Home Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
Article Open Access

Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics

  • Yi Li , Xiwen Zhou and Zhi Lyu EMAIL logo
Published/Copyright: October 5, 2023

Abstract

Small-cell lung cancer (SCLC) has a poor prognosis and can be diagnosed with systemic metastases. Nevertheless, the molecular mechanisms underlying the development of SCLC are unclear, requiring further investigation. The current research aims to identify relevant biomarkers and available drugs to treat SCLC. The bioinformatics analysis comprised three Gene Expression Omnibus datasets (including GSE2149507, GSE6044, and GSE30219). Using the limma R package, we discovered differentially expressed genes (DEGs) in the current work. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analyses were made by adopting the DAVID website. The DEG protein–protein interaction network was built based on the Search Tool for the Retrieval of Interacting Genes/Proteins website and visualized using the CytoHubba plugin in Cytoscape, aiming to screen the top ten hub genes. Quantitative real-time polymerase chain reaction was adopted for verifying the level of the top ten hub genes. Finally, the potential drugs were screened and identified using the QuartataWeb database. Totally 195 upregulated and 167 downregulated DEGs were determined. The ten hub genes were NCAPG, BUB1B, TOP2A, CCNA2, NUSAP1, UBE2C, AURKB, RRM2, CDK1, and KIF11. Ten FDA-approved drugs were screened. Finally, two genes and related drugs screened could be the prospective drug targets for SCLC treatment.

1 Introduction

Lung cancer refers to one of the most commonly seen cancers globally, showing high morbidity and mortality rates. Each year, around 2.2 million new cases of lung cancer as well as over 1.8 million lung cancer deaths are reported across the world [1]. Small-cell lung cancer (SCLC) is considered a type of lung cancer. It occupies 15% of all lung cancer-related deaths. Most SCLC patients exhibit systemic metastases at the time of diagnosis. As a result, its 5 year survival rate is around 5% [2,3]. Chemotherapy for SCLC frequently fails because SCLC is drug-resistant, which further deteriorates therapeutic outcomes [4]. On the other hand, for the immune surveillance mechanism of SCLC, although the recent immune insertion point blockers for SCLC patients have brought hope for the treatment of SCLC, it only benefits a small number of SCLC patients, not for most of SCLC patients [5]. Therefore, it is essential to develop efficient diagnostic techniques and treatment strategies for SCLC patients.

High-throughput genome sequencing has enabled significant advancements in the diagnosis and therapy of cancer [6]. Following the analysis of clinical and molecular sequencing data, bioinformatic methods can provide new ideas for understanding cancer development. To date, with the development of bioinformatics, there are many studies on SCLC, not only on target genes [79] but also on non-coding RNA (ncRNA) [10], and genome-wide studies on SCLC [11]. Although the current research results have enabled us to further understand the molecular level of SCLC, it is still not effective for studying the biological process of SCLC. The molecular mechanisms of SCLC have not been completely illustrated.

The term “drug repositioning” refers to the process of using an FDA-approved drug to treat a disease or condition that is beyond its current indication [12]. The development of new antineoplastic drugs has stalled because of the high cost and time to market, as well as drug toxicity and therapeutic effects [13]. “Drug repositioning” has inspired the use of novel approaches to cancer treatment [14]. For example, disulfide, a drug used for treating alcoholism, has been discovered to exhibit antitumor activity against non-small cell lung cancer (NSCLC), liver cancer, breast cancer, prostate cancer, pancreatic cancer, glioblastoma, as well as melanoma [15]. Another example is chlorpromazine, a high-dose antipsychotic drug approved by FDA as an antineoplastic drug [16]. Therefore, we hypothesized that FDA-approved drugs could be tested using bioinformatic techniques to develop novel antineoplastic drugs for SCLC.

As the molecular regulation is still unknown, the therapeutic effects of drugs are limited. Therefore, it is necessary to detect biomarkers and drugs to treat SCLC. In the current work, bioinformatics analysis was adopted for discovering promising biomarkers and available drugs for SCLC. We selected three microarray datasets from the Gene Expression Omnibus (GEO) database for analysis and also identified differentially expressed genes (DEGs) between the SCLC groups and normal groups. We further performed Gene Ontology (GO) annotation, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway annotation, as well as protein–protein interaction (PPI) analysis. Finally, the possible biomarkers were identified, and potential drugs related to the treatment of SCLC were screened. Figure 1 presents the workflow of the current study.

Figure 1 
               Workflow chart of integrative bioinformatics in this study.
Figure 1

Workflow chart of integrative bioinformatics in this study.

2 Materials and methods

2.1 SCLC dataset

A large amount of gene expression data, such as microarray and high-throughput data, are stored in the GEO database [17]. GSE149507, GSE6044, and GSE30219 were downloaded from the GEO database. In addition, the platform adopted for the microarray dataset was GPL23270 (Affymetrix Human Genome U133 Plus 2.0 Array). GSE149507 includes 36 samples, among which 18 are tumor tissue samples, with 18 being normal tissue samples. GSE6044 includes nine SCLC tissue samples and five normal lung tissue samples. There are 21 lung SCLC samples and 14 non-tumoral lung samples in the GSE30219 dataset.

2.2 Identification of DEGs

For the purpose of identifying DEGs, we adopted the limma R package. Genes with |logFC| > 2, and p-value < 0.05 were regarded to be DEGs. Genes with downregulated expression in DEGs were assigned logFC < −2, and genes with upregulated expression were assigned logFC > 2. Venn software was used to filter the overlapping DEGs in the three sets of data.

2.3 Biological function analysis and pathway enrichment analysis

As an online data analysis website, DAVID (https://david.ncifcrf.gov/) was adopted for performing the GO and KEGG pathway enrichment analysis [18]. Statistical significance was detected at P < 0.05.

2.4 PPI network construction and selection of hub genes

The STRING database (http://string-db.org) integrates various proteins to construct their interaction networks [19]. In the current work, we created a network of interacting DEGs using STRING software. The interaction network created by DEGs was visualized based on Cytoscape software (http://www.cytoscape.org/) [20]. In addition, the top ten hub genes (scores > 2) were screened with the Hubba plugin in Cytoscape [21].

2.5 Screening of existing drugs

In this study, the QuartataWeb (http://quartata.csb.pitt.edu/) integrates, organizes, and displays drug-gene interactions and gene-pharmaceutical information from the stick and drug bank [22]. Through the database and support from previous literature, the top ten hub genes were screened for similarities to existing or failed FDA-approved drugs.

