
- UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
- Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
- Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
- UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
- LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
- Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
- Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
- circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
- Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
- Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
- A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
- WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
- Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
- Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
- Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
- Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
- Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
- Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
- Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
- CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
- Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
- Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
- HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
- The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
- Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
- A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
- Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
- Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
- TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
- The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
- miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
- Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
- IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
- Comprehensive analysis of the role of SFXN family in breast cancer
- Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
- Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
- AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
- Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
- Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
- Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
- The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
- Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
- Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
- F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
- Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
- Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
- Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
- Cholesterol induces inflammation and reduces glucose utilization
- circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
- NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
- The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
- miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
- Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
- α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
- Changes of microbiota level in urinary tract infections: A meta-analysis
- Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
- Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
- Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
- Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
- Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
- Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
- Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
- An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
- Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
- Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
- PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
- miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
- lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
- Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
- Subjective well-being in informal caregivers during the COVID-19 pandemic
- Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
- Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
- Bladder cancer screening: The new selection and prediction model
- circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
- Prone position effect in intensive care patients with SARS-COV-2 pneumonia
- Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
- Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
- Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
- Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
- Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
- Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
- Clinical significance of serum MBD3 detection in girls with central precocious puberty
- Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
- Collagen treatment of complex anorectal fistula: 3 years follow-up
- LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
- Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
- SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
- A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
- circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
- hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
- Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
- lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
- Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
- Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
- Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
- Analysis of somatic mutations and key driving factors of cervical cancer progression
- Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
- Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
- Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
- Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
- Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
- Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
- Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
- Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
- The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
- Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
- Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
- The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
- Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
- Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
- Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
- The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
- Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
- Clinical characteristics of current COVID-19 rehabilitation outpatients in China
- Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
- miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
- The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
- Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
- The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
- Identification of cuproptosis-related genes for predicting the development of prostate cancer
- Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
- Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
- A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
- Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
- Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
- Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
- A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
- A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
- Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
- The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
- Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
- AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
- Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
- Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
- LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
- Factors associated with gastrointestinal dysmotility in critically ill patients
- Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
- Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
- Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
- Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
- Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
- The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
- Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
- Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
- Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
- Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
- Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
- Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
- D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
- WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
- Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
- Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
- Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
- Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
- Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
- Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
- A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
- Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
- A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
- Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
- The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
- Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
- CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
- Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
- KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
- Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
- The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
- Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
- Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
- Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
- Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
- Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
- Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
- lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
- Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
- The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
- The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
- Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
- MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
- Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
- Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
- Predictors of gastrointestinal complaints in patients on metformin therapy
- Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
- A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
- Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
- miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
- Clinical features and management of lymphoepithelial cyst
- Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
- ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
- Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
- The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
- Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
- Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
- Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
- miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
- Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
- Review Articles
- Prenatal diagnosis of fetal defects and its implications on the delivery mode
- Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
- Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
- Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
- Vitamin C and epigenetics: A short physiological overview
- Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
- Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
- Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
- Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
- The progress of autoimmune hepatitis research and future challenges
- METTL16 in human diseases: What should we do next?
- New insights into the prevention of ureteral stents encrustation
- VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
- Case Reports
- Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
- Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
- Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
- Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
- Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
- Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
- Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
- Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
- Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
- Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
- CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
- Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
- Anesthetic management of fetal pulmonary valvuloplasty: A case report
- Rapid Communication
- Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
- Erratum
- Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
- Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
- Retraction
- Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
- Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
- Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
- Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
- Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
- Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
- Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
- Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
- Special issue The evolving saga of RNAs from bench to bedside - Part I
- FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
- Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Artikel in diesem Heft
- Research Articles
- Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
- Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
- circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
- circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
- WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
- Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
- Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
- 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
- Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
- PVT1/miR-16/CCND1 axis regulates gastric cancer progression
- Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
- Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
- SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
- Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
- lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
- SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
- Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
- Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
- Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
- circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
- Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
- UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
- Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
- Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
- UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
- LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
- Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
- Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
- circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
- Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
- Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
- A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
- WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
- Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
- Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
- Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
- Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
- Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
- Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
- Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
- CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
- Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
- Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
- HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
- The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
- Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
- A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
- Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
- Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
- TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
- The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
- miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
- Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
- IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
- Comprehensive analysis of the role of SFXN family in breast cancer
- Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
- Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
- AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
- Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
- Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
- Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
- The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
- Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
- Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
- F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
- Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
- Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
- Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
- Cholesterol induces inflammation and reduces glucose utilization
- circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
- NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
- The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
- miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
- Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
- α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
- Changes of microbiota level in urinary tract infections: A meta-analysis
- Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
- Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
- Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
- Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
- Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
- Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
- Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
- An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
- Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
- Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
- PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
- miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
- lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
- Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
- Subjective well-being in informal caregivers during the COVID-19 pandemic
- Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
- Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
- Bladder cancer screening: The new selection and prediction model
- circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
- Prone position effect in intensive care patients with SARS-COV-2 pneumonia
- Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
- Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
- Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
- Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
- Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
- Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
- Clinical significance of serum MBD3 detection in girls with central precocious puberty
- Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
- Collagen treatment of complex anorectal fistula: 3 years follow-up
- LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
- Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
- SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
- A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
- circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
- hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
- Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
- lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
- Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
- Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
- Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
- Analysis of somatic mutations and key driving factors of cervical cancer progression
- Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
- Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
- Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
- Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
- Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
- Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
- Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
- Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
- The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
- Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
- Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
- The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
- Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
- Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
- Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
- The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
- Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
- Clinical characteristics of current COVID-19 rehabilitation outpatients in China
- Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
- miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
- The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
- Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
- The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
- Identification of cuproptosis-related genes for predicting the development of prostate cancer
- Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
- Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
- A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
- Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
- Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
- Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
- A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
- A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
- Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
- The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
- Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
- AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
- Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
- Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
- LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
- Factors associated with gastrointestinal dysmotility in critically ill patients
- Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
- Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
- Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
- Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
- Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
- The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
- Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
- Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
- Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
- Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
- Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
- Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
- D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
- WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
- Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
- Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
- Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
- Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
- Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
- Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
- A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
- Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
- A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
- Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
- The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
- Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
- CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
- Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
- KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
- Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
- The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
- Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
- Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
- Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
- Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
- Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
- Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
- lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
- Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
- The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
- The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
- Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
- MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
- Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
- Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
- Predictors of gastrointestinal complaints in patients on metformin therapy
- Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
- A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
- Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
- miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
- Clinical features and management of lymphoepithelial cyst
- Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
- ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
- Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
- The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
- Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
- Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
- Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
- miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
- Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
- Review Articles
- Prenatal diagnosis of fetal defects and its implications on the delivery mode
- Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
- Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
- Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
- Vitamin C and epigenetics: A short physiological overview
- Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
- Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
- Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
- Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
- The progress of autoimmune hepatitis research and future challenges
- METTL16 in human diseases: What should we do next?
- New insights into the prevention of ureteral stents encrustation
- VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
- Case Reports
- Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
- Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
- Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
- Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
- Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
- Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
- Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
- Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
- Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
- Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
- CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
- Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
- Anesthetic management of fetal pulmonary valvuloplasty: A case report
- Rapid Communication
- Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
- Erratum
- Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
- Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
- Retraction
- Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
- Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
- Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
- Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
- Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
- Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
- Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
- Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
- Special issue The evolving saga of RNAs from bench to bedside - Part I
- FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
- Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer