Abstract
GRIN2A is associated with epilepsy (EP); however, its regulatory mechanism involving upstream miRNA (miR-30b-5p) has been overlooked. In this study, we aimed to identify the regulatory mechanism of the miR-30b-5p/GRIN2A axis in EP. Hippocampal neurons isolated from mice were incubated in magnesium-free medium for 48 h to establish an in vitro EP model. An in vivo model of EP was constructed by the intraperitoneal injection of atropine into mice. Nissl staining and hematoxylin and eosin staining were used to evaluate pathological injuries in the hippocampal CA1 regions of mice. The CCK8 assay confirmed that miR-30b-5p overexpression restored the suppressed proliferative capacity of hippocampal neurons exposed to magnesium-free conditions. Caspase-3 activity assay revealed that miR-30b-5p overexpression abrogated the increased apoptosis of hippocampal neurons under magnesium-free conditions. In an in vivo model of EP, miR-30b-5p overexpression reversed pathological injuries in the hippocampal CA1 regions of mice and abrogated the increased apoptosis in the EP mouse model. Luciferase assays and western blotting confirmed that miR-30b-5p targeted GRIN2A, thereby inhibiting GRIN2A expression. Overall, miR-30b-5p can protect against cell proliferation and attenuate apoptosis in hippocampal neurons under magnesium-free conditions by targeting GRIN2A.
1 Introduction
Epilepsy (EP) is a prevalent neurological disorder accompanied by transient cerebral dysfunction resulting from the aberrant synchronization of neuronal firing in the brain [1]. The main clinical manifestations of EP are repeated seizures and loss of consciousness and awareness, which causes a tremendous social and economic burden globally [2]. Global statistics have reported that 5 × 107 patients were diagnosed with EP. Among them, 80% of patients were from the developing countries [3]. Although current anti-EP drugs can reduce the frequency of convulsive episodes, the disorder remains incurable [4]. Hippocampal CA3 and CA1 pyramidal neurons are the beginning sites of interictal epileptiform discharges, and the hippocampus is one of the critical sites of EP [2,5]. Hippocampal neurons exposed to magnesium-free conditions are often used to construct EP models in vitro [6,7]. Therefore, using magnesium-free conditions to treat hippocampal neurons to further decipher the biological progression of EP is a potential novel approach for EP diagnosis and intervention.
MicroRNAs (miRNAs) are transcripts of 20–25 nucleotides without a protein-coding ability. Compelling data demonstrate that miRNAs are critical players in different physiological and pathological cascades such as carcinogenesis and neurological disorders [8]. Aberrantly expressed miRNAs have been detected in EP and act as critical players in modulating neuronal apoptosis, glial hyperplasia and hypertrophy, neuroinflammation, and neuronal microarchitecture remodeling [9,10]. For example, an in vivo model of pentylenetetrazol-stimulated EP demonstrated that highly expressed miRNA-137 attenuates the frequency of seizures [11]. Furthermore, blockade of the NF-kB signaling pathway by microRNA-129-5p impedes autoimmune encephalomyelitis-related EP [12]. Elnady et al. found that miR-106b and miR-146a are robustly expressed in childhood EP and function as markers of this neurological disorder [13]. Recently, miR-30b-5p was found to be involved in drug-resistant EP [14]. However, little is known about whether and how miR-30b-5p modulates EP progression.
The GRIN2A gene is located on chromosome 16p13.2 consisting of 16 exons. This gene encodes a member of the glutamate-gated ion-channel protein family [15]. The encoded protein is an N-methyl-d-aspartate receptor subunit involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain types of memory and learning [16]. Genetic mutations in GRIN2A are associated with epilepsy-aphasia spectrum disorders [17,18]. However, the mechanism through which GRIN2 influences EP remains unclear.
A previous investigation demonstrated that miRNAs exert their functions by recognizing the 3′-UTR target gene [19]. In this study, we employed a series of bioinformatics analyses and identified miR-30b-5p as a potential upstream regulator of GRIN2A, interfering with EP progression. A previous study reported that miR-30b-5p targeting MYBL2 could suppress the proliferation and induce apoptosis of medulloblastoma cells [20]. The miR-30b-5p induced by NF-κB aggravates joint pain and loss of articular cartilage [21]. However, the role of miR-30b-5p in EP remains unknown. We first investigated the effects of miR-30b-5p overexpression on the proliferation and apoptosis of hippocampal neurons under magnesium-free conditions and in a pilocarpine-induced EP mouse model. Our investigation further revealed a potential mechanism of the miR-30b-5p/GRIN2A axis in EP progression. Our findings suggest that miR-30b-5p/GRIN2A plays an important role in EP progression.
2 Methods
2.1 Animal maintenance and housing
A total of 56 3-month-old mice weighing 20–25 g were obtained from the Laboratory Animal Center, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China. The mice received normal feed and 12 h cycle of lighting with adequate food availability.
-
Ethical approval: The research related to animals’ use has been complied with national and institutional guidelines for animal care and was approved by the Institutional Animal Ethics Committee Review Board of the Hubei Provincial Hospital of Integrated Chinese & Western Medicine.
2.2 Hippocampal neurons isolation and culture
We separated hippocampal neurons from the brains of mice as instructed previously [22]. The separated hippocampal neurons were cultivated in RPMI-1640 medium containing 10% FBS and 1% penicillin/streptomycin at 37°C and 5% CO2. Morphological observations coupled with immunofluorescence staining were used to identify hippocampal neurons.
2.3 RNA pull-down assay
A Magnetic RNA-Protein Pull-Down Kit (Thermo Fisher Scientific, USA) was used to detect the interaction between GRIN2A and its potential target miRNAs. Briefly, isolated hippocampal neurons were treated with Pierce IP Lysis Buffer (Thermo Fisher Scientific, USA). After 10 min, cell lysates were collected and subjected to centrifugation. The prepared supernatants underwent co-incubation with magnetic beads (Thermo Fisher Scientific, USA) attached to biotinylated miRNA or miRNA-NC (Ribobio, China). RT-qPCR analysis was employed to determine GRIN2A mRNA levels in the pull-down proteins of the RNA–protein complexes.
2.4 Immunofluorescence staining
After cultivating them for 12 h, the hippocampal neurons were subjected to 10% goat serum for 1.5 h at room temperature before incubation with anti-MAP2 antibody (Abcam; 1:1,000) at 4°C. Next day, the cells were continuously detected using goat anti-rabbit IgG (Abcam; 1:5,000) for 24 h at 37°C for additional 1 h, followed by nuclear staining with DAPI (Sigma, USA) for 5 min. Finally, fluorescence activity was observed under a fluorescence microscope (Olympus CX23, Japan).
2.5 Cell transfection
miR-30b-5p mimic, mimic NC, pcDNA-3.1-GRIN2A (GRIN2A-overexpressing vector, GRIN2A OE), and the empty vector (pcDNA 3.1) were purchased from GenePharma (Shanghai, China). The synthesized mononucleotides and vectors were introduced into hippocampal neurons at 30% confluence with Lipo3000 and Opti-MEM (Thermo Fisher, USA) according to the manufacturer’s instructions.
2.6 Establishment of the in vitro EP model
Magnesium-free conditions are often used to induce EP in vitro, according to previous studies [6,7]. Therefore, isolated hippocampal neurons in the logarithmic growth phase were cultivated in magnesium-free media for 48 h to establish an in vitro EP model.
2.7 CCK8 assays
Hippocampal neurons in the different treatment groups were seeded in 96-well plates for 24 h. Then, 10 μL CCK8 reagent was added to the medium for the next 2 h of cultivation. Absorbance at 450 nm was measured using a microplate reader.
2.8 Assessment of caspase-3 activity
Caspase-3 activity in hippocampal neurons in different treatments was detected using a Caspase 3 Assay Kit (Merck, USA) following the manufacturer’s instructions. Briefly, 2 × 106 cells were lysed in 100 µL ice-cold lysis buffer for 15 min. After microcentrifugation at 4℃, the supernatant was collected. Incubation with 2 mM Ac-DEVD-pNA was conducted for 1 h at 37℃. When the color changed, the A405 was read using a microplate ELISA reader.
2.9 Western blots
The hippocampal neurons were homogenized and sonicated in ice-cold lysis buffer for 30 min. The supernatant samples were diluted to assess protein concentration using a Pierce BCA kit (Thermo Fisher, USA). Similar amounts of proteins were loaded onto 10% SDS-PAGE and run at 200 V before electric transfer to PVDF membranes. After blocking with 10% non-fat milk, the proteins on the membrane were detected at 4°C using anti-orb29358 (orb571010, 1:1,000; Biorbyt, UK) and anti-GAPDH (orb555879, 1:1,000; Biorbyt, UK). After 24 h, secondary anti-antibodies (Cat#: orb27046, 1:1,000; Biorbyt, UK) were supplemented for co-incubation with the membrane for 1 h. Finally, Pierce ECL western blot substrate (Thermo Fisher, USA) was used for the staining and visualization of the target proteins.
2.10 RT-qPCR
Total RNA was isolated from hippocampal neurons using a MolPure Cell RNA Kit (Yeasen, China), according to the manufacturer’s instructions. A reverse transcription kit (Yeasen, China) was used for reverse transcription. The expression levels of miR-30b-5p and GRIN2A were determined using a Real-Time PCR kit (Thermo Fisher, USA) on a real-time fluorescence quantitative PCR system (ABI7500). Relative expression was calculated using the 2−ΔΔCt method by normalizing U6 or GAPDH. Primers used are listed in Table 1.
The primers used
| Gene symbol | Primer sequence (5′…3′) |
|---|---|
| GRIN2A-F | TCAGTGCCTCCGTCTGGGTGA |
| GRIN2A-R | GCCCGTGGGGAGCTTCCCT |
| rno-miR-30b-5p-F | GGGCTGTAAACATCCTACAC |
| rno-miR-30b-5p-R | TGCGTGTCGTGGAGTC |
| GAPDH-F | TGATTCTACCCACGGCAAGTT |
| GAPDH-R | TGATGGGTTTCCCATTGATGA |
| U6-F | CGCTTCACGAATTTGCGTGTCAT |
| U6-R | GCTTCGGCAGCACATATACTAAAAT |
2.11 Luciferase reporter assays
The putative binding sequence (wild-type, WT) of 3′-UTR GRIN2A with miR-30b-5p and the corresponding mutant (MUT) fragment were amplified and inserted into pGL3 Luciferase Reporter Vectors (Promega, USA). The resulting WT and MUT vectors were transfected into 60% confluent hippocampal neurons. At 48 h post-transfection, luminescence measurements were performed using a luciferase assay kit (Genomeditech, China).
2.12 Establishment of the mice model for EP
Pilocarpine (300 mg/kg) (Sigma, USA) was intraperitoneally injected into 30 healthy mice before receiving an injection of atropine (2.5 mL/kg). Epileptic seizures were recorded. After 2 h, diazepam (8.0 mg/kg) was intraperitoneally injected into the mice to terminate EP induction. When an epileptic seizure reached four grades and lasted for more than 2 h, status epilepticus (SE) occurred. After 2 months, an in vivo EP model was successfully established. Normal mice were intraperitoneally injected with an equal amount of normal saline.