2.6 Cell culture

Normal human lung cell line (HLF-a) and human typical SCLC cell line (NCI-H1688) were purchased from Procell (Wuhan, China). Procell offered all cells and their special culture medium. In addition, all the cells were cultivated at 37°C in a humid environment with the concentration of 5% CO2 and were exposed to STR profiling.

2.7 RNA extraction and quantitative real-time polymerase chain reaction (qRT-PCR)

Using TRIzol reagent, total RNA was isolated from HLF-a and H1688 cells (Invitrogen, CA, USA). By adopting a PrimeScript Reverse Transcriptase Reagent Kit, we performed reverse transcription (RT) of complementary DNA (cDNA) (TakaRa, Tokyo, Japan). In addition, cDNA aliquots were amplified with SYBR Green PCR Master Mix (TaKaRa, Tokyo, Japan). GAPDH acted as an endogenous control. Table 1 presents the sequence of positive and antisense primers involved.

Table 1

Primers used for qRT-PCR

Gene Primer Sequence 5′–3′
NCAPG Forward CTCAGGGGTGTAAAAGCAACCCAAG
Reverse ATCACTTTCAGAGTCGGCTTCAGCA
BUB1B Forward ATCCTGGCTAACTGTTCTTCTCCCT
Reverse TGGCTAAGTTTCCAGAAGGACCCAT
TOP2A Forward AATGCTCAGCTCTTTGGCTCGATTG
Reverse AATGTACCATTCAGGCTCAACACGC
CCNA2 Forward ACCAAGAAACAAGTTCTGAGAATGGAGC
Reverse AGGCTGCTGATGCAGAAAGTATTGG
NUSAP1 Forward AGCAAAGGTTTTGGGAATGCGAAGG
Reverse TCGTGACTAAAGTGGGGATGACAGC
UBE2C Forward GTTCCTGTCTCTCTGCCAACGC
Reverse TCATCAGCTCCTGCTGTAGCCTTTT
AURKB Forward CGAACAGCCACGATCATGGAGGAG
Reverse CTCCCTTGAGCCCTAAGAGCAGATT
RRM2 Forward TAGGCGAGTATCAGAGGATGGGAGT
Reverse CAGCCAAGTAAGGGCACATCTTCAG
CDK1 Forward TCCTACAGGGGATTGTGTTTTGTCA
Reverse AGGTATTCCAAAAGCTCTGGCAAGG
KIF11 Forward GCGGGGTTCCATTTTTCCAGCATA
Reverse GTTGATCTGGGCTCGCAGAGGTAAT

3 Results

3.1 Identification of DEGs

The R limma package identified DEGs from the three datasets based on the filtering conditions. There were 22,189 DEGs in GSE30219, 8,563 of which were upregulated and 13,626 of which were downregulated. GSE149507 had 672 DEGs, of which 378 showed upregulation and 294 presented downregulation. GSE6044 has 8,537 DEGs, with 3,874 upregulated and 4,657 downregulated (Figure 2). By intersecting these DEGs using the Venn diagram, 362 overlapping DEGs were acquired, including 195 upregulated genes and 167 downregulated genes (Figure 3, Table 2). Normalization has been performed before obtaining overlapping DEGs.

Figure 2 
                  Volcano plot of differentially expressed genes between SCLC tissues and normal lung tissues in datasets GSE6044, GSE30219, and GSE149507. Red denotes genes with high expression in tumor tissues, and blue stands for low expression in tumor tissues. (a) GSE6044; (b) GSE30219; and (c) GSE149507.
Figure 2

Volcano plot of differentially expressed genes between SCLC tissues and normal lung tissues in datasets GSE6044, GSE30219, and GSE149507. Red denotes genes with high expression in tumor tissues, and blue stands for low expression in tumor tissues. (a) GSE6044; (b) GSE30219; and (c) GSE149507.

Figure 3 
                  A total of 363 DEGs were found in the three databases (GSE149507, GSE6044, and GSE30219).
Figure 3

A total of 363 DEGs were found in the three databases (GSE149507, GSE6044, and GSE30219).

Table 2

Identified DEGs

DEGs* Gene name
Upregulated RAB33A, SMC2, TYMS, GNAZ, HMGB3, CDC7, CHEK1, PRAME, TPH1, HRASLS, GMNN, CA9, MB, KIF20A, COL10A1, CTNNA2, ESRRG, HOXB2, CXCL9,DLK1, CDC45, HOXD10, CHRNA5, PAX9, PAX6, RFC4, TFF3, CBFA2T2, ORC1, KCNB2, CAMK2B, PFN2, TROAP, FZD3, ONECUT2, HIST1H2BH, CDK5R1, MYBL2, OLE2, RAD54L, ELOVL4, AMPH, PCSK1N, PTH2R, PROX1, AURKB, AURKA, FEN1, EPHA7, ADGRB2, DSP, CALCA, GREM1, SNAP25, PRDM13, MCM2, CDKN2A, HIST1H2AE, PROM1, ELAVL4, KCNK12,CALB1, LMNB1, ENO2, PCSK2, ELAVL2, FBXO5, UCHL1, CST1, WASF1, KCNA1, BIK, PMAIP1, CDK1, ACTL6B, RNASEH2A, AP3B2, HOXD11, KCNJ6, EYA2, CENPF, ORC6, CRMP1, TRIP13, NPTX1, PSAT1, SCN2A, BIRC5, NRCAM, RACGAP1, ADCYAP1, MNX1, KCNC1, RGS7, DDX25, COCH, ACYP1, CD24, ELAVL3, EEF1A2, SLCO5A1, SALL1, CENPE, KCNMB2, MKI67, STIL, DNAJC12, CDC6, CRYBA2, HMP19, CCNA2, RBFOX1, RPRM, POU3F2, CELSR3, NKX2, HOXA10, GAD1, RAB3B, SCG5, RAD51AP1,HMMR, DLX6, EXO1, GPR19, PTTG1, MAD2L1, PTTG3P, DDC, NEUROD1, KIF5C, NEK2, NDC80, CEL, PCDH8, ADAMDEC1, GHRH, SPOCK1, FOXG1, NCAPG, MAGEA12, SH3GL2, KIF4A, CDKN3, ZWINT, KIF2C, KIF23, UGT8, KIF15, TOP2A, RRM2, COL11A1, SCG2, CALCB, EZH2, DCX, RGS17, CHGB, NUSAP1, SYT1, CDH2,KIF11, BUB1B, PRC1, CCNE2, ESPL1, DLX5, CDC20, UBE2C, GRP, STMN2, CXCL13, TPX2, LHX2, POU4F1, TTK, SOX11, PBK, PCP4, NMU, INA, TAGLN3, CLGN, GNG4, MAGEA6, SCGN, ASCL1, RIPPLY3, ISL1, PCSK1, MMP12, SCG3, NOL4, INSM1, CHGA
Downregulated WIF1, PPBP, CLDN18, SCGB1A1, CPB2, PLA2G1B, SFTPC, AGER, SFTPD, TNNC1, PGC, AQP4, CYP4B1, CPA3, HPGD, CA3, SLC6A4, FCGR3B, CLIC3, FOLR1, SDPR, SCN7A, ANXA3, C4BPA, CA4, OLR1, TYRP1, CEACAM6, FABP4, SFTPB, PTGS2, ACADL, BMP5, SLPI, FOSB, SCEL, AGTR1, CH25H, GPX3, TCF21, GPRC5A, ZBTB16, HCAR3, GDF10, LYVE1, ADH1B, SELENBP1, CAV1, ADIRF, MMRN1, AOC3, MSLN, FXYD1, GHR, FLRT3, HSD17B6, EMCN, SLC34A2, MRC1, NR3C2, EDNRB, SLC6A14, CFD, FOXF2, HPGDS, RNASE4, SLC19A3, ADAMTS1, ICAM4, SRPX, GNG11, VGLL3, PPARG, MAOA, LAMP3, CA2, C7, FBLN5, BCHE, AQP1, MS4A2, S1PR1, TRHDE, CNTN6, CD52, CDH5, SLC16A4, CAV2, CLDN5, S100A4, HYAL1, FCN3, HLF, KCNJ15, JAM2, CPM, WISP2, SLC1A1, PTGDS, HIGD1B, F3, S100A14, CD93, FMO3, CACNA2D2, ZFPM2, STX11, CFP, CD36, RETN, RASSF9, RGN, S100P, DPP4, SPARCL1, SGCG, BMP2, SOCS2, S100A10, ALOX5AP, ITGAM, WFDC1, FHL1, CCDC68, SELE, IL33, TFPI, ANKRD1, LPL, TRPC6, MARCO, CD55, CXCL3, ADRB2, PIGR, ROS1, FOXF1, CST6, PROS1, PDK4, GSTA1, CDO1, ATP1A2, FAM107A, S100A12, FBP1, YAP1, IL6, ANG, SLCO2A1, TGFBR3, TREM1, VSIG4, PLSCR4, CFH, EMP1, P2RY1, ALDH2, PCOLCE2, FCN1, CTSH, TFPI2, MUC1, ABCG2

*DEGs, differentially expressed genes.

3.2 Biological function analysis and pathway enrichment analysis

GO analysis focused on “positive regulation of gene expression,” “positive regulation of transcription from RNA polymerase II promoter,” “cell division,” and “negative regulation of transcription from RNA polymerase II promoter” for biological process (BP) annotation. Moreover, it was abundant in the “extracellular space,” “extracellular region,” “plasma membrane,” “cytoplasm,” “nucleus,” and “nucleoplasm,” according to the cellular component (CC) annotation. In molecular function (MF) annotation, “protein binding,” “identical protein binding,” and “DNA binding” were clustered (Table 3). DEGs are primarily enriched in “Cell cycle,” “Complement and coagulation cascades,” and “Human T-cell leukemia virus 1 infection” in the KEGG pathway (Table 4).

Table 3

GO analysis

Category Term Counts Ratio P value
BP * 0010628∼positive regulation of gene expression 20 5.62 0.003
0045944∼positive regulation of transcription from RNA polymerase II promoter 43 12.08 4.08 × 10−5
0051301∼cell division 25 7.02 1.67 × 10−7
0000122∼negative regulation of transcription from RNA polymerase II promoter 33 9.02 8.90 × 10−4
CC1 0005615∼extracellular space 83 23.31 8.24 × 10−15
0005576∼extracellular region 81 22.75 9.85 × 10−12
0005886∼plasma membrane 123 34.55 1.70 × 10−5
0005737∼cytoplasm 124 34.83 7.86 × 10−4
0005634∼nucleus 127 35.67 0.004
0005654∼nucleoplasm 87 24.44 0.010
MF2 0005515∼protein binding 272 76.40 1.95 × 10−6
0042802∼identical protein binding 52 14.61 4.39 × 10−4
0003677∼DNA binding 40 11.24 0.003

*BP, Biology Process; CC1, Cellular Component; MF2, Molecular Function. Term: Term is the basic unit of GO, and each term corresponds to a GO class name, which is an attribute. Counts: The total number of genes enriched in this Go term. Ratio: Ratio represents the proportion of genes enriched in the Go term to the total genes. P value: P value represents significance, and P value < 0.05 is considered to be statistically significant for genes enriched in this term.

Table 4

KEGG pathway enrichment analysis

Category Term Counts Ratio P value
KEGG 04110: Cell cycle 17 4.78 6.62 × 10−8
04610: Complement and coagulation cascades 11 3.09 4.10 × 10−5
_ 05166: Human T-cell leukemia virus 1 infection 10 2.81 0.097

Term: Category of the pathway in KEGG pathway enrichment analysis. Counts: The total number of genes enriched in the pathway. Ratio: The proportion of genes enriched in the pathway to the total genes. P value: Significance enriched to pathways. P value < 0.05 was considered to be statistically significant for genes enriched in the pathway. From large to small, the degree of enrichment becomes more and more significant.

3.3 Construction of protein network and selection of hub gene

Blue nodes represent downregulated genes, whereas orange nodes stand for upregulated genes (Figure 4a and b). A total of 156 genes or nodes and 1,420 edges were enriched in the network. NCAPG, BUB1B, TOP2A, CCNA2, NUSAP1, UBE2C, AURKB, RRM2, CDK1, and KIF11 were the top ten hub genes (Figure 4b). Besides, all the parameters were set by default in the CytoHubba.

Figure 4 
                  The construction of PPI network and significant gene modules analysis. (a) The PPI networks of differentially expressed genes and (b) the top ten genes in the PPI networks. The orange nodes represented upregulated genes, while the blue ones represented downregulated genes.
Figure 4

The construction of PPI network and significant gene modules analysis. (a) The PPI networks of differentially expressed genes and (b) the top ten genes in the PPI networks. The orange nodes represented upregulated genes, while the blue ones represented downregulated genes.

3.4 Screening for existing drugs that target the ten genes

Ten hub genes were matched with existing drugs using the drug–gene interaction module in the QuartataWeb database. Only two genes, TOP2A and RRM2, were found and matched to ten estimated medicinal drugs (Teniposide, Etoposide, Daunorubicin, Doxorubicin, Amrubicin, Dactinomycin, Epirubicin, Idarubicin, Cladribine, and Gallium nitrate) (Table 5). Screening criteria were: drug–gene interaction cut-off p < 0.05 and support from previous literature (Table 6).

Table 5

Significant drugs targeting hub genes

Gene Drug ID Drug name Drug type Drug group P value
TOP2A DB00445 Epirubicin Small molecule drug Approved 5.74 × 10−3
DB01177 Idarubicin Small molecule drug Approved 6.46 × 10−3
DB00997 Doxorubicin Small molecule drug Approved 5.17 × 10−3
DB00970 Dactinomycin Small molecule drug Approved; investigational 5.44 × 10−3
DB00773 Etoposide Small molecule drug Approved 4.49 × 10−3
DB00444 Teniposide Small molecule drug Approved 3.45 × 10−3
DB00694 Daunorubicin Small molecule drug Approved 4.92 × 10−3
DB06263 Amrubicin Small molecule drug Approved; investigational 5.17 × 10−3
RRM2 DB00242 Cladribine Small molecule drug Approved; investigational 1.65 × 10−2
DB05260 Gallium nitrate Small molecule drug Approved; investigational 7.64 × 10−3
Table 6

Publications related to the effective drugs targeted hub genes

Gene names Drug name Publications
Molecular or cellular level Human body level
TOP2A Epirubicin [23] [24]
Idarubicin [25]
Doxorubicin [26] [27]
[28]
Dactinomycin [29]
Etoposide [30] [31]
[32]
Teniposide [33]
Daunorubicin [34,35]
Amrubicin [36]
RRM2 Cladribine [37]
Gallium nitrate [38,39]

3.5 Validation of gene expression in SCLC

With the aim of verifying the expression levels of NCAPG, BUB1B, TOP2A, CCNA2, NUSAP1, UBE2C, AURKB, RRM2, CDK1, and KIF11, normal lung cell lines and SCLC cell lines were selected. Additionally, the qRT-PCR assays were used with the purpose of quantifying the relative mRNA expression of the above genes in normal lung and SCLC cell lines. Based on the obtained findings, the mRNA expressions of the above genes in SCLC cell lines were greater in relative to those in normal lung cell lines (P < 0.05, Figure 5).

Figure 5 
                  qPCR validation of hub genes in the normal human cell lines (HLF-a) and tumor cell lines (NCI-H1688). *P < 0.05. **P < 0.01.
Figure 5

qPCR validation of hub genes in the normal human cell lines (HLF-a) and tumor cell lines (NCI-H1688). *P < 0.05. **P < 0.01.

4 Discussion

Oncologists still face significant difficulties in treating SCLC owing to their high mutation rates and other clinical limitations. Patients with SCLC have low survival rates. However, during the past few decades, research on novel therapeutic strategies for treating SCLC has been limited [40]. Hence, there is an urgent need to identify target genes that can specifically and effectively target SCLC and thus correctly treat it. The development of high-throughput techniques and sophisticated computational tools has enabled the identification of relatively few genes that are characteristically deregulated in a given cancer cell among the thousands of normally expressed genes [41]. These methods offer novel approaches to diagnosis and treatment. Our study is the first to use bioinformatics to identify ten previously approved drugs that are related to RRM2 and TOP2A. Our findings might provide patients with SCLC new therapy options.

The current study analyzed GSE149507, GSE6044, and GSE30219 using the limma package and screened 195 upregulated and 167 downregulated genes. In the BP annotation in GO analysis, these genes were mostly enriched in “positive regulation of gene expression” and “cell division,” which are closely related to gene expression.” The DEGs in the CC category were mainly related to “extracellular space,” “extracellular region,” “plasma membrane,” “nucleus,” and “nucleoplasm,” and they showed close relationship to the extracellular and nuclear microenvironment. Additionally, the DEGs in the MF class were enriched for “protein binding” and “identical protein binding” terms and showed tight association with protein synthesis. The findings of GO analysis demonstrated that SCLC may play a pathogenic role through gene expression and translation in cells. DEGs were primarily enriched in cell cycle-related pathways including “Cell cycle” and “Complement and coagulation cascades” in the KEGG pathway. According to recent research, the cell cycle pathway makes a vital impact on developing SCLC [42]. Our results are in consistence with those of earlier research.

In the PPI network, 156 genes or nodes and 1,420 edges were enriched. We chose the top ten hub genes with the CytoHubba plugin in the Cytoscape software. This suggests that overexpression of NCAPG, BUB1B, TOP2A, CCNA2, NUSAP1, UBE2C, AURKB, RRM2, CDK1, and KIF11 may promote SCLC progression.

Additionally, to assess the level of ten hub genes in SCLC cells and healthy human lung cells, the validation of the qRT-PCR assay was performed. Moreover, the obtained findings demonstrated that similar gene expression trends of 10 hub genes in SCLC cells and normal human lung cells were demonstrated by qPCR, verifying the accuracy of our findings.

TOP2A produces polyisomerase II (TOPII), a crucial enzyme that alters the DNA topology by joining two double-stranded DNA molecules. TOPII is essential for gene transcription and replication. The aberrant expression of TOP2A can be related to poor prognosis in the lung, esophageal, breast, ovarian, and oral cancers [43]. A previous study showed that TOP2A is engaged in the occurrence and development of SCLC through inhibiting ectopic expression of miR-27a-5p and miR-34b-3p [44]. Therefore, TOP2A may show close relationship to the occurrence and prognosis of SCLC through comprehensive analysis.

AURKB, a serine/threonine protein kinase, is a crucial mitotic regulator. The oncogenic properties of AURKB have been studied in various tumors [45]. According to a recent study, SCLCs lacking the RB1 tumor suppressor gene are overly relied on Aurora B kinase for survival. Patients with SCLC typically have RB1 gene mutations. Furthermore, the study found that Aurora B kinase exerts a role in suppressing tumor cell growth in multiple SCLC models [46].

BUB1B, a member of the spindle assembly checkpoint protein family, is necessary for the anaphase of mitosis. Multiple research works have confirmed that abnormal BUB1B expression is related to tumor prognosis [47]. A large-scale analysis of the transcriptional profile of NSCLC suggested that BUB1B is a hub gene in adenocarcinoma (ADC, lung adenocarcinomas) [48]. Thus, BUB1B is a promising candidate gene.

The cell cycle regulator Cyclin-A2 (CCNA2) regulates mitotic G1/S and G2/M phases [49]. The occurrence and development of tumors may be caused by impaired regulation of this process [50]. In addition, CCNA2 is abnormally expressed in other tumors [51].

RRM2, the ribonucleoside-diphosphate reductase subunit M2B, has been identified as a gene with poor survival prognosis through network analysis and multivariate prognostic analysis in patients with LUAD [52]. Bioinformatics analysis by Chen et al. [53] identified RRM2 as the hub gene for SCLC.

UBE2C, a cell cycle-regulated ubiquitin ligase, regulates mitosis. Some researchers have reported that UBE2C shows close relationship to tumor occurrence, proliferation, and other behaviors [54]. Additionally, Wang et al. [55] discovered that UBE2C is tightly correlated with angiogenesis in NSCLC, confirming the speculation of previous studies.

Cyclin-dependent kinase 1 (CDK1) binds to cyclin B1 (CCNB1) or cyclin B2 (CCNB2) to form a complex that regulates the mitotic initiation process. Its dysregulation has been indicated to correlate with tumor cell proliferation [56]. A bioinformatics study revealed that CDK1 stimulates the stemness of lung cancer cells by the interaction with SOX2 and that increased CDK1 expression shows relationship to lower overall survival in patients suffering from lung cancer. Therefore, CDK1 may play the role of a potential biomarker [57].

Similarly, NUSAP1 and NCAPG stimulate the progression of NSCLC by controlling the BTG2/PI3K/Akt signaling pathway and upregulating LGALS1 expression [58,59]. They are also highly expressed in various tumors [60,61].

The current work used bioinformatics methods to screen FDA-approved drugs and reposition them as new anticancer drugs. Our study showed that TOP2A and RRM2 matched predicted FDA-approved drugs.

The TOP2A gene matched with eight drugs, and they are adopted for cancer therapy, among the matches between the input hub genes and the selected drugs. Etoposide, a semisynthetic derivative of podophyllotoxin with antitumor activity, was chosen as the first-line chemotherapy for SCLC among these drugs [31,32,62]. Teniposide refers to a cytotoxic drug used to treat refractory childhood acute lymphoblastic leukemia [63]. Epirubicin is an anthracycline antineoplastic drug used as adjuvant therapy after primary breast cancer resection [64]. Idarubicin is also an anthracycline antineoplastic drug, and its indications are adult acute myeloid leukemia [65]. Doxorubicin is an anthracycline antibiotic that is cytotoxic. It has a wide range of indications and can be used to treat various cancers [66]. Valrubicin is a chemotherapeutic drug which can be adopted for treating bladder cancer [67]. Daunorubicin is an anthracycline aminoglycoside antitumor drug used to induce remission in adults with acute non-lymphocytic leukemia and children and adults with acute lymphoblastic leukemia [68]. Amrubicin, an anthracycline, is currently being studied for SCLC treatment [36].

RRM2 matches only the two FDA-approved drugs. Cladribine is a purine analog and antineoplastic agent used to treat adults with highly active relapsing multiple sclerosis [69]. Gallium nitrate is used to treat cancer-related hypercalcemia and non-Hodgkin lymphoma [70].

In conclusion, NCAPG, BUB1B, TOP2A, CCNA2, NUSAP1, UBE2C, AURKB, RRM2, CDK1, and KIF11 are potential markers for diagnosing and treating SCLC. Additionally, we selected and constructed two genes, TOP2A and RRM2, as well as their potential related drugs to offer novel ideas for treating SCLC. Moreover, our experiments were subject to significant bias. Our shortcoming was that we did not validate this through relevant experiments. Therefore, these drugs require validation using relevant experimental models.

Acknowledgments

We thank all the public databases and websites used in this study: GEO database, DAVID database, and the QuartataWeb.

  1. Funding information: None.

  2. Author contributions: Y.L. analyzed the data and wrote the manuscript. Y.L. and Z.L. designed the study. X.Z. assisted with writing the manuscript. All authors read and approved the final manuscript.

  3. Conflict of interest: The authors declare that there are no conflicts of interest in this work.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available in the GEO repository, https://www.ncbi.nlm.nih.gov/gds/?term=.

References

[1] Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71(3):209–49.10.3322/caac.21660Search in Google Scholar PubMed

[2] Blandin Knight S, Crosbie PA, Balata H, Chudziak J, Hussell T, Dive C. Progress and prospects of early detection in lung cancer. Open Biol. 2017;7(9):170070.10.1098/rsob.170070Search in Google Scholar PubMed PubMed Central

[3] van Meerbeeck JP, Fennell DA, De Ruysscher DKM. Small-cell lung cancer. Lancet. 2011;378(9804):1741–55.10.1016/S0140-6736(11)60165-7Search in Google Scholar PubMed

[4] Herzog BH, Devarakonda S, Govindan R. Overcoming chemotherapy resistance in SCLC. J Thorac Oncol. 2021;16(12):2002–15.10.1016/j.jtho.2021.07.018Search in Google Scholar PubMed

[5] Rudin CM, Brambilla E, Faivre-Finn C, Sage J. Small-cell lung cancer. Nat Rev Dis Primers. 2021;7(1):3.10.1038/s41572-020-00235-0Search in Google Scholar PubMed PubMed Central

[6] Levy SE, Boone BE. Next-generation sequencing strategies. Cold Spring Harb Perspect Med. 2019;9(7):a025791.10.1101/cshperspect.a025791Search in Google Scholar PubMed PubMed Central

[7] Liao Y, Yin G, Wang X, Zhong P, Fan X, Huang C. Identification of candidate genes associated with the pathogenesis of small cell lung cancer via integrated bioinformatics analysis. Oncol Lett. 2019;18(4):3723–33.10.3892/ol.2019.10685Search in Google Scholar PubMed PubMed Central

[8] Liu H, Li T, Ye X, Lyu J. Identification of key biomarkers and pathways in small-cell lung cancer using biological analysis. Biomed Res Int. 2021;2021:5953386.10.1155/2021/5953386Search in Google Scholar PubMed PubMed Central

[9] Wen P, Chidanguro T, Shi Z, Gu H, Wang N, Wang T, et al. Identification of candidate biomarkers and pathways associated with SCLC by bioinformatics analysis. Mol Med Rep. 2018;18(2):1538–50.10.3892/mmr.2018.9095Search in Google Scholar PubMed PubMed Central

