Zum Hauptinhalt springen
Artikel Open Access

3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p

  • , , EMAIL logo , , , und
Veröffentlicht/Copyright: 28. Januar 2023

Abstract

The object was to enhance the bioactivity of pure polyether-ether-ketone (PEEK) by incorporating nano-TiO2 (n-TiO2) and investigate its potential mechanism. PEEK/n-TiO2 composite was manufactured using a 3D PEEK printer and characterized by scanning electron microscopy (SEM), 3D profiler, energy-dispersive spectroscopy, and Fourier-transform infrared (FT-IR) analyses. Cytocompatibility was tested using SEM, fluorescence, and cell counting kit-8 assays. Osteogenic differentiation was evaluated by osteogenic gene and mineralized nodule levels. The expression of the candidate miRNAs were detected in composite group, and its role in osteogenic differentiation was studied. As a results the 3D-printed PEEK/n-TiO2 composite (Φ = 25 mm, H = 2 mm) was successfully fabricated, and the TiO2 nanoparticles were well distributed and retained the nanoscale size of the powder. The Ra value of the composite surface was 2.69 ± 0.29, and Ti accounted for 22.29 ± 12.09% (in weight), and FT-IR analysis confirmed the characteristic peaks of TiO2. The cells in the composite group possessed better proliferation and osteogenic differentiation abilities than those in the PEEK group. miR-154-5p expression was decreased in the composite group, and the inhibition of miR-154-5p significantly enhanced the proliferation and osteogenic differentiation abilities. In conclusion, 3D-printed PEEK/n-TiO2 composite enhanced cytocompatibility and osteogenic induction ability by downregulating miR-154-5p, which provides a promising solution for improving the osteointegration of PEEK.

1 Introduction

Polyether-ether-ketone (PEEK) is an attractive thermoplastic polymer with excellent biocompatibility, an elastic modulus similar to that of bone, favorable mechanical properties, and adequate chemical stability. Owing to such favorable properties, it is a promising alternative to metallic and ceramic orthopedic implants [1,2]. However, many in vivo and clinical studies indicate a less satisfying effect of PEEK implants in osteointegration. The limitation is caused by the hydrophobicity and bioinertness of PEEK, thereby inhibiting cell attachment, leading to poor bone apposition and eventually causing implant dislocation and failure [3,4]. Various techniques and materials have been developed to overcome these shortcomings. The most widely used method is surface property modification of PEEK for better bone-binding by physicochemical modification and coating deposition with bioactive ions or bone-binding materials, including titanium (Ti)/TiO2, hydroxyapatite (HA), zirconia, and tantalum [5]. Notably, these modifications also lead to many new problems such as degradation of the coatings and poor binding force between the coating and implant in vivo [6], as well as degradation of PEEK [7]. In addition to the instability of the modified surface, reproducibility and controllability of these techniques are less satisfactory [5].

Another strategy is the 3D printing of a PEEK/material composite that enables the functional groups to be distributed on the surface and inside [8,9] and circumvents all surface-modification-related issues. In contrast to traditional manufacturing, 3D printing technology is an additive manufacturing (AM) approach that can provide personalized/precise solutions to meet the clinical needs of patients [10]. Thus far, several PEEK composites such as PEEK/HA and Ti–6Al–4V/PEEK [11,12] have been manufactured by AM technology, and the Ti–6Al–4V/PEEK composites show better bone formation than commercial pure PEEK [12]. However, these composites are mechanically integrated using two independent materials. Frontier research reports that they developed a fused filament fabrication approach, also known as fused deposition modeling that realizes the direct 3D printing of extruded PEEK/HA composite filaments and evenly distributes HA particles throughout the bulk and across the surface of the native 3D-printed samples [13]. In addition, the mechanical properties of the 3D-printed-PEEK/HA composites are comparable to those of human femoral cortical bone; however, whether the bone formation ability of the composites is enhanced remains unknown.

TiO2 is a widely used material for surface modification, and its coating has been confirmed to considerably enhance the adhesion, proliferation, and differentiation of osteoblast cells compared to pure PEEK [14]. TiO2 nanoparticles (n-TiO2) have higher bioactivities than conventional microparticles in cell proliferation and osteointegration [15,16]. Therefore, the incorporation of n-TiO2 into PEEK would be a more effective way to enhance the properties of pure PEEK.

MicroRNAs (miRNAs) are a class of short non-coding RNAs (∼22 nucleotides) that have been reported as key regulators of gene expression [17]. Studies have shown that miRNAs are involved in various cellular activities, including proliferation, migration, and differentiation [17,18]. Osteogenesis is regulated by several miRNAs [19], and coating with TiO2 alters the expression of miR-17 and miR-21 in MC3T3-E1 cells [20]. In addition, miR-154-3p, miR-154-5p, and miR-770-5p expression levels are considerably altered in human adipose-tissue-derived stem cells (hASCs) cultured or induced in the TiO2 nanotube [21]. This observation indicated that these miRNAs may be associated with the superior properties of TiO2.

In the present study, we aimed to enhance the cytocompatibility and osteogenic induction activity of pure PEEK by incorporating n-TiO2 and investigate the role of miRNA in this process. We intended to manufacture the PEEK/n-TiO2 composite by 3D printing technology and characterized the same using scanning electron microscopy (SEM), 3D profiler, elemental, and Fourier-transform infrared (FT-IR) analyses. The cytocompatibility and osteogenic induction ability of the composite were then evaluated in vitro. Next, five candidate miRNAs (miR-17, miR-21, miR-154-3p, miR-154-5p, and miR-770-5p) were verified, and miR-154-5p was found to be involved in the improved cytocompatibility and osteogenic induction ability of the 3D-printed composite.

2 Materials and methods

2.1 Preparation of the 3D-printed PEEK/n-TiO2 composite

First, the TiO2 nanopowder (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) was mixed with PEEK powder (VESTAKEEP® 2000FP; Evonik, Essen, Germany) to obtain mixed powders with different n-TiO2 contents (0 and 30 wt%). The powders were then processed using a co-rotating twin-screw extruder (PolyLab HAAKE Rheomex OS PTW16, D = 16 mm, L/D = 40; Thermo Fisher, USA) to obtain continuous PEEK/n-TiO2 filaments (Φ = 1.75 ± 0.10 mm). The parameters of the two types of powder are listed in Table 1.

Table 1

Parameters of PEEK and TiO2 powders

Parameters PEEK powder TiO 2 nanopowder
Powder size (nm) 50,000 21
Density (g/mL) 1.3 4.26
Mw 328 79
Melting point (℃) 340 1,850
Melt viscosity (Pa s) 350 /
Purity (%) 99.9 99.5

Next, 3D models of the PEEK and PEEK/n-TiO2 composite samples (Φ = 25 mm, H = 2 mm) were designed using CAD modeling software (Mimics; Materialize, Belgium). Subsequently, the filaments were assembled using a 3D PEEK printer (Medvance, Shanghai, China), melted at 450°C, injected into nozzles (Φ = 0.4 mm), and deposited layer-by-layer (0.1 mm) following the designed program. The printing speed was 10 mm/s, and the plate and chamber temperatures were maintained at 260 and 220°C, respectively. Several hours later, PEEK (tensile modulus = 6.15 GPa) and a PEEK/n-TiO2 composite (30 wt%, tensile modulus = 4.15 GPa) were successfully manufactured.

The tensile moduli of the samples were determined using the standard tensile test method. First, a standard tensile test sample (ISO527-2:1993 1BA) (n = 1) was manufactured using a 3D printer with the aforementioned printing parameters. Tensile testing was conducted by the Weipu Technology Group (Shanghai, China) following the standard tensile test method (ISO527-2:1993). An electronic universal testing machine (Instron 5969, Canton, MA, USA) was used for tensile testing. The test speed was 1 mm/min, and the maximum loading force was 50 kN. The tensile modulus was calculated according to a previous study [22].

2.2 Characterization of the PEEK/n-TiO2 composite

To study the microstructure of the samples, they were pre-treated with gold sputtering and then observed using a scanning electron microscope (Zeiss Sigma 300, Oberkochen, Germany). Macromorphologies of the two samples (n = 1) were photographed using a conventional camera. Energy-dispersive spectroscopy (EDS; Zeiss) was used to analyze the surface elements (C, O, and Ti) of the samples (n = 1). Two different square areas of each sample were randomly selected for the elemental analysis.

Surface roughness measurement: Surface roughness of the samples (n = 1) was analyzed using a 3D profile measurement laser microscope (Bruker Contour GTK, Karlsruhe, Germany). The mean surface roughness or arithmetic mean deviation of the profile (Ra), root mean square of the profile (Rq), and maximum peak-to-valley height of the profile (Rz) were measured. The surface roughness of each sample was measured twice in different areas. The measurement area was approximately 627 μm × 470 μm.

FT-IR analysis: FT-IR spectra of the samples (n = 1) were recorded with a Bruker Vertex 70v (Bruker, Billerica, MA, USA) using wavenumbers ranging from 1,000 to 4,000 cm−1 with a resolution of 2 cm−1, averaging 128 scans.

2.3 Cytocompatibility evaluation

Cells and cell culture: Mouse pre-osteoblast (MC3T3-E1) cells, purchased from Cell Bank of Chinese Academy of Sciences (Shanghai, China), were cultured in α-minimum essential medium (Gibco) supplemented with 10% fetal bovine serum (Gibco) and 1% penicillin/streptomycin (Gibco) at 5% CO2 and 37°C.

SEM detection: PEEK and PEEK/n-TiO2 composite samples were placed into a tissue culture-treated six-well cell culture plate, and the MC3T3-E1 cells were seeded on the surface of the samples (n = 1) at a density of 8 × 104 cells/well. After a 3-day culture, the samples were washed thrice with phosphate buffered saline (PBS) (Servicebio, Wuhan, China) and immersed in 2.5% paraformaldehyde (Servicebio) for 1 h at room temperature. Different concentrations of alcohol (Servicebio) were then used for gradient dehydration. Subsequently, the samples were left to dry overnight in a fume hood and then, sputter-coated with Au. The cells attached to the surface were observed using SEM imaging (Zeiss).

Fluorescence detection: Cells seeded on the surface of the samples (n = 1) were fixed with 4% paraformaldehyde (Servicebio), washed thrice with PBS, and incubated with 5 μM 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate (Beyotime, Shanghai, China) for 20 min. The cell morphology was observed using a laser scanning confocal microscope (Leica, Wetzlar, Germany).

Cell Counting Kit-8 (CCK-8 kit; Dojindo Laboratories, Kumamoto, Japan) was used to detect cell proliferation. Briefly, MC3T3-E1 cells (4 × 104 cells/well) were seeded on the surface of the PEEK and PEEK/n-TiO2 composite samples (n = 3). After the cells were cultured for 1, 4, and 7 days, 200 µL of CCK-8 reagent (Dojindo Laboratories) was added to each well and incubated for another 3 h. Next, the samples were removed and the optical density (OD) at 450 nm of each well was measured using a spectrophotometer (BioTek Instruments Inc., Winooski, VT, USA). Cell proliferation was calculated using the following formula: Proliferation rate = Experimental OD/Control OD.

2.4 qPCR analysis of osteogenic genes expression

Osteogenic induction: Cells (1.5 × 105 cells/well) were seeded on the surface of the PEEK and PEEK/n-TiO2 composite samples (n = 3). After the cell density reached 80%, 50 µg/mL ascorbate-2 phosphate (Sigma-Aldrich; Merck KGaA), 100 nM dexamethasone (Sigma-Aldrich), and 10 mM β-glycerophosphate (Sigma-Aldrich) were added for osteogenic induction.

qPCR: Total RNA of the cells induced in osteogenic medium for 7 days was extracted and purified using a TaKaRa MiniBEST Universal RNA Extraction Kit (TAKARA, Dalian, China) following the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized using a ReverTra Ace qPCR RT Kit (TOYOBO, Osaka, Japan) following the manufacturer’s protocol. Next, cDNA (1 µL) was mixed with 1 µL of each primer, 10 µL of SYBR Green (Takara, Dalian, China), and 7 µL of deionized water to obtain a final volume of 20 µL. The reaction was performed at 95°C for 5 min, followed by 42 cycles at 95°C for 5 s, and 60°C for 1 min. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal reference gene, and the relative expression of related genes was calculated using the 2−ΔΔCT method. For miRNAs, U6 was used as the internal control. The primer sequences are listed in Table 2.

