Home Medicine Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
Article Open Access

Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways

  • Yiyan Peng , Peng Li EMAIL logo , Wei Hu , Qi Shao , Panpan Li and Haiyue Wen
Published/Copyright: October 5, 2023
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 18 Issue 1

Abstract

Can the spinal cord stimulation (SCS) regulate the autonomic nerves through the endothelin-1 (ET-1) and nerve growth factor (NGF)/p75NTR pathways and thus inhibit the occurrence of atrial fibrillation (AF)? In our research, 16 beagles were randomly divided into a rapid atrial pacing (RAP) group (n = 8) and a RAP + SCS group (n = 8), and the effective refractory period (ERP), ERP dispersion, AF induction rate, and AF vulnerability window (WOV) at baseline, 6 h of RAP, 6 h of RAP + SCS were measured. The atrial tissue was then taken for immunohistochemical analysis to determine the localization of ET-1, NGF, p75NTR, NF-kB p65, and other genes. Our results showed that SCS attenuated the shortening of ERP in all parts caused by RAP, and after 6 h of SCS, the probability of AF in dogs was reduced compared with that in the RAP group. Moreover, the expression of ET-1, NGF, and p75NTR in the atrial tissues of dogs in the RAP + SCS group was significantly increased, but the expression of NF-kB p65 was reduced. In conclusion, SCS promotes the positive remodeling of cardiac autonomic nerves by weakening NFκB p65-dependent pathways to interfere with the ET-1 and NGF/p75NTR pathways to resist the original negative remodeling and inhibit the occurrence of AF.

Keywords: atrial fibrillation; spinal cord stimulation; autonomic nerves; nerve growth factor; endothelin-1; NF-kB p65; p75NTR

1 Introduction

Atrial fibrillation (AF) is the most common arrhythmia, and its basic pathophysiology includes electrical remodeling, structural reconstruction, and autonomic remodeling [1]. Previous studies have demonstrated that spinal nerve stimulation may inhibit rapid atrial pacing (RAP)-induced AF by inhibiting autonomic remodeling, and the mechanism of its action may be related to the expression of nerve growth factor (NGF) [2]. Many studies have found that cardiac autonomic nerve growth is closely related to NGF, and endothelin-1 (ET-1) can promote the synthesis of NGF by cardiomyocytes, thereby causing cardiac sympathetic abnormalities and altering cardiac autonomic imbalance [3,4,5], but the exact signaling pathway is unknown. This study aimed to use the spinal cord stimulation (SCS) of an AF dog model to determine whether the ET-1 and NGF/p75NTR pathways can promote the positive remodeling of cardiac autonomic nerves and affect the changes in atrial myocyte channel proteins, thereby changing the electrophysiological characteristics of the myocardium and promoting positive electrical remodeling of atrial muscle, so as to antagonize the negative effects of antigens, intervene in the triggering and maintenance of AF, and thus treat AF.

2 Materials and methods

Sixteen beagles ranging from 15 to 20 kg were used in this experiment. All procedures were performed under 3% sodium pentobarbital anesthesia with an initial dose of 1 mL/kg and a maintenance dose of 2 mL/h. The depth of anesthesia was monitored throughout the experiment by examining heart rate, respiratory rate, and toe crush responses. All dogs were endotracheally intubated and ventilated on a ventilator (MAO01746, Harvard Apparatus, Holliston, USA). A catheter was introduced into the left femoral artery to monitor the systemic arterial pressure, and the body surface electrocardiogram and blood pressure were recorded throughout the experiment with a computer laboratory system (Lead 2000B, Jingjiang Inc., Wuhan, China). Intravenous fluids were injected into the left femoral vein to maintain fluid loss. Dogs maintained the body nuclear temperature at 36.5 ± 1.5°C with open thoracotomy in the left and right thoracic fourth intercostal space.