[10] Wang D, Wu W, Huang W, Wang J, Luo L, Tang D. LncRNA LUADT1 sponges miR-15a-3p to upregulate Twist1 in small cell lung cancer. BMC Pulm Med. 2019;19(1):246.10.1186/s12890-019-0991-7Search in Google Scholar PubMed PubMed Central

[11] Liu J, Zhao Z, Wei S, Li B, Zhao Z. Genomic features of Chinese small cell lung cancer. BMC Med Genomics. 2022;15(1):117.10.1186/s12920-022-01255-3Search in Google Scholar PubMed PubMed Central

[12] Zhang Z, Zhou L, Xie N, Nice EC, Zhang T, Cui Y, et al. Overcoming cancer therapeutic bottleneck by drug repurposing. Signal Transduct Target Ther. 2020;5(1):113.10.1038/s41392-020-00213-8Search in Google Scholar PubMed PubMed Central

[13] Issa NT, Stathias V, Schurer S, Dakshanamurthy S. Machine and deep learning approaches for cancer drug repurposing. Semin Cancer Biol. 2021;68:132–42.10.1016/j.semcancer.2019.12.011Search in Google Scholar PubMed PubMed Central

[14] Yadav V, Talwar P. Repositioning of fluoroquinolones from antibiotic to anti-cancer agents: An underestimated truth. Biomed Pharmacother. 2019;111:934–46.10.1016/j.biopha.2018.12.119Search in Google Scholar PubMed

[15] Lu C, Li X, Ren Y, Zhang X. Disulfiram: A novel repurposed drug for cancer therapy. Cancer Chemother Pharmacol. 2021;87(2):159–72.10.1007/s00280-020-04216-8Search in Google Scholar PubMed

[16] Rai S, Tanaka H, Suzuki M, Espinoza JL, Kumode T, Tanimura A, et al. Chlorpromazine eliminates acute myeloid leukemia cells by perturbing subcellular localization of FLT3-ITD and KIT-D816V. Nat Commun. 2020;11(1):4147.10.1038/s41467-020-17666-8Search in Google Scholar PubMed PubMed Central

[17] Barrett T, Wilhite SE, Ledoux P, Evangelista C, Kim IF, Tomashevsky M, et al. NCBI GEO: archive for functional genomics data sets-update. Nucleic Acids Res. 2013;41(Database issue):D991–5.10.1093/nar/gks1193Search in Google Scholar PubMed PubMed Central

[18] Dennis G, Jr., Sherman BT, Hosack DA, Yang J, Gao W, Lane HC, et al. DAVID: Database for annotation, visualization, and integrated discovery. Genome Biol. 2003;4(5):P3.10.1186/gb-2003-4-5-p3Search in Google Scholar

[19] Szklarczyk D, Gable AL, Nastou KC, Lyon D, Kirsch R, Pyysalo S, et al. The STRING database in 2021: Customizable protein-protein networks, and functional characterization of user-uploaded gene/measurement sets. Nucleic Acids Res. 2021;49(D1):D605–12.10.1093/nar/gkaa1074Search in Google Scholar PubMed PubMed Central

[20] Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res. 2003;13(11):2498–504.10.1101/gr.1239303Search in Google Scholar PubMed PubMed Central

[21] Chin CH, Chen SH, Wu HH, Ho CW, Ko MT, Lin CY. cytoHubba: identifying hub objects and sub-networks from complex interactome. BMC Syst Biol. 2014;8(Suppl 4):S11.10.1186/1752-0509-8-S4-S11Search in Google Scholar PubMed PubMed Central

[22] Li H, Pei F, Taylor DL, Bahar I. QuartataWeb: Integrated chemical-protein-pathway mapping for polypharmacology and chemogenomics. Bioinformatics. 2020;36(12):3935–7.10.1093/bioinformatics/btaa210Search in Google Scholar PubMed PubMed Central

[23] Liang CH, Shiu LY, Chang LC, Sheu HM, Tsai EM, Kuo KW. Solamargine enhances HER2 expression and increases the susceptibility of human lung cancer H661 and H69 cells to trastuzumab and epirubicin. Chem Res Toxicol. 2008;21(2):393–9.10.1021/tx700310xSearch in Google Scholar PubMed

[24] Jacot W, Pujol JL, Chakra M, Molinier O, Bozonnat MC, Gervais R, et al. Epirubicin and ifosfamide in relapsed or refractory small cell lung cancer patients. Lung Cancer. 2012;75(2):213–6.10.1016/j.lungcan.2011.07.012Search in Google Scholar PubMed

[25] Jönsson-Videsäter K, Andersson G, Bergh J, Paul C. Doxorubicin-resistant, MRP1-expressing U-1285 cells are sensitive to idarubicin. Ther Drug Monit. 2003;25(3):331–9.10.1097/00007691-200306000-00014Search in Google Scholar PubMed

[26] Yan T, Deng S, Metzger A, Gödtel-Armbrust U, Porter AC, Wojnowski L. Topoisomerase II{alpha}-dependent and -independent apoptotic effects of dexrazoxane and doxorubicin. Mol Cancer Ther. 2009;8(5):1075–85.10.1158/1535-7163.MCT-09-0139Search in Google Scholar PubMed

[27] White SC, Lorigan P, Middleton MR, Anderson H, Valle J, Summers Y, et al. Randomized phase II study of cyclophosphamide, doxorubicin, and vincristine compared with single-agent carboplatin in patients with poor prognosis small cell lung carcinoma. Cancer. 2001;92(3):601–8.10.1002/1097-0142(20010801)92:3<601::AID-CNCR1360>3.0.CO;2-KSearch in Google Scholar

[28] Livingston RB, Moore TN, Heilbrun L, Bottomley R, Lehane D, Rivkin SE, et al. Small-cell carcinoma of the lung: Combined chemotherapy and radiation: A Southwest Oncology Group study. Ann Intern Med. 1978;88(2):194–9.10.7326/0003-4819-88-2-194Search in Google Scholar

[29] Deng S, Yan T, Nikolova T, Fuhrmann D, Nemecek A, Gödtel-Armbrust U, et al. The catalytic topoisomerase II inhibitor dexrazoxane induces DNA breaks, ATF3 and the DNA damage response in cancer cells. Br J Pharmacol. 2015;172(9):2246–57.10.1111/bph.13046Search in Google Scholar

[30] Kanne J, Hussong M, Isensee J, Muñoz-López Á, Wolffgramm J, Heß F, et al. Pericentromeric Satellite III transcripts induce etoposide resistance. Cell Death Dis. 2021;12(6):530.10.1038/s41419-021-03810-9Search in Google Scholar

