Home MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
Article Open Access

MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway

  • Jia-Bei Xie EMAIL logo , Hao Zhang , Xiao-Fang Li , Shuang-Yin Han and Xiu-Ling Li
Published/Copyright: November 18, 2023
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 18 Issue 1

Abstract

This study aimed to investigate the interaction between miR-1278 and Caldesmon (CALD1) in gastric cancer (GC) and the regulatory mechanism. In both GC cells and tissues, the levels of CALD1, miR-1278, migration-related markers (E-cadherin, N-cadherin, and Snail), and MAPK signaling pathway-related proteins were clarified using quantitative real-time PCR and western blotting analyses. The effects of miR-1278 and CALD1 on GC cell viability and migration were analyzed using CCK-8 and Transwell assays, respectively. The targeting effect of miR-1278 on CALD1 was investigated using bioinformatics prediction and a dual luciferase reporter assay. The effect of miR-1278 on tumor growth was estimated in vivo using a tumor xenograft assay. In GC, miR-1278 expression decreased, whereas CALD1 was highly expressed. Transfecting an miR-1278 mimic into cells inhibited the viability as well as migration of GC cells, and suppressed Ras, phosphorylated (p)-P38, and p-ERK1/2 protein levels. Moreover, miR-1278 targeted and negatively regulated CALD1 expression. CALD1 overexpression promoted GC cell survival and migration and activated the MAPK pathway. Treatment with an miR-1278 mimic partially rescued the changes caused by CALD1 overexpression. Overall, our study revealed that miR-1278 suppresses the malignant behavior of GC cells by targeting CALD1 and regulating the MAPK pathway.

Keywords: miR-1278; CALD1; gastric cancer; migration

1 Introduction

Gastric cancer (GC) is the sixth most common cancer in both men and women with a worldwide prevalence rate of 11.1/100,000 population in 2020 [1]. Although great achievements in the surgical treatment and prognosis of GC have been noted, the overall 5-year survival rate of patients with GC remains low, at approximately 31% [2]. Studies have shown that the occurrence of GC is associated with risk factors such as smoking, alcohol abuse, irregular diet, Helicobacter pylori infection, and genetic factors [3]. However, the pathogenesis of GC is still unclear. Therefore, exploring new diagnostic biomarkers for GC is of great significance for the diagnosis and treatment of GC.

microRNAs (miRNAs) are endogenous small non-coding RNAs that can regulate key processes, including proliferation, invasion, differentiation, apoptosis, as well as metastasis, through post-transcriptional regulation, and play a key regulatory role in tumor development. Various abnormally expressed miRNAs have been identified in GC, such as miR-21, which is overexpressed in both human GC tissues and cell lines and acts as an oncogenic miRNA, thereby enhancing GC cell proliferation and invasion [4,5,6]. Meanwhile, miR-451, miR-486, and miR-101 [7,8,9] can act as either oncogenic miRNAs or tumor suppressors. Our study observed the upregulation of miR-1278 in GC. Previous studies have suggested that miR-1278 is considerably enriched in thyroid cancer, promotes cancer cell growth, migration, and invasion, and may function as an oncogenic miRNA [10]. In colorectal cancer, miR-1278 can also function as a potential biomarker and act as a tumor suppressor [11]. However, the role of miR-1278 in GC remains unclear; in particular, its role requires further investigation due to its abnormal expression in GC.

Caldesmon (CALD1) is a cytoskeleton-associated protein that has multiple isoforms and plays multiple regulatory roles. It has been shown that CALD1 plays a key regulatory role in the growth, migration, invasion, and apoptosis of tumor cells [12], and enrichment of CALD1 is linked to poor metastasis and prognosis in different cancers, including gastric, bladder, and colorectal cancers [13,14]. In particular, CALD1 was found to be strongly related to several immune as well as stromal components of the tumor microenvironment [15], and CALD1 levels in GC were closely associated with infiltration of immune cells, including dendritic cells, T cells, and tumor-associated macrophages [16]. Meanwhile, various functions regulated by CALD1, such as cell adhesion and leukocyte transendothelial migration, are closely related to the MAPK and TGF-β signaling pathways, which play a crucial role in both the proliferation and migration of tumor cells [17]. Therefore, CALD1 acts as a key regulator of GC progression; however, the specific regulatory mechanism requires further investigation.

In the current study, we focused on the roles and mechanisms of action of miR-1278 and CALD1 in GC. We hypothesized that miR-1278 could target and negatively regulate CALD1 expression and affect GC cell survival and migration by regulating the MAPK signaling pathway. Our results suggest that miR-1278 is a potent diagnostic marker for the treatment of GC patients, and the miR-1278/CALD1 axis is a therapeutic target for GC.