Table 2

Primer sequences used for qPCR

Genes/miRNAs Forward (5–3′) Reverse (5–3′)
OCN CTGCAAAGGTTGGCAGAGATG CCACGGAAACGCTCTAGGAA
OPN ATCTCACCATTCGGATGAGTCT TGTAGGGACGATTGGAGTGAAA
COL1 GCTCCTCTTAGGGGCCACT ATTGGGGACCCTTAGGCCAT
RUNX2 GACTGTGGTTACCGTCATGGC ACTTGGTTTTTCATAACAGCGGA
ALP CCAACTCTTTTGTGCCAGAGA GGCTACATTGGTGTTGAGCTTTT
miR-17 AGGCCCAAAGTGCTGTTCGT GTGCAGGGTCCGAGGT
miR-21 CTCGCTTCGGCAGCACA GCCGCTAGCTTATCAGACTCAACA
miR-154-3p TAGGTTATCCGTGTTG ATCCAGTGCAGGGTCCGAGG
miR-154-5p CTCGAGGCTTCTAAGCTGGGAACTTTGTC ACTGAATTCCGCTTGTCTTGGACATATGGCACT
miR-770-5p ATCCAGT GCGTGTCGTG TGCTTCCAGTA CCACGTGTC
U6 TGCGGGTGCTCGCTTCGCAGC CCAGTGCAGGGTCCGAGGT
GAPDH AGGTCGGTGTGAACGGATTTG GGGGTCGTTGATGGCAACA

2.5 Western blot analysis of the protein expression level of osteogenic genes

Cells seeded on the surface of PEEK and PEEK/n-TiO2 composite samples (n = 3) were induced with osteogenic medium for 7 days, and then the total protein was collected. Briefly, cells were lysed with radio-immunoprecipitation assay buffer (Beyotime, Shanghai, China) supplemented with a protease inhibitor cocktail (MCE, NJ, USA), and the protein concentration was determined using a BCA kit (Beyotime) following the manufacturer’s instructions. Subsequently, the protein sample was mixed with loading buffer (Beyotime) and denatured at 100°C for 10 min. The next day, the samples were separated using 10% SDS-PAGE and transferred to a PVDF membrane (Merck, Darmstadt, Germany). After blocking with fat-free milk for 2 h at room temperature, the membrane was cut into several pieces according to the potential MW of the protein, followed by an incubation with the corresponding primary antibody overnight at 4°C. Thereafter, the membranes were incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody at room temperature. Finally, the signal was visualized using a Chemiluminescent Imaging System (Tanon, Shanghai, China) after signal enhancement using an ECL kit (Tanon), and GAPDH was used as the internal control. The following antibodies were used: OCN (#A20800, 1:1,000), OPN (#A1499, 1:1,000), COL (#A1352, 1:1,000), RUNX2 (#A2851, 1:1,000), ALP (#A4304, 1:1,000), GAPDH (#AC001, 1:1,000), and a HRP-conjugated secondary antibody (#AS014, 1:2,000).

2.6 Alizarin red S (ARS) staining

After the cells seeded in the samples (n = 3) were induced in the osteogenic medium for 14 days, the samples were washed thrice with PBS (Servicebio), immersed in 2.5% paraformaldehyde (Servicebio) for 30 min, and then incubated with 0.1% ARS stain (Solarbio, Beijing, China) for 10 min. Next, 100 mM cetylpyridinium chloride (Sigma-Aldrich) was added to each well to dissolve the stained nodules, the solution was collected, and the OD of each sample was measured at 562 nm. Relative mineralization level (ODexperimental/ODcontrol) was used to indicate the osteogenic level.

2.7 Cell transfection

Cells were seeded into a six-well plate and the inhibitor sequences were transfected using Lipofectamine 3000 (Invitrogen, CA, USA) following the manufacturer’s instructions when the cell confluence reached ∼80%. After 48 h of transfection, the cells were harvested for qPCR analysis and cell function experiments. The miR-154-5p inhibitor (5ʹ-UAGGUUAUCCGUGUUGCCUUCG-3ʹ) and negative control inhibitor (inhibitor NC; 5′-TAACACGTCTATACGCCCA-3′) were synthesized by RiboBio (Guangzhou, China).

2.8 Statistical analysis

Quantitative data are expressed as mean ± standard deviation (SD) from at least three independent experiments. All analyses were performed using SPSS 16.0 (SPSS Inc.). The Student’s t-test was used to evaluate the statistical significance of the differences between the two groups. Statistical significance was set at P < 0.05.

3 Results

3.1 Morphological features of the 3D-printed PEEK/n-TiO2 composite

As shown in Figure 1a, the circular samples shared a size of Φ = 25 mm and H = 2 mm, and the PEEK/n-TiO2 composite was much whiter than the PEEK control. The local enlargement images indicated that the surface lines of the two samples were both crisscross in a regular manner, indicating the moving trajectory of the nozzle during the printing process (Figure 1a, right).

Figure 1 
                  Morphological features of 3D-printed PEEK/n-TiO2 composite. (a) Macromorphological of 3D-printed PEEK and PEEK/n-TiO2 composite samples. (b) SEM was used to observe the microstructure of the two samples. Scales: 100, 10, and 1 µm (from left to right). (c) 3D profiler was used to detect the surface roughness of two samples.
Figure 1

Morphological features of 3D-printed PEEK/n-TiO2 composite. (a) Macromorphological of 3D-printed PEEK and PEEK/n-TiO2 composite samples. (b) SEM was used to observe the microstructure of the two samples. Scales: 100, 10, and 1 µm (from left to right). (c) 3D profiler was used to detect the surface roughness of two samples.

SEM imaging showed that the microstructure of the PEEK sample was consistent with its macroscopic morphology, and the surface of PEEK was less smooth, with many irregular pores (Figure 1b). The bottom microstructure of the PEEK/n-TiO2 composite was relatively smooth, and uniformly distributed powders without significant aggregation (most particles were less than 1 μm) could be clearly observed under a magnification of 5,000 (Figure 1b, right).