[31] Kosmidis PA, Samantas E, Fountzilas G, Pavlidis N, Apostolopoulou F, Skarlos D. Cisplatin/etoposide versus carboplatin/etoposide chemotherapy and irradiation in small cell lung cancer: a randomized phase III study. Hellenic Cooperative Oncology Group for Lung Cancer Trials. Semin Oncol. 1994;21(3 Suppl 6):23–30.Search in Google Scholar

[32] Sundstrøm S, Bremnes RM, Kaasa S, Aasebø U, Hatlevoll R, Dahle R, et al. Cisplatin and etoposide regimen is superior to cyclophosphamide, epirubicin, and vincristine regimen in small-cell lung cancer: results from a randomized phase III trial with 5 years’ follow-up. J Clin Oncol. 2002;20(24):4665–72.10.1200/JCO.2002.12.111Search in Google Scholar PubMed

[33] Giaccone G, Donadio M, Bonardi G, Testore F, Calciati A. Teniposide in the treatment of small-cell lung cancer: The influence of prior chemotherapy. J Clin Oncol. 1988;6(8):1264–70.10.1200/JCO.1988.6.8.1264Search in Google Scholar PubMed

[34] Jensen PB, Jensen PS, Demant EJ, Friche E, Sørensen BS, Sehested M, et al. Antagonistic effect of aclarubicin on daunorubicin-induced cytotoxicity in human small cell lung cancer cells: relationship to DNA integrity and topoisomerase II. Cancer Res. 1991;51(19):5093–9.Search in Google Scholar

[35] Jensen PB, Vindeløv L, Roed H, Demant EJ, Sehested M, Skovsgaard T, et al. In vitro evaluation of the potential of aclarubicin in the treatment of small cell carcinoma of the lung (SCCL). Br J Cancer. 1989;60(6):838–44.10.1038/bjc.1989.376Search in Google Scholar PubMed PubMed Central

[36] Sato Y, Iihara H, Kinomura M, Hirose C, Fujii H, Endo J, et al. Primary prophylaxis of febrile neutropenia with pegfilgrastim in small-cell lung cancer patients receiving amrubicin as second-line therapy. Anticancer Res. 2021;41(3):1615–20.10.21873/anticanres.14923Search in Google Scholar PubMed

[37] Chitambar CR. Apoptotic mechanisms of gallium nitrate: basic and clinical investigations. Oncol (Williston Park). 2004;18(13 Suppl 10):39–44.Search in Google Scholar

[38] Tan S, Sun D, Lyu J, Sun X, Wu F, Li Q, et al. Antiproliferative and apoptosis-inducing activities of novel naphthalimide-cyclam conjugates through dual topoisomerase (topo) I/II inhibition. Bioorg Med Chem. 2015;23(17):5672–80.10.1016/j.bmc.2015.07.011Search in Google Scholar PubMed

[39] Tan S, Yin H, Chen Z, Qian X, Xu Y. Oxo-heterocyclic fused naphthalimides as antitumor agents: synthesis and biological evaluation. Eur J Med Chem. 2013;62:130–8.10.1016/j.ejmech.2012.12.039Search in Google Scholar PubMed

[40] Byers LA, Rudin CM. Small cell lung cancer: Where do we go from here? Cancer. 2015;121(5):664–72.10.1002/cncr.29098Search in Google Scholar PubMed PubMed Central

[41] Rivenbark AG, Coleman WB. Dissecting the molecular mechanisms of cancer through bioinformatics-based experimental approaches. J Cell Biochem. 2007;101(5):1074–86.10.1002/jcb.21283Search in Google Scholar PubMed

[42] Hubaux R, Thu KL, Coe BP, MacAulay C, Lam S, Lam WL. EZH2 promotes E2F-driven SCLC tumorigenesis through modulation of apoptosis and cell-cycle regulation. J Thorac Oncol. 2013;8(8):1102–6.10.1097/JTO.0b013e318298762fSearch in Google Scholar PubMed PubMed Central

[43] Chen T, Sun Y, Ji P, Kopetz S, Zhang W. Topoisomerase IIα in chromosome instability and personalized cancer therapy. Oncogene. 2015;34(31):4019–31.10.1038/onc.2014.332Search in Google Scholar PubMed PubMed Central

[44] Mizuno K, Mataki H, Arai T, Okato A, Kamikawaji K, Kumamoto T, et al. The microRNA expression signature of small cell lung cancer: tumor suppressors of miR-27a-5p and miR-34b-3p and their targeted oncogenes. J Hum Genet. 2017;62(7):671–8.10.1038/jhg.2017.27Search in Google Scholar PubMed

[45] Zhu Q, Ding L, Zi Z, Gao S, Wang C, Wang Y, et al. Viral-mediated AURKB cleavage promotes cell segregation and tumorigenesis. Cell Rep. 2019;26(13):3657–71.e5.10.1016/j.celrep.2019.02.106Search in Google Scholar PubMed

[46] Oser MG, Fonseca R, Chakraborty AA, Brough R, Spektor A, Jennings RB, et al. Cells lacking the RB1 tumor suppressor gene are hyperdependent on aurora B kinase for survival. Cancer Discov. 2019;9(2):230–47.10.1158/2159-8290.CD-18-0389Search in Google Scholar PubMed PubMed Central

[47] Chen J, Liao Y, Fan X. Prognostic and clinicopathological value of BUB1B expression in patients with lung adenocarcinoma: a meta-analysis. Expert Rev Anticancer Ther. 2021;21(7):795–803.10.1080/14737140.2021.1908132Search in Google Scholar PubMed

[48] Niemira M, Collin F, Szalkowska A, Bielska A, Chwialkowska K, Reszec J, et al. Molecular signature of subtypes of non-small-cell lung cancer by large-scale transcriptional profiling: Identification of key modules and genes by weighted gene co-expression network analysis (WGCNA). Cancers (Basel). 2019;12(1):37.10.3390/cancers12010037Search in Google Scholar PubMed PubMed Central

[49] Pagano M, Pepperkok R, Verde F, Ansorge W, Draetta G. Cyclin A is required at two points in the human cell cycle. Embo J. 1992;11(3):961–71.10.1002/j.1460-2075.1992.tb05135.xSearch in Google Scholar PubMed PubMed Central