2 Methods

2.1 Patient sample collection

All GC tissue specimens and the corresponding paracancerous tissues (normal gastric mucosal tissues, 5 cm from the tumor margin) were obtained from patients with GC. The patients did not receive other therapies, such as radiotherapy or chemotherapy, before surgery. We obtained 38 matched normal and tumor samples. Tissues were confirmed as GC by at least three pathologists.

2.2 Cell culture

Human GC cell lines (HGC-27, AGS, and GTL-16) and the immortalized gastric epithelial cells (GES-1) were purchased from the Chinese Academy of Sciences Cell Resource Center (Shanghai, China). All cell lines were routinely cultured in RPMI 1,640 medium (Gibco, USA) at 37°C in an incubator with 5% CO2. Cell passaging was performed at a split ratio of 1:3 to 1:4, and the frequency of fluid exchange was three times per week.

2.3 RNA extraction and quantitative real-time PCR (qRT-PCR) assay

RNA isolation was performed using RNAiso Plus (TAKARA, Japan), and a Reverse Transcription kit (Invitrogen, USA) was used for cDNA generation. The miRNEasy EFPE Kit (BioTeke, China) was utilized to extract miRNA, followed by the generation of cDNA using the TaqMan miRNA reverse transcription kit (Applied Biosystems, USA). Next, PCRs were performed using the TaqMan Fast Universal PCR Master Mix (Applied Biosystems) and Hieff qPCR SYBR Green Master Mix kit (Yeasen, China) on ABI 7500 PCR (Applied Biosystems). The ΔCt values were calculated for each group, and gene levels were determined using the 2–ΔΔCt method; the values were normalized using U6 (internal reference of miR-1278) or GAPDH (internal reference of CALD1) as internal controls. The primers used in this study are listed in Table 1.

Table 1

Primer sequences for qRT-PCR

Gene Primer sequence (5′–3′)
miR-1278 Forward primer: GGCTCTGGCTCCGTGTCTT
Reverse primer: CAGTGCAGGGTCCGAGGTATT
CALD1 Forward primer: TGGAGGTGAATGCCCAGAAC
Reverse primer: GAAGGCGTTTTTGGCGTCTTT
U6 Forward primer: CAAATTCGTGAAGCGTTCCATA
Reverse primer: AGTGCAGGGTCCGAGGTATTC
GAPDH Forward primer: GGAGCGAGATCCCTCCAAAAT
Reverse primer: GGCTGTTGTCATACTTCTCATGG

2.4 Cell transfection

The CALD1 overexpression vector (CALD1-OE) and empty vector were synthesized by Agilent Technologies (USA). We obtained an miR-1278 mimic and a mimic negative control (mimic-NC) from SwitchGear Genomics (USA). Next, Lipofectamine 3000 (Invitrogen) reagent was used to transfect mimic (75 nM) or vector (2 μg/mL) into AGS and GTL-16 cells, following the manufacturer’s protocol. Two days later, both cell types were seeded for qRT-PCR analysis.

2.5 Western blotting

From each group, total protein was extracted from cells using a lysis buffer (Beyotime, China), followed by quantification using a BCA kit (Pierce, USA). Next, 30 μg protein was isolated using SDS-PAGE (12%), and proteins were transferred to poly(vinylidene fluoride) (PVDF) membranes (Millipore, USA). Blocking was performed by dipping the membranes in 5% skimmed milk for 2 h at room temperature, followed by overnight incubation of protein bands at 4°C in the corresponding primary antibody: E-cadherin (cat. no. abs130068; Absin, China; 1:1,000), N-cadherin (cat. no. abs155766; Absin; 1:1,000), Snail (cat. no. abs151371; Absin; 1:1,000), Ras (cat.no. 91054; Cell Signaling Technology, USA; 1:1,000), P38 (cat.no. 8690; Cell Signaling Technology; 1:1,000), phosphorylated (p)-P38 (cat.no. 4511; Cell Signaling Technology; 1:1,000), ERK (cat.no. 4695; Cell Signaling Technology; 1:1,000), p-ERK (cat.no. 4370; Cell Signaling Technology; 1:2,000), and GAPDH (cat.no. 51332; Cell Signaling Technology; 1:1,000). Subsequently, the PVDF membranes were incubated with the corresponding secondary HRP-linked mouse or rabbit antibody (Cell Signaling Technology; 1:1,000) for 1 h at room temperature. Band images were visualized using enhanced chemiluminescence (Thermol Biotech Inc, USA).

2.6 CCK-8 assay

Cells were seeded in 96-well plates at 5,000 cells/well, and 3 replicate wells were set for each group. The cells were then cultured at 0, 24, 48, and 72 h and mixed with 10 μL of CCK-8 solution (Biosharp, China) at 37°C for 1 h. The absorbance at 450 nm was measured using an ElX-800 absorbance spectrophotometer (Bio-Tek, USA).