2.13 Agomir injection
Fifteen mice were divided into three subgroups: SE, SE + agomir-NC, and SE + agromir-miR. Five mice that underwent intraperitoneal administration of equal amounts of normal saline were defined as the normal group. For the SE + agomir-NC and SE + agromir groups, agromir-miR-30b-5p and agomir-NC were chemically synthesized by GenePharma, China. Agomir and agomir-NC (30 nL) were microinjected into the hippocampal CA1 region of mice. Finally, the hippocampal CA1 region was separated from the euthanized mice.
2.14 Hematoxylin and eosin (HE) staining
Tissue slices of the hippocampal CA1 regions from different groups were prepared by Linmei Biotechnology Co., Ltd, China, according to the conventional method. Sections were dewaxed with xylene for 5 min and hydrated with different doses of ethanol for 5 min. After repeated rinsing with PBS, the sections were stained with hematoxylin for 2 min and washed in running water. Eosin was added, and the slides were covered for 5 s. After dehydration with ethanol, sections were coagulated at room temperature. Representative images were obtained under a microscope in the direction of the pathologist.
2.15 Nissl staining
The deparaffinized tissue slices were stained with 1% toluidine blue. After 1 h, the slices were treated with gradient alcohol (70–100%) for color separation and dehydration. Nissl-stained cells were imaged under a microscope.
2.16 TUNEL staining
TUNEL staining was performed to examine apoptosis in the tissues of the mouse hippocampal CA1 regions. After deparaffinization, the sections were treated with 3% hydrogen peroxide to block endogenous peroxidase activity before incubation with 20% fetal bovine serum and 3% bovine serum albumin. After 20 min, 50 µL of the TUNEL mixture was added to the sections, which were maintained in a humidified 37°C incubator. After 1 h, the sections were exposed to peroxidase conjugated anti-digoxin antibody at 37°C. After 20 min, the sections were rinsed with PBS and developed with diaminobenzidine before double staining with hematoxylin. TUNEL-positive cells in the CA1 region were observed using a 400× magnification light microscope (Leica DM750, USA).
2.17 Statistical analysis
Data are expressed as mean ± standard deviation and plotted using GraphPad Prism 9.0. Student’s t-test and one-way analysis of variance were used to determine significant differences between two groups or among multiple groups, respectively. Statistical significance was set at P < 0.05.
3 Results
3.1 Identification of key regulators in EP
GSE28674 downloaded from GEO DataSets included the hippocampus with or without EP samples to screen for differentially expressed genes (DEGs). With adj. P < 0.05, 571 DEGs were screened and uploaded to STRING and Metascape for GO enrichment. STRING analysis showed that nervous system development involving 143 genes was the key GO process (Figure 1a), while Metascape found that the neuronal system involving 61 genes was the key GO process (Figure 1b). Then, 25 key genes were associated with nervous system development and neuronal system overlap (Figure 1c). After uploading the genes to STRING, STXBP1, GRIN2A, and SYN1 among these 25 key genes were identified as the key genes involved in EP (Figure 1d). GRIN2A has been reported to be closely related to EP [23,24], but its upstream miRNAs that regulate its expression have not been explored in EP. To identify the upstream regions of GRIN2A, miRDB, TarBase, TargetScan, and starBase were used to predict miRNAs targeting GRIN2A. The miR-30b-5p and miR-30c-5p overlapped in all four databases (Figure 1e). RNA pull-down assay revealed that GRIN2A was enriched in hippocampal neurons transfected with bio-miR-30b-5p (Figure 1f).

miR-30b-5p and GRIN2A were the key regulators in epilepsy. (a) STING was used for GO enrichment of 571 DEGs screened from GSE28674 with adj. P < 0.05. (b) Metascape was used for GO enrichment of 571 DEGs screened from GSE28674 with adj. P < 0.05. (c) Twenty-five genes involving nervous system development from STRING and neuronal system from Metascape overlapped. (d) STXBP1, GRIN2A, and SYN1 were enriched to be related to epilepsy. (e) Two miRNAs were predicted to bind to GRIN2A based on the four databases (miRDB, TarBase, TargetScan, and starBase). (f) Enrichment of GRIN2A was detected by RNA pull-down assay.
3.2 miR-30b-5p overexpression abrogates the inhibitory effect exerted by magnesium-free condition on hippocampal neurons proliferation
Having verified the involvement of miR-30b-5p and GRIN2A in EP, we further investigated their functional roles in hippocampal neurons. We isolated hippocampal neurons from the brain tissue of normal rats. As shown in Figure 2a, morphological observations demonstrated that the hippocampal neurons were characterized by an elongated shape, which is a typical feature of hippocampal neurons. In parallel, immunofluorescence staining analysis of MAP2 displayed high fluorescent staining, indicating the successful isolation of hippocampal neurons from rats (Figure 2b). The absence of magnesium is a well-accepted stimulus for EP. Therefore, isolated hippocampal neurons were exposed to magnesium-free conditions. Interestingly, the downregulation of miR-30b-5p was detected in magnesium-free-treated hippocampal neurons (Figure 2c). However, the reduced expression of miR-30b-5p in hippocampal neurons as a consequence of magnesium-free induction was rescued after the cells were transfected with the miR-30b-5p mimic (Figure 2d). Magnesium-free treatment reduces the proliferation of hippocampal neurons while accelerating apoptosis. However, alterations in both hippocampal neuron proliferation and apoptosis were abrogated by the miR-30b-5p mimic (Figure 2e and f). Collectively, miR-30b-5p ectopic expression might protect hippocampal neurons from magnesium-free injuries.