2.1 Program stimulation

Acute atrial remodeling induced by 6 h RAP was performed at 1,200 beats/min (2 thresholds) in the left atrial appendage. The effective refractory period (ERP) in the atrial and pulmonary veins was determined by reducing S1–S2 with programmed stimulation of S1 = 330 ms, a 10-diastolic threshold. The S1–S2 interval was reduced by 10 ms from the initial 180 ms, followed by a 2 ms reduction when near the ERP. The window of vulnerability (WOV), a measure of the propensity for AF inducibility, was determined by the longest coupling interval of the premature beat (S1–S2) minus the shortest S1–S2, which induced AF. The cumulative WOV was the sum of WOVs at all sites in each dog [6,7,8]. AF was induced by the S1S1 (a procedure of 120, 100, and 75 ms cycle length for 5 s each and repeated three times for each frequency) (Figure 1). AF was defined as an irregular atrial rate >500 bpm lasting >5 s [9].

Figure 1 Schematic diagram of electrodes (a and b) and flow chart of experiments (c). AF = atrial fibrillation; ARGP = the right anterior ganglionic plexus; BH = baseline; ERP = effective refractory period; ILGP = the left lower ganglionic plexus; IRGP = what was found in the lower right ganglionic plexus; IVC = inferior vena cava; LA = left atrium; LAA = left atrial appendage; LIPV = left upper pulmonary vein left ventricle; PA = pulmonary artery; RA = right atrium; RAA = right atrial appendage; RIPV = the right lower pulmonary vein; RSPV = the right upper pulmonary vein; RV = right ventricle; SCS = spinal cord stimulation; SLGP = the left upper ganglionic plexus; SVC = superior vena cava; RAP = rapid atrial pacing; WOV = window of vulnerability; ΣWOV = cumulative WOV.
Figure 1

Schematic diagram of electrodes (a and b) and flow chart of experiments (c). AF = atrial fibrillation; ARGP = the right anterior ganglionic plexus; BH = baseline; ERP = effective refractory period; ILGP = the left lower ganglionic plexus; IRGP = what was found in the lower right ganglionic plexus; IVC = inferior vena cava; LA = left atrium; LAA = left atrial appendage; LIPV = left upper pulmonary vein left ventricle; PA = pulmonary artery; RA = right atrium; RAA = right atrial appendage; RIPV = the right lower pulmonary vein; RSPV = the right upper pulmonary vein; RV = right ventricle; SCS = spinal cord stimulation; SLGP = the left upper ganglionic plexus; SVC = superior vena cava; RAP = rapid atrial pacing; WOV = window of vulnerability; ΣWOV = cumulative WOV.

2.2 SCS

A small incision was made in the dorsal thoracic spine (T1–T2 level), and the thoracic epidural cavity was punctured with a Tuohy needle until the loss of resistance. The electrode was then introduced into the epidural cavity through this cannula, with the electrode tip oriented to the level of the T1–T2 spinal cord, slightly to the left of the midline. The end of the electrode was connected to a stimulator (S88, Grass Instruments, Quincy, MA) and to generate 50 Hz pulses with a 0.2 ms duration. Continuous stimulation occurred for 6 h.

2.3 Histological staining

At the end of the experiment, the atrial tissue was rapidly excised and fixed in 4% paraformaldehyde at room temperature. Paraffin-embedded tissue was cut into 5 μm sections. Immunofluorescence staining was used to determine the expression and localization of ET-1, NGF, p75NTR, NF-κB p65, and tyrosine hydroxylase (TH) in tissues. Sections were incubated in PBS containing 10% FBS for 60 min and incubated overnight with the primary antibody at 4°C, including anti-ET-1 (ABclonal, China), anti-NGF (Abcam, Cambridge, UK), anti-p75ntr (Abcam, Cambridge, UK), anti-NF-κB p65 (Abcam, Cambridge, UK), and anti-TH (Abcam, Cambridge, UK). Sections were washed with PBS and incubated with secondary antibodies for 1 h at 37°C. After the sections were washed, they were visualized using the DAB reagent. Hematoxylin was counterstained with cores dehydrated with ethanol and sealed with glycerol gelatin. Blinded analysis was performed using Image-Pro Plus 6.0 (Media Cybernetics).

2.4 mRNA analysis

Total RNA was obtained from atrial tissue using TRIzol reagent (Servicebio) and then reverse transcribed to cDNA. Finally, the PCR assay was performed. The primers are shown in Table 1. The relative expression level was calculated using the 2−ΔΔCt method.

Table 1

Primer sequences of the genes that were verified by RT-PCR

Primer name Forward sequence (5′–3′) Reverse sequence (5′–3′)
ET-1 CTGCTCCTGCTCTTCCCTGAT TGTGGTCTGTTGCCTTTGTGAT
TrkA GCTGTCTTTGCCTGCCTCTT GACAAGGAACTGCCACCTAATG
NGF TCCTTCCTGGGCATGGAATC ACAGCACTGTGTTGGCATAGA
P75NTR TGGACAGCGTGACGTTCTCC GATCTCCTCGCACTCGGCGT
NF-KB p65 GTGCAGAAAGAAGACATTGA AGGCTAGGGTCAGCGTATGG

2.5 Experimental scheme

The 16 beagles were randomly divided into two groups, one for 6 hours of rapid atrial pacing (n = 8) and the other group for 6 hours of rapid atrial pacing followed by 6 hours of spinal cord stimulation in the T1–T2 spinal cord level (delivered at 50 Hz, 0.1 ms pulse width, by approximately 90% of the motion threshold) (n = 8). Atrial electrophysiological parameters (ERP, ERP dispersion, and WOV) were measured at three time points: baseline, 6-h RAP, and 6-h RAP + 6-h SCS. Finally, the removed atrial tissue was used for protein blotting and messenger RNA (mRNA) analysis.

2.6 Data analysis

Measurement data of the study were expressed using the mean ± standard deviation and analyzed by paired t tests, with P < 0.05 considered statistically significant. Data analysis and plotting were performed using the Graphpad Prism software.

3 Results

3.1 Effect of SCS on ERP, ΣWOV, and AF inducible properties

In Figure 2, at the baseline, ERP was measured at any tissue site. SCS attenuated the shortening of the ERP at all sites caused by the RAP (Figure 2a–d). SCS caused an increase in ΣWOV (Figure 2e). After 6 h of RAP, AF was observed in three of the eight dogs in the RAP group and two of the eight dogs in the SCS + RAP group with AF (37.5% vs 25%, P > 0.05) (Figure 2f) (P < 0.05 compared with RAP group).

Figure 2 Effect of SCS on ERP (a–d), ΣWOV (e), and AF episodes (f) at all sites of the atrium. *P < 0.05.
Figure 2

Effect of SCS on ERP (a–d), ΣWOV (e), and AF episodes (f) at all sites of the atrium. *P < 0.05.

3.2 Effect of SCS on the molecules associated with the ET-1 signaling pathway

3.2.1 Localization and expression of ET-1, NGF, p75NTR, NF-κB p65, and TH in atrial tissue

The localization of ET-1, NGF, p75NTR, NF-κB p65, and TH in atrial tissue was determined by immunohistochemistry (Figure 3). Atrial tissue expression of ET-1 (Figure 3a and b), p75NTR (Figure 3c and d), NF-κB p65 (Figure 3e and f), NGF (Figure 3g and h), and TH (Figure 3i and j) in the RAP + SCS and RAP groups was found. The scale bar represents 50 μm. The figure shows the average optical density (mean density) data for various target proteins expressed as mean ± SD (Figure 4). The expression of ET-1, NGF, and p75NTR was higher in the RAP + SCS group than in the RAP group, and NF-κB p65 and TH expressions were lower than those in the RAP group. *P < 0.05.

Figure 3 Localization of ET-1 (a and b), NGF (c and d), p75NTR (e and f), NF-κB p65 (g and h), and TH (i and j) in the atrial tissue was determined by immunohistochemistry. Scale bar represents 50 μm.
Figure 3

Localization of ET-1 (a and b), NGF (c and d), p75NTR (e and f), NF-κB p65 (g and h), and TH (i and j) in the atrial tissue was determined by immunohistochemistry. Scale bar represents 50 μm.

Figure 4 Average optical densities of the various target proteins in the atrial tissue. *P < 0.05.
Figure 4

Average optical densities of the various target proteins in the atrial tissue. *P < 0.05.

3.2.2 mRNA expression of ET-1, NGF, TrkA, p75NTR, and NF-κB p65

As shown in left atrium (Figure 5a) and right atrium (Figure 5b), the mRNA expression of ET-1, NGF, and p75NTR was higher in the RAP + SCS group than in the RAP group (P < 0.05), and the mRNA expression of NF-κB p65 and trkA was lower in the RAP + SCS group than in the RAP group (P < 0.05).

Figure 5 mRNA levels of ET-1, NGF, p75NTR, NF-κB p65, and trkA, respectively, in the left atrium tissue (a) and in the atrium tissue (b). *P < 0.05.
Figure 5

mRNA levels of ET-1, NGF, p75NTR, NF-κB p65, and trkA, respectively, in the left atrium tissue (a) and in the atrium tissue (b). *P < 0.05.

4 Discussion

Autonomic nervous system (ANS) imbalance is one of the important mechanisms by which atrial arrhythmias occur [10]. Although pulmonary venous isolation is widely used for AF ablation, it is an invasive procedure with potentially serious complications. SCS is the delivery of electrical stimulation to spinal cord segments through implanted electrodes to treat a variety of painful conditions, including chronic back pain and intractable angina [11,12]. Recent studies have shown that SCS can be used to prevent the development of AF after cardiac surgery [13]. We controlled the development of AF by using a spinal cord-stimulating canine animal model to modulate the ANS imbalance. Previous studies have demonstrated that SCS has a direct effect on cardiac electrophysiology [2,14]. This study also confirmed that SCS breaks the vicious cycle of autonomic electrical remodeling and structural remodeling by inhibiting the shortening of atrial ERP and the expansion of WOV, thereby inhibiting negative autonomic remodeling and inhibiting the occurrence of AF.

ET-1 is an endogenous vasoconstrictor peptide, and local ET-1 production in the heart is secreted by the endocardium, myocardium, and coronary artery endothelium thereby acting on cardiomyocytes in paracrine and autocrine ways [15,16]. Previous studies have suggested that ET-1 may play a key role in the regulation of sympathetic activity and is associated with the development of sympathetic neurons [17,18,19,20]. NGF is a 118-amino acid glycoprotein composed of three subunits (α, β, and γ complexes), and β-NGF is responsible for its biological activity. NGF is associated with sympathetic distribution, and its increase triggers nerve germination in noninfarcted ventricles and atria [21]. Sympathetic overgermination may be an important factor in sympathetic remodeling leading to arrhythmias [22]. Elevated NGF levels and excessive sympathetic innervation lead to arrhythmias, including AF [5]. ET-1 has been shown to increase (NGF, mRNA, and protein levels during the development and regeneration of cardiac sympathetic innervation [5,23]. In this study, we found that the mRNA and protein expression of ET-1 and NGF in the atrial tissue of beagle dogs with SCS RAP for 6 h was elevated, indicating that SCS can activate the ET-1 and NGF signaling pathways.

The receptors of cardiac NGF are divided into the high affinity receptor TrkA and the low affinity tumor necrosis factor receptor P75NTR [24], which maintain cardiac sympathetic neuron growth and are closely related to stimulating axon regeneration. NGF/TrkA signaling plays an important role in enhancing normal cardiac calcium circulation and the normal function of the cardiovascular system [25,26]. Studies have demonstrated that NGF/TrKA signaling is associated with the development of AF [27]. In this study, the expression of p75NTR in the SCS group was higher than that in the RAP group, and the TrkA expression was lower than that in the RAP group, indicating that NGF in the SCS group mainly binds to p75NTR. Therefore, we speculate that the activation of ET-1 and NGF/p75NTR is closely related to the regulation of cardiac autonomic remodeling by SCS.

Nuclear factor kappa B (NF-κB) is a family of dimer transcription factors, and the NF-κB transcription factor system plays various roles in nervous system development and postnatal physiological processes [28]. Nuclear factor-κB p65 (NF-κB p65) activation can upregulate cardiac NGF and promote sympathetic innervation [29,30]. This study showed that the expression of NF-κB p65 was reduced in the SCS group, demonstrating that the activation of NF-κB p65 was inhibited, thus inhibiting the sympathetic nerve growth. The present study also showed that TH expression was significantly reduced in the SCS group, further confirming that sympathetic nerve growth was inhibited. All these results indicate that the ET-1 and NGF/p75NTR signaling pathways in the SCS can attenuate the sympathetic innervation through the NF-κB p65-dependent pathway and promote positive remodeling of the cardiac autonomic nerve to resist the original negative remodeling and inhibit the occurrence of AF.

4.1 Clinical significance of this study

This study further explored the mechanism of ET-1 and NGF/p75NTR-dependent pathways in SCS in AF, providing more beneficial effects for future SCS in regulating the cardiac ANS.

4.2 Research restrictions

This study has some limitations. First, this experiment was performed under general anesthesia. Based on previous research, plasma pentobarbital concentration in this experiment speeded up and slowed down early repolarization and reduce the amplitude of the action potential [31,32,33]. In the future, we hope to design experiments at anesthetic concentrations that do not affect changes in dog electrophysiology. Second, the expression levels of cardiac molecular substances in normal animals (beagle dogs not receiving RAP) were not measured in this study. To provide a comprehensive comparison, we plan to measure the expression levels of cardiac molecular substances in normal animals (beagle dogs not receiving RAP).

# Contributed equally.

  1. Funding information: Health commission of Hubei Province scientific research project (WJ2019H155).

  2. Conflict of interest: All authors declare no support from any organization for the submitted work, no financial relationships with any organizations that might have an interest in the submitted work in the previous 3 years, and no other relationships or activities that could appear to have influenced the submitted work.

  3. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Wakili R, Voigt N, Kääb S, Dobrev D, Nattel S. Recent advances in the molecular pathophysiology of atrial fibrillation. J Clin Invest. 2011;121(8):2955–68. 10.1172/jci46315.Search in Google Scholar PubMed PubMed Central

[2] Wang S, Zhou X, Huang B, Wang Z, Zhou L, Chen M, et al. Spinal cord stimulation suppresses atrial fibrillation by inhibiting autonomic remodeling. Heart Rhythm. 2016;13(1):274–81. 10.1016/j.hrthm.2015.08.018.Search in Google Scholar PubMed

[3] Pius-Sadowska E, Machaliński B. Pleiotropic activity of nerve growth factor in regulating cardiac functions and counteracting pathogenesis. ESC Heart Fail. 2021;8(2):974–87. 10.1002/ehf2.13138.Search in Google Scholar PubMed PubMed Central

[4] Oliveira NK, Ferreira RN, Lopes SDN, Chiari E, Da Silva Camargos ER, Martinelli PM. Cardiac autonomic denervation and expression of neurotrophins (NGF and BDNF) and their receptors during experimental Chagas disease. Growth Factors. 2017;35(4–5):161–70. 10.1080/08977194.2017.1395420.Search in Google Scholar PubMed

[5] Ieda M, Fukuda K, Hisaka Y, Kimura K, Kawaguchi H, Fujita J, et al. Endothelin-1 regulates cardiac sympathetic innervation in the rodent heart by controlling nerve growth factor expression. J Clin Invest. 2004;113(6):876–84. 10.1172/jci19480.Search in Google Scholar PubMed PubMed Central

[6] Lu Z, Scherlag BJ, Lin J, Niu G, Fung KM, Zhao L, et al. Atrial fibrillation begets atrial fibrillation autonomic mechanism for atrial electrical remodeling induced by short-term rapid atrial pacing. Circ Arrhythm Electrophysiol. 2008;1(3):184–92. 10.1161/circep.108.784272.Search in Google Scholar

[7] Sheng X, Scherlag BJ, Yu L, Li S, Ali R, Zhang Y, et al. Prevention and reversal of atrial fibrillation inducibility and autonomic remodeling by low-level vagosympathetic nerve stimulation. J Am Coll Cardiol. 2011;57(5):563–71. 10.1016/j.jacc.2010.09.034.Search in Google Scholar PubMed

[8] Yu L, Scherlag BJ, Yu S, Li S, Sharma T, Nakagawa H, et al. Interactions between atrial electrical remodeling and autonomic remodeling: how to break the vicious cycle. Heart Rhythm. 2012;9(5):804–9. 10.1016/j.hrthm.2011.12.023.Search in Google Scholar PubMed

