Home Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
Article Open Access

Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells

  • Xiang Deng EMAIL logo , Zhenmin Liu and Siqi Han
Published/Copyright: November 29, 2023
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 18 Issue 1

Abstract

To investigate the effects of cimifugin on adipogenesis and tumor necrosis factor (TNF-α)-induced insulin resistance (IR) and inflammation in 3T3-L1 adipocytes. 3T3-L1 adipocytes were treated with 3-isobutyl-1-methyl-xanthine, dexamethasone, and insulin or cimifugin and then Oil Red O staining and intracellular triglyceride content detection were performed to assess adipogenesis. Subsequently, after cimifugin treatment, TNF-α was used to induce IR and inflammation. The results showed that cimifugin reduced intracellular lipids accumulation of 3T3-L1 adipocytes. Cimifugin improved IR of 3T3-L1 adipocytes induced by TNF-α, as reflected in decreased adiponectin, GLUT-4, and IRS-1 mRNA and protein expression. Moreover, cimifugin reduced TNF-α-induced pro-inflammatory factors production and phospho-P65 expression, and MAPK pathway activation in the 3T3-L1 adipocytes. These findings suggested that cimifugin might be useful for the prevention and therapy of obesity-related IR and inflammation.

Keywords: obesity; cimifugin; adipogenesis; insulin resistance; inflammation; MAPK pathway

1 Introduction

Obesity has become a worldwide epidemic, which seriously affect children and adolescents’ physical and psychological development [1,2]. Obesity is characterized by an excess or abnormal distribution of fat content throughout the body [3]. Moreover, an elevated release of free fatty acids, reactive oxygen species, and pro-inflammatory factors within adipose tissue contribute to the development of insulin resistance (IR), thereby augmenting the susceptibility to various obesity-related diseases [4–6].

Cimifugin, a traditional Chinese medical herb also called Fang-feng, is a coumarin derivative obtained from the root of Saposhnikovia divaricata, which exhibits diverse biological properties against allergy, inflammation, and oxidative stress [7,8]. It has been reported that cimifugin inhibited inflammation and oxidative stress during psoriasis-like pathogenesis [9]. In mice with type 2 atopic dermatitis, cimifugin administration reduced epithelial cells’ allergic inflammation [10]. Cimifugin protected hepatocytes from lipotoxicity-induced death and steatosis [11]. However, few articles have reported on cimifugin’ application in the field of obesity and its lack of mechanism of action.

The elevation of tumor necrosis factor (TNF-α) in adipose tissue of individuals with obesity has been substantiated [12]. As an inflammatory factor released by adipocytes, it not only regulates cellular survival, apoptosis, and cytotoxicity, but also exhibits a strong association with the development of obesity-induced IR [13,14]. Herein, the role and possible mechanisms of cimifugin on adipogenesis and TNF-α-induced IR and inflammation were investigated in 3T3-L1 cells.

2 Materials and methods

2.1 Cell culture and differentiation

3T3-L1 preadipocytes were acquired from ATCC (Manassas, VA, USA), and cultured in Dulbecco’s modified eagle medium (DMEM) (Sigma-Aldrich, St. Louis, MO, USA) with 10% FBS and 1% penicillin/streptomycin at 37℃. To induce differentiation, 3-isobutyl-1-methyl-xanthine, dexamethasone, and insulin (MDI) induction medium was used. Preadipocytes at 2 days postconfluence were incubated with 10% FBS-DMEM supplemented with 0.5 mM 3-isobutyl-1-methyl-xanthine, 1 µM dexamethasone, and 1 µg/mL insulin (MDI medium). After 2 days, the medium was replaced with 10% FBS-DMEM containing 1 µg/mL insulin, and 10% FBS-DMEM was replenished every 2 days until mature adipocytes were obtained.

2.2 Cell counting kit-8 (CCK8) assay for cell viability

3T3-L1 adipocytes in 96-well plates (1 × 103/well) were treated with 0–200 mg/L of cimifugin (IC0410, Solarbio, Beijing, China) for 12 h. Next, 10 µL CCK8 solution (Beyotime, Shanghai, China) was used and incubated in each well for 1 h. Then, a 450 nm absorbance measurement was performed. After that, 3T3-L1 adipocytes were subjected to pretreatment with 0, 25, 50, and 100 mg/L of cimifugin for 1 h, and then exposed to 5 ng/mL TNF-α for 24 h, and then cell viability was determined as described above.

2.3 Lipid quantification

To evaluate lipid accumulation, Oil Red O staining was performed. 3T3-L1 adipocytes were treated with MDI or cimifugin (25, 50, or 100 mg/L), washed, fixed with 4% formaldehyde for 1 h, and then incubated with 3 mg/mL ORO solution for 1 h. Next, the cells were washed and pictured. Further, isopropanol was utilized to elute the dye within the cells, and the lipid accumulation was quantified by detecting 520 nm absorbance.

The intracellular triglyceride (TG) content of 3T3-L1 adipocytes was determined enzymatically using a TG kit (Wako Chemicals, Richmond, VA, USA).

2.4 Enzyme-linked immunosorbent assay (ELISA)

The culture supernatant of 3T3-L1 adipocytes after TNF-α and cimifugin treatment was collected, and the levels of Interleukin 6 (IL-6), IL-1β, and monocyte chemotactic protein-1 (MCP-1) were assessed using ELISA kits (R&D Systems, Minneapolis, MN, USA).

2.5 Quantitative PCR (qPCR)

Trizol reagent (Servicebio, Wuhan, China) was employed to isolate total RNA, and a Fastquant reverse kit (TIANGEN, Beijing, China) was utilized to synthesize cDNA from total RNA. Subsequently, ABI 7500 system (Applied Biosystems, Carlsbad, CA, USA) was used to conduct qPCR using SYBR Green method. The sequences of primers is given in Table 1. Calculation of mRNA relative levels was based on the 2−ΔΔct method, which normalized to β-actin.

Table 1

Primer sequences for qRT-PCR

Gene Forward (5′–3′) Reverse (5′–3′)
Adiponectin ACTGCAGTCTGTGGTTCTGA CATGACCGGGCAGAGCTAAT
GLUT-4 GTTCTTTCATCTTCGCCGCC TTCCCCATCTTCGGAGCCTA
IRS-1 AGAGGACCGTCAGTAGCTCA ACTGAAATGGATGCATCGTACC
β-actin TGGATCAGCAAGCAGGAGTA TCGGCCACATTGTGAACTTT

2.6 Western blot

Equal proteins from the cells separated by RIPA reagent were run on 10% SDS-PAGE. After blocking, the membranes were incubated with primary antibodies against adiponectin (ab75989, 1:1,000; Abcam), GLUT-4 (ab33780, 1:1,000; Abcam), IRS-1 (ab46800, 1:10,000; Abcam), phospho-P65 (p-P65, ab28856, 1:1,000; Abcam), P65 (ab32536, 1:1,000; Abcam), phospho-ERK (p-ERK, ab201015; Abcam), ERK (ab184699, 1:10,000; Abcam), phospho-P38 (p-P38, ab178867, 1:1,000), P38 (ab170099, 1:5,000; Abcam), phospho-JNK (p-JNK, ab124956, 1:1,000; Abcam), JNK (ab179461, 1:20,000; Abcam), and β-actin (ab8227, 1:1,000; Abcam), and later with the secondary antibody. After visualization, the protein bands were quantified using Image J software.

2.7 Statistical analysis

GraphPad Prism 8.0 software was employed to conduct statistical analysis. The results of each experiment were presented as the mean ± SD of three replicates of each analysis. Analyses of variance were carried out across multiple groups. The significance level was defined as p < 0.05.

3 Results

3.1 Cimifugin inhibits the adipogenesis of 3T3-L1 cells

The chemical formula of cimifugin is shown in Figure 1a. To explore the role of cimifugin, we first examined cimifugin’s potential toxicity on 3T3-L1 adipocytes with CCK8 assays. As shown in Figure 1b, without TNF-α, concentrations of 0–100 mg/L cimifugin had no obvious effect on 3T3-L1 adipocytes’ viability. However, cimifugin exhibited cytotoxicity by inhibiting 3T3-L1 adipocytes’ activity at concentrations up to 200 mg/L. Therefore, 3T3-L1 adipocytes were treated with three concentrations 25, 50, and 100 mg/L cimifugin in subsequent experiments.

