Home Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
Article Open Access

Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene

  • Xiao Han EMAIL logo , Kun Liu , Fumin Gao , Mingjun Yang and Fei Wang
Published/Copyright: July 25, 2023
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 18 Issue 1

Abstract

Irreversible cardiomyopathy was caused by the therapeutic of anthracyclines in the chemotherapy of cancers. The cell apoptosis and autophagy were induced by anthracyclines in AC16 cells. MiR-223-3p ascends in anthracycline-treated AC16, but the expression of nuclear factor I-A (NFIA) was specifically down-regulated. However, the underlying molecular mechanism between NFIA and miR-223-3p is unclear now in AC16 cells. In our research, NFIA expression was dampened in AC16 cells by miR-223-3p mimics. Additionally, miR-223-3p knockdown hindered the apoptosis and autophagy in anthracycline-treated AC16. Furthermore, NFIA was predicted and verified as a miR-223-3p’s downstream target and rescued the functions of miR-223-3p. These findings illustrated that miR-223-3p advances anthracycline-stimulated cardiomyocyte damage progression by targeting NFIA, implying the promising therapeutic function of miR-223-3p on cardiomyocyte damage in cancer patients.

Keywords: miR-223-3p; NFIA; cardiomyocyte damage; anthracyclines

1 Introduction

Cancer remains a leading cause of death worldwide, and anthracyclines are widely used in the chemotherapy of many solid and hematological cancers [1]. But the dose-dependent relationship between anthracyclines and congestive heart failure caused by irreversible cardiomyopathy hinders their therapeutic potential [2]. As key regulators of cellular progression associated with drug resistance [3], microRNAs (miRNAs) are demonstrated to play suppressor roles in different oncogenic and tumor types [4,5]. This phenomenon is related to the regulation of a variety of complex pathways, including the loss of drug accumulation ability, the protective mechanism of autophagy, the reduction of DNA damage, and the inhibition of downstream signals from turning into apoptosis events [3].

miRNAs are generally composed of 18–25 nucleotides and are highly conserved noncoding RNAs, which modulate the expression of multiple genes [6]. In addition to their role in controlling the mechanisms of chemo-resistance, miRNAs also have shown that changes in their levels are related to multiple cardiovascular diseases and heart tissue damage [7,8]. We predicted genes related to cardiomyocyte damage and found that most of them are related to miR-223-3p, and then found that many reports had revealed miR-223-3p was relative to cell apoptosis promotion [9,10] and cell proliferation inhibition [11]. It was reported that the reduction of miR-223-3p lessened the occurrence of ischemic arrhythmias [12]. In H9c2 cells, deletion of miR-223-3p significantly lessened cardiomyocyte damage induced by hypoxia, including improving cell viability, which indicates a new mechanism for miR-223-3p to prevent the apoptosis and oxidative stress through modulating KLF15 expression in cardiomyocyte [13]. However, the molecular mechanisms that miR-223-3p regulates the evolvement of anthracycline-induced cardiomyocyte damage have not been fully clarified.

In our research, we predicted that miR-223-3p was interrelated to nuclear factor I-A (NFIA) by bioinformatics in AC16 cells. Research studies make known that miR-212-3p induces apoptosis of breast cancer cells by targeting NFIA [14] and miRNA-302b induces glioma cell apoptosis by regulating NFIA/insulin-like growth factor-binding protein 2 signaling pathway [15]. So, our research focus was the pathological effect of miR-223-3p in AC16 cells treated with anthracycline, as well as the possible molecular mechanisms of both NFIA and miR-223-3p.

All data demonstrated that miR-223-3p increased apoptosis and autophagy through binding with NFIA, which was a new molecular regulation mechanism in the process of anthracycline-induced cardiomyocyte damage.

2 Methods and materials

2.1 Cell cultivation and processing

Human cardiomyocyte-like cells (AC16) acquired from the American Type Cell Culture (Rockville, MD, USA) were cultivated in DMEM (Bio-Channel, Nanjing, China) supplementary with 10% fetal bovine serum (OriCell, Suzhou, China) at 37°C, 5% CO2. Cells were processed with 1 μM epirubicin and 1 μM pirarubicin for 24 h.