miR-30b-5p overexpression abrogates the inhibitory effect exerted by magnesium-free condition on hippocampal neurons proliferation. (a) Efficacy of isolation was observed by a light microscope at 200× magnification. (b) Efficiency of isolation was detected using immunofluorescence staining. The green fluorescence indicates MAP2, and the blue fluorescence indicates nuclear staining (DAPI). (c) RT-qPCR analysis of miR-30b-5p in hippocampal neurons in the presence or absence of free magnesium. (d) RT-qPCR analysis of miR-30b-5p in hippocampal neurons transfected with miR-30b-5p mimic or mimic NC in the presence or absence of free magnesium. (e) CCK8 assays determining the cell proliferation in hippocampal neurons transfected with miR-30b-5p mimic or mimic NC in the presence or absence of free magnesium. (f) Caspase-3 activity assessment in hippocampal neurons transfected with miR-30b-5p mimic or mimic NC in the presence or absence of free magnesium. *P < 0.05, **P < 0.001. NC, negative control.
3.3 miR-30b-5p overexpression restored the pathological injury and cell apoptosis in the hippocampal CA1 region
In addition to the role of miR-30b-5p in vitro, we examined its function in vivo. First, we constructed a mouse model of EP by intraperitoneal injection of pilocarpine. Accumulating spontaneous seizures in mice were detected in the PE mouse model (Figure 3a). Furthermore, most mice presented with spontaneous recurrent seizures. These data suggest the successful establishment of an in vivo EP model. Next, agomir-30b-5p or agomir-NC was injected into the established mouse model, and hippocampal CA1 was isolated for the assessment of pathological alterations. As shown in Figure 3b, in the EP model, an increased number of Nissl bodies and serious pathological disorders were observed in the hippocampal CA1 area, while agomir-30b-5p introduction almost recovered the induced damage in the hippocampal CA1 area (Figure 3b). TUNEL apoptosis detection showed that hippocampal CA1 in mice suffering from seizures was characterized by high apoptosis, while agomir-30b-5p nullified accelerated apoptosis (Figure 3c). Therefore, miR-30b-5p may protect against induced disorders in the hippocampal CA1 region in vivo.

miR-30b-5p overexpression restored the pathological injury and cell apoptosis in hippocampal CA1 region. (a) Number of seizures of mice increases in the model group. (b) Pathological changes of hippocampal CA1 region were found in the model group after miR-30b-5p agomir or agomir negative control (agomir NC) was immediately injected via the tail vein. Hippocampal CA1 region using HE staining (400×) and Nissl’s staining. (c) TUNEL staining determining cell apoptosis rate in seizures. *P < 0.05, **P < 0.001. NC, negative control; HE, hematoxylin and eosin; SE, seizures.
3.4 miR-30b-5p targets GRIN2A interfering with the magnesium-free condition that induces the growth inhibition of hippocampal neurons
Consistent with the predicted interplay between GRIN2A and miR-30b-5p, Figure 4a reveals that miR-30b-5p shared interaction motifs with the 3′-UTR of GRIN2A. There was a conspicuous decrease in 3′-UTR GRIN2A-WT-derived luciferase reporter activity in hippocampal neurons transfected with the miR-30b-5p mimic, while no change was observed in 3′-UTR GRIN2A-MUT-driven activity (Figure 4b). Western blot analysis confirmed that the miR-30b-5p mimic suppressed GRIN2A expression, whereas the miR-30b-5p inhibitor enhanced GRIN2A expression (Figure 4c). To further investigate whether GRIN2A is important for the role of miR-30b-5p in EP, we co-transfected GRIN2A overexpressing vectors and miR-30b-5p mimic into hippocampal neurons before magnesium-free treatment. RT-qPCR analysis and western blotting demonstrated that the miR-30b-5p mimic abolished exogenous overexpression of GRIN2A (Figure 4d and e). Moreover, GRIN2A overexpression caused an extra induction in the proliferation of hippocampal neurons following magnesium-free treatment; however, the miR-30b-5p mimic almost restored the reduced proliferative capacity (Figure 4f). Undoubtedly, GRIN2A overexpression aggravated the proliferative defect caused by magnesium-free treatment, whereas the defect was abrogated by co-transfection with the miR-30b-5p mimic (Figure 4g). Collectively, these data suggest that miR-30b-5p targeting of GRIN2A hampers EP progression in vitro.

miR-30b-5p targets GRIN2A interfering with the magnesium-free condition that induces the growth inhibition of hippocampal neurons. (a) Gene structure of GRIN2A indicated the predicted target site of miR-30b-5p in its 3′-UTR. (b) Luciferase activity was measured in hippocampal neurons following co-transfecting with WT/MUT GRIN2A 3′-UTR plasmid and miR-30b-5p with the dual luciferase reporter assay. (c) Expression of GRIN2A protein in hippocampal neurons transfected with mimic-NC, miR-30b-5p mimic (mimic), inhibitor-NC, and miR-30b-5p inhibitor (inhibitor) was detected by western blots. (d) Expression of GRIN2A in hippocampal neurons transfected with pcDNA3.1-GRIN2A, pcDNA3.1, miR-30b-5p mimic, and miR-30b-5p mimic + pcDNA3.1-GRIN2A before magnesium-free treatment was investigated by RT-qPCR. (e) Western blotting analysis of GRIN2A expression in hippocampal neurons in the same groups as (d). (f) CCK8 assays determine the cell proliferation in the same groups as (d). (g) Caspase-3 activity measured in the same groups as (d). **P < 0.001. WT, wild type; MUT, mutant.
4 Discussion
The pathogenesis of EP involves the abnormal expression of various genes and transcripts [10]. Among these, miRNAs are implicated in synaptic plasticity, neuronal apoptosis, and neuroinflammation. Therefore, further elucidation of the role of miRNAs in EP may favor EP diagnosis and treatment [25]. In this study, we found that miR-30b-5p overexpression restored the reduced growth of hippocampal neurons caused by the magnesium-free condition. Subsequent investigation in EP model mice revealed that miR-30b-5p upregulation attenuated pathological injuries of hippocampal CA1 region of mice as well as declined the apoptosis of hippocampal CA1 region of mice. These findings suggest that targeting miR-30b-5p is a promising anti-EP method.
Magnesium-free conditions can induce recurrent spontaneous epileptic discharges in hippocampal neurons, which is similar to the electrophysiology of human EP [26]. During this process, various EP-related transcripts are activated. Therefore, we constructed an in vitro EP model to investigate the role of miR-30b-5p in EP. This miRNA is reported to be involved in diverse disorders such as diabetic retinopathy [27], myocardial infarction [28], and cancer [29,30]. However, its effect on cell proliferation and apoptosis is context- or tissue-dependent. For example, in breast cancer, miR-30b-5p increases the malignant behavior of tumor cells and acts as an oncomir [28]. miR-30b-5p was also shown to suppress the proliferation of cardiac fibroblasts and attenuate fibrogenesis post-myocardial infarction [31]. Our data demonstrated that the miR-30b-5p mimic promoted cellular proliferation and reduced apoptotic activity in hippocampal neurons exposed to magnesium-free conditions. Next, we dissected the role of miR-30b-5p in an EP mouse model. Consistent with the in vitro findings, we found that miR-30b-5p decreased apoptosis in the hippocampal CA1 region of EP mice, in addition to reversing the pathological changes in EP mice. Our findings suggest that miR-30b-5p exerts its anti-EP effect by increasing proliferation and impeding apoptosis in hippocampal neurons.
Generally, miRNAs post-transcriptionally edit mRNA and are involved in various pathophysiological processes. Based on our bioinformatic analysis, we verified that GRIN2A is a target of miR-30b-5p in hippocampal neurons. Previously, GRIN2A mutant was found to be associated with EP [17,32,33]. In our in vitro EP model, overexpression of GRIN2A led to extra suppression of proliferation in hippocampal neurons exposed to magnesium-free conditions as well as higher apoptosis compared with other groups, suggesting that GRIN2A overexpression can exacerbate EP status. The mechanical outcome demonstrated that the miR-30b-5p mimic abrogated the exogenous expression of GRIN2A in hippocampal neurons in the presence of magnesium-free conditions. Furthermore, the miR-30b-5p mimic abrogated the promotion of cell growth of GRIN2A overexpression in an in vitro EP model. Collectively, miR-30b-5p may attenuate the proliferation of hippocampal neurons in magnesium-free conditions by targeting GRIN2A.
However, this study had several limitations. First, the sample size was small and we only investigated the roles of miR-30b-5p and GRIN2A in vitro and in vivo. miRNAs can recognize different genes through seed-complementary sequences. Therefore, the complex regulatory network of miR-30b-5p in EP requires further investigation. The mTOR signaling [34], zinc signaling [35], and inflammation-associated signaling [36] are dysregulated during EP initiation and progression. Therefore, GRIN2A-mediated signaling pathways warrant further research.
Collectively, our data revealed that miR-30b-5p targeting GRIN2A promoted the proliferation and attenuated apoptosis of hippocampal neurons in an in vitro EP model. Furthermore, miR-30b-5p overexpression exerted anti-EP effects by suppressing apoptosis and pathological injuries in the hippocampal CA1 region in an EP mouse model. Our findings provide a promising approach for EP diagnosis and intervention.
Abbreviations
- DEGs
-
differentially expressed genes
- EP
-
epilepsy
- HE
-
hematoxylin and eosin
- miRNAs
-
microRNAs
- MUT
-
mutant
- SE
-
status epilepticus
Acknowledgement
None.
-
Funding information: The authors state no funding involved.
-
Author contributions: H.Z. performed the experiments and data analysis. L.Y.W. conceived and designed the study. H.Z. and H.S.Y. made the acquisition of data. L.Y.W. did the analysis and interpretation of data. All authors read and approved the manuscript.
-
Conflict of interest: Authors state no conflict of interest.
-
Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
References
[1] Manford M. Recent advances in epilepsy. J Neurol. 2017;264(8):1811–24.10.1007/s00415-017-8394-2Search in Google Scholar PubMed PubMed Central
[2] Huberfeld G, Blauwblomme T, Miles R. Hippocampus and epilepsy: findings from human tissues. Rev Neurol (Paris). 2015;171(3):236–51.10.1016/j.neurol.2015.01.563Search in Google Scholar PubMed PubMed Central
[3] Singh G, Sander JW. The global burden of epilepsy report: implications for low- and middle-income countries. Epilepsy Behav. 2020;105:106949.10.1016/j.yebeh.2020.106949Search in Google Scholar PubMed
[4] Beghi E, Giussani G, Sander JW. The natural history and prognosis of epilepsy. Epileptic Disord. 2015;17(3):243–53.10.1684/epd.2015.0751Search in Google Scholar PubMed
[5] Churn SB, Anderson WW, DeLorenzo RJ. Exposure of hippocampal slices to magnesium-free medium produces epileptiform activity and simultaneously decreases calcium and calmodulin-dependent protein kinase II activity. Epilepsy Res. 1991;9(3):211–7.10.1016/0920-1211(91)90054-JSearch in Google Scholar PubMed
[6] Gong L, Yang P, Hu L, Zhang C. miR-181b suppresses the progression of epilepsy by regulation of lncRNA ZNF883. Am J Transl Res. 2020;12(6):2769–80.Search in Google Scholar
[7] Chen F, Zheng H, Zhang W, Kang J, Liu Q, Pu J, et al. circ_0003170 aggravates human hippocampal neuron injuries by regulating the miR-421/CCL2 axis in cells models of epilepsy. Gen Physiol Biophys. 2021;40(2):115–26.10.4149/gpb_2020045Search in Google Scholar PubMed
[8] Bhaskaran M, Mohan M. MicroRNAs: history, biogenesis, and their evolving role in animal development and disease. Vet Pathol. 2014;51(4):759–74.10.1177/0300985813502820Search in Google Scholar PubMed PubMed Central
[9] Henshall DC, Hamer HM, Pasterkamp RJ, Goldstein DB, Kjems J, Prehn JHM, et al. MicroRNAs in epilepsy: pathophysiology and clinical utility. Lancet Neurol. 2016;15(13):1368–76.10.1016/S1474-4422(16)30246-0Search in Google Scholar PubMed
[10] Brennan GP, Henshall DC. microRNAs in the pathophysiology of epilepsy. Neurosci Lett. 2018;667:47–52.10.1016/j.neulet.2017.01.017Search in Google Scholar PubMed
[11] Yu Y, Luo W, Yang ZJ, Chi JR, Li YR, Ding Y, et al. miR-190 suppresses breast cancer metastasis by regulation of TGF-β-induced epithelial–mesenchymal transition. Mol Cancer. 2018;17(1):70.10.1186/s12943-018-0818-9Search in Google Scholar PubMed PubMed Central
[12] Liu AH, Wu YT, Wang YP. MicroRNA-129-5p inhibits the development of autoimmune encephalomyelitis-related epilepsy by targeting HMGB1 through the TLR4/NF-kB signaling pathway. Brain Res Bull. 2017;132:139–49.10.1016/j.brainresbull.2017.05.004Search in Google Scholar PubMed
[13] Elnady HG, Abdelmoneam N, Eissa E, Hamid ERA, Zeid DA, Abo-Shanab AM, et al. MicroRNAs as potential biomarkers for childhood epilepsy. Open Access Maced J Med Sci. 2019;7(23):3965–9.10.3889/oamjms.2019.634Search in Google Scholar PubMed PubMed Central
[14] De Matteis M, Cecchetto G, Munari G, Balsamo L, Gardiman MP, Giordano R, et al. Circulating miRNAs expression profiling in drug-resistant epilepsy: up-regulation of miR-301a-3p in a case of sudden unexpected death. Leg Med (Tokyo). 2018;31:7–9.10.1016/j.legalmed.2017.12.003Search in Google Scholar PubMed
[15] Wu Y, Wang Y, Wang M, Sun N, Li C. GRIN2A polymorphisms and expression levels are associated with lead-induced neurotoxicity. Toxicol Ind Health. 2017;33(4):332–9.10.1177/0748233716647636Search in Google Scholar PubMed
[16] Ali F, Meier R. Primate home range and GRIN2A, a receptor gene involved in neuronal plasticity: implications for the evolution of spatial memory. Genes Brain Behav. 2009;8(4):435–41.10.1111/j.1601-183X.2009.00489.xSearch in Google Scholar PubMed
[17] Yang X, Qian P, Xu X, Liu X, Wu X, Zhang Y, et al. GRIN2A mutations in epilepsy-aphasia spectrum disorders. Brain Dev. 2018;40(3):205–10.10.1016/j.braindev.2017.09.007Search in Google Scholar PubMed
[18] Myers SJ, Yuan H, Kang JQ, Tan FCK, Traynelis SF, Low CM. Distinct roles of GRIN2A and GRIN2B variants in neurological conditions. F1000Res. 2019;8:1940.10.12688/f1000research.18949.1Search in Google Scholar PubMed PubMed Central
[19] Li MM, Li XM, Zheng XP, Yu JT, Tan L. MicroRNAs dysregulation in epilepsy. Brain Res. 2014;1584:94–104.10.1016/j.brainres.2013.09.049Search in Google Scholar PubMed
[20] Xu C, He Z, Lin C, Shen Z. miR-30b-5p inhibits proliferation and promotes apoptosis of medulloblastoma cells via targeting MYB proto-oncogene like 2 (MYBL2). J Investig Med. 2020;68(6):1179–85.10.1136/jim-2020-001354Search in Google Scholar PubMed
[21] Xu H, Zhang J, Shi X, Li X, Zheng C. NF-κB inducible miR-30b-5p aggravates joint pain and loss of articular cartilage via targeting SIRT1-FoxO3a-mediated NLRP3 inflammasome. Aging (Albany NY). 2021;13(16):20774–92.10.18632/aging.203466Search in Google Scholar PubMed PubMed Central
[22] Wen X, Han XR, Wang YJ, Wang S, Shen M, Zhang ZF, et al. MicroRNA-421 suppresses the apoptosis and autophagy of hippocampal neurons in epilepsy mice model by inhibition of the TLR/MYD88 pathway. J Cell Physiol. 2018;233(9):7022–34.10.1002/jcp.26498Search in Google Scholar PubMed
[23] Strehlow V, Heyne HO, Vlaskamp DRM, Marwick KFM, Rudolf G, de Bellescize J, et al. GRIN2A-related disorders: genotype and functional consequence predict phenotype. Brain. 2019;142(1):80–92.10.1093/brain/awy304Search in Google Scholar PubMed PubMed Central
[24] Mota Vieira M, Nguyen TA, Wu K, Badger JD 2nd, Collins BM, Anggono V, et al. An epilepsy-associated GRIN2A rare variant disrupts CaMKIIα phosphorylation of GluN2A and NMDA receptor trafficking. Cell Rep. 2020;32(9):108104.10.1016/j.celrep.2020.108104Search in Google Scholar PubMed
[25] Pitkänen A, Löscher W, Vezzani A, Becker AJ, Simonato M, Lukasiuk K, et al. Advances in the development of biomarkers for epilepsy. Lancet Neurol. 2016;15(8):843–56.10.1016/S1474-4422(16)00112-5Search in Google Scholar PubMed
[26] Neuman RS, Cherubini E, Ben-Ari Y. Endogenous and network bursts induced by N-methyl-D-aspartate and magnesium free medium in the CA3 region of the hippocampal slice. Neuroscience. 1989;28(2):393–9.10.1016/0306-4522(89)90186-3Search in Google Scholar PubMed
[27] Mazzeo A, Lopatina T, Gai C, Trento M, Porta M, Beltramo E. Functional analysis of miR-21-3p, miR-30b-5p and miR-150-5p shuttled by extracellular vesicles from diabetic subjects reveals their association with diabetic retinopathy. Exp Eye Res. 2019;184:56–63.10.1016/j.exer.2019.04.015Search in Google Scholar PubMed
[28] Chi F, Feng L, Li Y, Zhao S, Yuan W, Jiang Y, et al. miR-30b-5p promotes myocardial cell apoptosis in rats with myocardial infarction through regulating Wnt/β-catenin signaling pathway. Minerva Med. 2020. 10.23736/S0026-4806.20.06565-9.Search in Google Scholar PubMed
[29] Estevão-Pereira H, Lobo J, Salta S, Amorim M, Lopes P, Cantante M, et al. Overexpression of circulating miR-30b-5p identifies advanced breast cancer. J Transl Med. 2019;17(1):435.10.1186/s12967-019-02193-ySearch in Google Scholar PubMed PubMed Central
[30] Zhang C, Pan X, Peng X, Liu K, Wang J, Zhao L, et al. miR-30b-5p up-regulation related to the dismal prognosis for patients with renal cell cancer. J Clin Lab Anal. 2021;35(2):e23599.10.1002/jcla.23599Search in Google Scholar PubMed PubMed Central
[31] Zhao XS, Ren Y, Wu Y, Ren HK, Chen H. miR-30b-5p and miR-22-3p restrain the fibrogenesis of post-myocardial infarction in mice via targeting PTAFR. Eur Rev Med Pharmacol Sci. 2020;24(7):3993–4004.Search in Google Scholar
[32] Lesca G, Møller RS, Rudolf G, Hirsch E, Hjalgrim H, Szepetowski P. Update on the genetics of the epilepsy-aphasia spectrum and role of GRIN2A mutations. Epileptic Disord. 2019;21(S1):41–7.10.1684/epd.2019.1056Search in Google Scholar
[33] Myers KA, Scheffer IE. GRIN2A-related speech disorders and epilepsy. In: Adam MP, Ardinger HH, Pagon RA, Wallace SE, Bean LJH, Mirzaa G, et al. editors. GeneReviews(®). Seattle (WA): University of Washington, Seattle. Copyright © 1993-2021, University of Washington, Seattle. GeneReviews is a registered trademark of the University of Washington, Seattle. All rights reserved.; 1993.Search in Google Scholar
[34] Hodges SL, Lugo JN. Therapeutic role of targeting mTOR signaling and neuroinflammation in epilepsy. Epilepsy Res. 2020;161:106282.10.1016/j.eplepsyres.2020.106282Search in Google Scholar PubMed PubMed Central
[35] Doboszewska U, Młyniec K, Wlaź A, Poleszak E, Nowak G, Wlaź P. Zinc signaling and epilepsy. Pharmacol Ther. 2019;193:156–77.10.1016/j.pharmthera.2018.08.013Search in Google Scholar PubMed
[36] Sanz P, Garcia-Gimeno MA. Reactive glia inflammatory signaling pathways and epilepsy. Int J Mol Sci. 2020;21(11):4096.10.3390/ijms21114096Search in Google Scholar PubMed PubMed Central
© 2023 the author(s), published by De Gruyter
This work is licensed under the Creative Commons Attribution 4.0 International License.
Articles in the same Issue
- Research Articles
- Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
- Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
- circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
- circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
- WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
- Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
- Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
- 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
- Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
- PVT1/miR-16/CCND1 axis regulates gastric cancer progression
- Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
- Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
- SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
- Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
- lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
- SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
- Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
- Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
- Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
- circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
- Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
- UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
- Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
- Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
- UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
- LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
- Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
- Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
- circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
- Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
- Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
- A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
- WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
- Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
- Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
- Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
- Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
- Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
- Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
- Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
- CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
- Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
- Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
- HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
- The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
- Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
- A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
- Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
- Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
- TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
- The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
- miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
- Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
- IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
- Comprehensive analysis of the role of SFXN family in breast cancer
- Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
- Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
- AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
- Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
- Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
- Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
- The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
- Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
- Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
- F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
- Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
- Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
- Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
- Cholesterol induces inflammation and reduces glucose utilization
- circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
- NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
- The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
- miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
- Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
- α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
- Changes of microbiota level in urinary tract infections: A meta-analysis
- Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
- Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
- Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
- Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
- Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
- Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
- Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
- An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
- Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
- Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
- PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
- miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
- lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
- Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
- Subjective well-being in informal caregivers during the COVID-19 pandemic
- Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
- Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
- Bladder cancer screening: The new selection and prediction model
- circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
- Prone position effect in intensive care patients with SARS-COV-2 pneumonia
- Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
- Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
- Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
- Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
- Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
- Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
- Clinical significance of serum MBD3 detection in girls with central precocious puberty
- Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
- Collagen treatment of complex anorectal fistula: 3 years follow-up
- LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
- Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
- SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
- A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
- circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
- hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
- Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
- lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
- Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
- Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
- Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
- Analysis of somatic mutations and key driving factors of cervical cancer progression
- Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
- Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
- Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
- Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
- Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
- Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
- Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
- Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
- The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
- Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
- Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
- The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
- Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
- Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
- Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
- The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
- Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
- Clinical characteristics of current COVID-19 rehabilitation outpatients in China
- Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
- miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
- The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
- Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
- The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
- Identification of cuproptosis-related genes for predicting the development of prostate cancer
- Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
- Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
- A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
- Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
- Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
- Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
- A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
- A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
- Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
- The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
- Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
- AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
- Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
- Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
- LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
- Factors associated with gastrointestinal dysmotility in critically ill patients
- Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
- Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
- Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
- Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
- Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
- The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
- Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
- Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
- Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
- Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
- Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
- Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
- D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
- WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
- Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
- Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
- Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
- Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
- Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
- Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
- A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
- Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
- A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
- Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
- The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
- Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
- CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
- Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
- KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
- Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
- The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
- Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
- Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
- Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
- Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
- Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
- Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
- lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
- Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
- The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
- The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
- Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
- MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
- Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
- Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
- Predictors of gastrointestinal complaints in patients on metformin therapy
- Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
- A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
- Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
- miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
- Clinical features and management of lymphoepithelial cyst
- Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
- ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
- Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
- The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
- Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
- Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
- Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
- miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
- Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
- Review Articles
- Prenatal diagnosis of fetal defects and its implications on the delivery mode
- Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
- Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
- Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
- Vitamin C and epigenetics: A short physiological overview
- Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
- Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
- Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
- Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
- The progress of autoimmune hepatitis research and future challenges
- METTL16 in human diseases: What should we do next?
- New insights into the prevention of ureteral stents encrustation
- VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
- Case Reports
- Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
- Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
- Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
- Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
- Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
- Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
- Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
- Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
- Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
- Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
- CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
- Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
- Anesthetic management of fetal pulmonary valvuloplasty: A case report
- Rapid Communication
- Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
- Erratum
- Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
- Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
- Retraction
- Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
- Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
- Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
- Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
- Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
- Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
- Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
- Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
- Special issue The evolving saga of RNAs from bench to bedside - Part I
- FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
- Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Articles in the same Issue
- Research Articles
- Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
- Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
- circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
- circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
- WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
- Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
- Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
- 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
- Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
- PVT1/miR-16/CCND1 axis regulates gastric cancer progression
- Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
- Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
- SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
- Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
- lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
- SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
- Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
- Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
- Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
- circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
- Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
- UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
- Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
- Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
- UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
- LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
- Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
- Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
- circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
- Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
- Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
- A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
- WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
- Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
- Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
- Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
- Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
- Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
- Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
- Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
- CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
- Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
- Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
- HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
- The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
- Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
- A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
- Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
- Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
- TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
- The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
- miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
- Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
- IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
- Comprehensive analysis of the role of SFXN family in breast cancer
- Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
- Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
- AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
- Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
- Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
- Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
- The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
- Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
- Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
- F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
- Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
- Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
- Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
- Cholesterol induces inflammation and reduces glucose utilization
- circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
- NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
- The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
- miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
- Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
- α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
- Changes of microbiota level in urinary tract infections: A meta-analysis
- Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
- Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
- Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
- Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
- Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
- Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
- Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
- An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
- Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
- Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
- PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
- miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
- lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
- Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
- Subjective well-being in informal caregivers during the COVID-19 pandemic
- Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
- Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
- Bladder cancer screening: The new selection and prediction model
- circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
- Prone position effect in intensive care patients with SARS-COV-2 pneumonia
- Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
- Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
- Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
- Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
- Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
- Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
- Clinical significance of serum MBD3 detection in girls with central precocious puberty
- Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
- Collagen treatment of complex anorectal fistula: 3 years follow-up
- LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
- Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
- SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
- A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
- circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
- hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
- Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
- lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
- Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
- Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
- Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
- Analysis of somatic mutations and key driving factors of cervical cancer progression
- Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
- Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
- Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
- Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
- Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
- Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
- Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
- Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
- The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
- Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
- Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
- The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
- Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
- Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
- Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
- The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
- Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
- Clinical characteristics of current COVID-19 rehabilitation outpatients in China
- Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
- miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
- The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
- Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
- The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
- Identification of cuproptosis-related genes for predicting the development of prostate cancer
- Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
- Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
- A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
- Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
- Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
- Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
- A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
- A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
- Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
- The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
- Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
- AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
- Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
- Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
- LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
- Factors associated with gastrointestinal dysmotility in critically ill patients
- Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
- Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
- Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
- Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
- Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
- The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
- Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
- Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
- Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
- Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
- Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
- Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
- D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
- WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
- Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
- Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
- Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
- Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
- Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
- Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
- A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
- Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
- A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
- Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
- The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
- Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
- CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
- Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
- KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
- Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
- The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
- Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
- Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
- Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
- Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
- Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
- Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
- lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
- Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
- The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
- The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
- Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
- MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
- Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
- Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
- Predictors of gastrointestinal complaints in patients on metformin therapy
- Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
- A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
- Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
- miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
- Clinical features and management of lymphoepithelial cyst
- Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
- ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
- Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
- The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
- Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
- Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
- Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
- miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
- Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
- Review Articles
- Prenatal diagnosis of fetal defects and its implications on the delivery mode
- Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
- Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
- Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
- Vitamin C and epigenetics: A short physiological overview
- Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
- Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
- Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
- Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
- The progress of autoimmune hepatitis research and future challenges
- METTL16 in human diseases: What should we do next?
- New insights into the prevention of ureteral stents encrustation
- VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
- Case Reports
- Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
- Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
- Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
- Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
- Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
- Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
- Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
- Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
- Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
- Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
- CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
- Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
- Anesthetic management of fetal pulmonary valvuloplasty: A case report
- Rapid Communication
- Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
- Erratum
- Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
- Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
- Retraction
- Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
- Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
- Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
- Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
- