lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
-
Wenhua Cheng
Abstract
lncRNA TPT1-AS1 plays an oncogenic role in ovarian and cervical cancers. However, its involvement in the pathological progress of esophageal squamous-cell carcinomas (ESCCs) is unclear. lncRNA TPT1-AS1 was mainly localized in the cytoplasm of ESCC cells and interacted with miR-26a. In ESCC tissues, lncRNA TPT1-AS1 level was obviously increased, while miR-26a level was decreased. Interestingly, lncRNA TPT1-AS1 level was not significantly correlated with miR-26a level but was positively correlated with HMGA1 mRNA, a target of miR-26a. In ESCC cell lines KYSE510 and KYSE-30, lncRNA TPT1-AS1 overexpression enhanced HMGA1 expression, while it had no effect on miR-26a expression. Cell migration and proliferation assays indicated that lncRNA TPT1-AS1 and HMGA1 overexpression promoted ESCC cell migration and invasion, while their effects were alleviated by miR-26a overexpression. The migration and invasion of ESCC cells were suppressed by lncRNA TPT1-AS1 knockdown. In conclusion, lncRNA TPT1-AS1 plays an oncogenic role in ESCC and might function by upregulating HMGA1 via sponging miR-26a.
1 Introduction
Esophageal cancer has been estimated to affect 572,034 new cases and has caused 508,585 deaths worldwide in 2018 [1]. Esophageal squamous-cell carcinoma (ESCC) is the common type of esophageal cancer [2]. Smoking, heavy alcohol consumption, and human papillomavirus infection are the main risk factors of ESCC [3,4]. Despite the continuous improvement in the medical standards in recent years, the 5 year survival rate of patients with esophageal cancer is not ideal [5,6,7]. Therefore, it is still necessary to develop novel diagnostic markers and therapeutic strategies.
It has been well established that the development of ESCC involves multiple molecular pathways [8]. The functional molecules involved in these pathways may be potential diagnostic markers and therapeutic targets [9,10]. Long (>200 nt) non-coding RNAs (lncRNAs) can function as gene regulators by interacting with DNA (e.g., promoters), RNA, or proteins [11]. Recently, mounting lncRNAs have been recognized as important regulators in ESCC. Accumulating evidence has proposed that lncRNAs play significant roles in the biological development of ESCC by regulating cell proliferation and apoptosis [12,13]. For instance, lncRNA small nucleolar host gene 1 (SNHG1), SNHG6, and SNHG16 have been reported to promote ESCC cell proliferation [14,15]. Cox univariate and multivariate analyses have revealed that SNHG1 is an independent prognostic factor for overall survival (OS) and disease-free survival in ESCC patients. The interaction between miRNA-21 and SNHG1 plays an important role in ESCC cell proliferation [16]. lncRNA SNHG1 promotes the development of cervical cancer cells. lncRNA SNHG1 knockdown decreases the proliferation, migration, and invasion of HeLa and C-33A cells [17]. lncRNA SNHG1 is upregulated in ESCC tissues and high SNHG1 expression is positively correlated with ESCC lymph node metastasis and decreased OS. CASC9 promotes ESCC growth by regulating the EZH2/CASC9 pathway [18], while KLF3-AS1 inhibits ESCC tumorigenesis by regulating the miR-185-5p/KLF3 axis [19]. TPT1-AS1, a lncRNA located on chromosome 13 with about 76,000 base pairs, has an oncogenic role in ovarian and cervical cancers [20,21,22]. Moreover, TPT1-AS1 accelerates the progression of colorectal cancer (CRC) by upregulating TPT1 levels and activating the FAK and JAK-STAT3 signaling pathways [23]. Tiang et al. has studied TPT1-AS1 and reported that TPT1-AS1 silencing suppressed gastric cancer development [22]. However, the effect of TPT1-AS1 on ESCC remains largely unknown. TPT1-AS1 is predicted to interact with miR-26a by IntaRNA software. Existing studies have revealed that miR-26a and its target HMGA1 are involved in the pathological progress of many cancers [24,25,26]. For instance, the interaction between miR-26a and its target gene HMGA1 might contribute to the malignant progression of human urothelial bladder cancer [27]. In addition, miR-26a-5p overexpression could be a novel therapy to improve coronary microembolization-induced myocardial damage. Studies have shown that HMGA1 is a target gene of miR-26a-5p. However, whether the TPT1-AS1/miR-26a axis plays a role in ESCC remains unclear. Here we attempted to verify the relationship between TPT1-AS1 and miR-26a and investigate the potential roles of TPT1-AS1 and miR-26a/HMGA1 axis in ESCC.
2 Methods
2.1 Research subjects
60 ESCC patients from Shanxi Cancer Hospital (Shanxi, China) between January 2017 and January 2019 were involved. Patients who had a history of malignancies or ESCC treatment or had other clinical diseases were excluded. The correlation between TPT1-AS1/miR-26a/HMGA1 expressions and clinicopathological factors of ESCC patients are listed in Tables 1–3.
Association between TPT1-AS1 expression and clinicopathological features of ESCC patients
| Characteristics | Total number (n = 60) | TPT1-AS1 expression | P value | |
|---|---|---|---|---|
| Low (n = 30) | High (n = 30) | |||
| Age (years) | 0.606 | |||
| <55 | 30 | 16 | 14 | |
| ≥55 | 30 | 14 | 16 | |
| Gender | 0.438 | |||
| Male | 29 | 13 | 16 | |
| Female | 31 | 17 | 14 | |
| Lymph node metastasis | 0.114 | |||
| Yes | 24 | 9 | 15 | |
| No | 36 | 21 | 15 | |
| Clinical stage | 0.001 | |||
| I–II | 33 | 10 | 23 | |
| III–IV | 27 | 20 | 7 | |
The screening criteria were P < 0.05 and a fold change >1.
The study included 60 patients (29 males and 31 females). Among them, 30 patients were assigned in the high TPT1-AS1 expression group. Of these 30 patients, 15 patients had lymph node metastasis and 15 had no lymph node metastasis.
Association between miR-26a expression and clinicopathological features of ESCC patients
| Characteristics | Total number (n = 60) | miR-26a expression | P value | |
|---|---|---|---|---|
| Low (n = 30) | High (n = 30) | |||
| Age (years) | 0.121 | |||
| <55 | 30 | 18 | 12 | |
| ≥55 | 30 | 12 | 18 | |
| Gender | 0.796 | |||
| Male | 29 | 14 | 15 | |
| Female | 31 | 16 | 15 | |
| Lymph node metastasis | 0.035 | |||
| Yes | 24 | 16 | 8 | |
| No | 36 | 14 | 22 | |
| Clinical stage | 0.020 | |||
| I–II | 33 | 21 | 12 | |
| III–IV | 27 | 9 | 18 | |
Association between HMGA1 expression and clinicopathological features of ESCC patients
| Characteristics | Total number (n = 60) | HMGA1 expression | P value | |
|---|---|---|---|---|
| Low (n = 30) | High (n = 30) | |||
| Age (years) | 1 | |||
| <55 | 30 | 15 | 15 | |
| ≥55 | 30 | 15 | 15 | |
| Gender | 0.796 | |||
| Male | 29 | 14 | 15 | |
| Female | 31 | 16 | 15 | |
| Lymph node metastasis | 0.598 | |||
| Yes | 24 | 11 | 13 | |
| No | 36 | 19 | 17 | |
| Clinical stage | 0.020 | |||
| I–II | 33 | 12 | 21 | |
| III–IV | 27 | 18 | 9 | |
-
Ethics approval and consent to participate: The present study was approved by the Ethics Committee of Shanxi Cancer Hospital. The research has been carried out in accordance with the World Medical Association Declaration of Helsinki. All patients and healthy volunteers provided written informed consent prior to their inclusion within the study.
2.2 RNA interaction prediction
The interaction between TPT1-AS1 and miR-26a was predicted using IntaRNA software (http://rna.informatik.uni-freiburg.de/IntaRNA/Input.jsp).
2.3 ESCC tissue samples and cells
Fine needle biopsies under the guidance of MRI were performed to collect ESCC tissues and their matched adjacent normal-appearing tissues. The tissue sections were stained by hematoxylin and eosin, and their histopathological features were examined by three professional pathologists. The ESCC cancer tissues were diagnosed according to the World Health Organization’s classification for esophageal cancer [28]. The matched adjacent normal-appearing tissues were diagnosed with the criteria that there were no detectable cancer cells in the samples.
KYSE510 and KYSE-30 ESCC cell lines were from BFB Biotechnology Co., Ltd (China). They were cultured in RPMI-1640 medium with 10% FBS under 5% CO2 at 37°C. The cells were harvested from passages 3–6 for subsequent experiments. All experiments were performed with mycoplasma-free cells, which were authenticated by STR analysis.
2.4 Cell transfection
Short hairpin RNAs targeting TPT1-AS1 (shTPT1-AS1) and scrambled vector (shNC) from Invitrogen (Carlsbad, CA, USA) were used to knockdown TPT1-AS1. The expression vectors of TPT1-AS1 (NCBI accession: NR_024458.1) and HMGA1 (NCBI accession: KJ891364.1) were constructed by Sangon Biotech (China). The miR-26a mimic (5′-UUCAAGUAAUCCAGGAUAGGCU-3′) and negative control (5′-GUACGUAGCUAGUACGGUCCCA-3′) were designed by Invitrogen (USA). The HMGA1 overexpression plasmid was purchased from Gikai Gene Company (GV492, Shanghai, China) (Table 4). Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) was used for cell transfection.
Inserted sequence of HMGA1 overexpression plasmid
| ATGAGTGAGTCGAGCTCG AAGTCCAGCCAGCCCT TGGCCTCC AAGCAG GAAAAGGACGGCACTGAGAAGC GGGGCCGGGGCAGG CCGCGCAAG CAGCCTCCGGTGAGTCCCGGGACAGCGCTGGTAGGGAG TCAGAAGGA GCCCAGC GAAGTGCCAACACCTAAGAGACCTCGG GGCCGACC AAAGG GAAGCAAAA ACAAGGGTGCTGCCAAGACCCG GAAAACCACCACA ACT CCAGGA AGGAAACCAAGGGGCAGACCC AAAAAACTGGAGAAGGAGG AA GAGGAGGGCATCTCGCAGGA GTCCTCGGAGGAGGAGCAG |
2.5 Dual luciferase reporter assay
Dual luciferase reporter assay was performed following a previous work [29]. Briefly, pGL3 Promoter Luciferase Reporter Vector (Promega Corporation) was used to construct TPT1-AS1 vector. KYSE510 cells were transfected with pGL3-TPT1-AS1-promoter + pRL-TK + NC miRNA (NC group) or pGL3-TPT1-AS1-promoter + pRL-TK + miR-26a mimic (miR-26a group) using Lipofectamine 2000. The luciferase activity was determined using LucPair™ Duo-Luciferase Assay Kit (GeneCopoeia), and the firefly/Renilla activity ratio was calculated.
HMGA1 wild-type and mutant-type luciferase reporter vector targeting the miR-26a binding site were constructed. The vectors and miR-26a mimics were co-transfected into cells using Lipofectamine 2000 reagent, and luciferase activities were detected 48 h later using the dual luciferase reporter system (Promega, USA).
2.6 RNA preparations and RT-qPCR
Total RNAs and miRNAs were extracted from KYSE510 cells and tissue samples using Direct-zol RNA Kit (R2061, Zymo Research) and PureLink miRNA Isolation Kit (K157001, Thermo Fisher Scientific), respectively. The cDNA samples were obtained by using QuantiTect Reverse Transcription Kit (205311, QIAGEN). RT-qPCR reactions were performed with KAPA SYBR® FAST qPCR Master Mix (2X) Kit (KR0390, Kapa Biosystems) or All-in-One™ miRNA qRT-PCR Detection Kit (QP015/AOMD-Q020, GeneCopoeia). GAPDH and U6 were selected as the internal controls for regular genes and miRNA, respectively. The corresponding primer sequences were 5′-CGTTTGGACCCCTGTCTTGGAC-3′ (forward) and 5′-CAGAAAGAAAGCAGGTCATT-3′ (reverse) for TPT1-AS1; 5′-TGAGTCGAGCTCGAAGTCCAG-3′ (forward) and 5′-CTTAGGTGTTGGCACTTCGC-3′ (reverse) for HMGA1; and 5′-GTCTCCTCTGACTTCAACAGC-3′ (forward) and 5′-CCACCCTGTTGCTGTAGCCAA-3′ (reverse) for GAPDH. The forward miR-26a primer was 5′-UUCAAGUAAUCCAGGAUAG-3′. The reverse miR-26a primer and U6 primers were from the kit. The PCR reaction conditions were 1 min at 95°C followed by 40 cycles of 95°C for 10 s and 58°C for 50 s. Each experiment was performed with 3 replicates, and the relative expression level was calculated using the 2−ΔΔCt method.
2.7 Subcellular fractionation
The nuclear and cytoplasm extracts of KYSE510 cells were isolated using NE-PER Nuclear and Cytoplasmic Extraction Reagents kit (pierce-78835, Pierce, USA). The TPT1-AS1, U6, and GAPDH levels in the nuclear and cytoplasmic extracts were detected by RT-qPCR.
2.8 Western blotting
Total proteins were isolated from in vitro cultivated cells and quantified using bicinchoninic acid assay method. 50 μg (10 μL) of total proteins were loaded to each sample well and separated by 10% SDS-PAGE. The separated proteins were transferred onto PVDF membranes, which were blocked with 5% nonfat dry milk for 2 h and incubated with antibodies against GAPDH (ab9845, Abcam) and HMGA1 (ab226850, Abcam) at 4°C for 18 h, followed by incubation with secondary antibody (ab6721, Abcam) at room temperature for 2 h. The target protein signals were detected using the enhanced chemiluminescence system (Amersham).
2.9 Transwell assays
Transwell assays were performed using KYSE510 and KYSE-30 cells collected at 48 h post-transfection using Transwell inserts (8 µm, 3415, Corning). For invasion assay, the Transwell inserts were pre-treated with 50 μL/well Matrigel (dilution rate = 1:3) at 37°C for 6 h. For migration assay, the uncoated Transwell inserts were used. 4,000 cells were seeded into the upper chamber, and RPMI-1640 media with 20% FBS were added into the lower chamber. 12 h later, the lower surface of membranes was stained using crystal violet (0.1%, Sigma-Aldrich) for 20 min. Images were analyzed using ImageJ software to measure the percentage of the area of cells present in each insert.
2.10 Statistics
The experimental data (three replicates) were analyzed using SPSS 17.0 software. Data from ESCC tissue samples were analyzed using paired t test and Pearson’s correlation coefficient. One-tailed t-test was used in the study. Unpaired t test was applied to compare the difference between two groups. ANOVA was used to compare the difference among multiple groups. The threshold of p-value was set to 0.05.
3 Results
3.1 TPT1-AS1 interacted with miR-26a
TPT1-AS1 was predicted to interact with miR-26a by IntaRNA (Figure 1a). As shown in Figure 1b, miR-26a overexpression markedly inhibited the luciferase activity in KYSE510 cells transfected with pGL3-TPT1-AS1-promoter and pRL-TK, indicating that TPT1-AS1 interacted with miR-26a. Moreover, we isolated the nuclear and cytoplasmic extracts from ESCC cell line KYSE510. Subsequent RT-qPCR assay indicated that TPT1-AS1 was mainly localized in the cytoplasm of KYSE510 cells (Figure 1c). MiR-26a overexpression significantly reduced the luciferase activity of the HMGA1-wt vector but failed to decrease that of the HMGA1-mut (Figure A1).
TPT1-AS1 interacted with miR-26a. (a) TPT1-AS1 was predicted to interact with miR-26a. (b) KYSE510 cells were transfected with pGL3-TPT1-AS1-promoter + pRL-TK + NC miRNA or pGL3-TPT1-AS1-promoter + pRL-TK + miR-26a mimic. Luciferase activity was assessed by using the corresponding assay kit. (c) TPT1-AS1 level in the nucleus and cytoplasm of ESCC cells. *, p < 0.05.