2.2 Gene transfection

Human miR-223-3p mimic, the human miR-223-3p inhibitor, NFIA siRNA (siNFIA), and its negative control siRNA (siNC) (RiboBio, Guangzhou, China) were transfected with cells. For transfection, inoculated AC16 in six-hole plates and transfected with 100 nM miR-223-3p mimic, miR-223-3p inhibitor, or siNFIA as well as their corresponding negative control by Lipofectamine 2000 (GLPBIO, Montclair, CA, USA) following the protocol.

2.3 Cell apoptosis

Estimated cell apoptosis by flow cytometry. Briefly, after cell collection, suspended with binding buffer (100 μL), and stained in the dark by propidium iodide and FITC Annexin V. After 10 min, the binding buffer (400 μL) was added to each tube. Subsequently, tested cell apoptosis by flow cytometry (Agilent Technologies, USA), and analyzed the data by FlowJo.

2.4 TUNEL assay

We detected the apoptosis using a TUNEL assay. The assay was carried out with a commercial Cell Death Detection kit (Roche Molecular Diagnostics) following the manufacturer’s kit’s protocols.

2.5 Transmission electron microscopy (TEM)

Under TEM, fixed the samples for 30 min in 2.5% glutaraldehyde, and treated at 20°C for 1 h with 1% buffered osmium tetroxide. Subsequently, the increasing ethanol gradient was used to dehydrate the samples followed by embedding in epoxy resin. Finally, observed and recorded the samples under a TEM (HT7800; HITACHI, Tokyo, Japan).

2.6 Western blotting

Extracted and calculated total proteins using a BCA assay kit (TIANGEN, Beijing, China). First, transferred the samples onto PVDF (Millipore, 0.45 μm) membranes after separation in 10% SDS-PAGE. The primary antibodies (Abcam, Cambridge, UK) were anti-NFIA (ab228897, 1:800), anti LC3-Ⅱ (ab48394, 1:800), anti-cleaved Caspase-3 (ab32042, 1:1,000), anti-Caspase-3 (ab13847, 1:500), anti-Caspase-9 (ab32539, 1:1,000), anti-cleaved Caspase-9 (ab2324, 1:1,000), anti-p62 (ab56416, 1:1,000), and anti-β-actin (ab8226, 1:800). Immunoreactive membranes were observed using ECL detection reagent (Millipore). The density of the bands was quantified by ImageQuant 1D software (GE Healthcare, PA, USA). The internal control was β-actin.

2.7 Quantitative real-time PCR (qRT-PCR) assay

Extracted total RNA in the Trizol reagent (Beyotime, Shanghai, China) following the protocols. The machine for qPCR was from Life Technologies Holdings Pte Ltd, Shanghai, China. The reactions were implemented with SYBR® Green Master Mix (Takara, Japan). Table 1 shows the primers for RT-qPCR. Normalized the relative expression levels of NFIA and miR-223-3p, respectively, to U6 and GAPDH.

Table 1

Primer sequences used for qRT-PCR

Genes Primer sequences (5′–3′)
hsa-miR-223-3p Forward GGTAACAGTCTCCAGTCA
Reverse GCAATTGCACTGGATACG
NFIA Forward TGGCCAAGTTACGGAAAGATG
Reverse GCGCTCGCCATCAGTACT
U6 Forward GCTTCGGCAGCACATATACTAAAAT
Reverse CGCTTCACGAATTTGCGTGTCAT
GAPDH Forward GAAGGTGAAGGTCGGAGTC
Reverse GAAGATGGTGATGGGATTTC

2.8 Luciferase assay

We predicted the binding sites of miR-233-3p by utilizing bioinformatics. WT and mutated (MUT) NFIA 3′-UTR sequences were chemically synthesized (Sangon, Shanghai, China) according to the sequence of miR-223-3p. Besides, the luciferase activity was detected according to the luciferase assay system (Promega, USA).

2.9 Statistics analysis

Comparisons were measured through unpaired/paired Student’s t-test, Mann–Whitney test, one-way ANOVA, and Bonferroni’s post hoc test. By SPSS 18.0 (SPSS Inc.), data were shown as the mean  ±  standard deviation. The differences were deemed statistically significant at P  <  0.05.

3 Results

3.1 Anthracyclines induce the apoptosis and autophagy of AC16 cell

Epirubicin and pirarubicin exert their anti-tumor effects through complexes with DNA, leading to DNA damage and interfering with the synthesis of DNA, RNA, and proteins [16]. AC16 cells were stimulated with 1 μM epirubicin and 1 μM pirarubicin for 1 day. TUNEL-positive cell quantity measured in AC16 cells was enhanced by epirubicin and pirarubicin (Figure 1(a)). Flow cytometry assay elucidated an elevating apoptosis rate triggered by epirubicin and pirarubicin in AC16 cells (Figure 1(b)). Then western blot was applied to evaluate apoptosis associated proteins’ content. We discovered that pro-apoptosis proteins’ level (Cleaved caspase-3 and -9) was elevated by epirubicin and pirarubicin in AC16 cells (Figure 1(c)). Next, TEM showed an increase in the number of autophagosomes with typical bilayer morphology in AC16 cells treated with epirubicin and pirarubicin (Figure 1(d)). Furthermore, the level of signaling adaptor p62 was decreased, yet LC3-II level was elevated by epirubicin and pirarubicin in AC16 cells (Figure 1(e)). All the results showed that anthracyclines promote apoptosis and autophagy in AC16 cells.

Figure 1 Anthracyclines induce AC16 cell apoptosis and autophagy. AC16 were processed with 1 μM epirubicin and 1 μM pirarubicin for 24 h. (a) and (b) Apoptosis was measured by TUNEL and flow cytometry in AC16 cells. (c) Levels of cleaved caspase-3 and -9 were assessed by western blot analysis in AC16 cells. (d) Autophagosomes were tested by TEM. (e) Expressions of p62, LC3-I, and LC3-II in AC16 cells. **P < 0.01 vs control. n = 3 per group.
Figure 1

Anthracyclines induce AC16 cell apoptosis and autophagy. AC16 were processed with 1 μM epirubicin and 1 μM pirarubicin for 24 h. (a) and (b) Apoptosis was measured by TUNEL and flow cytometry in AC16 cells. (c) Levels of cleaved caspase-3 and -9 were assessed by western blot analysis in AC16 cells. (d) Autophagosomes were tested by TEM. (e) Expressions of p62, LC3-I, and LC3-II in AC16 cells. **P < 0.01 vs control. n = 3 per group.

3.2 Anthracyclines promote miR-223-3p expression and cell damage

We found miRNAs related to myocardial cell injury through Genecards (https://www.genecards.org/) and g: Profiler (https://biit.cs.ut.ee/gprofiler/) enrichment analysis, with miR-223-3p having a higher correlation with myocardial cell injury (Figure 2(a)). miR-223-3p was reported to induce cell damage, especially in cardiomyocytes [12]. Different concentrations of epirubicin and pirarubicin were used to treat AC16 cells, and the qPCR results implied that miR-223-3p expression was ascended through epirubicin or pirarubicin in the dose-dependent manner (Figure 2(b)). Then AC16 cells were treated with epirubicin or pirarubicin for different concentrations or hours, we discovered a constant increasing miR-223-3p level with the prolongation of epirubicin or pirarubicin treatment time (Figure 2(c)). Above data confirmed that miR-223-3p content was positively related to anthracyclines treatment.

Figure 2 Anthracyclines promote miR-223-3p level. (a) Genecards were used to search the genes related to cardiomyocyte damage and then found most of them are related to miR-223-3p. (b) and (c) miR-223-3p levels were assessed by qRT-PCR in AC16 cells treated with different concentrations of epirubicin and pirarubicin or different time points of epirubicin and pirarubicin. *P < 0.05, **P < 0.01 vs 0 h; *P < 0.05, **P < 0.01 vs control. n = 3 per group.
Figure 2

Anthracyclines promote miR-223-3p level. (a) Genecards were used to search the genes related to cardiomyocyte damage and then found most of them are related to miR-223-3p. (b) and (c) miR-223-3p levels were assessed by qRT-PCR in AC16 cells treated with different concentrations of epirubicin and pirarubicin or different time points of epirubicin and pirarubicin. *P < 0.05, **P < 0.01 vs 0 h; *P < 0.05, **P < 0.01 vs control. n = 3 per group.