[9] Wang X, Zhao Q, Huang H, Tang Y, Xiao JK, Dai M, et al. Effect of renal sympathetic denervation on atrial substrate remodeling in ambulatory canines with prolonged atrial pacing. PLoS One. 2013;8(5):e64611. 10.1371/journal.pone.0064611.Search in Google Scholar PubMed PubMed Central

[10] Chen PS, Chen LS, Fishbein MC, Lin SF, Nattel S. Role of the autonomic nervous system in atrial fibrillation: pathophysiology and therapy. Circ Res. 2014;114(9):1500–15. 10.1161/circresaha.114.303772.Search in Google Scholar PubMed PubMed Central

[11] Woolf CJ. Pain modulation in the spinal cord. Front Pain Res (Lausanne). 2022;3:984042. 10.3389/fpain.2022.984042.Search in Google Scholar PubMed PubMed Central

[12] Aryal V, Poudel S, Zulfiqar F, Shrestha T, Singh A, Shah SA, et al. Updates on the role of spinal cord stimulation in the management of non-surgical chronic lower back pain. Cureus. 2021;13(10):e18928. 10.7759/cureus.18928.Search in Google Scholar PubMed PubMed Central

[13] Romanov A, Лoмивopoтoв BH, Chernyavskiy AM, Murtazin V, Kliver E, Ponomarev D, et al. Temporary spinal cord stimulation to prevent postcardiac surgery atrial fibrillation: 30-day safety and efficacy outcomes. J Am Coll Cardiol. 2022;79(7):754–6. 10.1016/j.jacc.2021.08.078.Search in Google Scholar PubMed

[14] Bernstein S, Wong BYL, Vasquez C, Rosenberg SP, Rooke R, Kuznekoff LM, et al. Spinal cord stimulation protects against atrial fibrillation induced by tachypacing. Heart Rhythm. 2012;9(9):1426–33.e3. 10.1016/j.hrthm.2012.04.038.Search in Google Scholar PubMed PubMed Central

[15] Evans HG, Lewis MJ, Shah A. Modulation of myocardial relaxation by basal release of endothelin from endocardial endothelium. Cardiovasc Res. 1994;28(11):1694–9. 10.1093/cvr/28.11.1694.Search in Google Scholar PubMed

[16] Suzuki T, Kumazaki T, Mitsui Y. Endothelin-1 is produced and secreted by neonatal rat cardiac myocytes in vitro. Biochem Biophys Res Commun. 1993;191(3):823–30. 10.1006/bbrc.1993.1291.Search in Google Scholar PubMed

[17] Wang Z, Li S, Lai H, Zhou L, Meng G, Wang M, et al. Interaction between endothelin-1 and left stellate ganglion activation: a potential mechanism of malignant ventricular arrhythmia during myocardial ischemia. Oxid Med Cell Longev. 2019;2019:1–11. 10.1155/2019/6508328.Search in Google Scholar PubMed PubMed Central

[18] Abukar Y, May CN, Ramchandra R. Role of endothelin-1 in mediating changes in cardiac sympathetic nerve activity in heart failure. Am J Physiol Regul Integr Comp Physiol. 2016;310(1):R94–9. 10.1152/ajpregu.00205.2015.Search in Google Scholar PubMed

[19] Makita T, Sucov HM, Gariepy CE, Yanagisawa M, Ginty DD. Endothelins are vascular-derived axonal guidance cues for developing sympathetic neurons. Nature. 2008;452(7188):759–63. 10.1038/nature0685.Search in Google Scholar

[20] Ieda M, Fukuda K, Hisaka Y, Kimura K, Kawaguchi H, Fujita J, et al. Endothelin-1 regulates cardiac sympathetic innervation in the rodent heart by controlling nerve growth factor expression. J Clin Investig. 2004;113(6):876–84. 10.1172/jci19480.Search in Google Scholar

[21] Miyauchi Y, Zhou S, Okuyama Y, Miyauchi M, Hayashi H, Hamabe A, et al. Altered atrial electrical restitution and heterogeneous sympathetic hyperinnervation in hearts with chronic left ventricular myocardial infarction: implications for atrial fibrillation. Circulation. 2003;108(3):360–6. 10.1161/01.cir.0000080327.32573.7c.Search in Google Scholar PubMed

[22] Li C, Li YG. Cardiac sympathetic nerve sprouting and susceptibility to ventricular arrhythmias after myocardial infarction. Cardiol Res Pract. 2015;2015:1–8. 10.1155/2015/698368.Search in Google Scholar PubMed PubMed Central

[23] Lee TM, Chen CC, Lin MS, Chang NC. Effect of endothelin receptor antagonists on ventricular susceptibility in postinfarcted rats. Am J Physiol Heart Circ Physiol. 2008;294(4):H1871–9. 10.1152/ajpheart.01129.2007.Search in Google Scholar PubMed

[24] Cui X, Chen L, Ren Y, Ji Y, Liu W, Liu J, et al. Genetic modification of mesenchymal stem cells in spinal cord injury repair strategies. Biosci Trends. 2013;7(5):202–8.10.5582/bst.2013.v7.5.202Search in Google Scholar

[25] Feng N, Huke S, Zhu G, Tocchetti CG, Shi S, Aiba T, et al. Constitutive BDNF/TrkB signaling is required for normal cardiac contraction and relaxation. Proc Natl Acad Sci U S A. 2015;112(6):1880–5. 10.1073/pnas.1417949112.Search in Google Scholar PubMed PubMed Central

[26] Hou Y, Jia L, Zhang Y, Ji W, Li H. Activation of the NGF/TrkA signaling pathway attenuates diabetic erectile dysfunction. Oncotarget. 2017;8(62):105692–702. 10.18632/oncotarget.22389.Search in Google Scholar PubMed PubMed Central

[27] Wang Q, Zhao Y, Dong X, Liu C, Zhou L, Zou C, et al. The occurrence of valvular atrial fibrillation: involvement of NGF/TrKA signaling pathway. J Invest Surg. 2021;34(12):1379–86. 10.1080/08941939.2020.1798570.Search in Google Scholar PubMed

[28] Teng FYH, Tang BL. NF-kappaB signaling in neurite growth and neuronal survival. Rev Neurosci. 2010;21(4):299–313. 10.1515/revneuro.2010.21.4.299.Search in Google Scholar PubMed

[29] Wang Y, Suo F, Liu J, Hu H, Xue M, Cheng WC, et al. Myocardial infarction induces sympathetic hyperinnervation via a nuclear factor-kappaB-dependent pathway in rabbit hearts. Neurosci Lett. 2013;535:128–33. 10.1016/j.neulet.2012.12.059.Search in Google Scholar PubMed

[30] Wang Y, Tan J, Yin J, Hu H, Shi Y, Wang Y, et al. Targeting blockade of nuclear factor-κB in the hypothalamus paraventricular nucleus to prevent cardiac sympathetic hyperinnervation post myocardial infarction. Neurosci Lett. 2019;707:134319. 10.1016/j.neulet.2019.134319.Search in Google Scholar PubMed

[31] Kiba T. Effects of thiopental and pentobarbital sodium on the transmembrane potentials of the rabbit’s atria in special reference to interaction with catecholamine. Jpn J Pharmacol. 1966;16(4):368–79. 10.1254/jjp.16.368.Search in Google Scholar PubMed

[32] Chiba S, Nakajima T. Effect of sodium pentobarbital on the SA nodal activity of the dog heart in vivo. Tohoku J Exp Med. 1972;106(4):381–5. 10.1620/tjem.106.381.Search in Google Scholar PubMed

[33] Urthaler F, Krames BL, James TN. Selective effects of pentobarbital on automaticity and conduction in the intact canine heart. Cardiovasc Res. 1974;8(1):46–57. 10.1093/cvr/8.1.46.Search in Google Scholar PubMed

Received: 2023-06-05
Revised: 2023-09-06
Accepted: 2023-09-08
Published Online: 2023-10-05

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
https://doi.org/10.1515/med-2023-0802
Keywords for this article
atrial fibrillation; spinal cord stimulation; autonomic nerves; nerve growth factor; endothelin-1; NF-kB p65; p75NTR
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2026 De Gruyter Brill
Downloaded on 5.1.2026 from https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0802/html
Scroll to top button