2.7 Transwell assay

Cell migration and invasion were detected after different transfections using a Transwell assay. In brief, 1  ×  105 cells were added in the upper compartment of Transwell chambers (pore size, 8 μm) (Corning, USA). Next, 600 μL of complete medium containing 10% FBS was added to the lower compartment. After incubation for 24 h, cells in the upper compartments were removed with cotton buds, and the cells translocated to the lower compartments were fixed in 95% ethanol for 5 min and stained with 4 g/L crystalline violet solution (Biyuntian Biotechnology, China) for 1 h. Migratory cells were counted under the microscope (magnification 100×).

To estimate cell invasion, the upper compartment of Transwell chambers was first covered with Matrigel overnight at 4°C before seeding cells. The remaining experimental steps were the same as those of the migration experiment.

2.8 Tumor xenografts in nude mice

Ten male BALB/c nude mice, aged 4–5 weeks, were purchased from Beijing Spefford (China) and housed in individually ventilated cage boxes in a class 10,000 barrier environment by qualified and accredited animal managers. Mice were randomly assigned into the agomir-NC and agomir groups (five mice per group). Agomir-NC as well as agomir-transfected AGS cells were injected into mice via the subcutaneous route (2 × 106 cells resuspended in 200 μL of PBS). Tumor formation was observed every 4 days by measuring the length and width of the formed tumors. The mice were euthanized on day 28; the tumors were removed intact, and the wet weight of each tumor was examined.

2.9 Dual-luciferase reporter assay

In 24-well plates, the AGS cells and GTL-16 cells were inoculated at a density of 5 × 104 cells/well. According to the binding sites between miR-1278 and CALD1 predicted by starBase, we inserted the CALD1 3′ untranslated region (UTR)-wild-type (wt) and mutated type (mut1, mut2, or co-mut) downstream of pGL3.0 vectors (Promega, USA) to manufacture the luciferase expression vectors. miR-1278 mimic or miR-NC was co-transfected along with luciferase expression vectors into AGS and GTL-16 cells using Lipofectamine 2000. After 48 h of transfection, we measured the relative luciferase activity using a dual luciferase reporter gene assay (Promega, USA).

2.10 Statistical analysis

SPSS 22.0 statistical software was used to analyze the data. Three parallel experiments were set up for each group, with three independent replications. The data are expressed as the mean ± standard deviation. We used Student’s t-test for independent samples for comparison between different groups and one-way analysis of variance for multiple-group comparisons. In GC tissues, Pearson’s analysis was performed to evaluate the correlation between miR-1278 and CALD1 expression. p < 0.05 was considered to indicate statistically significant differences.

  1. Ethics approval and consent to participate: The present study was approved by the Ethics Committee of Henan Provincial People’s Hospital (Zhengzhou, China). The processing of clinical tissue samples is in strict compliance with the ethical standards of the Declaration of Helsinki. All patients signed a written informed consent. All animal experiments comply with the ARRIVE guidelines and were carried out in accordance with the National Research Council’s Guide for the Care and Use of Laboratory Animals. The procedures performed in this animal study had an approval from the Animal Ethics Committee of Henan Provincial People’s Hospital (Zhengzhou, China).

  2. Consent for publication: Consent for publication was obtained from the participants.

3 Results

3.1 miR-1278 expression is downregulated in GC, and overexpression of miR-1278 inhibits viability and migration of GC cells and suppressed the MAPK signaling pathway in vitro

To investigate the role of miR-1278 in GC, we first collected samples and determined miR-1278 expression levels in tumor and paracancerous tissues. The results showed that miR-1278 expression level was significantly downregulated in GC tissues (Figure 1a). Furthermore, we detected that miR-1278 expression levels were significantly downregulated in GC cell lines (HGC-27, AGS, and GTL-16) compared to those in control cells GES-1 (Figure 1b). Subsequently, we investigated the role of miR-1278 in miR-1278 mimic-transfected AGS and GTL-16 cells (Figure 1c). CCK-8 analysis confirmed the inhibition of GC cell survival by the miR-1278 mimic (Figure 1d). Moreover, Transwell migration and invasion analysis revealed that the miR-1278 mimic inhibited the migration and invasion of GC cells (Figure 1e–f). Western blotting analysis demonstrated that E-cadherin expression was enhanced by the miR-1278 mimic, whereas the expression of N-cadherin and Snail was impaired by the miR-1278 mimic (Figure 1g). In addition, since the MAPK signaling pathway is essential for both cell proliferation and migration, we analyzed how miR-1278 overexpression affects the MAPK signaling pathway in GC cells. Western blotting analysis showed that the miR-1278 mimic significantly inhibited the relative expression levels of Ras, p-ERK, and p-P38 (Figure 1h). These results suggest that, in GC, miR-1278 levels decreased, and miR-1278 may repress cell survival and migration by inhibiting the MAPK pathway.

