Home Medicine Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
Article Open Access

Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice

  • Shuang Liu , Min Liu , Jinnan Zhong , Shi Chen , Ziming Wang , Xiaoyan Gao and Fajiu Li EMAIL logo
Published/Copyright: October 17, 2023

Abstract

We elucidated the effect of S100A4 on airway remodeling by regulating airway inflammation and epithelial–mesenchymal transition (EMT) in mouse models of asthma. Asthmatic mouse models were established by sensitization and challenged with ovalbumin (OVA). Anti-S100A4 antibody or control IgG antibody was administered daily before the OVA challenge. After the last challenge, airway inflammation and airway hyperresponsiveness were measured; lung tissues and bronchoalveolar lavage fluid (BALF) were harvested. Lung tissue sections were stained and evaluated for pathological changes. Levels of inflammatory cytokines were measured using ELISA. Levels of S100A4 and EMT markers were determined via western blotting analysis. Human bronchial epithelial cells were stimulated with 100 mg/mL house dust mites (HDMs) to evaluate the effect of S100A4 downregulation on EMT in vitro. S100A4 was increased in lung tissues and BALF from asthmatic mice. The asthmatic mice presented airway hyperresponsiveness, airway inflammation, and airway remodeling. After anti-S100A4 antibody administration, pathophysiological signs, including airway hyperresponsiveness and increased infiltration of inflammatory cells, were attenuated. Additionally, anti-S100A4 administration downregulated vimentin and α-SMA expression and upregulated E-cadherin expression in OVA-challenged mice. S100A4 downregulation also inhibited EMT process in HDM-stimulated 16HBE cells. Anti-S100A4 antibody administration alters airway remodeling by preventing EMT in mouse models of asthma.

1 Introduction

Asthma is a common airway condition characterized by reversible airway obstruction, irreversible airway remodeling, and airway inflammation [1,2]. It is a heterogeneous disorder involving different endotypes and phenotypes [3]. Airway remodeling induced by chronic inflammation is an important characteristic in the pathogenesis of asthma, characterized by subepithelial collagen, goblet cell hyperplasia, and smooth muscle hyperplasia, which is considered to be responsible for persistent airflow obstruction and irreversible airway hyperresponsiveness [4,5]. Preventing accelerated airway remodeling is a critical treatment target of asthma due to the minimal effects of current treatments on airway remodeling [6]. Persistent chronic airway inflammation in asthma induces the conversion of epithelial cells to active mesothelial cells, which is the pathological manifestation of epithelial–mesenchymal transition (EMT). This suggests that EMT is implicated in the progression of subepithelial fibrosis and airway remodeling in asthma [7]. During the process of EMT, epithelial marker E-cadherin is downregulated and mesenchymal marker such as α-SMA and vimentin is upregulated, ultimately resulting in impaired airway barrier function and aggravated airway stenosis [8,9]. Therefore, the possible mechanisms related to the link between airway remodeling and EMT need to be fully clarified.

As a member of the S100 calcium-binding family [10], S100A4 is widely expressed in various types of cells, including macrophages, endothelial cells, lymphocytes, neutrophils, fibroblasts, and smooth muscle cells [11,12]. S100A4 interacts with multiple intracellular targets that regulate cell survival, differentiation, growth, and cytoskeletal dynamics [11]. The S100 proteins including S100A4 can be secreted extracellularly by a range of cell types to affect cellular activities in an autocrine or paracrine manner [11,13]. Current studies on S100A4 have mainly focused on its role in regulating tumorigenesis and cancer metastasis [10]. However, emerging evidence has shown that S100A4, as a candidate gene in allergic condition, is involved in pathological inflammatory conditions, such as experimental autoimmune encephalomyelitis, fibrotic disease, cardiovascular disease, and rheumatoid arthritis [1417]. S100A4 was found to be elevated in the nasal mucus of allergic individuals [18] and in the sputum of asthmatic patients [19]. High level of S100A4 was found in the lung of mouse models with allergic asthma; additionally, the administration of S100A4-neutralizing antibodies in mice decreased inflammatory cell infiltration and accumulation in the lung and bronchoalveolar lavage fluid (BALF) [19]. Recent reports have indicated that S100A4 activates proinflammatory pathways in airway smooth muscle tissues [20], and it is critical for mast cell activation in mouse models of allergic asthma [21]. Moreover, evidence shows that the S100A4-mediated EMT displays a key role in tumor development and non-tumor pathophysiology [16]. Downregulation of S100A4 attenuates cardiac fibrosis by inhibiting extracellular matrix deposition and α-SMA expression [22,23]. However, whether S100A4 mediates the EMT in asthma remains unclear.

Here, we hypothesized that S100A4 affects airway remodeling by regulating EMT process. To determine this, we used a mouse model of asthma and 16HBE cell line to analyze the effect of S100A4 in asthma. We applied anti‐S100A4 antibody administration in vivo or transfection technology to silence S100A4 in vitro to observe changes in EMT markers.

2 Materials and methods

2.1 Animals

Forty male BALB/c mice between 6 and 8 weeks of age (25 ± 2 g) were used in this research. The animals were supplied by Vital River Co. Ltd. (Beijing, China). All mice were healthy, and they were maintained under standard laboratory conditions in a 12 h light/dark cycle at 20 ± 3°C. They were fed with commercial pellets and had free access to water. Prior to the experiment, they were quarantined for 7 days to be acclimatized. Efforts were made to alleviate any suffering of the animals. All experimental protocols were conducted following the institution’s ethical guidelines and were approved by the Ethics Commission of Affiliated Hospital of Jianghan University (Hubei, China).

2.2 Asthma sensitization and challenge with ovalbumin (OVA)

Forty male BALB/c mice were assigned into four groups: control, OVA, OVA + isotype antibody, and OVA + anti-S100A4, with ten animals for each group. The asthma model was established as described previously, with minor modifications [24]. Briefly, on days 0, 7, and 14, animals were intraperitoneally sensitized with 200 µl of solution (10 µg OVA emulsified in 1 mg aluminum hydroxide) (Sigma, MO, USA). Between days 21 and 28, animals were challenged with 5% OVA for 30 min daily. Mice in the control received phosphate-buffered saline (PBS) for sensitization and stimulation. Mice were injected intraperitoneally with 100 µg/body of a neutralizing mouse monoclonal IgG1 antibody specific for S100A4 (clone 6B12) or with the corresponding mouse monoclonal IgG1 isotype control (clone MOPC-21, BP0083, BioXcell, NH, USA) at the same concentration for 30 min before the OVA challenge. Isolation and characterization of 6B12 anti-S100A4 mouse monoclonal antibody were described as reported [25]. The schematic experimental protocol for drug administration and timeline is shown in Figure 1a.

Figure 1 
                  High expression levels of S100A4 in OVA‐induced asthmatic mice. (a) The schematic experimental protocol for drug administration and timeline. (b) Immunohistochemistry analysis of S100A4 in lung tissue sections from OVA‐induced murine asthmatic models. (c) RT-qPCR and (d and e) western blotting analyses of S100A4 expression in lung tissues from OVA mice and PBS control mice. N = 10 for each group. **
                     p < 0.1.
Figure 1

High expression levels of S100A4 in OVA‐induced asthmatic mice. (a) The schematic experimental protocol for drug administration and timeline. (b) Immunohistochemistry analysis of S100A4 in lung tissue sections from OVA‐induced murine asthmatic models. (c) RT-qPCR and (d and e) western blotting analyses of S100A4 expression in lung tissues from OVA mice and PBS control mice. N = 10 for each group. ** p < 0.1.

2.3 Hyperresponsiveness measurement

Twenty‐four hours following the final OVA challenge, airway hyperresponsiveness in response to acetylcholine chloride (3.125, 6.25, 12.5, and 25 mg/mL; Sigma) was detected using a whole-body plethysmography (Buxco Electronics, NY, USA). The detailed procedure was described previously [26].

2.4 BALF collection and cell count

Twenty‐four hours following the final OVA challenge, the mice were sacrificed. PBS (100 mL) was used to wash the pulmonary circulation. To collect the BALF, right bronchus was ligated, and left bronchus was flushed three times with 3 mL of PBS via a catheter; the fluid recovery rate was 80%. Cell suspension was centrifuged at 500 g for 10 min at 4°C. Cell pellet was resuspended in 1 mL of normal saline. A total number of cells in 0.05 mL BALF were counted with a hemocytometer (Baxter Diagnostics, USA). The inflammatory cells were dried and stained with Wright-Giemsa (Solarbio, Beijing, China) following the manufacturer’s instructions and were counted based on conventional morphological criteria. Differential cell counts were obtained by counting at least 400 cells per slide. All counts were conducted with blind methods. The remaining BALF supernatants were maintained at −80°C for next use.

2.5 ELISA

The concentrations of IL-4, IL-13, TNF-α, and IL-1β in BALF were measured with mouse ELISA kits (R&D Systems, MN, USA) following the manufacturer’s instructions. The optical density for the ELISA was detected using a microplate reader.

2.6 Histological staining

Lung tissues were fixed and embedded in paraffin. Then, the blocks were cut into 5 μm-thick sections and subjected to hematoxylin–eosin (H&E) staining according to routine procedures. The severity degree of inflammation was graded referring to previously described scoring criteria [27]. Staining analyses were performed from five randomly selected fields (200× magnification).

2.7 RT-qPCR

Total RNA was extracted from lung sections using TRIzol (Invitrogen, USA). The optical density was measured by a spectrophotometer (Bio-Rad, USA) at 260 and 280 nm. RNA was reverse transcribed using commercially reverse transcription kits (Qiagen, Hilden, Germany). Real‐time PCR was performed using ABI PRISM 7500 Real-time PCR System (ABI, CA, USA) and SYBR Premix EX Taq (Takara, Japan). S100A4 expression was determined using the threshold cycle value normalized against GAPDH expression. The used primer sequences are as follows: S100A4: 5′‐ATTTCTGCCAGAGCCGCTTCTACT‐3′ (forward) and 5′‐CAGTTTGTATCCGGCAAACTAGTA‐3′ (reverse), and GAPDH: 5′‐AGGTCGGTGTGAACGGATTTG‐3′ (forward) and 5′‐TGTAGACCATGTAGTTGAGGTCA‐3′ (reverse).

2.8 Cell treatment and transfection

Human bronchial epithelial cell line 16HBE (ATCC, USA) was cultured in RPMI 1640 medium (Invitrogen) containing 8% FBS (Gibco, USA). Cells were maintained at 37°C in a humid atmosphere containing 5% CO2, and cell growth was observed under a microscope. When cells reached 90% confluence, they were subjected to trypsin digestion. Cells were treated with 100 mg/mL house dust mites (HDMs; STALLERGENES GREER, Lenoir, NC, USA) for 24 h. 16HBE cells were transfected with shRNAs to generate the negative control shRNA (sh-NC) group and S100A4-knockdown (sh-S100A4; GeneChem, Shanghai, China) group. Transfection was performed using Lipofectamine 3000 (Invitrogen) following the manufacturer’s instructions.

2.9 Western blotting

Total proteins from cells or tissues were extracted as previously described [28]. Bradford methods (Bio-Rad) were applied to determine protein concentrations. The samples were separated by 8, 10, or 12% SDS-PAGE and electro-transferred to PVDF membranes. After blocking with 5% skim milk for 1.5 h, the membranes were probed with S100A4 (1:1,000; 13018), E-cadherin (1:1,000; 3195), α-SMA (1:1,000; 19245), and vimentin (1:1,000; 5741) overnight at 4°C with GAPDH (1:1,000; 5174) as a loading control. All antibodies are supplied by Cell Signaling Technology. After incubation with corresponding secondary antibodies for 1.5 h at room temperature, an enhanced chemiluminescence reagent (Santa Cruz, CA, USA) was used for color development.

2.10 Statistical analysis

All data were processed using SPSS 18.0 (SPSS Inc., Chicago, USA) and are expressed as mean ± standard deviation. Pairwise comparisons were performed using Student’s independent t-test and comparisons among multiple groups using one-way ANOVA. The value of p < 0.05 indicated statistical significance.

3 Results

3.1 Increased expression levels of S100A4 in OVA‐induced asthmatic mice

Immunohistochemistry analysis showed weak S100A4 expression in a number of inflammatory cells including macrophages and granulocytes in mice from the control group. However, mice in the asthma mouse model group had moderate expression levels of S100A4 in inflammatory and vascular smooth muscle cells, with prominent S100A4 expression in granulocytes. In addition, S100A4 was weakly stained in a number of epithelial cells in asthmatic mice. Compared to control mice, the number of positive stained S100A4 cells was significantly increased in asthmatic mice (Figure 1b). Additionally, both mRNA and protein levels of S100A4 were notably higher in the lung of asthmatic mice than those of control mice (Figure 1c–e). Forty male BALB/c mice were assigned into four groups: control, OVA, OVA + isotype antibody, and OVA + anti-S100A4, with ten animals for each group.

3.2 Treatment with anti‐S100A4 inhibits airway hyperresponsiveness and inflammation in OVA-challenged mouse models

ELISA showed that OVA-challenged mice had a higher level of S100A4 in BALF than control mice. Anti‐S100A4 administration markedly reduced S100A4 expression level in BALF (Figure 2a). We evaluated the effect of anti-S100A4 on airway hyperresponsiveness in response to acetylcholine chloride. Baseline airway resistance had no significant differences among all groups. Acetylcholine chloride at doses increasing progressively significantly increased lung resistance in OVA mice compared to control mice. However, anti‐S100A4 administration resulted in a marked reduction of lung resistance in OVA mice (Figure 2b), suggesting that anti‐S100A4 inhibited airway hyperresponsiveness. Following the OVA challenge, the increased number of total cells, as well as neutrophils, eosinophils, and lymphocytes in BALF, was found (Figure 2c). ELISA showed upregulated levels of TNF-α, IL-1β, IL-4, and IL-13 in BALF induced by OVA (Figure 2d). However, the number of inflammatory cells and inflammatory cytokines was significantly reduced after anti‐S100A4 administration (Figure 2c and d). This suggested that anti‐S100A4 suppressed airway inflammation in OVA mice.

Figure 2 
                  Treatment with anti‐S100A4 inhibits airway hyperresponsiveness and inflammation in BALF from OVA-challenged mouse models. Forty male BALB/c mice were assigned into four groups: control, OVA, OVA + isotype antibody, and OVA + anti-S100A4. (a) ELISA of S100A4 levels in BALF. (b) Airway hyperresponsiveness in each group. (c) The number of total inflammatory cells and cellular components in BALF. (d) ELISA of TNF-α, IL-1β, IL-4, and IL-13 levels in BALF. N = 10 for each group. **
                     p < 0.1 vs the control group; ##
                     p < 0.1 vs the OVA group.
Figure 2

Treatment with anti‐S100A4 inhibits airway hyperresponsiveness and inflammation in BALF from OVA-challenged mouse models. Forty male BALB/c mice were assigned into four groups: control, OVA, OVA + isotype antibody, and OVA + anti-S100A4. (a) ELISA of S100A4 levels in BALF. (b) Airway hyperresponsiveness in each group. (c) The number of total inflammatory cells and cellular components in BALF. (d) ELISA of TNF-α, IL-1β, IL-4, and IL-13 levels in BALF. N = 10 for each group. ** p < 0.1 vs the control group; ## p < 0.1 vs the OVA group.

3.3 Treatment with anti‐S100A4 alleviates airway inflammation in OVA-challenged mouse models

Airway inflammation was further assessed using histopathological analyses of lung tissues. H&E staining showed that OVA-challenged mice presented massive peribronchial and perivascular infiltration of inflammatory cells, accompanied by increased inflammation score compared with control mice. However, anti‐S100A4 administration decreased infiltration of inflammatory cells and inflammation score caused by OVA (Figure 3a and b).

Figure 3 
                  Treatment with anti‐S100A4 alleviates airway inflammation in OVA-challenged mouse models. (a) Infiltration of inflammatory cells in lung tissues was evaluated using H&E staining. Magnification: 200 ×. Scale bar: 50 µm. (b) Inflammation score. N = 10 for each group. **
                     p < 0.1 vs the control group; ##
                     p < 0.1 vs the OVA group.
Figure 3

Treatment with anti‐S100A4 alleviates airway inflammation in OVA-challenged mouse models. (a) Infiltration of inflammatory cells in lung tissues was evaluated using H&E staining. Magnification: 200 ×. Scale bar: 50 µm. (b) Inflammation score. N = 10 for each group. ** p < 0.1 vs the control group; ## p < 0.1 vs the OVA group.

3.4 Treatment with anti‐S100A4 inhibits EMT in asthmatic mice

EMT plays a key role in airway narrowing and obstruction caused by airway remodeling. As shown by western blotting in Figure 4a and b, a significant reduction of the E-cadherin level and an elevation of the α-SMA and vimentin levels were detected in the lung of OVA mice. Following administration of anti-S100A4, the E-cadherin level was upregulated, while the α-SMA and vimentin levels were downregulated, suggesting that the OVA-induced EMT process was inhibited by anti-S100A4.

Figure 4 
                  Treatment with anti‐S100A4 inhibits EMT in asthmatic mice. (a and b) Western blotting analysis of E‑cadherin, α-SMA, and vimentin in lung tissues. N = 10 for each group. **
                     p < 0.1 vs the control group; ##
                     p < 0.1 vs the OVA group.
Figure 4

Treatment with anti‐S100A4 inhibits EMT in asthmatic mice. (a and b) Western blotting analysis of E‑cadherin, α-SMA, and vimentin in lung tissues. N = 10 for each group. ** p < 0.1 vs the control group; ## p < 0.1 vs the OVA group.

3.5 S100A4 downregulation inhibits EMT in HDM-stimulated 16HBE cells

The in vitro effect of S100A4 on EMT was evaluated in HDM-stimulated 16HBE cells. After 16HBE cells were stimulated with 100 ng/mL HDM for 24, 48, and 72 h, western blotting examined the S100A4 level, showing that the S100A4 level had the most significant upregulation at 48 h (Figure 5a and b). 16HBE cells were transfected with sh-NC or sh-S100A4. The protein expression level of S100A4 was lower in cells transfected with sh-S100A4#1 than those with sh-S100A4#2 (Figure 5c and d); therefore, sh-S100A4#1 was applied in subsequent experiments. Western blotting showed that the E-cadherin level was downregulated, while the α-SMA and vimentin levels were upregulated in HDM-stimulated 16HBE cells. As expected, transfection of sh-S100A4#1 markedly upregulated E-cadherin level and downregulated α-SMA and vimentin levels in HDM-stimulated 16HBE cells (Figure 5e and F), suggesting that S100A4 downregulation inhibited EMT in HDM-stimulated 16HBE cells.

Figure 5 
                  S100A4 downregulation inhibits EMT in HDM-stimulated 16HBE cells. (a and b) Western blotting analysis of S100A4 level in 16HBE cells after treatment with 100 ng/mL HDM for 24, 48, and 72 h. (c and d) Western blotting analysis of S100A4 level in 16HBE cells transfected with sh-S100A4 or control. (e and f) Western blotting of E‑cadherin, α-SMA, vimentin, and S100A4 levels in HDM-stimulated 16HBE cells transfected with sh-S100A4 or control. *
                     p < 0.5, **
                     p < 0.1 vs the control or sh-NC group; ##
                     p < 0.1 vs the HDM group.
Figure 5

S100A4 downregulation inhibits EMT in HDM-stimulated 16HBE cells. (a and b) Western blotting analysis of S100A4 level in 16HBE cells after treatment with 100 ng/mL HDM for 24, 48, and 72 h. (c and d) Western blotting analysis of S100A4 level in 16HBE cells transfected with sh-S100A4 or control. (e and f) Western blotting of E‑cadherin, α-SMA, vimentin, and S100A4 levels in HDM-stimulated 16HBE cells transfected with sh-S100A4 or control. * p < 0.5, ** p < 0.1 vs the control or sh-NC group; ## p < 0.1 vs the HDM group.

4 Discussion

Asthma is a chronic airway condition with complex predisposing factors and pathogenesis. Airway remodeling in asthmatic patients is intractable under the current treatment. Reduction of epithelial proteins and elevation of mesenchymal proteins are pathological manifestations of EMT, which occur during the process of airway remodeling. In this study, BALB/c mice were subjected to OVA sanitization to establish animal models of asthma. Based on this model, airway hyperreactivity, airway inflammation, and EMT characteristics were examined in asthmatic mice. We detected elevated levels of S100A4 in the lung and BALF of OVA-challenged mice, suggesting that S100A4 may be associated with the pathogenesis of asthma. The treatment effect of S100A4 on OVA-induced asthma was investigated.

S100A4 has been implicated in the development of several lung diseases. Expression of S100A4 was significantly increased in a dose‐ and time‐dependent manner in lung tissues of bleomycin‐induced murine models for pulmonary fibrosis and localized mainly in lung fibroblasts [29]. S100A4, used as a marker for EMT, stained weakly in a number of biopsy epithelial cells from patients with stable lung allografts [15]. S100A4 mRNA and protein expression were elevated in pulmonary arteries of mice treated with hypoxia. S100A4 protein was specifically localized in vascular smooth muscle cells and fibroblasts as demonstrated by immunohistochemistry analysis [30]. It is unclear what types of cells in the lungs are responsible for S100A4 secretion; however, cell types like pulmonary artery smooth muscle cells [31], fibroblasts [30], and several cancer cells [32] have been identified to secrete S100A4. S100A4 immuno‐staining in lung tissues in our study showed that S100A4‐stained cells were mainly infiltrating inflammatory cells, especially granulocyte and vascular smooth muscle cells. Furthermore, the number of S100A4‐positive cells in the interstitial and peri‐vascular regions was significantly increased in OVA‐induced asthmatic mice compared to control mice. This suggested that inflammatory cells, especially granulocytes and vascular smooth muscle cells, are potential sources of S100A4 in the airway and lungs. However, further studies need to be performed to confirm the cell types responsible for S100A4 secretion and determine the mechanism underlying the secretion process.

In this study, OVA-challenged mice exhibited asthma-like symptoms. Airway hyperreactivity is a main feature of asthma. Acetylcholine chloride at doses increasing progressively significantly increased lung resistance in OVA mice compared to control mice, suggesting that airway hyperreactivity occurred in OVA-challenged mice. Airway inflammation is considered a key trigger for airway hyperreactivity. Proinflammatory cytokines IL-4 and IL-13 secreted by Th2 are closely associated with mucus secretion, eosinophil activation, and airway remodeling in asthma [33,34]. Studies demonstrate that controlling Th2-type asthma is effective via the preparation of anti-IL-4/IL-13 antibodies [35]. S100A4 has been shown to suppress airway inflammation in chronic asthmatic mouse models [19]. In this study, treatment with anti‐S100A4 antibody significantly inhibited Th2-mediated airway hyperreactivity and reduced the production of IL-4 and IL-13. Inflammatory cell infiltration around the airway also aggravates the progression of asthma [36]. Eosinophil gathering around the bronchus and release of cytotoxic granule protein contribute to collagen deposition and epithelial cell injury [33], which is required for airway remodeling. The cytokines (such as IL-1β and TNF-α) are also involved in promoting the allergic response [37]. Therefore, there is ongoing research on how to prevent the release of inflammatory factors [38]. Here, the administration of anti‐S100A4 antibody in vivo alleviated airway remodeling by reducing airway hyperreactivity and inflammation. Extracellular S100A4 can affect numerous cell types by binding to their receptors. Epidermal growth factor receptor (EGFR) [39] and the receptor for advanced glycation end products (RAGE) [40] have been shown to be the extracellular receptors for S100A4. S100A4 can enhance EGFR/ErbB2 receptor signaling pathway to induce cell proliferation and promote tumor progression [39]. In addition, extracellular S100A4 can also interact with RAGE to increase plasmin levels and thus induce tube formation in endothelial cells [40]. More importantly, S100A4 plays a crucial role in leukocyte migration, which has been associated with the pathogenesis of inflammatory diseases. S100A4 can induce the secretion of cytokines, particularly eotaxin‐2 and GM‐CSF from T lymphocytes [41]. We hypothesized that the potential role of S100A4 in asthmatic airway inflammation may be partially attributed to its ability to promote the infiltration of inflammatory cells.

E-cadherin, vimentin, and α-SMA proteins are key markers in the process of EMT [42]. Loss of epithelial cell adhesion protein E-cadherin causes the dysfunction of epithelial barrier, resulting in the loss of structural stability and polarity of the bronchial epithelium, which is required for the migration of bronchial epithelial cells. Increased vimentin and α-SMA expression alters the composition of cytoskeletal proteins and thereby contributes to the epithelial cubic‑shaped cells into fiber‑like cells. These cells thus obtain the potential of migration [43]. It has been suggested that low E-cadherin expression in patients with asthma is related to the dysfunction of airway barrier and the development of airway remodeling [44]. A study reported decreased expression of E-cadherin and elevated expression of vimentin in the airway epithelium from dust mite-induced asthmatic mice [45]. We also found that E-cadherin was downregulated and vimentin and α-SMA were upregulated in OVA-challenged mice and in HDM-stimulated epithelial cells. Although the relationship between S100A4 and airway inflammation was elucidated, whether it affects EMT in asthma remains unknown. S100A4 drives EMT in chronic sinusitis mucosal epithelial cells and accelerates nasal mucosa tissue remodeling [46]. S100A4 silencing inhibits TGF-β-induced EMT in pleural mesothelial cells [47]. In the current study, anti-S100A4 administration downregulated vimentin and α-SMA levels and upregulated E-cadherin level in OVA-challenged mice. S100A4 downregulation also inhibited EMT process in HDM-stimulated 16HBE cells. These findings suggested that silencing S100A4 may be a possible mechanism to prevent the bronchial epithelium from fibrosis in asthma. However, we only investigated the effects of intracellular S100A4 on EMT process in human bronchial epithelial cells. We plan to investigate whether extracellular S100A4 exerts the effects on EMT in vitro in future studies. This will support our data in mouse models.

5 Conclusion

In summary, we verified that S100A4 was elevated in the bronchial epithelium from mouse models of airway remodeling and in human bronchial epithelial cell line stimulated by HDM. Additionally, intracellular S100A4 blockage attenuated airway remodeling by the inhibition of airway inflammation and EMT process, suggesting that S100A4-antibody therapy may have clinical applicability in controlling airway remodeling in patients with asthma. However, further investigations should be conducted to elucidate the mechanisms of S100A4 in asthma.


# These authors contributed equally to this work.


Acknowledgements

Not applicable.

  1. Funding information: This work was supported by Wuhan Municipal Health Commission Clinical Medical Research Project (No. WX20B30).

  2. Author contributions: SL, ML, and FJL were the main designers of this study. JNZ, SC, ZMW, and XYG performed the experiments. SL and ML analyzed the data. FJL drafted the manuscript. All authors read and approved the final manuscript.

  3. Conflict of interest: The authors declare that there is no conflict of interest regarding the publication of this study.

  4. Data availability statement: The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Killeen K, Skora E. Pathophysiology, diagnosis, and clinical assessment of asthma in the adult. Nurs Clin North Am. 2013;48(1):11–23.10.1016/j.cnur.2012.11.001Search in Google Scholar PubMed

[2] Yang IV, Schwartz DA. Epigenetic mechanisms and the development of asthma. J Allergy Clin Immunol. 2012;130(6):1243–55.10.1016/j.jaci.2012.07.052Search in Google Scholar PubMed PubMed Central

[3] Al Heialy S, Ramakrishnan RK, Hamid Q. Recent advances in the immunopathogenesis of severe asthma. J Allergy Clin Immunol. 2022;149(2):455–65.10.1016/j.jaci.2021.12.765Search in Google Scholar PubMed

[4] Prakash YS, Halayko AJ, Gosens R, Panettieri RA Jr., Camoretti-Mercado B, Penn RB. An official American thoracic society research statement: Current challenges facing research and therapeutic advances in airway remodeling. Am J Respir Crit Care Med. 2017;195(2):e4–19.10.1164/rccm.201611-2248STSearch in Google Scholar PubMed

[5] Gras D, Bourdin A, Chanez P, Vachier I. [Airway remodeling in asthma: Clinical and functional correlates]. Med Sci. 2011;27(11):959–65.10.1051/medsci/20112711011Search in Google Scholar PubMed

[6] Menzies-Gow A, Bafadhel M, Busse WW, Casale TB, Kocks JWH, Pavord ID, et al. An expert consensus framework for asthma remission as a treatment goal. J Allergy Clin Immunol. 2020;145(3):757–65.10.1016/j.jaci.2019.12.006Search in Google Scholar PubMed

[7] Fischer KD, Agrawal DK. Vitamin D regulating TGF-β induced epithelial-mesenchymal transition. Respir Res. 2014;15(1):146.10.1186/s12931-014-0146-6Search in Google Scholar PubMed PubMed Central

[8] Ijaz T, Pazdrak K, Kalita M, Konig R, Choudhary S, Tian B, et al. Systems biology approaches to understanding Epithelial Mesenchymal Transition (EMT) in mucosal remodeling and signaling in asthma. World Allergy Organ J. 2014;7(1):13.10.1186/1939-4551-7-13Search in Google Scholar PubMed PubMed Central

[9] Liu T, Liu Y, Miller M, Cao L, Zhao J, Wu J, et al. Autophagy plays a role in FSTL1-induced epithelial mesenchymal transition and airway remodeling in asthma. Am J Physiol Lung Cell Mol Physiol. 2017;313(1):L27–l40.10.1152/ajplung.00510.2016Search in Google Scholar PubMed

[10] Donato R, Cannon BR, Sorci G, Riuzzi F, Hsu K, Weber DJ, et al. Functions of S100 proteins. Curr Mol Med. 2013;13(1):24–57.10.2174/156652413804486214Search in Google Scholar

[11] Ambartsumian N, Klingelhöfer J, Grigorian M. The multifaceted S100A4 protein in cancer and inflammation. Methods Mol Biol (Clifton, NJ). 2019;1929:339–65.10.1007/978-1-4939-9030-6_22Search in Google Scholar PubMed

[12] Boye K, Maelandsmo GM. S100A4 and metastasis: A small actor playing many roles. Am J Pathol. 2010;176(2):528–35.10.2353/ajpath.2010.090526Search in Google Scholar PubMed PubMed Central

[13] Leclerc E, Fritz G, Vetter SW, Heizmann CW. Binding of S100 proteins to RAGE: An update. Biochim Biophys Acta. 2009;1793(6):993–1007.10.1016/j.bbamcr.2008.11.016Search in Google Scholar PubMed

[14] Chen L, Li J, Zhang J, Dai C, Liu X, Wang J, et al. S100A4 promotes liver fibrosis via activation of hepatic stellate cells. J Hepatol. 2015;62(1):156–64.10.1016/j.jhep.2014.07.035Search in Google Scholar PubMed

[15] Lawson WE, Polosukhin VV, Zoia O, Stathopoulos GT, Han W, Plieth D, et al. Characterization of fibroblast-specific protein 1 in pulmonary fibrosis. Am J Respir Crit Care Med. 2005;171(8):899–907.10.1164/rccm.200311-1535OCSearch in Google Scholar PubMed

[16] Fei F, Qu J, Li C, Wang X, Li Y, Zhang S. Role of metastasis-induced protein S100A4 in human non-tumor pathophysiologies. Cell Biosci. 2017;7:64.10.1186/s13578-017-0191-1Search in Google Scholar PubMed PubMed Central

[17] Dierick BJH, van der Molen T, Flokstra-de Blok BMJ, Muraro A, Postma MJ, Kocks JWH, et al. Burden and socioeconomics of asthma, allergic rhinitis, atopic dermatitis and food allergy. Expert Rev Pharmacoeconomics Outcomes Res. 2020;20(5):437–53.10.1080/14737167.2020.1819793Search in Google Scholar PubMed

[18] Bruhn S, Fang Y, Barrenäs F, Gustafsson M, Zhang H, Konstantinell A, et al. A generally applicable translational strategy identifies S100A4 as a candidate gene in allergy. Sci Transl Med. 2014;6(218):218ra4.10.1126/scitranslmed.3007410Search in Google Scholar PubMed PubMed Central

[19] Huang X, Qu D, Liang Y, Huang Q, Li M, Hou C. Elevated S100A4 in asthmatics and an allergen-induced mouse asthma model. J Cell Biochem. 2019;120(6):9667–76.10.1002/jcb.28245Search in Google Scholar PubMed

[20] Wu Y, Zhang W, Gunst SJ. S100A4 is secreted by airway smooth muscle tissues and activates inflammatory signaling pathways via receptors for advanced glycation end products. Am J Physiol Lung Cell Mol Physiol. 2020;319(1):L185–95.10.1152/ajplung.00347.2019Search in Google Scholar PubMed PubMed Central

[21] Wu T, Ma L, Jin X, He J, Chen K, Zhang D, et al. S100A4 is critical for a mouse model of allergic asthma by impacting mast cell activation. Front Immunol. 2021;12:692733.10.3389/fimmu.2021.692733Search in Google Scholar PubMed PubMed Central

[22] Qian L, Hong J, Zhang Y, Zhu M, Wang X, Zhang Y, et al. Downregulation of S100A4 alleviates cardiac fibrosis via Wnt/β-catenin pathway in mice. Cell Physiol Biochem: Int J Exp Cell Physiol Bioch Pharmacol. 2018;46(6):2551–60.10.1159/000489683Search in Google Scholar PubMed

[23] Tamaki Y, Iwanaga Y, Niizuma S, Kawashima T, Kato T, Inuzuka Y, et al. Metastasis-associated protein, S100A4 mediates cardiac fibrosis potentially through the modulation of p53 in cardiac fibroblasts. J Mol Cell Cardiol. 2013;57:72–81.10.1016/j.yjmcc.2013.01.007Search in Google Scholar PubMed

[24] Hou C, Kong J, Liang Y, Huang H, Wen H, Zheng X, et al. HMGB1 contributes to allergen-induced airway remodeling in a murine model of chronic asthma by modulating airway inflammation and activating lung fibroblasts. Cell Mol Immunol. 2015;12(4):409–23.10.1038/cmi.2014.60Search in Google Scholar PubMed PubMed Central

[25] Klingelhöfer J, Grum-Schwensen B, Beck MK, Knudsen RS, Grigorian M, Lukanidin E, et al. Anti-S100A4 antibody suppresses metastasis formation by blocking stroma cell invasion. Neoplasia (New York, NY). 2012;14(12):1260–8.10.1593/neo.121554Search in Google Scholar PubMed PubMed Central

[26] Yao J, Jiang M, Zhang Y, Liu X, Du Q, Feng G. Chrysin alleviates allergic inflammation and airway remodeling in a murine model of chronic asthma. Int Immunopharmacol. 2016;32:24–31.10.1016/j.intimp.2016.01.005Search in Google Scholar PubMed

[27] Zang N, Li S, Li W, Xie X, Ren L, Long X, et al. Resveratrol suppresses persistent airway inflammation and hyperresponsivess might partially via nerve growth factor in respiratory syncytial virus-infected mice. Int Immunopharmacol. 2015;28(1):121–8.10.1016/j.intimp.2015.05.031Search in Google Scholar PubMed

[28] Li LC, Piao HM, Zheng MY, Lin ZH, Choi YH, Yan GH. Ginsenoside Rh2 attenuates allergic airway inflammation by modulating nuclear factor-κB activation in a murine model of asthma. Mol Med Rep. 2015;12(5):6946–54.10.3892/mmr.2015.4272Search in Google Scholar PubMed

[29] Li Y, Bao J, Bian Y, Erben U, Wang P, Song K, et al. S100A4( +) macrophages are necessary for pulmonary fibrosis by activating lung fibroblasts. Front Immunol. 2018;9:1776.10.3389/fimmu.2018.01776Search in Google Scholar PubMed PubMed Central

[30] Ward C, Forrest IA, Murphy DM, Johnson GE, Robertson H, Cawston TE, et al. Phenotype of airway epithelial cells suggests epithelial to mesenchymal cell transition in clinically stable lung transplant recipients. Thorax. 2005;60(10):865–71.10.1136/thx.2005.043026Search in Google Scholar PubMed PubMed Central