3.2 TPT1-AS1 level was increased while miR-26a level was reduced in ESCC tissues
TPT1-AS1 and miR-26a levels in ESCC and matched non-tumor tissues were assessed. The results indicated that TPT1-AS1 level was markedly increased in ESCC tissues (Figure 2a), while miR-26a level was apparently reduced in ESCC tissues (Figure 2b). The expression levels of TPT1-AS1 and miR-26a/HMGA1 in these two cells were compared with KYSE180 cells and normal cells. The results indicated that TPT1-AS1 level was increased in KYSE180 cells and KYSE510 cells (Figure A3a), while miR-26a level was reduced in KYSE180 cells and KYSE510 cells (Figure A3b). In addition, HMGA level was increased in KYSE180 cells and KYSE510 cells (Figure A3c). Moreover, TPT1-AS1 level was increased in KYSE180 cells and KYSE-30 cells (Figure A3d), while miR-26a level was reduced in KYSE180 cells and KYSE-30 cells (Figure A3e). Moreover, HMGA level was increased in KYSE180 cells and KYSE-30 cells (Figure A3f).
TPT1-AS1 level was increased, while miR-26a level was reduced in ESCC tissues. TPT1-AS1 (a) and miR-26a (b) levels in ESCC and matched non-tumor tissues were measured by RT-qPCR. ***, p < 0.001.
3.3 TPT1-AS1 enhanced HMGA1 expression in ESCC cells by sponging miR-26a
The correlation among TPT1-AS1, miR-26a, and HMGA1 levels were assessed. As shown in Figure 3a, TPT1-AS1 level in ESCC tissues was not obviously correlated with miR-26a level. Interestingly, TPT1-AS1 level in ESCC tissues was positively correlated with HMGA1 mRNA, a target of miR-26a (Figure 3b). We then transfected KYSE510 cells with TPT1-AS1 expression vector or miR-26a mimic. As shown in Figure 4a, TPT1-AS1 overexpression and miR-26a mimic remarkably upregulated TPT1-AS1 and miR-26a levels in KYSE510 cells, respectively. As shown in Figure 4b, TPT1-AS1 and miR-26a overexpression did not affect the expression levels of each other. In addition, we also assessed the effects of TPT1-AS1 and miR-26a overexpression on HMGA1. The results indicated that TPT1-AS1 overexpression promoted HMGA1 mRNA and protein levels, while miR-26a overexpression inhibited HMGA1 mRNA and protein levels (Figure 4c and d). Moreover, miR-26a overexpression attenuated the effects of TPT1-AS1 overexpression on HMGA1 mRNA and protein expression (Figure 4c and d). Furthermore, TPT1-AS1 knockdown had no effect on miR-26a expression (Figure 4e) but decreased HMGA1 expression (Figure 4f). Collectively, TPT1-AS1 might enhance HMGA1 expression by sponging miR-26a.
TPT1-AS1 was positively correlated with HMGA1 mRNA. (a) The correlation between TPT1-AS1 and miR-26a across ESCC tissues. (b) The correlation between TPT1-AS1 and HMGA1 mRNA across ESCC tissues.
TPT1-AS1 enhanced HMGA1 expression by sponging miR-26a. TPT1-AS1 expression vector and miR-26a mimic were transfected into KYSE510 cells. (a and b) TPT1-AS1 and miR-26a levels were assessed by RT-qPCR. (c and d) HMGA1 expression level was assessed by RT-qPCR and western blotting. (e and f) The expressions of miR-26a and HMGA1 were assessed by RT-qPCR in KYSE510 cells transacted with shTPT1-AS1. *, p < 0.05.
3.4 TPT1-AS1 enhanced ESCC cell migration and invasion by regulating the miR-26a/HMGA1 axis
The function of TPT1-AS1 in ESCC cells was explored. TPT1-AS1 and HMGA1 overexpression markedly promoted migration and invasion of ESCC cells, while miR-26a overexpression and TPT1-AS1 knockdown obviously suppressed migration and invasion of ESCC cells. Moreover, the effects of TPT1-AS1 and HMGA1 overexpression on migration and invasion were alleviated by miR-26a overexpression (Figure 5a and b).
TPT1-AS1 regulated the miR-26a/HMGA1 axis to enhance KYSE510 and KYSE-30 cell migration and invasion. ESCC cells migration (a) and invasion (b) abilities were determined by Transwell assays. *, p < 0.05.
4 Discussion
Our study mainly explored the role of TPT1-AS1 in ESCC. We revealed that TPT1-AS1 is remarkably increased in ESCC, and it could enhance ESCC cell migration and invasion by regulating the miR-26a/HMGA1 axis. Therefore, TPT1-AS1 might be a possible therapeutic target for ESCC.
Previous studies have shown that TPT1-AS1 knockdown significantly inhibits proliferation and cell cycle G1/S transition of SGC-7901 and MGC-803 cells. TPT1-AS1 diminishes cell proliferation and sensitizes cells to chemotherapy by sponging miR-3156-5p and upregulating CASP2. In addition, it has been reported that TPT1-AS1 induces epithelial ovarian cancer (EOC) tumor growth and metastasis through TPT1 and downstream PI3K/AKT signaling and that TPT1-AS1 might be a promising therapeutic target for EOC. Recent studies have explored the involvement of TPT1-AS1 in ovarian and cervical cancers [20,21]. In ovarian cancer, TPT1-AS1 is upregulated and induces TPT1 expression to promote cancer cell metastasis [21]. In cervical cancer, TPT1-AS1 is increased and sponges miR-324-5p [30] to promote tumor metastasis and growth [20]. Previous studies have also shown that TPT1-AS1 enhances EOC cell proliferation, migration, and invasion via the TPT1/PI3K/AKT signaling pathway in vitro. In addition, TPT1-AS1 promotes tumor progression and metastasis in CRC by upregulating TPT1 level and activating the FAK and JAK-STAT3 signaling pathways. The phenotypic changes in pathways related to migration and invasion remain to be further elucidated [22,31]. Here we observed that TPT1-AS1 is remarkably increased in ESCC tissues, and its overexpression enhances ESCC cell migration and invasion. Therefore, TPT1-AS1 also has an oncogenic function in ESCC. Moreover, we uncovered that TPT1-AS1 interacts with miR-26a. Existing studies have found that the role of miR-26a in cancers is differentiated. In CRC, miR-26a is apparently downregulated and can regulate FUT4 expression to suppress cancer cell aggressiveness [32]. In triple-negative breast cancer, miR-26a is downregulated and can target metadherin to suppress cancer cell migration and proliferation [33]. However, miR-26a is increased in ovarian cancer and promotes cancer cell proliferation [34]. Here we observed that miR-26a is decreased in ESCC tissues, and its overexpression represses ESCC cell migration and invasion, consistent with a recent report [35].
Studies have found that miR-26a suppresses bladder cancer by regulating its target HMGA1 [26]. HMGA1 can regulate various genes due to its ability to alter chromatin structures. HMGA1 overexpression is a hallmark of human cancers and exhibits a pivotal role in cell transformation [36]. miR-26a downregulates HMGA1 by targeting its 3′-UTR, and HMGA1 knockdown significantly suppresses the migration and invasion of two osteosarcoma cell lines in vitro [37]. Moreover, we uncovered that TPT1-AS1 might play its oncogenic function by modulating the miR-26a/HMGA1 axis. Further studies are needed to explore other potential mechanisms.
Our study also has some limitations. First, our sample size of ESCC patients is small, and all patients are Han Chinese. Therefore, a bigger sample size with different ethnic backgrounds is needed to further confirm our conclusion. In addition, in vivo animal experiments are needed to assess the role of TPT1-AS1 in tumor metastasis. The effect of HMGA1 knockdown on ESCC cells migration and invasion should be confirmed in the future.
5 Conclusion
TPT1-AS1 level is markedly increased in ESCC tissues, and its overexpression enhances ESCC cell migration and invasion via modulating the miR-26a/HMGA1 axis.
List of abbreviations
- CR
-
Ccolorectal cancer
- EOC
-
epithelial ovarian cancer
- ESCC
-
esophageal squamous-cell carcinoma
- lncRNAs
-
long (>200nt) non-coding RNAs
- NC
-
negative control
- OS
-
Overall Survival
- SNHG1
-
small nucleolar host gene 1
Acknowledgements
Not applicable.
-
Funding information: Not applicable.
-
Author contributions: Wenhua Cheng and Yong Ma: concepts, literature research, clinical studies, data analysis, experimental studies, and manuscript writing and review; Wenhua Cheng and Fang Yang: study design, literature research, experimental studies, and manuscript editing; Yong Ma and Fang Yang: definition of intellectual content, clinical studies, data acquisition, and statistical analysis. All authors have read and approved the submission of the manuscript.
-
Conflict of interest: The authors declare no conflicting interests.
-
Data availability statement: The experimental data are available from the corresponding author on reasonable request.
Appendix
Luciferase assays in ESCC cells co-transfected with wild-type or mutant HMGA1 and miR-26a or NC. MiR-26a overexpression significantly reduced the luciferase activity of the HMGA1-wt vector.
TPT1-AS1 localization in KYSE510 cells. RNA-FISH revealed that TPT1-AS1 is mainly colocalized in the cytoplasm of KYSE510 cells.
The expression levels of TPT1-AS1 and miR-26a/HMGA1 in these two cells were compared with other ESCC cells lines and normal cell line. TPT1-AS1 (A, D), miR-26a (B, E) and HMGA (C, F) levels in ESCC cells and normal cell line were determined by RT-qPCR.
References
[1] Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68(6):394–424.10.3322/caac.21492Search in Google Scholar PubMed
[2] Ohashi S, Miyamoto S, Kikuchi O, Goto T, Amanuma Y, Muto M. Recent advances from basic and clinical studies of esophageal squamous cell carcinoma. Gastroenterology. 2015;149(7):1700–15.10.1053/j.gastro.2015.08.054Search in Google Scholar PubMed
[3] Dheilly NM, Ewald PW. Parasite-microbe-host interactions and cancer risk. 2019;15(8):e1007912.10.1371/journal.ppat.1007912Search in Google Scholar PubMed PubMed Central
[4] Domper Arnal MJ, Ferrández Arenas Á, Lanas Arbeloa Á. Esophageal cancer: risk factors, screening and endoscopic treatment in Western and Eastern countries. World J Gastroenterol. 2015;21(26):7933–43.10.3748/wjg.v21.i26.7933Search in Google Scholar PubMed PubMed Central
[5] Lim H, Kim DH, Jung HY, Gong EJ, Na HK, Ahn JY, et al. Clinical significance of early detection of esophageal cancer in patients with head and neck cancer. Gut Liver. 2015;9(2):159–65.10.5009/gnl13401Search in Google Scholar PubMed PubMed Central
[6] Njei B, McCarty TR, Birk JW. Trends in esophageal cancer survival in United States adults from 1973 to 2009: A SEER database analysis. J Gastroenterol Hepatol. 2016;31(6):1141–6.10.1111/jgh.13289Search in Google Scholar PubMed PubMed Central
[7] Malhotra GK, Yanala U, Ravipati A, Follet M, Vijayakumar M, Are C. Global trends in esophageal cancer. J Surg Oncol. 2017;115(5):564–79.10.1002/jso.24592Search in Google Scholar PubMed
[8] Shimonosono M, Idichi T, Seki N, Yamada Y, Arai T, Arigami T, et al. Molecular pathogenesis of esophageal squamous cell carcinoma: Identification of the antitumor effects of miR‑145‑3p on gene regulation. Int J Oncol. 2019;54(2):673–88.10.3892/ijo.2018.4657Search in Google Scholar PubMed
[9] Xu WW, Li B, Lam AK, Tsao SW, Law SY, Chan KW, et al. Targeting VEGFR1- and VEGFR2-expressing non-tumor cells is essential for esophageal cancer therapy. Oncotarget. 2015;6(3):1790–805.10.18632/oncotarget.2781Search in Google Scholar PubMed PubMed Central
[10] Zhang L, Ma J, Han Y, Liu J, Zhou W, Hong L, et al. Targeted therapy in esophageal cancer. Expert Rev Gastroenterol Hepatol. 2016;10(5):595–604.10.1586/17474124.2016.1140036Search in Google Scholar PubMed
[11] Peng WX, Koirala P, Mo YY. LncRNA-mediated regulation of cell signaling in cancer. Oncogene. 2017;36(41):5661–7.10.1038/onc.2017.184Search in Google Scholar PubMed PubMed Central
[12] Li Y, Chen D, Gao X, Li X, Shi G. LncRNA NEAT1 regulates cell viability and invasion in esophageal squamous cell carcinoma through the miR-129/CTBP2 axis. Dis Markers. 2017;2017:5314649.10.1155/2017/5314649Search in Google Scholar PubMed PubMed Central
[13] Zhang Y, Jin X, Wang Z, Zhang X, Liu S, Liu G. Down regulation of SNHG1 suppresses cell proliferation and invasion by regulating Notch signaling pathway in esophageal squamous cell cancer. Cancer Biomark. 2017;21(1):89–96.10.3233/CBM-170286Search in Google Scholar PubMed
[14] Yan Y, Fan Q, Wang L, Zhou Y, Li J, Zhou K. LncRNA SNHG1, a non-degradable sponge for miR-338, promotes expression of proto-oncogene CST3 in primary esophageal cancer cells. Oncotarget. 2017;8(22):35750–60.10.18632/oncotarget.16189Search in Google Scholar PubMed PubMed Central
[15] Zhang Y, Li R, Ding X, Zhang K, Qin W. Upregulation of long non-coding RNA SNHG6 promotes esophageal squamous cell carcinoma cell malignancy and its diagnostic value. Am J Transl Res. 2019;11(2):1084–91.Search in Google Scholar
[16] Luo D, Huang Z, Lv H, Wang Y, Sun W, Sun X. Up-regulation of microRNA-21 indicates poor prognosis and promotes cell proliferation in esophageal squamous cell carcinoma via upregulation of lncRNA SNHG1. Cancer Manag Res. 2020;12:1–14.10.2147/CMAR.S221731Search in Google Scholar PubMed PubMed Central
[17] Liu Y, Yang Y, Li L, Liu Y, Geng P, Li G, et al. LncRNA SNHG1 enhances cell proliferation, migration, and invasion in cervical cancer. Biochem Cell Biol. 2018;96(1):38–43.10.1139/bcb-2017-0188Search in Google Scholar PubMed
[18] Wu Y, Hu L, Liang Y, Li J, Wang K, Chen X, et al. Up-regulation of lncRNA CASC9 promotes esophageal squamous cell carcinoma growth by negatively regulating PDCD4 expression through EZH2. Mol Cancer. 2017;16(1):150.10.1186/s12943-017-0715-7Search in Google Scholar PubMed PubMed Central
[19] Liu JQ, Deng M, Xue NN, Li TX, Guo YX, Gao L, et al. lncRNA KLF3-AS1 suppresses cell migration and invasion in ESCC by impairing miR-185-5p-targeted KLF3 inhibition. Mol Ther Nucleic Acids. 2020;20:231–41.10.1016/j.omtn.2020.01.020Search in Google Scholar PubMed PubMed Central
[20] Jiang H, Huang G, Zhao N, Zhang T, Jiang M, He Y, et al. Long non-coding RNA TPT1-AS1 promotes cell growth and metastasis in cervical cancer via acting as a sponge for miR-324-5p. J Exp Clin Cancer Res. 2018;37(1):169.10.1186/s13046-018-0846-8Search in Google Scholar PubMed PubMed Central
[21] Wu W, Gao H, Li X, Zhu Y, Peng S, Yu J, et al. LncRNA TPT1-AS1 promotes tumorigenesis and metastasis in epithelial ovarian cancer by inducing TPT1 expression. Cancer Sci. 2019;110(5):1587–98.10.1111/cas.14009Search in Google Scholar PubMed PubMed Central
[22] Tang J, Huang F, Wang H, Cheng F, Pi Y, Zhao J, et al. Knockdown of TPT1-AS1 inhibits cell proliferation, cell cycle G1/S transition, and epithelial-mesenchymal transition in gastric cancer. Bosn J Basic Med Sci. 2021;21(1):39–46.10.17305/bjbms.2020.4470Search in Google Scholar PubMed PubMed Central
[23] Zhang L, Ye F, Zuo Z, Cao D, Peng Y, Li Z, et al. Long noncoding RNA TPT1-AS1 promotes the progression and metastasis of colorectal cancer by upregulating the TPT1-mediated FAK and JAK-STAT3 signalling pathways. Aging (Albany NY). 2021;13(3):3779–97.10.18632/aging.202339Search in Google Scholar PubMed PubMed Central
[24] Kaddar T, Rouault JP, Chien WW, Chebel A, Gadoux M, Salles G, et al. Two new miR-16 targets: caprin-1 and HMGA1, proteins implicated in cell proliferation. Biol Cell. 2009;101(9):511–24.10.1042/BC20080213Search in Google Scholar PubMed
[25] Lin P, Li Q, Lv X, Qu J, Wang D, Li A, et al. HMGA1 promotes the development of esophageal squamous cell carcinoma by mediating miR-671-5p/lncRNA DLEU1. Panminerva Med. 2020.10.23736/S0031-0808.19.03843-6Search in Google Scholar PubMed
[26] Lin Y, Chen H, Hu Z, Mao Y, Xu X, Zhu Y, et al. miR-26a inhibits proliferation and motility in bladder cancer by targeting HMGA1. FEBS Lett. 2013;587(15):2467–73.10.1016/j.febslet.2013.06.021Search in Google Scholar PubMed
[27] Lin R, Shen W, Zhi Y, Zhou Z. Prognostic value of miR-26a and HMGA1 in urothelial bladder cancer. Biomed Pharmacother. 2014;68(8):929–34.10.1016/j.biopha.2014.10.003Search in Google Scholar PubMed
[28] Travis WD, Brambilla E, Nicholson AG, Yatabe Y, Austin JHM, Beasley MB, et al. The 2015 World Health Organization classification of lung tumors: impact of genetic, clinical and radiologic advances since the 2004 classification. J Thorac Oncol. 2015;10(9):1243–60.10.1097/JTO.0000000000000630Search in Google Scholar PubMed
[29] Wang X, Kan J, Han J, Zhang W, Bai L, Wu H. LncRNA SNHG16 functions as an oncogene by sponging MiR-135a and promotes JAK2/STAT3 signal pathway in gastric cancer. J Cancer. 2019;10(4):1013–22.10.7150/jca.29527Search in Google Scholar PubMed PubMed Central
[30] Wu W, Gao H, Li X, Zhu Y, Peng S, Yu J, et al. LncRNA TPT1-AS1 promotes tumorigenesis and metastasis in epithelial ovarian cancer by inducing TPT1 expression. Cancer Sci. 2019;110(5):1587–98.10.1111/cas.14009Search in Google Scholar PubMed PubMed Central
[31] Huang Y, Zheng Y, Shao X, Shi L, Li G, Huang P. Long non-coding RNA TPT1-AS1 sensitizes breast cancer cell to paclitaxel and inhibits cell proliferation by miR-3156-5p/caspase 2 axis. Hum Cell. 2021;34(4):1244–54.10.1007/s13577-021-00541-zSearch in Google Scholar PubMed
[32] Li Y, Sun Z, Liu B, Shan Y, Zhao L, Jia L. Tumor-suppressive miR-26a and miR-26b inhibit cell aggressiveness by regulating FUT4 in colorectal cancer. Cell Death Disease. 2017;8(6):e2892.10.1038/cddis.2017.281Search in Google Scholar PubMed PubMed Central
[33] Liu P, Tang H, Chen B, He Z, Deng M, Wu M, et al. miR-26a suppresses tumour proliferation and metastasis by targeting metadherin in triple negative breast cancer. Cancer Lett. 2015;357(1):384–92.10.1016/j.canlet.2014.11.050Search in Google Scholar PubMed
[34] Shen W, Song M, Liu J, Qiu G, Li T, Hu Y, et al. MiR-26a promotes ovarian cancer proliferation and tumorigenesis. PLoS One. 2014;9(1):e86871.10.1371/journal.pone.0086871Search in Google Scholar PubMed PubMed Central
[35] Shao Y, Li P, Zhu ST, Yue JP, Ji XJ, Ma D, et al. MiR-26a and miR-144 inhibit proliferation and metastasis of esophageal squamous cell cancer by inhibiting cyclooxygenase-2. Oncotarget. 2016;7(12):15173–86.10.18632/oncotarget.7908Search in Google Scholar PubMed PubMed Central
[36] Esposito F, De Martino M, Petti MG, Forzati F, Tornincasa M, Federico A, et al. HMGA1 pseudogenes as candidate proto-oncogenic competitive endogenous RNAs. Oncotarget. 2014;5(18):8341–54.10.18632/oncotarget.2202Search in Google Scholar PubMed PubMed Central
[37] Liu J, Mi B, Wang Y, Shi C, Mi X, Lu Y, et al. miR-26a suppresses osteosarcoma migration and invasion by directly targeting HMGA1. Oncol Lett. 2018;15(6):8303–10.10.3892/ol.2018.8359Search in Google Scholar PubMed PubMed Central
© 2023 the author(s), published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Articles in the same Issue
- Research Articles
- Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
- Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
- circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
- circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
- WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
- Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
- Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
- 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
- Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
- PVT1/miR-16/CCND1 axis regulates gastric cancer progression
- Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
- Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
- SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
- Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
- lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
- SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
- Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
- Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
- Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
- circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
- Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
- UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
- Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
- Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
- UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
- LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
- Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
- Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
- circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
- Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
- Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
- A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
- WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
- Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
- Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
- Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
- Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
- Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
- Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
- Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
- CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
- Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
- Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
- HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
- The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
- Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
- A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
- Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
- Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
- TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
- The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
- miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
- Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
- IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
- Comprehensive analysis of the role of SFXN family in breast cancer
- Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
- Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
- AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
- Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
- Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
- Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
- The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
- Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
- Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
- F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
- Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
- Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
- Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
- Cholesterol induces inflammation and reduces glucose utilization
- circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
- NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
- The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
- miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
- Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
- α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
- Changes of microbiota level in urinary tract infections: A meta-analysis
- Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
- Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
- Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
- Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
- Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
- Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
- Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
- An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
- Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
- Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
- PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
- miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
- lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
- Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
- Subjective well-being in informal caregivers during the COVID-19 pandemic
- Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
- Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
- Bladder cancer screening: The new selection and prediction model
- circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
- Prone position effect in intensive care patients with SARS-COV-2 pneumonia
- Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
- Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
- Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
- Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
- Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
- Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
- Clinical significance of serum MBD3 detection in girls with central precocious puberty
- Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
- Collagen treatment of complex anorectal fistula: 3 years follow-up
- LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
- Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
- SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
- A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
- circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
- hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
- Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
- lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
- Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
- Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
- Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
- Analysis of somatic mutations and key driving factors of cervical cancer progression
- Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
- Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
- Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
- Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
- Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
- Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
- Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
- Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
- The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
- Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
- Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
- The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
- Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
- Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
- Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
- The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
- Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
- Clinical characteristics of current COVID-19 rehabilitation outpatients in China
- Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
- miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
- The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
- Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
- The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
- Identification of cuproptosis-related genes for predicting the development of prostate cancer
- Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
- Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
- A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
- Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
- Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
- Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
- A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
- A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
- Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
- The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
- Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
- AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
- Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
- Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
- LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
- Factors associated with gastrointestinal dysmotility in critically ill patients
- Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
- Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
- Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
- Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
- Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
- The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
- Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
- Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
- Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
- Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
- Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
- Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
- D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
- WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
- Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
- Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
- Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
- Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
- Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
- Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
- A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
- Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
- A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
- Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
- The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
- Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
- CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
- Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
- KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
- Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
- The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
- Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
- Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
- Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
- Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
- Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
- Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
- lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
- Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
- The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
- The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
- Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
- MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
- Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
- Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
- Predictors of gastrointestinal complaints in patients on metformin therapy
- Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
- A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
- Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
- miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
- Clinical features and management of lymphoepithelial cyst
- Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
- ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
- Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
- The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
- Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
- Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
- Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
- miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
- Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
- Review Articles
- Prenatal diagnosis of fetal defects and its implications on the delivery mode
- Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
- Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
- Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
- Vitamin C and epigenetics: A short physiological overview
- Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
- Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
- Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
- Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
- The progress of autoimmune hepatitis research and future challenges
- METTL16 in human diseases: What should we do next?