Figure 1 Cimifugin promotes the viability and inhibits the adipogenesis of 3T3-L1 adipocytes exposed to TNF-α. (a) Chemical formula of cimifugin. (b) Cell viability was detected by CCK8 assay in 3T3-L1 adipocytes with different cimifugin concentrations (12.5, 25, 50, 100, and 200 mg/L) in the absence of TNF-α. (c) Cell viability was detected by CCK8 assay in 3T3-L1 adipocytes with different cimifugin concentrations (25, 50, and 100 mg/L) in the presence of TNF-α. (d) A treatment with MDI medium induced the differentiation of 3T3-L1 preadipocytes, while incubating cells with various concentrations (25, 50, and 100 mg/L) of CIM. Then, the formation of lipid droplets was observed by light microscopy after 3T3-L1 adipocytes stained with Oil Red O. (e) Intracellular TG content of 3T3-L1 adipocytes was determined. *p < 0.05, ***p < 0.001, compared with control group; $ p < 0.05, $$ p < 0.01, $$$ p < 0.001, compared with MDI+ group.
Figure 1

Cimifugin promotes the viability and inhibits the adipogenesis of 3T3-L1 adipocytes exposed to TNF-α. (a) Chemical formula of cimifugin. (b) Cell viability was detected by CCK8 assay in 3T3-L1 adipocytes with different cimifugin concentrations (12.5, 25, 50, 100, and 200 mg/L) in the absence of TNF-α. (c) Cell viability was detected by CCK8 assay in 3T3-L1 adipocytes with different cimifugin concentrations (25, 50, and 100 mg/L) in the presence of TNF-α. (d) A treatment with MDI medium induced the differentiation of 3T3-L1 preadipocytes, while incubating cells with various concentrations (25, 50, and 100 mg/L) of CIM. Then, the formation of lipid droplets was observed by light microscopy after 3T3-L1 adipocytes stained with Oil Red O. (e) Intracellular TG content of 3T3-L1 adipocytes was determined. *p < 0.05, ***p < 0.001, compared with control group; $ p < 0.05, $$ p < 0.01, $$$ p < 0.001, compared with MDI+ group.

A CCK8 assay was conducted with TNF-α-induced 3T3-L1 adipocytes, and the result showed that TNF-α evidently suppressed cell viability, while cimifugin (50 and 100 mg/L) treatment increased cell viability (Figure 1c). Further, Oil Red O staining of 3T3-L1 cells showed the accumulation of lipid droplets inside the cells after MDI stimulation, which was reduced by cimifugin (25, 50, and 100 mg/L) treatment (Figure 1d). Furthermore, the intracellular TG contents of 3T3-L1 cells were elevated when supplemented with MDI. However, 50 and 100 mg/L cimifugin treatment reduced the TG contents (Figure 1e). Taken together, these data suggest that cimifugin could promote cell viability in TNF-α-induced 3T3-L1 adipocytes and inhibit adipogenesis.

3.2 Cimifugin decreases 3T3-L1 adipocytes IR induced by TNF-α

Further, the effects of cimifugin on the IR of 3T3-L1 adipocytes was assessed by detecting the insulin signaling genes, such as adiponectin, GLUT-4, and IRS-1 with qRT-PCR and western blot analysis. As shown in Figure 2a–b, decrease in adiponectin, GLUT-4, and IRS-1 mRNA and protein expression in TNF-α-treated 3T3-L1 adipocytes were observed, but cimifugin pre-treatment ameliorated these alterations. These data suggest that cimifugin attenuated TNF-α-induced IR of 3T3-L adipocytes by improving insulin signaling impairment.

Figure 2 Cimifugin decreases 3T3-L1 adipocytes insulin-resistant induced by TNF-α. (a) mRNA expression of adiponectin, GLUT-4, and IRS-1 was measured by qRT-PCR. (b) Western blot was performed to detect adiponectin, GLUT-4, and IRS-1 protein expression. ***p < 0.001, compared with control group; $ p < 0.05, $$ p < 0.01, $$$ p < 0.001, compared with TNF-α group.
Figure 2

Cimifugin decreases 3T3-L1 adipocytes insulin-resistant induced by TNF-α. (a) mRNA expression of adiponectin, GLUT-4, and IRS-1 was measured by qRT-PCR. (b) Western blot was performed to detect adiponectin, GLUT-4, and IRS-1 protein expression. ***p < 0.001, compared with control group; $ p < 0.05, $$ p < 0.01, $$$ p < 0.001, compared with TNF-α group.

3.3 Cimifugin reduces TNF-α-induced inflammation in 3T3-L1 adipocytes

The results of ELISA showed that the contents of proinflammatory factors IL-6, IL-1β, and MCP-1 were significantly increased after TNF-α treatment, which were reduced by cimifugin pre-treatment (Figure 3a). Studies have indicated that NF-kB P65 signaling is involved in the response triggered by TNF-α [15,16]. Herein, the effect of cimifugin on P65 phosphorylation level was further studied. As shown in Figure 3b, cimifugin (50 and 100 mg/L) obviously inhibited the elevated expression of p-P65 induced by TNF-α. These data demonstrate that cimifugin probably suppressed the TNF-α-mediated inflammation in 3T3-L1 adipocytes by inactivating P65 pathway.

Figure 3 Cimifugin reduces TNF-α-induced inflammation in 3T3-L1 adipocytes. (a) IL-6, IL-1β, and MCP-1 levels were measured by ELISA. (b) Expressions of P65 and p-P65 were determined by western blot. ***p < 0.001, compared with control group; $ p < 0.05, $$$ p < 0.001, compared with TNF-α group.
Figure 3

Cimifugin reduces TNF-α-induced inflammation in 3T3-L1 adipocytes. (a) IL-6, IL-1β, and MCP-1 levels were measured by ELISA. (b) Expressions of P65 and p-P65 were determined by western blot. ***p < 0.001, compared with control group; $ p < 0.05, $$$ p < 0.001, compared with TNF-α group.

3.4 Cimifugin inhibited the MAPKs pathway

Previous studies illustrated that MAPKs activation play a pivotal role in TNF-α-induced adipogenesis and inflammation [17–19]. To explore whether cimifugin had an influence on MAPKs pathway, the phosphorylation levels of ERK, P38, and JNK were assayed by western blot. As a results, TNF-α notably increased the levels of ERK, P38, and JNK phosphorylation. However, pretreatment with cimifugin obviously reduced these increases (Figure 4). These data suggest that cimifugin may exert its biological function through regulating the MAPKs pathway.

Figure 4 Cimifugin inhibited the MAPKs pathway. Representative blots (left) and quantitative results (right) regarding the protein levels of p-ERK, ERK, p-P38, P38, p-JNK, and JNK detected by western blot. ***p < 0.001, compared with control group; $ p < 0.05, $$$ p < 0.001, compared with TNF-α group.
Figure 4

Cimifugin inhibited the MAPKs pathway. Representative blots (left) and quantitative results (right) regarding the protein levels of p-ERK, ERK, p-P38, P38, p-JNK, and JNK detected by western blot. ***p < 0.001, compared with control group; $ p < 0.05, $$$ p < 0.001, compared with TNF-α group.

4 Discussion

The data of this study, for the first time, confirmed that cimifugin could suppress adipogenesis in 3T3-L1 cells. Furthermore, cimifugin attenuated IR and inflammation of 3T3-L1 adipocytes induced by TNF-α. The results also showed that cimifugin inhibited MAPK pathway activation. Thus, these data suggest that cimifugin could reduce obesity-related inflammation and ameliorate obesity-related IR.

IR is the most common metabolic dysfunction related to obesity [20]. The development of IR caused by obesity is connected to the hormones and cytokines produced by adipocytes, including the rise of free fatty acids, TNF, leptin, resistin, and the inadequacy of adiponectin [5,21]. Research has demonstrated that adipocytes’ secretion of TNF-α can prompt the phosphorylation of IRS-1 serine and reduce GLUT-4 expression, resulting in disruptions in insulin-regulated glucose metabolism and the onset of obesity-related IR [22–24]. Therefore, TNF-α is often used to establish IR adipocyte models [17,25,26]. In the present study, 3T3-L1 preadipocytes were induced by MDI to differentiate into adipocytes, and the results found that cimifugin suppressed accumulation of lipids in 3T3-L1 cells. Next, 3T3-L1 adipocytes were treated with TNF-α to induce IR, and the results of western blot indicated that cimifugin could partly reverse the decreased expression of adiponectin, GLUT-4, and IRS-1 TNF-α-treated 3T3-L1 adipocytes.

Studies have suggested that higher levels of inflammatory cell infiltration are present in obese patients, such as TNF-α, IL-6, and MCP-1 [27,28]. These cytokines not only stimulated local inflammation of fat tissues but also caused IR by perturbing the insulin signal transduction pathways [29,30]. A study has reported that cimifugin inhibits LPS-induced release of inflammatory factors and MAPK/NF-kB pathways activation in RAW264.7 cells [31]. Another study confirmed that cimifugin reduced the production of inflammatory factors through inhibiting the NF-kB/MAPK pathway relieving psoriasis [9]. Similarly, our data indicated that cimifugin decreased the levels of pro-inflammatory factors and suppressed P65 phosphorylation expression in TNF-α-stimulated 3T3-L1 adipocytes. Moreover, we also found that cimifugin inhibited TNF-α-caused MAPK pathway activation in 3T3-L1 adipocytes, which reflected in inhibiting ERK, P38, and JNK phosphorylation.

In conclusion, the present study substantiated that cimifugin has the bioactivity of inhibiting adipogenesis and improving TNF-α-induced IR and inflammation in 3T3-L1 adipocytes, and the inhibition of NF-kB/MAPK pathways may possibly explain these functions. These results provided evidence for cimifugin as a medication for preventing and treating obesity and obesity-related IR.

tel: +86-028-82712564

Acknowledgements

Not applicable.

  1. Funding information: This work was supported by the Scientific Research Fund of Chengdu Fifth People’s Hospital (Grant no. KYJJ2021-036).

  2. Author contributions: Xiang Deng designed the study, completed the experiment, and supervised the data collection; Zhenmin Liu analyzed the data and interpreted the data; Siqi Han prepared the manuscript for publication and reviewed the draft of the manuscript. All authors have read and approved the manuscript.

  3. Conflict of interest: The authors state that there are no conflicts of interest to disclose.

  4. Data availability statement: All data generated or analyzed during this study are included in this published article. The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

References

[1] Litwin M, Kułaga Z. Obesity, metabolic syndrome, and primary hypertension. Pediatr Nephrol. 2021;36(4):825–37. 10.1007/s00467-020-04579-3.Search in Google Scholar PubMed PubMed Central

[2] Caballero B. Humans against obesity: who will win. Adv Nutr. 2019;10(suppl_1):S4–9. 10.1093/advances/nmy055.Search in Google Scholar PubMed PubMed Central

[3] Piché ME, Tchernof A, Després JP. Obesity phenotypes, diabetes, and cardiovascular diseases. Circ Res. 2020;126(11):1477–500. 10.1161/circresaha.120.316101.Search in Google Scholar PubMed

[4] Guo X, Cheng L, Yang S, Che H. Pro-inflammatory immunological effects of adipose tissue and risk of food allergy in obesity: focus on immunological mechanisms. Allergol Immunopathol (Madr). 2020;48(3):306–12. 10.1016/j.aller.2019.06.004.Search in Google Scholar PubMed

[5] Al-Sulaiti H, Diboun I, Agha MV, Mohamed FFS, Atkin S, Dömling AS, et al. Metabolic signature of obesity-associated insulin resistance and type 2 diabetes. J Transl Med. 2019;17(1):348. 10.1186/s12967-019-2096-8.Search in Google Scholar PubMed PubMed Central

[6] Ahmed B, Sultana R, Greene MW. Adipose tissue and insulin resistance in obese. Biomed Pharmacother. 2021;137:111315. 10.1016/j.biopha.2021.111315.Search in Google Scholar PubMed

[7] Duan J, Hu X, Li T, Wu G, Dou P, Ouyang Z. Cimifugin suppresses NF-κB signaling to prevent osteoclastogenesis and periprosthetic osteolysis. Front Pharmacol. 2021;12:724256. 10.3389/fphar.2021.724256.Search in Google Scholar PubMed PubMed Central