3.3 miR-223-3p down-regulation affects the apoptosis of AC16 cell

To probe the effects of miR-223-3p, AC16 cells treated with epirubicin or pirarubicin were transfected with miR-223-3p inhibitor and NC inhibitor, respectively. Compared to the NC inhibitor group, the TUNEL-positive AC16 cells were reduced in miR-223-3p inhibitor group, signifying that apoptosis degree was cut down by miR-223-3p reduction in the AC16 stimulated with epirubicin or pirarubicin (Figure 3(a)). The flow cytometry elucidated that miR-223-3p knockdown suppressed cellular apoptosis in the AC16 cells treated with epirubicin or pirarubicin (Figure 3(b)). In addition, expressions of pro-apoptosis proteins (cleaved caspase-3 and -9) were discovered to be debased by a miR-223-3p inhibitor (Figure 3(c)). Above results showed that the apoptosis degree up-regulated by epirubicin or pirarubicin was inhibited by miR-223-3p inhibitor in AC16.

Figure 3 miR-223-3p knockdown affects AC16 apoptosis. miR-223-3p inhibitor and NC inhibitor were transfected into AC16 cells treated with epirubicin or pirarubicin. (a) and (b) Apoptosis was measured by TUNEL and flow cytometry in AC16 cells. (c) Levels of cleaved caspase-3 and -9 in AC16 cells were assessed by western blot analysis. **P < 0.01 vs NC-inhibitor; # P < 0.05, ## P < 0.01 vs NC-inhibitor + epirubicin, NC-inhibitor + pirarubicin. n = 3 per group.
Figure 3

miR-223-3p knockdown affects AC16 apoptosis. miR-223-3p inhibitor and NC inhibitor were transfected into AC16 cells treated with epirubicin or pirarubicin. (a) and (b) Apoptosis was measured by TUNEL and flow cytometry in AC16 cells. (c) Levels of cleaved caspase-3 and -9 in AC16 cells were assessed by western blot analysis. **P < 0.01 vs NC-inhibitor; # P < 0.05, ## P < 0.01 vs NC-inhibitor + epirubicin, NC-inhibitor + pirarubicin. n = 3 per group.

3.4 Down-regulation of miR-223-3p affects AC16 cell autophagy

To inspect the role of miR-223-3p in the autophagy of AC16 cells, electron microscopy was used to detect the autophagosome. Results suggested that the increased number of autophagosomes was reduced by knockdown of miR-223-3p in AC16 stimulated with epirubicin or pirarubicin (Figure 4(a)). In AC16 cells treated with epirubicin or pirarubicin, the results of western blot showed that miR-223-3p inhibitor promoted LC3-Ⅱ protein level, but abated p62 protein level (Figure 4(b)). All these data illustrated that low miR-223-3p level reduces the level of autophagy in AC16 cells.

Figure 4 miR-223-3p knockdown affects AC16 autophagy. miR-223-3p inhibitor and NC inhibitor were transfected into AC16 cells treated with epirubicin or pirarubicin. (a) Autophagosomes were detected by TEM. (b) Expressions of p62, LC3-I, and LC3-II were measured by western blot analysis in AC16 cells. *P < 0.05, **P < 0.01 vs NC-inhibitor; # P < 0.05, ## P < 0.01 vs NC-inhibitor + epirubicin, NC-inhibitor + pirarubicin. n = 3 per group.
Figure 4

miR-223-3p knockdown affects AC16 autophagy. miR-223-3p inhibitor and NC inhibitor were transfected into AC16 cells treated with epirubicin or pirarubicin. (a) Autophagosomes were detected by TEM. (b) Expressions of p62, LC3-I, and LC3-II were measured by western blot analysis in AC16 cells. *P < 0.05, **P < 0.01 vs NC-inhibitor; # P < 0.05, ## P < 0.01 vs NC-inhibitor + epirubicin, NC-inhibitor + pirarubicin. n = 3 per group.

3.5 Analyzed and verified the relevance between NFIA and miR-223-3p

It was proved that the NFIA transcription factor participates in inhibiting cell apoptosis [17]. We used bioinformatics prediction websites (starbase, Carolina, targetscan, and miRWalk) to predict the relationship and the binding site between NFIA and miR-223-3p (Figure 5(a) and (b)). Then, luciferase reporter analysis was carried out, showing that luciferase activity of the 3′-UTR region of NFIA dramatically reduced in AC16 co-transfected with NFIA-WT and miR-223-3p mimics. However, luciferase activity of NFIA-Mut showed no significant difference between the NC group and miR-223-3p mimics group (Figure 5(c)). Meanwhile, qRT-PCR and western bolt illustrated that NFIA level was specifically depressed by miR-223-3p mimics (Figure 5(d) and (e)). Then it was found that the NFIA level was reduced by anthracyclines (Figure 5(f) and (g)). In summary, the above data illustrated that miR-223-3p binds with NFIA mRNA and negatively regulates NFIA expression.