[50] Lu Y, Su F, Yang H, Xiao Y, Zhang X, Su H, et al. E2F1 transcriptionally regulates CCNA2 expression to promote triple negative breast cancer tumorigenicity. Cancer Biomark. 2022;33(1):57–70.10.3233/CBM-210149Search in Google Scholar PubMed

[51] Gopinathan L, Tan SL, Padmakumar VC, Coppola V, Tessarollo L, Kaldis P. Loss of Cdk2 and cyclin A2 impairs cell proliferation and tumorigenesis. Cancer Res. 2014;74(14):3870–9.10.1158/0008-5472.CAN-13-3440Search in Google Scholar PubMed PubMed Central

[52] Jin CY, Du L, Nuerlan AH, Wang XL, Yang YW, Guo R. High expression of RRM2 as an independent predictive factor of poor prognosis in patients with lung adenocarcinoma. Aging (Albany NY). 2020;13(3):3518–35.10.18632/aging.202292Search in Google Scholar PubMed PubMed Central

[53] Chen X, Wang L, Su X, Luo SY, Tang X, Huang Y. Identification of potential target genes and crucial pathways in small cell lung cancer based on bioinformatic strategy and human samples. PLoS One. 2020;15(11):e0242194.10.1371/journal.pone.0242194Search in Google Scholar PubMed PubMed Central

[54] Xiong Y, Lu J, Fang Q, Lu Y, Xie C, Wu H, et al. UBE2C functions as a potential oncogene by enhancing cell proliferation, migration, invasion, and drug resistance in hepatocellular carcinoma cells. Biosci Rep. 2019;39:4.10.1042/BSR20182384Search in Google Scholar PubMed PubMed Central

[55] Wang Y, Shi F, Tao R, Wu J, Gu J, Yang R, et al. The relationship between UBE2C and AGGF1 overexpression and tumor angiogenesis in non-small cell lung cancer. Cancer Manag Res. 2021;13:5919–30.10.2147/CMAR.S320393Search in Google Scholar PubMed PubMed Central

[56] Roskoski R, Jr. Cyclin-dependent protein serine/threonine kinase inhibitors as anticancer drugs. Pharmacol Res. 2019;139:471–88.10.1016/j.phrs.2018.11.035Search in Google Scholar PubMed

[57] Huang Z, Shen G, Gao J. CDK1 promotes the stemness of lung cancer cells through interacting with SOX2. Clin Transl Oncol. 2021;23(9):1743–51.10.1007/s12094-021-02575-zSearch in Google Scholar PubMed

[58] Xu Z, Wang Y, Xiong J, Cui F, Wang L, Peng H. NUSAP1 knockdown inhibits cell growth and metastasis of non-small-cell lung cancer through regulating BTG2/PI3K/Akt signaling. J Cell Physiol. 2020;235(4):3886–93.10.1002/jcp.29282Search in Google Scholar PubMed

[59] Sun H, Zhang H, Yan Y, Li Y, Che G, Zhou C, et al. NCAPG promotes the oncogenesis and progression of non-small cell lung cancer cells through upregulating LGALS1 expression. Mol Cancer. 2022;21(1):55.10.1186/s12943-022-01533-9Search in Google Scholar PubMed PubMed Central

[60] Cai X, Gao J, Shi C, Guo WZ, Guo D, Zhang S. The role of NCAPG in various of tumors. Biomed Pharmacother. 2022;155:113635.10.1016/j.biopha.2022.113635Search in Google Scholar PubMed

[61] Iyer J, Moghe S, Furukawa M, Tsai MY. What’s Nu(SAP) in mitosis and cancer? Cell Signal. 2011;23(6):991–8.10.1016/j.cellsig.2010.11.006Search in Google Scholar PubMed

[62] Lo Russo G, Macerelli M, Platania M, Zilembo N, Vitali M, Signorelli D, et al. Small-cell lung cancer: Clinical management and unmet needs new perspectives for an old problem. Curr Drug Targets. 2017;18(3):341–62.10.2174/1389450117666160502152331Search in Google Scholar PubMed

[63] Rivera GK, Pui CH, Santana VM, Pratt CB, Crist WM. Epipodophyllotoxins in the treatment of childhood cancer. Cancer Chemother Pharmacol. 1994;34(Suppl):S89–95.10.1007/BF00684870Search in Google Scholar PubMed

[64] Earl H, Iddawela M. Epirubicin as adjuvant therapy in breast cancer. Expert Rev Anticancer Ther. 2004;4(2):189–95.10.1586/14737140.4.2.189Search in Google Scholar PubMed

[65] Adige S, Lapidus RG, Carter-Cooper BA, Duffy A, Patzke C, Law JY, et al. Equipotent doses of daunorubicin and idarubicin for AML: a meta-analysis of clinical trials versus in vitro estimation. Cancer Chemother Pharmacol. 2019;83(6):1105–12.10.1007/s00280-019-03825-2Search in Google Scholar PubMed PubMed Central

[66] Rivankar S. An overview of doxorubicin formulations in cancer therapy. J Cancer Res Ther. 2014;10(4):853–8.10.4103/0973-1482.139267Search in Google Scholar PubMed

[67] Chou R, Selph S, Buckley DI, Fu R, Griffin JC, Grusing S, et al. Intravesical therapy for the treatment of nonmuscle invasive bladder cancer: A systematic review and meta-analysis. J Urol. 2017;197(5):1189–99.10.1016/j.juro.2016.12.090Search in Google Scholar PubMed

[68] Tsimberidou AM, Kantarjian HM, Cortes J, Thomas DA, Faderl S, Garcia-Manero G, et al. Fractionated cyclophosphamide, vincristine, liposomal daunorubicin, and dexamethasone plus rituximab and granulocyte-macrophage-colony stimulating factor (GM-CSF) alternating with methotrexate and cytarabine plus rituximab and GM-CSF in patients with Richter syndrome or fludarabine-refractory chronic lymphocytic leukemia. Cancer. 2003;97(7):1711–20.10.1002/cncr.11238Search in Google Scholar PubMed

[69] Deeks ED. Cladribine tablets: A review in relapsing MS. CNS Drugs. 2018;32(8):785–96.10.1007/s40263-018-0562-0Search in Google Scholar PubMed PubMed Central

[70] Chitambar CR. Gallium nitrate revisited. Semin Oncol. 2003;30(2 Suppl 5):1–4.10.1016/S0093-7754(03)00169-6Search in Google Scholar PubMed

Received: 2022-10-29
Revised: 2023-08-29
Accepted: 2023-09-01
Published Online: 2023-10-05

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Downloaded on 8.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0806/html
Scroll to top button