[8] Yao L, Wang S, Wei P, Bao K, Yuan W, Wang X, et al. Huangqi-Fangfeng protects against allergic airway remodeling through inhibiting epithelial–mesenchymal transition process in mice via regulating epithelial derived TGF-β1. Phytomedicine. 2019;64:153076. 10.1016/j.phymed.2019.153076.Search in Google Scholar PubMed

[9] Liu A, Zhao W, Zhang B, Tu Y, Wang Q, Li J. Cimifugin ameliorates imiquimod-induced psoriasis by inhibiting oxidative stress and inflammation via NF-κB/MAPK pathway. Biosci Rep. 2020;40(6):BSR20200471. 10.1042/bsr20200471.Search in Google Scholar PubMed PubMed Central

[10] Gu X, Chen Y, Qian P, He T, Wu Y, Lin W, et al. Cimifugin suppresses type 2 airway inflammation by binding to SPR and regulating its protein expression in a non-enzymatic manner. Phytomedicine. 2023;111:154657. 10.1016/j.phymed.2023.154657.Search in Google Scholar PubMed

[11] Yang W, Zhu L, Lai S, Ding Q, Xu T, Guo R, et al. Cimifugin ameliorates lipotoxicity-induced hepatocyte damage and steatosis through TLR4/p38 MAPK- and SIRT1-involved pathways. Oxid Med Cell Longev. 2022;2022:4557532. 10.1155/2022/4557532.Search in Google Scholar PubMed PubMed Central

[12] Virdis A, Colucci R, Bernardini N, Blandizzi C, Taddei S, Masi S. Microvascular endothelial dysfunction in human obesity: role of TNF-α. J Clin Endocrinol Metab. 2019;104(2):341–8. 10.1210/jc.2018-00512.Search in Google Scholar PubMed

[13] Alzamil H. Elevated serum TNF-α is related to obesity in type 2 diabetes mellitus and is associated with glycemic control and insulin resistance. J Obes. 2020;2020:5076858. 10.1155/2020/5076858.Search in Google Scholar PubMed PubMed Central

[14] Ezquerro S, Mocha F, Frühbeck G, Guzmán-Ruiz R, Valentí V, Mugueta C, et al. Ghrelin reduces TNF-α-induced human hepatocyte apoptosis, autophagy, and pyroptosis: role in obesity-associated NAFLD. J Clin Endocrinol Metab. 2019;104(1):21–37. 10.1210/jc.2018-01171.Search in Google Scholar PubMed

[15] Chen T, Zhang X, Zhu G, Liu H, Chen J, Wang Y, et al. Quercetin inhibits TNF-α induced HUVECs apoptosis and inflammation via downregulating NF-kB and AP-1 signaling pathway in vitro. Medicine (Baltimore). 2020;99(38):e22241. 10.1097/md.0000000000022241.Search in Google Scholar

[16] Muzurović E, Cojić M, Stanković Z, Janež A. Epicardial adipocyte-derived TNF-α modulates local inflammation in patients with advanced coronary artery disease. Curr Vasc Pharmacol. 2022;20(1):94–5. 10.2174/157016112001211228145754.Search in Google Scholar PubMed

[17] Peng J, Li K, Zhu W, Nie R, Wang R, Li C. Penta-O-galloyl-β-d-glucose, a hydrolysable tannin from Radix Paeoniae Alba, inhibits adipogenesis and TNF-α-mediated inflammation in 3T3-L1 cells. Chem Biol Interact. 2019;302:156–63. 10.1016/j.cbi.2019.01.037.Search in Google Scholar PubMed

[18] Lim SH, Lee HS, Han HK, Choi CI. Saikosaponin A and D inhibit adipogenesis via the AMPK and MAPK signaling pathways in 3T3-L1 adipocytes. Int J Mol Sci. 2021;22(21):11409. 10.3390/ijms222111409.Search in Google Scholar PubMed PubMed Central

[19] Yu W, Chen CZ, Peng Y, Li Z, Gao Y, Liang S, et al. KRAS affects adipogenic differentiation by regulating autophagy and MAPK activation in 3T3-L1 and C2C12 cells. Int J Mol Sci. 2021;22(24):13630. 10.3390/ijms222413630.Search in Google Scholar PubMed PubMed Central

[20] Yaribeygi H, Maleki M, Sathyapalan T, Jamialahmadi T, Sahebkar A. Obesity and insulin resistance: a review of molecular interactions. Curr Mol Med. 2021;21(3):182–93. 10.2174/1566524020666200812221527.Search in Google Scholar PubMed

[21] Ye J. Mechanism of insulin resistance in obesity: a role of ATP. Front Med. 2021;15(3):372–82. 10.1007/s11684-021-0862-5.Search in Google Scholar PubMed

[22] Yaribeygi H, Farrokhi FR, Butler AE, Sahebkar A. Insulin resistance: review of the underlying molecular mechanisms. J Cell Physiol. 2019;234(6):8152–61. 10.1002/jcp.27603.Search in Google Scholar PubMed

[23] Jayaraman S, Devarajan N, Rajagopal P, Babu S, Ganesan SK, Veeraraghavan VP, et al. β-sitosterol circumvents obesity induced inflammation and insulin resistance by down-regulating IKKβ/NF-κB and JNK signaling pathway in adipocytes of type 2 diabetic rats. Molecules. 2021;26(7):2101. 10.3390/molecules26072101.Search in Google Scholar PubMed PubMed Central

[24] Lee HA, Lee JK, Han JS. Betulinic acid improves TNF-α-induced insulin resistance by inhibiting negative regulator of insulin signalling and inflammation-activated protein kinase in 3T3-L1 adipocytes. Arch Physiol Biochem. 2022;1–8. 10.1080/13813455.2022.2120503.Search in Google Scholar PubMed

[25] Lin Y, Hu Y, Hu X, Yang L, Chen X, Li Q, et al. Ginsenoside Rb2 improves insulin resistance by inhibiting adipocyte pyroptosis. Adipocyte. 2020;9(1):302–12. 10.1080/21623945.2020.1778826.Search in Google Scholar PubMed PubMed Central

[26] Anusree SS, Sindhu G, Preetha Rani MR, Raghu KG. Insulin resistance in 3T3-L1 adipocytes by TNF-α is improved by punicic acid through upregulation of insulin signalling pathway and endocrine function, and downregulation of proinflammatory cytokines. Biochimie. 2018;146:79–86. 10.1016/j.biochi.2017.11.014.Search in Google Scholar PubMed

[27] Kawai T, Autieri MV, Scalia R. Adipose tissue inflammation and metabolic dysfunction in obesity. Am J Physiol Cell Physiol. 2021;320(3):C375–91. 10.1152/ajpcell.00379.2020.Search in Google Scholar PubMed PubMed Central

[28] Kumar DP, Koka S, Li C, Rajagopal S. Inflammatory mediators in obesity. Mediators Inflamm. 2019;2019:9481819. 10.1155/2019/9481819.Search in Google Scholar PubMed PubMed Central

[29] Ben J, Jiang B, Wang D, Liu Q, Zhang Y, Qi Y, et al. Major vault protein suppresses obesity and atherosclerosis through inhibiting IKK-NF-κB signaling mediated inflammation. Nat Commun. 2019;10(1):1801. 10.1038/s41467-019-09588-x.Search in Google Scholar PubMed PubMed Central

[30] Ying W, Fu W, Lee YS, Olefsky JM. The role of macrophages in obesity-associated islet inflammation and β-cell abnormalities. Nat Rev Endocrinol. 2020;16(2):81–90. 10.1038/s41574-019-0286-3.Search in Google Scholar PubMed PubMed Central

[31] Han B, Dai Y, Wu H, Zhang Y, Wan L, Zhao J, et al. Cimifugin inhibits inflammatory responses of RAW264.7 cells induced by lipopolysaccharide. Med Sci Monit. 2019;25:409–17. 10.12659/msm.912042.Search in Google Scholar
Received: 2023-08-08
Revised: 2023-11-05
Accepted: 2023-11-06
Published Online: 2023-11-29

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
https://doi.org/10.1515/med-2023-0855
Keywords for this article
obesity; cimifugin; adipogenesis; insulin resistance; inflammation; MAPK pathway
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 8.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0855/html
Scroll to top button