3D profiler analysis showed that the outlines of the two samples were consistent with the corresponding SEM results (Figure 2b). The Ra values of the two samples were similar, while the Rq and Rt values of the composite samples were much higher than those of the PEEK sample (Table 3). This indicated a rougher surface of the composite.

Figure 2 
                  Elemental and FT-IR analyses of PEEK and PEEK/n-TiO2 composite samples. (a) Randomly selected areas used for EDS analysis (left, scale: 250 µm) and results of dispersive spectroscopy analysis (right). (b) FT-IR analysis of characteristic absorption peaks of two samples.
Figure 2

Elemental and FT-IR analyses of PEEK and PEEK/n-TiO2 composite samples. (a) Randomly selected areas used for EDS analysis (left, scale: 250 µm) and results of dispersive spectroscopy analysis (right). (b) FT-IR analysis of characteristic absorption peaks of two samples.

Table 3

Surface roughness of PEEK and PEEK/n-TiO2 composite

PEEK PEEK/n-TiO 2
Area 1 Area 2 Mean ± SD Area 1 Area 2 Mean ± SD
Ra (μm) 2.147 2.88 2.51 ± 0.52 2.486 2.893 2.69 ± 0.29
Rq (μm) 2.715 3.686 3.20 ± 0.69 3.579 4.748 4.16 ± 0.83
Rt (μm) 15.722 25.758 20.74 ± 7.10 42.558 64.645 53.60 ± 15.62

3.2 Elemental and FT-IR analyses of PEEK/n-TiO2 composite

EDS analysis showed that the surface of the PEEK sample comprised C (82.96% by weight) and O (17.04% by weight), and the SD values of the two elements were both less than 0.3 (Figure 2a). In the PEEK/n-TiO2 composite sample, nearly 60% was C, and the other two elements, O and Ti, accounted for 18.24 ± 2.72% and 22.29 ± 12.09%, respectively (Figure 2a), indicating the addition of TiO2 nanopowder before printing. Notably, the SD values of the three elements varied significantly from 2.72 to 12.09; hence, fully mixing the two different powders at the microlevel was a challenge and requires further research.

The FT-IR analysis indicated that the characteristic peaks of the two samples were similar, with several typical peaks of PEEK. For instance, the peak at 1,647 cm−1 indicated C═O stretching, and the peaks at 1,593 and 1,487 cm−1 were attributed to C−C stretching of the aromatic rings (Figure 2b). Furthermore, the peaks at 1,217 and 1,098 cm−1 indicate the C−O−C stretching vibrations of the aromatic ether bond. Compared to the PEEK spectrum, there was an intense absorption band at ∼594 cm−1 in the composite spectrum (Figure 2b), indicating Ti–O–Ti stretching.

3.3 PEEK/n-TiO2 composite showed better cytocompatibility and osteogenic induction ability

After MC3T3-E1 cells were cultured on the surfaces of the two samples for 3 days, SEM was employed to detect cytocompatibility. As shown in Figure 3a, the cells were well attached on both the materials. The cells in the PEEK group were slender in morphology, and the number of attached cells in the PEEK/n-TiO2 group was more than that in the control group (local vision-based observation), indicating a potentially higher cytocompatibility of the composite. In addition, the surface of the PEEK/n-TiO2 composite, with many bumps and hollows, was much rougher than the PEEK surface. Fluorescence analysis indicated that some cells in the PEEK/n-TiO2 group also showed a slender shape (Figure 3b), consistent with the SEM results. The surfaces of the samples were not flat, and the pores were visible under a bright field (Figure 3b), which also caused a higher background under the fluorescent field. Subsequently, a cell proliferation assay was performed to quantitatively compare cytocompatibility between the two materials. The results presented in Figure 3c indicate that there was no significant difference between the two groups in the proliferation rate on the fourth day. After an additional 3 days of culture, the proliferation rate of cells in the PEEK/n-TiO2 group was significantly enhanced compared to that in the PEEK group, suggesting that the PEEK/n-TiO2 composite had better cytocompatibility than pure PEEK (Figure 3c, P < 0.05).

Figure 3 
                  PEEK/n-TiO2 composite showing better cytocompatibility and osteogenic induction ability. (a) MC3T3-E1 cells were cultured on the surface of the PEEK and PEEK/n-TiO2 composite samples for 3 days; subsequently, SEM imaging was employed to observe cell morphology and distribution. Scales: 300 µm (left) and 50 µm (right), respectively. (b) MC3T3-E1 cells were cultured on the surface of the two samples for 3 days and stained with Dil; then, laser scanning confocal microscope was used to observe cell morphology and distribution. BF: bright field, Scale: 25 µm. (c) CCK-8 was used to detect the proliferation of cells cultured on the surface of the two samples for 1, 4, and 7 days. (d and e) qPCR and western blot were used to detect the mRNA and protein expression levels of OPN, OCN, COL1, RUNX2, and ALP, after the cells seeded on the surface of the two samples were induced with osteogenic medium for 7 days. (f) ARS staining was used to detect the mineralization level after the cells cultured on the surface of the two samples experienced the osteogenic induction for 14 days. * P < 0.05.
Figure 3

PEEK/n-TiO2 composite showing better cytocompatibility and osteogenic induction ability. (a) MC3T3-E1 cells were cultured on the surface of the PEEK and PEEK/n-TiO2 composite samples for 3 days; subsequently, SEM imaging was employed to observe cell morphology and distribution. Scales: 300 µm (left) and 50 µm (right), respectively. (b) MC3T3-E1 cells were cultured on the surface of the two samples for 3 days and stained with Dil; then, laser scanning confocal microscope was used to observe cell morphology and distribution. BF: bright field, Scale: 25 µm. (c) CCK-8 was used to detect the proliferation of cells cultured on the surface of the two samples for 1, 4, and 7 days. (d and e) qPCR and western blot were used to detect the mRNA and protein expression levels of OPN, OCN, COL1, RUNX2, and ALP, after the cells seeded on the surface of the two samples were induced with osteogenic medium for 7 days. (f) ARS staining was used to detect the mineralization level after the cells cultured on the surface of the two samples experienced the osteogenic induction for 14 days. * P < 0.05.

To investigate the role of the PEEK/n-TiO2 composite in the osteogenic differentiation of MC3T3-E1 cells, qPCR was used to detect the expression levels of osteogenic genes. As shown in Figure 3d, the qPCR results showed that the mRNA levels of OPN, OCN, COL1, RUNX2, and ALP were significantly increased in the PEEK/n-TiO2 group compared to the PEEK group (P < 0.05) after the cells were induced in the osteogenic medium for 7 days. Western blotting results also indicated an increase in the protein levels of the five osteogenic markers (Figure 3e). Subsequently, the cells were further induced for another 7 days, and ARS staining was used to evaluate the mineralization level. As a result, the cells seeded on the surface of the PEEK/n-TiO2 composite showed a higher mineralization level than the cells on the PEEK surface (Figure 3f, P < 0.05). These results indicated that the addition of n-TiO2 significantly enhanced the osteogenic differentiation of MC3T3-E1 cells compared to pure PEEK.

3.4 Inhibition of miR-154-5p promotes the proliferation and osteogenic differentiation of MC3T3-E1 cells

To screen the miRNAs involved in the enhanced properties of the PEEK/n-TiO2 composite, the expression level of five candidates (miR-17, miR-21, miR-154-3p, miR-154-5p, and miR-770-5p) was detected, and two of them (miR-21 and miR-154-5p) were significantly altered in the PEEK/n-TiO2 group (Figure 4a, P < 0.05). Next, MC3T3-E1 cells were induced on the composite surface for 7 days, and only miR-154-5p was reduced significantly in the PEEK/n-TiO2 group compared to the PEEK group (Figure 4b, P < 0.05). Therefore, miR-154-5p may be related to the better cytocompatibility and osteogenic induction ability of the PEEK/n-TiO2 composite.

Figure 4 
                  Inhibition of miR-154-5p promotes the proliferation and osteogenic differentiation of MC3T3-E1 cells. (a) Expression levels of five miRNAs were detected by qPCR after MC3T3-E1 cells were seeded on the surface of the PEEK and PEEK/n-TiO2 composite samples and underwent osteogenic induction for 7 days. (b) Expression levels of the two miRNAs were detected by qPCR after cells were induced on the surface of the two samples for 7 days. (c) qPCR validation of the interference effect of the miR-154-5p inhibitor. (d) CCK-8 was used to detect the proliferation potency of cells infected with the miR-154-5p inhibitor for 1, 4, and 7 days. (e and f) qPCR and western blotting were used to detect the mRNA and protein expression levels of OPN, OCN, COL1, RUNX2, and ALP after the cells were infected with the miR-154-5p inhibitor and underwent osteogenic induction for 7 days. (g) ARS staining was used to detect the mineralization level after the cells infected with the miR-154-5p inhibitor experienced osteogenic induction for 14 days. *P < 0.05.
Figure 4

Inhibition of miR-154-5p promotes the proliferation and osteogenic differentiation of MC3T3-E1 cells. (a) Expression levels of five miRNAs were detected by qPCR after MC3T3-E1 cells were seeded on the surface of the PEEK and PEEK/n-TiO2 composite samples and underwent osteogenic induction for 7 days. (b) Expression levels of the two miRNAs were detected by qPCR after cells were induced on the surface of the two samples for 7 days. (c) qPCR validation of the interference effect of the miR-154-5p inhibitor. (d) CCK-8 was used to detect the proliferation potency of cells infected with the miR-154-5p inhibitor for 1, 4, and 7 days. (e and f) qPCR and western blotting were used to detect the mRNA and protein expression levels of OPN, OCN, COL1, RUNX2, and ALP after the cells were infected with the miR-154-5p inhibitor and underwent osteogenic induction for 7 days. (g) ARS staining was used to detect the mineralization level after the cells infected with the miR-154-5p inhibitor experienced osteogenic induction for 14 days. *P < 0.05.

To confirm the role of miR-154-5p, MC3T3-E1 cells were transfected with its inhibitor, and qPCR validation indicated that its expression level was significantly inhibited (Figure 4c). Further CCK-8 detection showed that the inhibition of miR-154-5p promoted the proliferation of MC3T3-E1 cells (Figure 4d, P < 0.05). After 7 days of induction, the mRNA levels of five osteogenic markers in the miR-154-5p inhibitor group were all significantly enhanced compared to the inhibitor NC group (Figure 4e, P < 0.05). Western blotting results indicated that the protein levels of the five osteogenic markers were also increased in the miR-154-5p inhibitor group (Figure 4f). As shown in Figure 4g, cells transfected with the miR-154-5p inhibitor exhibited higher mineralization levels compared to the inhibitor NC group (P < 0.05). These results indicate that the inhibition of miR-154-5p promotes the proliferation and osteogenic differentiation of MC3T3-E1 cells.

4 Discussion

3D printing technologies not only overcome many restraints in traditional manufacturing techniques but also avoid various complications that arise during the surface modifications for property enhancements of the original materials. In this study, for the first time, we prepared a 3D-printed PEEK/n-TiO2 composite with a better cytocompatibility and osteogenic induction ability with MC3T3-E1 cells, providing a new strategy to improve the osteointegration of PEEK.

The introduction of functional materials significantly enhances the bioactivities of pure PEEK; however, the mechanical properties of the composite PEEK changed significantly with the decrease in PEEK content. For instance, Hughes and Grover prepared several calcium sulfate (CaS)–PEEK composites through compression molding, in which the CaS content varies from 20 to 80 wt%. They observed that the addition of 20 wt% CaS exhibited the best mechanical performance, while the mechanical parameters of the 80 wt% CaS group decreased by 50–80% compared to the 20 wt% CaS group [23]. Therefore, maintaining the dominant proportion of PEEK (e.g., >60 wt%) is crucial so that the excellent mechanical properties of PEEK can be preserved. A recent study showed that the incorporation of HA (5–30 wt%) enhanced the mechanical properties of pure PEEK, and the increased mechanical behaviors are still in line with those of human femoral cortical bone [13]. In addition, the Young’s modulus of the four TiO2–PEEK/PEI blends (1–8 wt% of TiO2) varies from ∼4.2 to ∼5.5 GPa [15], which is also comparable to that of cancellous bone (3.78 GPa) and cortical bone (14.64 GPa) [22]. In this study, we initially prepared three types of PEEK/n-TiO2 composites (10, 20, and 30 wt% n-TiO2). As expected, the tensile modulus of the three printed composites were relatively close, varying from 4.15 to 5.68 GPa (data not shown). Therefore, the composites with the highest n-TiO2 content was selected for further study.

Compared with conventional TiO2 microparticles, nanoparticles possess higher bioactivities in cell adhesion, proliferation, and osteointegration [16,24]. For instance, both osteoblasts and chondrocytes, when exposed to TiO2 nanofillers, exhibit an expanded morphology and increased proliferation ability compared with cells exposed to microparticles [25]. Another study revealed that the strength of bone–titanium integration was considerably greater for implants with nanoparticles [26]. Therefore, avoiding the agglomeration of nanoparticles during the manufacturing process is important. Till date, several studies have reported that the addition of TiO2 nanoparticles to PEEK/n-TiO2 composites significantly enhanced the bioactivity of PEEK [27,28]. However, because of the high pressure and high temperature conditions required for molding in the traditional manufacturing procedures, the TiO2 nanoparticles do not remain well distributed and agglomerate into microparticles [27,28]. However, our PEEK/n-TiO2 composite was manufactured using the AM technology, which does not require high pressure; hence, most of the TiO2 particles distributed on the composite surface were still nanoparticles.

First, we tested the pore size and roughness of the composite using an atomic force microscope; however, the surface was too rough to test these two parameters. Therefore, a 3D profiler was used to detect the roughness, but still the pore size was too large for testing. Many gaps were clearly observed on the surface. Although the Ra values of the two samples were similar, the Rq and Rt values of the composite were higher than those of the PEEK group. This also indicates a higher roughness of the composite surface, which is consistent with the SEM results. We also observed that the Rt value of the composite was significantly higher than that of PEEK. Notably, the gaps parallel to the printing path in the PEEK sample were wider than those in the composite; thus, the melted composite filament showed better fluidity. The valleys perpendicular to the printing path result in a higher Rt value for the composite. This might be due to the higher fluidity of the melted composite filaments. Better fluidity would fill the gap generated in the previously printed layer.

SEM imaging also showed that the surface of the PEEK/n-TiO2 composite was rougher than that of the control PEEK. Generally, a rougher surface indicates better cell attachment [27], which might be another reason for the enhanced proliferation of MC3T3 cells, in addition to the TiO2 nanoparticles themselves. The SEM data also indicated that there was a significant difference in smoothness between the bottom (smoother) and surface (rougher) of the PEEK/n-TiO2 composite. We inferred that this might be due to the different temperatures of the print bed and print chamber or the different interfaces (solid and gas, respectively).

OCN is the most abundant non-collagenous protein in the bone matrix and plays a crucial role in the biomineralization process during osteogenic maturation [29]. COLI is involved in the formation of bone matrix and is synthesized and secreted by osteoblasts [30]. In this study, the incorporation of n-TiO2 significantly enhanced the expression of these two osteogenic markers and the other three markers (OPN, RUNX2, and ALP), as well as increased mineralization in MC3T3-E1 cells. This indicated that the 3D-printed PEEK/n-TiO2 composite reversed the positive osteogenesis of the TiO2 nanoparticles [16,31,32]. The stained mineralized nodules distributed on the PEEK or PEEK/n-TiO2 composite, where the cells were not well distributed, and a similar size of the well (culture plate) might be helpful to obtain a better cell distribution. Nevertheless, there was a significant difference in mineralization levels between the two groups. The osteointegration effect of the PEEK/n-TiO2 composite awaits further in vivo evaluation, which also requires the design of different pore sizes of the PEEK/n-TiO2 scaffold.

To determine the potential miRNA responsible for the improved properties of the composite, several related candidates were considered. miR-17 and miR-21 are both upregulated in MC3T3 cells cultured on glass coated with a TiO2 layer compared to those cultured on the uncoated substrate glass [20]. The expression changes of miR-154-3p, miR-154-5p, and miR-770-5p in hASCs cultured on TiO2-nanotube are consistent in both the proliferation and induction processes (vs cells cultured on pure Ti) [21]. Till date, the miRNA expression alterations induced by PEEK doped with n-TiO2, compared to pure PEEK, have been less investigated, and directly related miRNAs are still unknown. Although the control material was glass or Ti in the two studies [20,21], the miRNA expression change induced by the TiO2 layer or TiO2-nanotube still indicates the possible involvement of TiO2. Therefore, the aforementioned five miRNAs were selected for further investigation. miR-154-5p was downregulated in both proliferation and osteogenic differentiation processes in the composite group. Several studies have indicated that miR-154-5p plays a negative role in the proliferation of tumor cells [33,34]. Furthermore, miR-154-5p expression levels are increased in patients with type 2 diabetes mellitus and are negatively correlated with OCN [35]. Mechanical tension treatment causes the downregulation of miR-154-5p in adipose-derived mesenchymal stem cells and the forced expression of miR-154-5p inhibits osteogenic differentiation [36]. These studies suggest a negative role of miR-154-5p on cell proliferation and osteogenic differentiation. Consistently, our study also uncovered its negative regulatory role in the proliferation and osteogenic differentiation of MC3T3-E1 cells, which is an important mechanism for the improved properties of PEEK/n-TiO2.

One limitation of this study is that only a single PEEK/n-TiO2 composite with 30% n-TiO2 and no other composite with a different composition was investigated. Another limitation was that the downstream target gene of miR-154-5p was unknown, which will be investigated in future studies.

In summary, we successfully printed a PEEK/n-TiO2 composite with higher bioactivity than pure PEEK. Moreover, the composite retained the nanoscale size of TiO2 as well as the positive osteogenesis of the TiO2 nanoparticles, which provides a promising new solution to improve the osteointegration of PEEK. We also proved that the downregulation of miR-154-5p was an important mechanism for the improved properties of the PEEK/n-TiO2 composite.


# Authors contributed equally


Acknowledgements

We are very grateful for the constant technology supports in the preparation of PEEK composite filament and 3D printing of the PEEK composite from Medvance Medical Technology (Shanghai) Co., Ltd.

  1. Funding information: The study is funded by Medical Cross Research Fund of Shanghai Jiao Tong University (YG2017MS66, YG2016MS68), Science and Technology Commission Shanghai Municipality (22ZR1457200), Shanghai Municipal Health Commission (2022YQ006), and Project supported by Shanghai Tongren Hospital (TRKYRC-xx202203).

  2. Author contributions: X.W., L.Z.K., and L.Y.F. participated in the design of the study. L.Z.K. and Y.J.M. performed the experiments and carried out the statistical analysis. T.S.C. and Y.X.J. interpreted the data. L.Z.K., L.Y.F., T.S.C., and Z.X.Y. drafted the manuscript. All authors read and approved the final manuscript.

  3. Conflict of interest: No authors of this study have any financial and personal relationships with other people or organizations, which could result in an inappropriate influence of this study.

  4. Data availability statement: The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Zhang J, Tian W, Chen J, Yu J, Zhang J, Chen J. The application of polyetheretherketone (PEEK) implants in cranioplasty. Brain Res Bull. 2019;153:143–9. 10.1016/j.brainresbull.2019.08.010.Suche in Google Scholar PubMed

[2] Kersten RF, van Gaalen SM, de Gast A, Oner FC. Polyetheretherketone (PEEK) cages in cervical applications: a systematic review. Spine J. 2015;15:1446–60. 10.1016/j.spinee.2013.08.030.Suche in Google Scholar PubMed

[3] Ma R, Li Y, Wang J, Yang P, Wang K, Wang W. Incorporation of nanosized calcium silicate improved osteointegration of polyetheretherketone under diabetic conditions. J Mater Sci Mater Med. 2020;31:98. 10.1007/s10856-020-06435-0.Suche in Google Scholar PubMed

[4] Phan K, Hogan JA, Assem Y, Mobbs RJ. PEEK-Halo effect in interbody fusion. J Clin Neurosci. 2016;24:138–40. 10.1016/j.jocn.2015.07.017.Suche in Google Scholar PubMed

[5] Buck E, Li H, Cerruti M. Surface modification strategies to improve the osseointegration of poly(etheretherketone) and its composites. Macromol Biosci. 2020;20:e1900271. 10.1002/mabi.201900271.Suche in Google Scholar PubMed

[6] Feng X, Ma L, Liang H, Liu X, Lei J, Li W, et al. Osteointegration of 3D-printed fully porous polyetheretherketone scaffolds with different pore sizes. ACS Omega. 2020;5:26655–66. 10.1021/acsomega.0c03489.Suche in Google Scholar PubMed PubMed Central

[7] Zheng Y, Xiong C, Zhang S, Li X, Zhang L. Bone-like apatite coating on functionalized poly(etheretherketone) surface via tailored silanization layers technique. Mater Sci Eng C Mater Biol Appl. 2015;55:512–23. 10.1016/j.msec.2015.05.070.Suche in Google Scholar PubMed

[8] Oladapo BI, Zahedi SA, Ismail SO, Omigbodun FT. 3D printing of PEEK and its composite to increase biointerfaces as a biomedical material – a review. Colloids Surf B Biointerfaces. 2021;203:111726. 10.1016/j.colsurfb.2021.111726.Suche in Google Scholar PubMed

[9] Oladapo BI, Ismail SO, Bowoto OK, Omigbodun FT, Olawumi MA, Muhammad MA. Lattice design and 3D-printing of PEEK with Ca10(OH)(PO4)3 and in-vitro bio-composite for bone implant. Int J Biol Macromol. 2020;165:50–62. 10.1016/j.ijbiomac.2020.09.175.Suche in Google Scholar PubMed

[10] Wang Y, Muller WD, Rumjahn A, Schwitalla A. Parameters influencing the outcome of additive manufacturing of tiny medical devices based on PEEK. Materials (Basel). 2020;13:466. 10.3390/ma13020466.Suche in Google Scholar PubMed PubMed Central

[11] Liao C, Li Y, Tjong SC. Polyetheretherketone and its composites for bone replacement and regeneration. Polymers (Basel). 2020;12:2858. 10.3390/polym12122858.Suche in Google Scholar PubMed PubMed Central

[12] Tsai PI, Wu MH, Li YY, Lin TH, Tsai JSC, Huang HI, et al. Additive-manufactured Ti–6Al–4V/polyetheretherketone composite porous cage for interbody fusion: bone growth and biocompatibility evaluation in a porcine model. BMC Musculoskelet Disord. 2021;22:171. 10.1186/s12891-021-04022-0.Suche in Google Scholar PubMed PubMed Central

[13] Rodzeń K, Sharma PK, McIlhagger A, Mokhtari M, Dave F, Tormey D, et al. The direct 3D printing of functional PEEK/hydroxyapatite composites via a fused filament fabrication approach. Polymers (Basel). 2021;13:545. 10.3390/polym13040545.Suche in Google Scholar PubMed PubMed Central

[14] Liu S, Zhu Y, Gao H, Ge P, Ren K, Gao J, et al. One-step fabrication of functionalized poly(etheretherketone) surfaces with enhanced biocompatibility and osteogenic activity. Mater Sci Eng C Mater Biol Appl. 2018;88:70–8. 10.1016/j.msec.2018.03.003.Suche in Google Scholar PubMed

[15] Diez-Pascual AM, Diez-Vicente AL. Nano-TiO2 reinforced PEEK/PEI blends as biomaterials for load-bearing implant applications. ACS Appl Mater Interfaces. 2015;7:5561–73. 10.1021/acsami.5b00210.Suche in Google Scholar PubMed

[16] Hasanzadeh Kafshgari M, Goldmann WH. Insights into theranostic properties of titanium dioxide for nanomedicine. Nanomicro Lett. 2020;12:22. 10.1007/s40820-019-0362-1.Suche in Google Scholar PubMed PubMed Central

[17] Hill M, Tran N. miRNA interplay: mechanisms and consequences in cancer. Dis Model Mech. 2021;14:1–9. 10.1242/dmm.047662.Suche in Google Scholar PubMed PubMed Central

[18] Price NL, Fernandez-Hernando C. miRNA regulation of white and brown adipose tissue differentiation and function. Biochim Biophys Acta. 2016;1861:2104–10. 10.1016/j.bbalip.2016.02.010.Suche in Google Scholar PubMed PubMed Central

[19] Ghafouri-Fard S, Abak A, Tavakkoli Avval S, Rahmani S, Shoorei H, Taheri M, et al. Contribution of miRNAs and lncRNAs in osteogenesis and related disorders. Biomed Pharmacother. 2021;142:111942. 10.1016/j.biopha.2021.111942.Suche in Google Scholar PubMed

[20] Smieszek A, Seweryn A, Marcinkowska K, Sikora M, Lawniczak-Jablonska K, Witkowski BS, et al. Titanium dioxide thin films obtained by atomic layer deposition promotes osteoblasts’ viability and differentiation potential while inhibiting osteoclast activity-potential application for osteoporotic bone regeneration. Materials (Basel). 2020;13:4817. 10.3390/ma13214817.Suche in Google Scholar PubMed PubMed Central

[21] Lv L, Liu Y, Zhang P, Bai X, Ma X, Wang Y, et al. The epigenetic mechanisms of nanotopography-guided osteogenic differentiation of mesenchymal stem cells via high-throughput transcriptome sequencing. Int J Nanomed. 2018;13:5605–23. 10.2147/IJN.S168928.Suche in Google Scholar PubMed PubMed Central

[22] Heary RF, Parvathreddy N, Sampath S, Agarwal N. Elastic modulus in the selection of interbody implants. J Spine Surg. 2017;3:163–7. 10.21037/jss.2017.05.01.Suche in Google Scholar PubMed PubMed Central

[23] Hughes EAB, Grover LM. Characterisation of a novel poly (ether ether ketone)/calcium sulphate composite for bone augmentation. Biomater Res. 2017;21:7. 10.1186/s40824-017-0093-7.Suche in Google Scholar PubMed PubMed Central

[24] Mohanapriya S, Mumjitha M, PurnaSai K, Raj V. Fabrication and characterization of poly(vinyl alcohol)-TiO2 nanocomposite films for orthopedic applications. J Mech Behav Biomed Mater. 2016;63:141–56. 10.1016/j.jmbbm.2016.06.009.Suche in Google Scholar PubMed

[25] Wang X, Gittens RA, Song R, Tannenbaum R, Olivares-Navarrete R, Schwartz Z, et al. Effects of structural properties of electrospun TiO2 nanofiber meshes on their osteogenic potential. Acta Biomater. 2012;8:878–85. 10.1016/j.actbio.2011.10.023.Suche in Google Scholar PubMed PubMed Central

[26] Ogawa T, Saruwatari L, Takeuchi K, Aita H, Ohno N. Ti nano-nodular structuring for bone integration and regeneration. J Dent Res. 2008;87:751–6. 10.1177/154405910808700809.Suche in Google Scholar PubMed

[27] Wu X, Liu X, Wei J, Ma J, Deng F, Wei S. Nano-TiO2/PEEK bioactive composite as a bone substitute material: in vitro and in vivo studies. Int J Nanomed. 2012;7:1215–25. 10.2147/IJN.S28101.Suche in Google Scholar PubMed PubMed Central

[28] Kong F, Nie Z, Liu Z, Hou S, Ji J. Developments of nano-TiO2 incorporated hydroxyapatite/PEEK composite strut for cervical reconstruction and interbody fusion after corpectomy with anterior plate fixation. J Photochem Photobiol B. 2018;187:120–5. 10.1016/j.jphotobiol.2018.07.016.Suche in Google Scholar PubMed

[29] Tsao YT, Huang YJ, Wu HH, Liu YA, Liu YS, Lee OK. Osteocalcin mediates biomineralization during osteogenic maturation in human mesenchymal stromal cells. Int J Mol Sci. 2017;18:159. 10.3390/ijms18010159.Suche in Google Scholar PubMed PubMed Central

[30] Wei QS, Huang L, Tan X, Chen ZQ, Chen SM, Deng WM. Serum osteopontin levels in relation to bone mineral density and bone turnover markers in postmenopausal women. Scand J Clin Lab Invest. 2016;76:33–9. 10.3109/00365513.2015.1087045.Suche in Google Scholar PubMed

[31] Jafari S, Mahyad B, Hashemzadeh H, Janfaza S, Gholikhani T, Tayebi L. Biomedical applications of TiO2 nanostructures: recent advances. Int J Nanomed. 2020;15:3447–70. 10.2147/IJN.S249441.Suche in Google Scholar PubMed PubMed Central

[32] Chuang YC, Chang CC, Yang F, Simon M, Rafailovich M. TiO2 nanoparticles synergize with substrate mechanics to improve dental pulp stem cells proliferation and differentiation. Mater Sci Eng C Mater Biol Appl. 2021;118:111366. 10.1016/j.msec.2020.111366.Suche in Google Scholar PubMed

[33] Chi JR, Yu ZH, Liu BW, Zhang D, Ge J, Yu Y, et al. SNHG5 promotes breast cancer proliferation by sponging the miR-154-5p/PCNA axis. Mol Ther Nucleic Acids. 2019;17:138–49. 10.1016/j.omtn.2019.05.013.Suche in Google Scholar PubMed PubMed Central

[34] Chen J, Ma C, Zhang Y, Pei S, Du M, Zhang Y, et al. MiR-154-5p suppresses cell invasion and migration through inhibiting KIF14 in nasopharyngeal carcinoma. Onco Targets Ther. 2020;13:2235–46. 10.2147/OTT.S242939.Suche in Google Scholar PubMed PubMed Central

[35] Ren H, Ma X, Shao Y, Han J, Yang M, Wang Q. Correlation between serum miR-154-5p and osteocalcin in males and postmenopausal females of type 2 diabetes with different urinary albumin creatinine ratios. Front Endocrinol (Lausanne). 2019;10:542. 10.3389/fendo.2019.00542.Suche in Google Scholar PubMed PubMed Central

[36] Li J, Hu C, Han L, Liu L, Jing W, Tang W, et al. MiR-154-5p regulates osteogenic differentiation of adipose-derived mesenchymal stem cells under tensile stress through the Wnt/PCP pathway by targeting Wnt11. Bone. 2015;78:130–41. 10.1016/j.bone.2015.05.003.Suche in Google Scholar PubMed

Received: 2022-05-02
Revised: 2022-11-10
Accepted: 2022-12-13
Published Online: 2023-01-28

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Artikel in diesem Heft

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Heruntergeladen am 11.5.2026 von https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0636/html?lang=de
Button zum nach oben scrollen