[31] Lawrie A, Spiekerkoetter E, Martinez EC, Ambartsumian N, Sheward WJ, MacLean MR, et al. Interdependent serotonin transporter and receptor pathways regulate S100A4/Mts1, a gene associated with pulmonary vascular disease. Circ Res. 2005;97(3):227–35.10.1161/01.RES.0000176025.57706.1eSearch in Google Scholar PubMed

[32] Schneider M, Hansen JL, Sheikh SP. S100A4: A common mediator of epithelial-mesenchymal transition, fibrosis and regeneration in diseases? J Mol Med (Berlin, Ger). 2008;86(5):507–22.10.1007/s00109-007-0301-3Search in Google Scholar PubMed

[33] Manka LA, Wechsler ME. Selecting the right biologic for your patients with severe asthma. Ann Allergy Asthma Immunol. 2018;121(4):406–13.10.1016/j.anai.2018.07.033Search in Google Scholar PubMed

[34] Ramsahai JM, Hansbro PM, Wark PAB. Mechanisms and management of asthma exacerbations. Am J Respir Crit Care Med. 2019;199(4):423–32.10.1164/rccm.201810-1931CISearch in Google Scholar PubMed

[35] Bagnasco D, Ferrando M, Varricchi G, Passalacqua G, Canonica GW. A critical evaluation of Anti-IL-13 and Anti-IL-4 strategies in severe asthma. Int Arch Allergy Immunol. 2016;170(2):122–31.10.1159/000447692Search in Google Scholar PubMed

[36] Mims JW. Asthma: Definitions and pathophysiology. Int Forum Allergy Rhinol. 2015(5 Suppl 1):S2–6.10.1002/alr.21609Search in Google Scholar PubMed

[37] Fahy JV. Type 2 inflammation in asthma--present in most, absent in many. Nat Rev Immunol. 2015;15(1):57–65.10.1038/nri3786Search in Google Scholar PubMed PubMed Central

[38] Barnes PJ. Targeting cytokines to treat asthma and chronic obstructive pulmonary disease. Nat Rev Immunol. 2018;18(7):454–66.10.1038/s41577-018-0006-6Search in Google Scholar PubMed

[39] Klingelhöfer J, Møller HD, Sumer EU, Berg CH, Poulsen M, Kiryushko D, et al. Epidermal growth factor receptor ligands as new extracellular targets for the metastasis-promoting S100A4 protein. FEBS J. 2009;276(20):5936–48.10.1111/j.1742-4658.2009.07274.xSearch in Google Scholar PubMed

[40] Semov A, Moreno MJ, Onichtchenko A, Abulrob A, Ball M, Ekiel I, et al. Metastasis-associated protein S100A4 induces angiogenesis through interaction with Annexin II and accelerated plasmin formation. J Biol Chem. 2005;280(21):20833–41.10.1074/jbc.M412653200Search in Google Scholar PubMed

[41] Grum-Schwensen B, Klingelhöfer J, Grigorian M, Almholt K, Nielsen BS, Lukanidin E, et al. Lung metastasis fails in MMTV-PyMT oncomice lacking S100A4 due to a T-cell deficiency in primary tumors. Cancer Res. 2010;70(3):936–47.10.1158/0008-5472.CAN-09-3220Search in Google Scholar PubMed

[42] Scanlon CS, Van Tubergen EA, Inglehart RC, D’Silva NJ. Biomarkers of epithelial-mesenchymal transition in squamous cell carcinoma. J Dental Res. 2013;92(2):114–21.10.1177/0022034512467352Search in Google Scholar PubMed PubMed Central

[43] Kokkinos MI, Wafai R, Wong MK, Newgreen DF, Thompson EW, Waltham M. Vimentin and epithelial-mesenchymal transition in human breast cancer--observations in vitro and in vivo. Cells Tissues Organs. 2007;185(1–3):191–203.10.1159/000101320Search in Google Scholar PubMed

[44] de Boer WI, Sharma HS, Baelemans SM, Hoogsteden HC, Lambrecht BN, Braunstahl GJ. Altered expression of epithelial junctional proteins in atopic asthma: Possible role in inflammation. Can J Physiol Pharmacol. 2008;86(3):105–12.10.1139/Y08-004Search in Google Scholar PubMed

[45] Fischer KD, Hall SC, Agrawal DK. Vitamin D supplementation reduces induction of epithelial-mesenchymal transition in allergen sensitized and challenged mice. PLoS one. 2016;11(2):e0149180.10.1371/journal.pone.0149180Search in Google Scholar PubMed PubMed Central

[46] Gong N, Shi L, Bing X, Li H, Hu H, Zhang P, et al. S100A4/TCF complex transcription regulation drives epithelial-mesenchymal transition in chronic sinusitis through Wnt/GSK-3β/β-catenin signaling. Front Immunol. 2022;13:835888.10.3389/fimmu.2022.835888Search in Google Scholar PubMed PubMed Central

[47] Ning Q, Li F, Wang L, Li H, Yao Y, Hu T, et al. S100A4 amplifies TGF-β-induced epithelial-mesenchymal transition in a pleural mesothelial cell line. J Invest Med. 2018;66(2):334–9.10.1136/jim-2017-000542Search in Google Scholar PubMed PubMed Central

Received: 2022-05-18
Revised: 2022-11-21
Accepted: 2022-11-28
Published Online: 2023-10-17

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Downloaded on 19.12.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2022-0622/html
Scroll to top button