Figure 5 Analyze and verify the relevance between NFIA and miR-223-3p. (a) We used bioinformatics prediction websites to predict the relationship and (b) the binding site of both miR-223-3p and NFIA. (c) Luciferase reporter assay was performed after 48 h transfection in AC16 with a luciferase reporter plasmid containing WT or mutant form of NFIA 3′-UTR along with NC mimics or miR-223-3p mimics. NC mimics or miR-223-3p mimics were transfected in AC16 cells, and NFIA expression was analyzed by (d) qRT-PCR and (e) western blot. The protein level of NFIA treated with epirubicin or pirarubicin was tested by (f) qRT-PCR and (g) western blot. **P < 0.01 vs NC mimics; **P < 0.01 vs NC-inhibitor + si-NC; # P < 0.05, ## P < 0.01 vs miR-223-3p inhibitor + si-NC; $ P < 0.05, $$ P < 0.01 vs miR-223-3p-inhibitor + Si-NC. n = 3 per group.
Figure 5

Analyze and verify the relevance between NFIA and miR-223-3p. (a) We used bioinformatics prediction websites to predict the relationship and (b) the binding site of both miR-223-3p and NFIA. (c) Luciferase reporter assay was performed after 48 h transfection in AC16 with a luciferase reporter plasmid containing WT or mutant form of NFIA 3′-UTR along with NC mimics or miR-223-3p mimics. NC mimics or miR-223-3p mimics were transfected in AC16 cells, and NFIA expression was analyzed by (d) qRT-PCR and (e) western blot. The protein level of NFIA treated with epirubicin or pirarubicin was tested by (f) qRT-PCR and (g) western blot. **P < 0.01 vs NC mimics; **P < 0.01 vs NC-inhibitor + si-NC; # P < 0.05, ## P < 0.01 vs miR-223-3p inhibitor + si-NC; $ P < 0.05, $$ P < 0.01 vs miR-223-3p-inhibitor + Si-NC. n = 3 per group.

3.6 Rescue experiments verified NFIA/miR-223-3p’s role in anthracycline-treated AC16

To test the functions of the NFIA/miR-223-3p axis, miR-223-3p inhibitor/NC inhibitor and si-NFIA/si-NC were co-transfected into AC16 cells treated with epirubicin or pirarubicin, respectively. NFIA up-regulation by miR-223-3p inhibitor was dampened by si-NFIA in the AC16 cells processed with epirubicin or pirarubicin, and the expression of NFIA was not affected by autophagy inhibitor LY294002 (Figure 6(a)). The reduction of the TUNEL-positive AC16 cells was improved by si-NFIA in miR-223-3p inhibitor group, and it was inhibited by LY294002 in AC16 cells treated with epirubicin or pirarubicin. It showed that the decreasing of apoptosis degree by miR-223-3p inhibitor was reversed by si-NFIA in AC16 cells treated with epirubicin or pirarubicin, and the autophagy inhibitor LY294002 inhibited the up-regulation of apoptosis by si-NFIA (Figure 6(b)). The flow cytometry assay elucidated that si-NFIA inverted the inhibition on apoptosis by miR-223-3p inhibitor in the AC16 cells treated with epirubicin or pirarubicin, and the autophagy inhibitor LY294002 inhibited the up-regulation of cell apoptosis by si-NFIA (Figure 6(c)). Next, si-NFIA reversed the decrease of autophagosomes by miR-223-3p inhibitor in the AC16 treated with epirubicin or pirarubicin, and the autophagy inhibitor LY294002 inhibited the increase of autophagosomes by si-NFIA (Figure 6(d)). Furthermore, miR-223-3p silencing stimulated the decline of pro-apoptosis factor and LC3-Ⅱ was partly reversed by si-NFIA by western bolt analysis; meanwhile, the increase was rescued by LY294002. The descent by miR-223-3p inhibitor in p62 expression was partly reversed by si-NFIA; meanwhile, the reduced effect on p62 was rescued by LY294002 (Figure 6(e)). All the results showed that si-NIFA reversed miR-223-3p inhibitor effects of anti-apoptosis and anti-autophagy in anthracycline-treated AC16, indicating that miR-223-3p monitored the process of apoptosis and autophagy by targeting NFIA in the anthracycline-treated AC16.