- New insights into the prevention of ureteral stents encrustation
- VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
- Case Reports
- Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
- Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
- Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
- Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
- Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
- Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
- Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
- Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
- Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
- Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
- CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
- Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
- Anesthetic management of fetal pulmonary valvuloplasty: A case report
- Rapid Communication
- Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
- Erratum
- Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
- Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
- Retraction
- Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
- Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
- Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
- Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
- Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
- Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
- Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
- Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
- Special issue The evolving saga of RNAs from bench to bedside - Part I
- FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
- Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Articles in the same Issue
- Research Articles
- Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
- Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
- circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
- circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
- WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
- Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
- Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
- 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
- Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
- PVT1/miR-16/CCND1 axis regulates gastric cancer progression
- Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
- Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
- SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
- Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
- lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
- SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
- Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
- Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
- Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
- circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
- Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
- UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
- Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
- Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
- UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
- LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
- Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
- Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
- circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
- Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
- Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
- A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
- WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
- Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
- Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
- Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
- Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
- Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
- Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
- Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
- CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
- Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
- Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
- HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
- The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
- Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
- A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
- Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
- Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
- TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
- The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
- miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
- Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
- IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
- Comprehensive analysis of the role of SFXN family in breast cancer
- Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
- Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
- AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
- Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
- Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
- Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
- The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
- Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
- Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
- F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
- Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
- Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
- Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
- Cholesterol induces inflammation and reduces glucose utilization
- circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
- NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
- The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
- miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
- Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
- α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
- Changes of microbiota level in urinary tract infections: A meta-analysis
- Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
- Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
- Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
- Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
- Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
- Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
- Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
- An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
- Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
- Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
- PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
- miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
- lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
- Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
- Subjective well-being in informal caregivers during the COVID-19 pandemic
- Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
- Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
- Bladder cancer screening: The new selection and prediction model
- circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
- Prone position effect in intensive care patients with SARS-COV-2 pneumonia
- Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
- Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
- Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
- Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
- Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
- Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
- Clinical significance of serum MBD3 detection in girls with central precocious puberty
- Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
- Collagen treatment of complex anorectal fistula: 3 years follow-up
- LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
- Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
- SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
- A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
- circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
- hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
- Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
- lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
- Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
- Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
- Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
- Analysis of somatic mutations and key driving factors of cervical cancer progression
- Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
- Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
- Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
- Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
- Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
- Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
- Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
- Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
- The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
- Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
- Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
- The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
- Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
- Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
- Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
- The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
- Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
- Clinical characteristics of current COVID-19 rehabilitation outpatients in China
- Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
- miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
- The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
- Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
- The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
- Identification of cuproptosis-related genes for predicting the development of prostate cancer
- Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
- Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
- A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
- Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
- Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
- Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
- A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
- A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
- Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
- The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
- Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
- AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
- Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
- Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
- LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
- Factors associated with gastrointestinal dysmotility in critically ill patients
- Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
- Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
- Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
- Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
- Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
- The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
- Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
- Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
- Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
- Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
- Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
- Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
- D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
- WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
- Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
- Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
- Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
- Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
- Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
- Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
- A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
- Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
- A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
- Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
- The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
- Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
- CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
- Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
- KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
- Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
- The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
- Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
- Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
- Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
- Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
- Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
- Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
- lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
- Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
- The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
- The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
- Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
- MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
- Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
- Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
- Predictors of gastrointestinal complaints in patients on metformin therapy
- Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
- A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
- Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
- miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
- Clinical features and management of lymphoepithelial cyst
- Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
- ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
- Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
- The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
- Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
- Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
- Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
- miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
- Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
- Review Articles
- Prenatal diagnosis of fetal defects and its implications on the delivery mode
- Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
- Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
- Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
- Vitamin C and epigenetics: A short physiological overview
- Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
- Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
- Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
- Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
- The progress of autoimmune hepatitis research and future challenges
- METTL16 in human diseases: What should we do next?
- New insights into the prevention of ureteral stents encrustation
- VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
- Case Reports
- Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
- Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
- Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
- Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
- Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
- Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
- Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
- Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
- Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
- Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
- CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
- Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
- Anesthetic management of fetal pulmonary valvuloplasty: A case report
- Rapid Communication
- Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
- Erratum
- Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
- Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
- Retraction
- Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
- Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
- Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
- Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
- Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
- Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
- Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
- Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
- Special issue The evolving saga of RNAs from bench to bedside - Part I
- FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
- Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