Figure 1 miR-1278 is downregulated in GC, whereas miR-1278 overexpression inhibits the viability and migration of GC cells and suppresses the MAPK signaling pathway in vitro. (a) qRT-PCR analysis of miR-1278 levels in GC tissues and paracancerous tissues (**P < 0.001). (b) The levels of miR-1278 in GC cells (HGC-27, AGS, GTL-16) and gastric epithelium immortalized cells (GES-1) were determined using qRT-PCR (compared with the GES-1 group, *P < 0.05 and **P < 0.001). (c) Transfection efficiency of the miR-1278 mimic and mimic-NC in GC cells, measured using qRT-PCR (compared with the mimic-NC group, **P < 0.001). (d) The effects of miR-1278 overexpression on GC cell viability were analyzed using a CCK-8 kit (compared with the mimic-NC group, **P < 0.001). (e and f) The effects of miR-1278 overexpression on the migration and invasion of GC cells were analyzed using a Transwell assay (compared with the mimic-NC group, **P < 0.001). (g) The regulation of migration-related protein markers (E-cadherin, N-cadherin, and Snail) by miR-1278 overexpression was analyzed using western blotting. (h) The regulation of MAPK signaling pathway-related protein levels (Ras, P38, p-P38, ERK1/2, and p-ERK1/2) by miR-1278 overexpression was analyzed using western blotting (compared with the mimic-NC group, **P < 0.001).
Figure 1

miR-1278 is downregulated in GC, whereas miR-1278 overexpression inhibits the viability and migration of GC cells and suppresses the MAPK signaling pathway in vitro. (a) qRT-PCR analysis of miR-1278 levels in GC tissues and paracancerous tissues (**P < 0.001). (b) The levels of miR-1278 in GC cells (HGC-27, AGS, GTL-16) and gastric epithelium immortalized cells (GES-1) were determined using qRT-PCR (compared with the GES-1 group, *P < 0.05 and **P < 0.001). (c) Transfection efficiency of the miR-1278 mimic and mimic-NC in GC cells, measured using qRT-PCR (compared with the mimic-NC group, **P < 0.001). (d) The effects of miR-1278 overexpression on GC cell viability were analyzed using a CCK-8 kit (compared with the mimic-NC group, **P < 0.001). (e and f) The effects of miR-1278 overexpression on the migration and invasion of GC cells were analyzed using a Transwell assay (compared with the mimic-NC group, **P < 0.001). (g) The regulation of migration-related protein markers (E-cadherin, N-cadherin, and Snail) by miR-1278 overexpression was analyzed using western blotting. (h) The regulation of MAPK signaling pathway-related protein levels (Ras, P38, p-P38, ERK1/2, and p-ERK1/2) by miR-1278 overexpression was analyzed using western blotting (compared with the mimic-NC group, **P < 0.001).

3.2 miR-1278 overexpression inhibits GC cell growth in vivo

To clarify the effect of miR-1278 on tumor cell growth in vivo, nude mouse xenograft experiments were conducted. The results showed a significant inhibition in tumor xenograft size in the miR-1278 agomir compared to the agomir-NC group (Figure 2a). In addition, tumor growth curves showed that tumor volume increased with the extension of xenograft time but decreased in the agomir compared to the agomir-NC group (Figure 2b). Furthermore, as shown in Figure 2c, the tumor weights in the xenograft model mice were significantly reduced by miR-1278 overexpression. These data confirm the suppression effect of miR-1278 on GC cell growth in vivo.

Figure 2 miR-1278 overexpression inhibits GC cell growth in vivo. (a) Images of the xenograft tumors in each group 28 days after a subcutaneous injection of AGS cells stably transfected with agomir-NC and agomir. (b) The effect of miR-1278 overexpression on tumor growth in BALB/c nude mice was measured every 4 days (compared with the agomir-NC group, **P < 0.001). (c) The effect of miR-1278 overexpression on tumor weight 28 days after a subcutaneous injection of AGS cells (compared with the agomir-NC group, **P < 0.001).
Figure 2

miR-1278 overexpression inhibits GC cell growth in vivo. (a) Images of the xenograft tumors in each group 28 days after a subcutaneous injection of AGS cells stably transfected with agomir-NC and agomir. (b) The effect of miR-1278 overexpression on tumor growth in BALB/c nude mice was measured every 4 days (compared with the agomir-NC group, **P < 0.001). (c) The effect of miR-1278 overexpression on tumor weight 28 days after a subcutaneous injection of AGS cells (compared with the agomir-NC group, **P < 0.001).

3.3 CALD1: a putative target of miR-1278

The above results suggest that miR-1278 has a tumor-suppressive role on the survival and migration of GC cells. Next, we explored the downstream target genes of miR-1278. We had previously predicted the downstream target genes of miR-1278 using starBase and further identified that miR-1278 had two binding sites for CALD1, using the starBase website (Figure 3a). The dual luciferase reporter assay showed that the luciferase activity in the wt + mimic, mut1 + mimic, and mut2 + mimic groups reduced by approximately 55, 30, and 25%, respectively, compared to that in the wt + NC group, while no significant change was detected in the co-mut + mimic group (Figure 3b). We also found that CALD1 levels increased in tumor tissues (Figure 3c) and GC cell lines (Figure 3d) compared to those in paraneoplastic tissues and the GES-1 cell line, respectively. Furthermore, Pearson’s analysis revealed that miR-1278 and CALD1 levels were inversely correlated in the tumor tissues (Figure 3e). These results show that CALD1 is highly expressed in GC tissues and cells and is negatively correlated with miR-1278.

Figure 3 CALD1: a putative target of miR-1278. (a) CALD1 was predicted as a miR-1278 target gene using the starBase website. (b) The targeting relationship between miR-1278 and CALD1 was estimated using a luciferase assay (compared with the wt + NC group, *P < 0.05 and **P < 0.001). (c) The expression levels of CALD1 in GC and paracancerous tissues were estimated using qRT-PCR (**P < 0.001). (d) The expression levels of CALD1 in GC cells (AGS and GTL-16) and GES-1 were estimated using qRT-PCR (compared with the GES-1 group, **P < 0.001). (e) In GC tissues, Pearson’s correlation was performed to assess the relationship between miR-1278 and CALD1 expressions.
Figure 3

CALD1: a putative target of miR-1278. (a) CALD1 was predicted as a miR-1278 target gene using the starBase website. (b) The targeting relationship between miR-1278 and CALD1 was estimated using a luciferase assay (compared with the wt + NC group, *P < 0.05 and **P < 0.001). (c) The expression levels of CALD1 in GC and paracancerous tissues were estimated using qRT-PCR (**P < 0.001). (d) The expression levels of CALD1 in GC cells (AGS and GTL-16) and GES-1 were estimated using qRT-PCR (compared with the GES-1 group, **P < 0.001). (e) In GC tissues, Pearson’s correlation was performed to assess the relationship between miR-1278 and CALD1 expressions.

3.4 Restoration of CALD1 reverses the miR-1278 effects on both GC cell growth and the MAPK signaling cascade

Based on the abovementioned results, we explored the regulatory effect of miR-1278 on CALD1. Western blotting indicated that miR-1278 overexpression significantly inhibited CALD1 protein expression, whereas upregulated CALD1 levels enhanced CALD1 expression and reversed the effect of miR-1278 overexpression (Figure 4a). We then found that CALD1 overexpression significantly promoted cell survival, migration, and invasion and activated the MAPK signaling pathway. The promoting effect of CALD1 overexpression on GC cell survival, migration, and invasion along with the activation of the MAPK signaling pathway was rescued by the miR-1278 mimic (Figure 4b–f). Taken together, our results indicate that miR-1278 suppresses GC progression by targeting CALD1 and inhibiting the MAPK signaling pathway (Figure 5).

Figure 4 Restoration of CALD1 reverses the effects of miR-1278 on GC cell growth and the MAPK signaling cascade. (a) Western blotting analysis of the CALD1 protein expression in CALD1-overexpressed AGS and GTL-16 cells transfected with an miR-1278 mimic. (b) Cell viability in CALD1-overexpressed AGS and miR-1278 mimic-transfected GTL-16 cells was analyzed using a CCK-8 kit. (c and d) Cell migration and invasion in CALD1-overexpressed AGS and miR-1278 mimic-transfected GTL-16 cells were analyzed using a Transwell assay. (e) The levels of migration-related proteins (E-cadherin, N-cadherin, and Snail) in CALD1-overexpressed AGS and miR-1278 mimic-transfected GTL-16 cells were analyzed using western blotting. (f) The levels of the MAPK signaling pathway-related proteins (Ras, P38, p-P38, ERK1/2, and p-ERK1/2) in CALD1-overexpressed AGS and miR-1278 mimic-transfected GTL-16 cells were analyzed using western blotting (compared with the empty vector group, **P < 0.001; compared with the mimic-NC group, ++ P < 0.001; compared with the CALD1-OE + mimic group, ^^ P < 0.001).
Figure 4

Restoration of CALD1 reverses the effects of miR-1278 on GC cell growth and the MAPK signaling cascade. (a) Western blotting analysis of the CALD1 protein expression in CALD1-overexpressed AGS and GTL-16 cells transfected with an miR-1278 mimic. (b) Cell viability in CALD1-overexpressed AGS and miR-1278 mimic-transfected GTL-16 cells was analyzed using a CCK-8 kit. (c and d) Cell migration and invasion in CALD1-overexpressed AGS and miR-1278 mimic-transfected GTL-16 cells were analyzed using a Transwell assay. (e) The levels of migration-related proteins (E-cadherin, N-cadherin, and Snail) in CALD1-overexpressed AGS and miR-1278 mimic-transfected GTL-16 cells were analyzed using western blotting. (f) The levels of the MAPK signaling pathway-related proteins (Ras, P38, p-P38, ERK1/2, and p-ERK1/2) in CALD1-overexpressed AGS and miR-1278 mimic-transfected GTL-16 cells were analyzed using western blotting (compared with the empty vector group, **P < 0.001; compared with the mimic-NC group, ++ P < 0.001; compared with the CALD1-OE + mimic group, ^^ P < 0.001).

Figure 5 Mechanism of function of the miR-1278/CALD1 axis in GC.
Figure 5

Mechanism of function of the miR-1278/CALD1 axis in GC.

4 Discussion

GC is among the most widely spread malignancies with a low overall survival rate [18]. The results of our experiments showed that the expression level of miR-1278 was downregulated in GC, whereas miR-1278 overexpression inhibited GC cell survival and migration and suppressed the MAPK signaling pathway. In addition, we found that CALD1 was enriched in GC, and miR-1278 targeted and negatively regulated CALD1 expression. CALD1 overexpression effectively promoted GC cell survival and migration and activated the MAPK signaling pathway. Importantly, the miR-1278 mimic rescued the facilitating effects of CALD1 overexpression on GC cell growth.

It is well established that miRNAs are key factors that influence cancer development. A large number of miRNAs have been found to be differentially expressed and play oncogenic and carcinogenic roles in GC [19]. Several studies have shown that miR-1278 acts as a key regulator in the development of several cancers, including nasopharyngeal and colorectal cancers. In nasopharyngeal carcinoma, miR-1278 exerts tumor-suppressive effects by targeting ATG28; miR-1278 expression is downregulated in colorectal carcinoma and tumor cell metastasis is inhibited by the targeting of CYP24A1, BTG2, and other downstream target genes [11,20]. Interestingly, miR-1278 is enriched in thyroid cancer, whereby it regulates cell proliferation and invasion by targeting LATS1 [10], suggesting a heterogeneous role of miR-1278 in tumor cells. In our study, miR-1278 expression was found to be downregulated in GC cells, whereas overexpression of miR-1278 inhibited tumor cell survival and migration and suppressed MAPK signaling activation. Additionally, miR-1278 overexpression inhibited tumor growth in vivo, which implies that miR-1278 can inhibit GC cell development.

MiRNAs negatively regulate the expression of their target genes by targeting the 3′UTR of the target mRNAs [21]. Here, using bioinformatics prediction coupled with a dual-luciferase reporter assay, we first confirmed that miR-1278 targets and regulates the expression of CALD1, a cytoskeleton-associated protein that is crucial for various cellular functions including proliferation, apoptosis, and adhesion [22,23]. Previous studies have found that CALD1 expression is correlated with the prognosis of gastrointestinal and lung cancer and glioma [24,25]. However, CALD1 also plays variable regulatory roles in different tumors, such as glioma, where it influences tumor progression by regulating tumor angiogenesis; increased CALD1 expression has been associated with poorer prognosis in GC but with better prognosis in lung cancer [16,26,27]. This shows that CALD1 plays a complex regulatory role in tumors. Previous studies have demonstrated high CALD1 expression in GC accompanied by increased immune cell infiltration, suggesting that CALD1 may influence GC progression by regulating the immune microenvironment in tumor cells [16]. Our study indicated that CALD1 enrichment can promote GC cell survival and migration, in addition to activation of MAPK signaling, and this regulatory effect could be rescued by the overexpression of miR-1278. In this sense, we identified a miRNA capable of targeting and negatively regulating CALD1 in GC, which further expands our understanding of GC pathogenesis.

Although we explored the complex pathogenesis of GC in some depth, some limitations remain. First, the correlation between miR-1278 and survival prognosis in patients with GC and cancer histopathology needs to be further studied. Second, the upstream regulatory mechanism of the miR-1278/CALD1 axis warrants further study.

In conclusion, we identified decreased miR-1278 expression and increased CALD1 expression in GC tissues and cells. MiR-1278 directly targets CALD1 and negatively regulates its expression. Overexpression of miR-1278 inhibited cell survival and migration and suppressed the MAPK signaling pathway activation. Moreover, miR-1278 overexpression rescued the promoting effect of CALD1 overexpression on GC progression. The findings of this study provide new insights into the complex regulatory mechanisms in GC and offer new strategies for treating GC.

tel: +86 15890072161

  1. Funding information: The authors state no funding involved.

  2. Author contributions: JBX conceived and designed this study. HZ formed the methodology. XFL conducted the experiments along with data analysis. SYH did the investigation. JBX found the resources required. XLL has written the article. HZ reviewed as well as edited the article. All authors have read and approved this article.

  3. Conflict of interest: The authors state no conflict of interest.

  4. Data availability statement: All data generated or analyzed during this study can be found in the below websites. starBase (https://starbase.sysu.edu.cn/) was used to predict the binding sites.

References

[1] Idowu S, Bertrand PP, Walduck AK. Homeostasis and cancer initiation: organoids as models to study the initiation of gastric cancer. Int J Mol Sci. 2022;23:52790.10.3390/ijms23052790Search in Google Scholar PubMed PubMed Central

[2] Cann C, Ciombor KK. Systemic therapy for gastric cancer: Perioperative strategies and beyond. J Surg Oncol. 2022;125(7):1151–60.10.1002/jso.26834Search in Google Scholar PubMed

[3] Li PF, Chen SC, Xia T, Jiang XM, Shao YF, Xiao BX, et al. Non-coding RNAs and gastric cancer. World J Gastroenterol. 2014;20(18):5411–9.10.3748/wjg.v20.i18.5411Search in Google Scholar PubMed PubMed Central

[4] Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F, et al. A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A. 2006;103(7):2257–61.10.1073/pnas.0510565103Search in Google Scholar PubMed PubMed Central

[5] Schultz-Coulon HJ. [Jejunum transplantation. Therapeutic progress?]. Hno. 1991;39(6):203–7.Search in Google Scholar

[6] Zhang Z, Li Z, Gao C, Chen P, Chen J, Liu W, et al. miR-21 plays a pivotal role in gastric cancer pathogenesis and progression. Lab Invest. 2008;88(12):1358–66.10.1038/labinvest.2008.94Search in Google Scholar PubMed

[7] Godlewski J, Bronisz A, Nowicki MO, Chiocca EA, Lawler S. microRNA-451: a conditional switch controlling glioma cell proliferation and migration. Cell Cycle. 2010;9(14):2742–8.10.4161/cc.9.14.12248Search in Google Scholar PubMed

[8] Wang R, Wang ZX, Yang JS, Pan X, De W, Chen LB. MicroRNA-451 functions as a tumor suppressor in human non-small cell lung cancer by targeting ras-related protein 14 (RAB14). Oncogene. 2011;30(23):2644–58.10.1038/onc.2010.642Search in Google Scholar PubMed

[9] Oh HK, Tan AL, Das K, Ooi CH, Deng NT, Tan IB, et al. Genomic loss of miR-486 regulates tumor progression and the OLFM4 antiapoptotic factor in gastric cancer. Clin Cancer Res. 2011;17(9):2657–67.10.1158/1078-0432.CCR-10-3152Search in Google Scholar PubMed

[10] Ding W, Shi Y, Zhang H. Circular RNA circNEURL4 inhibits cell proliferation and invasion of papillary thyroid carcinoma by sponging miR-1278 and regulating LATS1 expression. Am J Transl Res. 2021;13(6):5911–27.Search in Google Scholar

[11] Lin W, Zou H, Mo J, Jin C, Jiang H, Yu C, et al. Micro1278 leads to tumor growth arrest, enhanced sensitivity to oxaliplatin and vitamin D and inhibits metastasis via KIF5B, CYP24A1, and BTG2, respectively. Front Oncol. 2021;11:637878.10.3389/fonc.2021.637878Search in Google Scholar PubMed PubMed Central

[12] Li C, Yang F, Wang R, Li W, Maskey N, Zhang W, et al. CALD1 promotes the expression of PD-L1 in bladder cancer via the JAK/STAT signaling pathway. Ann Transl Med. 2021;9(18):1441.10.21037/atm-21-4192Search in Google Scholar PubMed PubMed Central

[13] Hou Q, Tan HT, Lim KH, Lim TK, Khoo A, Tan IB, et al. Identification and functional validation of caldesmon as a potential gastric cancer metastasis-associated protein. J Proteome Res. 2013;12(2):980–90.10.1021/pr3010259Search in Google Scholar PubMed

[14] Kim KH, Yeo SG, Kim WK, Kim DY, Yeo HY, Hong JP, et al. Up-regulated expression of l-caldesmon associated with malignancy of colorectal cancer. BMC Cancer. 2012;12:601.10.1186/1471-2407-12-601Search in Google Scholar PubMed PubMed Central

[15] Zheng H, Bai Y, Wang J, Chen S, Zhang J, Zhu J, et al. Weighted Gene Co-Expression Network Analysis Identifies CALD1 as a biomarker related to M2 macrophages infiltration in stage III and IV mismatch repair-proficient colorectal carcinoma. Front Mol Biosci. 2021;8:649363.10.3389/fmolb.2021.649363Search in Google Scholar PubMed PubMed Central

[16] Liu Y, Xie S, Zhu K, Guan X, Guo L, Lu R. CALD1 is a prognostic biomarker and correlated with immune infiltrates in gastric cancers. Heliyon. 2021;7(6):e07257.10.1016/j.heliyon.2021.e07257Search in Google Scholar PubMed PubMed Central

[17] Wongchana W, Kongkavitoon P, Tangtanatakul P, Sittplangkoon C, Butta P, Chawalitpong S, et al. Notch signaling regulates the responses of lipopolysaccharide-stimulated macrophages in the presence of immune complexes. PLoS One. 2018;13(6):e0198609.10.1371/journal.pone.0198609Search in Google Scholar PubMed PubMed Central

[18] Figueiredo C, Camargo MC, Leite M, Fuentes-Pananá EM, Rabkin CS, Machado JC. Pathogenesis of gastric cancer: genetics and molecular classification. Curr Top Microbiol Immunol. 2017;400:277–304.10.1007/978-3-319-50520-6_12Search in Google Scholar PubMed PubMed Central

[19] Ma YY, Tao HQ. Microribonucleic acids and gastric cancer. Cancer Sci. 2012;103(4):620–5.10.1111/j.1349-7006.2011.02185.xSearch in Google Scholar PubMed PubMed Central

[20] Zhao Y, Wang P, Wu Q. miR-1278 sensitizes nasopharyngeal carcinoma cells to cisplatin and suppresses autophagy via targeting ATG2B. Mol Cell Probes. 2020;53:101597.10.1016/j.mcp.2020.101597Search in Google Scholar PubMed

[21] Alamoudi AA, Alnoury A, Gad H. miRNA in tumour metabolism and why could it be the preferred pathway for energy reprograming. Brief Funct Genomics. 2018;17(3):157–69.10.1093/bfgp/elx023Search in Google Scholar PubMed

[22] Waniczek D, Lorenc Z, Śnietura M, Wesecki M, Kopec A, Muc-Wierzgoń M. Tumor-associated macrophages and regulatory T cells infiltration and the clinical outcome in colorectal cancer. Arch Immunol Ther Exp (Warsz). 2017;65(5):445–54.10.1007/s00005-017-0463-9Search in Google Scholar PubMed PubMed Central

[23] Yao YB, Xiao CF, Lu JG, Wang C. Caldesmon: biochemical and clinical implications in cancer. Front Cell Dev Biol. 2021;9:634759.10.3389/fcell.2021.634759Search in Google Scholar PubMed PubMed Central

[24] Rhodes DR, Kalyana-Sundaram S, Mahavisno V, Varambally R, Yu J, Briggs BB, et al. Oncomine 3.0: genes, pathways, and networks in a collection of 18,000 cancer gene expression profiles. Neoplasia. 2007;9(2):166–80.10.1593/neo.07112Search in Google Scholar PubMed PubMed Central

[25] Zhao B, Baloch Z, Ma Y, Wan Z, Huo Y, Li F, et al. Identification of potential key genes and pathways in early-onset colorectal cancer through bioinformatics analysis. Cancer Control. 2019;26(1):1073274819831260.10.1177/1073274819831260Search in Google Scholar PubMed PubMed Central

[26] Cheng Q, Tang A, Wang Z, Fang N, Zhang Z, Zhang L, et al. CALD1 Modulates gliomas progression via facilitating tumor angiogenesis. Cancers (Basel). 2021;13(11):2705.10.3390/cancers13112705Search in Google Scholar PubMed PubMed Central

[27] Chang KP, Wang CL, Kao HK, Liang Y, Liu SC, Huang LL, et al. Overexpression of caldesmon is associated with lymph node metastasis and poorer prognosis in patients with oral cavity squamous cell carcinoma. Cancer. 2013;119(22):4003–11.10.1002/cncr.28300Search in Google Scholar PubMed

Received: 2022-03-21
Revised: 2023-03-08
Accepted: 2023-07-28
Published Online: 2023-11-18

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
https://doi.org/10.1515/med-2023-0776
Keywords for this article
miR-1278; CALD1; gastric cancer; migration
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 21.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0776/html
Scroll to top button