Figure 6 Rescue experiments verify the effects of NFIA/miR-223-3p in anthracycline-treated AC16. miR-223-3p inhibitor/NC inhibitor and si-NFIA/si-NC were co-transfected into anthracycline-induced AC16 cells processed with or without LY294002, respectively. (a) NFIA expression was detected by western blot. (b) and (c) Apoptosis of AC16 cells was detected by TUNEL and flow cytometry. (d) Autophagosomes were detected by TEM. (e) Expression levels of p62, LC3-I, LC3-II, cleaved caspase-3 and -9. **P < 0.01 vs normal. n = 3 per group.
Figure 6

Rescue experiments verify the effects of NFIA/miR-223-3p in anthracycline-treated AC16. miR-223-3p inhibitor/NC inhibitor and si-NFIA/si-NC were co-transfected into anthracycline-induced AC16 cells processed with or without LY294002, respectively. (a) NFIA expression was detected by western blot. (b) and (c) Apoptosis of AC16 cells was detected by TUNEL and flow cytometry. (d) Autophagosomes were detected by TEM. (e) Expression levels of p62, LC3-I, LC3-II, cleaved caspase-3 and -9. **P < 0.01 vs normal. n = 3 per group.

4 Discussion

The anthracycline drugs epirubicin and pirarubicin are considered a double-edged sword in clinical treatment. On the positive side, anthracyclines exert a capital role in the therapy of neoplastic disorder; on the negative side, chronic use of anthracyclines spawns congestive heart failure and cardiomyopathy, which are often difficult to cure with common drugs [18]. This study found that epirubicin or pirarubicin increased autophagy and apoptosis of AC16 cells. According to reports, the expression of miRNA is affected by drugs, and their levels are associated with various cardiovascular diseases and heart tissue damage, indicating that miRNA has the potential as a biomarker and diagnostic tool [8]. This study found that the expression level of miR-223-3p was significantly higher in AC16 cells treated with epirubicin and pirarubicin.

Many miRNAs are involved in the progression of cardiomyocyte damage. For instance, it is reported that the knockdown of miR-132 improves heart failure and cardiac hypertrophy in mice [19]. Also, miR-34a was found to spawn in the aging heart, and miR-34a knockdown reduces the death of age-associated cardiomyocytes in vivo [20]. Meanwhile, miR-223-3p prevents oxidative stress and apoptosis via regulating KLF15 in H9c2 cells [13]. In this study, we predicted genes related to cardiomyocyte damage and found that most of them are related to miR-223-3p, which was up-regulated by epirubicin or pirarubicin in AC16 cells. Furthermore, miR-223-3p reduction hindered the apoptosis and autophagy in AC16 cells treated with epirubicin or pirarubicin. Those results revealed that miR-223-3p is a crux for the restraint of apoptosis and autophagy in anthracycline-treated AC16.

NFIA, a group of the NFI family, was originally found to play a role in adenovirus DNA replication. Recently, it is reported that NFIs, especially NFIA and NFIB, also function in the occurrence or development of cancers [21]. Few reports showed that NFIA was targeted by miRNAs, such as miR-29a [22] and miR-223 [23]. In the research, we predicted and testified the association of miR-223-3p with NFIA in AC16 cells. Silencing of NFIA partly rescued the suppression of miR-223-3p inhibitor on cell apoptosis and autophagy in AC16 cells treated with an anthracycline, suggesting that between miR-223-3p and NFIA existed molecular regulation way in AC16 cells. At the bottom of this study, we performed rescue experiments to further inquire about the regulation mechanism of apoptosis and autophagy between NFIA and miR-223-3p. It was improved that the down-regulation of the NFIA party reversed the protection of miR-223-3p inhibitor in anthracycline-treated AC16. All data manifested that miR-223-3p dampened the apoptosis and autophagy via negatively regulating NFIA expression, which was a new molecular regulation mechanism in the process of anthracycline-induced cardiomyocyte damage.

In conclusion, all findings demonstrated that the knockdown of miR-223-3p protected AC16 cells by inhibiting cell apoptosis and autophagy. MiR-223-3p inhibitor exerted protective functions by targeting NFIA. Our study demonstrated the regulation mechanism and function between NFIA and miR-223-3p in AC16 cells in vitro. The function and molecular regulation of miR-223-3p and NFIA need to be confirmed in vivo in the future. Furthermore, this study provided a novel and promising therapeutic target for anthracycline-induced cardiomyocyte damage.

Acknowledgements

Not applicable.

  1. Funding information: Not applicable.

  2. Author contributions: X.H. conceived and designed the study. X.H., K.L., and F.G. done all of the experiments. F.G. analyzed the data. M.Y. performed the literature search and data extraction. F.W. drafted the manuscript. X.H. finalized the manuscript. All authors read and approved the final manuscript.

  3. Conflict of interest: The authors state that there are no conflicts of interest.

  4. Data availability statement: The datasets generated during or analyzed during the current study are available from the corresponding author upon reasonable request.

References

[1] Quinones-Lombrana A, Intini A, Blanco JG. Insights into the transcriptional regulation of the anthracycline reductase AKR7A2 in human cardiomyocytes. Toxicol Lett. 2019;307:11–6.10.1016/j.toxlet.2019.02.015Search in Google Scholar PubMed PubMed Central

[2] McGowan JV, Chung R, Maulik A, Piotrowska I, Walker JM, Yellon DM. Anthracycline chemotherapy and cardiotoxicity. Cardiovasc Drugs Ther. 2017;31(1):63–75.10.1007/s10557-016-6711-0Search in Google Scholar PubMed PubMed Central

[3] Pratama MY, Pascut D, Massi MN, Tiribelli C. The role of microRNA in the resistance to treatment of hepatocellular carcinoma. Ann Transl Med. 2019;7(20):577.10.21037/atm.2019.09.142Search in Google Scholar PubMed PubMed Central

[4] Kurozumi S, Yamaguchi Y, Kurosumi M, Ohira M, Matsumoto H, Horiguchi J. Recent trends in microRNA research into breast cancer with particular focus on the associations between microRNAs and intrinsic subtypes. J Hum Genet. 2017;62(1):15–24.10.1038/jhg.2016.89Search in Google Scholar PubMed

[5] Kent OA, Mendell JT. A small piece in the cancer puzzle: microRNAs as tumor suppressors and oncogenes. Oncogene. 2006;25(46):6188–96.10.1038/sj.onc.1209913Search in Google Scholar PubMed

[6] Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 1993;75(5):843–54.10.1016/0092-8674(93)90529-YSearch in Google Scholar PubMed

[7] El-Awady RA, Hersi F, Al-Tunaiji H, Saleh EM, Abdel-Wahab AH, Al Homssi A, et al. Epigenetics and miRNA as predictive markers and targets for lung cancer chemotherapy. Cancer Biol Ther. 2015;16(7):1056–70.10.1080/15384047.2015.1046023Search in Google Scholar PubMed PubMed Central

[8] Skala M, Hanouskova B, Skalova L, Matouskova P. MicroRNAs in the diagnosis and prevention of drug-induced cardiotoxicity. Arch Toxicol. 2019;93(1):1–9.10.1007/s00204-018-2356-zSearch in Google Scholar PubMed

[9] Wan L, Yuan X, Liu M, Xue B. miRNA-223-3p regulates NLRP3 to promote apoptosis and inhibit proliferation of hep3B cells. Exp Ther Med. 2018;15(3):2429–35.10.3892/etm.2017.5667Search in Google Scholar PubMed PubMed Central

[10] Liu J, Shi H, Li X, Chen G, Larsson C, Lui WO. miR2233p regulates cell growth and apoptosis via FBXW7 suggesting an oncogenic role in human testicular germ cell tumors. Int J Oncol. 2017;50(2):356–64.10.3892/ijo.2016.3807Search in Google Scholar PubMed PubMed Central

[11] Ji Q, Xu X, Song Q, Xu Y, Tai Y, Goodman SB, et al. miR-223-3p inhibits human osteosarcoma metastasis and progression by directly targeting CDH6. Mol Ther. 2018;26(5):1299–312.10.1016/j.ymthe.2018.03.009Search in Google Scholar PubMed PubMed Central

[12] Liu X, Zhang Y, Du W, Liang H, He H, Zhang L, et al. miR-223-3p as a novel microRNA regulator of expression of voltage-gated K + Channel Kv4.2 in acute myocardial infarction. Cell Physiol Biochem. 2016;39(1):102–14.10.1159/000445609Search in Google Scholar PubMed

[13] Tang Q, Li MY, Su YF, Fu J, Zou ZY, Wang Y, et al. Absence of miR-223-3p ameliorates hypoxia-induced injury through repressing cardiomyocyte apoptosis and oxidative stress by targeting KLF15. Eur J Pharmacol. 2018;841:67–74.10.1016/j.ejphar.2018.10.014Search in Google Scholar PubMed

[14] Wu X, Chen H, Zhang G, Wu J, Zhu W, Gu Y, et al. miR-212-3p inhibits cell proliferation and promotes apoptosis by targeting nuclear factor IA in bladder cancer. J Biosci. 2019;44(4):80.10.1007/s12038-019-9903-5Search in Google Scholar

[15] Lee CC, Chen PH, Ho KH, Shih CM, Cheng CH, Lin CW, et al. The microRNA-302b-inhibited insulin-like growth factor-binding protein 2 signaling pathway induces glioma cell apoptosis by targeting nuclear factor IA. PLoS One. 2017;12(3):e0173890.10.1371/journal.pone.0173890Search in Google Scholar PubMed PubMed Central

[16] Cersosimo RJ, Hong WK. Epirubicin: a review of the pharmacology, clinical activity, and adverse effects of an adriamycin analogue. J Clin Oncol. 1986;4(3):425–39.10.1200/JCO.1986.4.3.425Search in Google Scholar PubMed

[17] Lee J, Hoxha E, Song HR. A novel NFIA-NFkappaB feed-forward loop contributes to glioblastoma cell survival. Neuro Oncol. 2017;19(4):524–34.10.1093/neuonc/now233Search in Google Scholar PubMed PubMed Central

[18] Minotti G, Menna P, Salvatorelli E, Cairo G, Gianni L. Anthracyclines: molecular advances and pharmacologic developments in antitumor activity and cardiotoxicity. Pharmacol Rev. 2004;56(2):185–229.10.1124/pr.56.2.6Search in Google Scholar PubMed

[19] Ucar A, Gupta SK, Fiedler J, Erikci E, Kardasinski M, Batkai S, et al. The miRNA-212/132 family regulates both cardiac hypertrophy and cardiomyocyte autophagy. Nat Commun. 2012;3:1078.10.1038/ncomms2090Search in Google Scholar PubMed PubMed Central

[20] Boon RA, Iekushi K, Lechner S, Seeger T, Fischer A, Heydt S, et al. MicroRNA-34a regulates cardiac ageing and function. Nature. 2013;495(7439):107–10.10.1038/nature11919Search in Google Scholar PubMed

[21] Yang B, Zhou ZH, Chen L, Cui X, Hou JY, Fan KJ, et al. Prognostic significance of NFIA and NFIB in esophageal squamous carcinoma and esophagogastric junction adenocarcinoma. Cancer Med. 2018;7(5):1756–65.10.1002/cam4.1434Search in Google Scholar PubMed PubMed Central

[22] Liu C, Duan P, Li B, Huang C, Jing Y, Yan W. miR-29a activates Hes1 by targeting Nfia in esophageal carcinoma cell line TE-1. Oncol Lett. 2015;9(1):96–102.10.3892/ol.2014.2678Search in Google Scholar PubMed PubMed Central

[23] Glasgow SM, Laug D, Brawley VS, Zhang Z, Corder A, Yin Z, et al. The miR-223/nuclear factor I-A axis regulates glial precursor proliferation and tumorigenesis in the CNS. J Neurosci. 2013;33(33):13560–8.10.1523/JNEUROSCI.0321-13.2013Search in Google Scholar PubMed PubMed Central

Received: 2022-12-26
Revised: 2023-06-23
Accepted: 2023-06-26
Published Online: 2023-07-25

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
https://doi.org/10.1515/med-2023-0754
Keywords for this article
miR-223-3p; NFIA; cardiomyocyte damage; anthracyclines
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 8.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0754/html
Scroll to top button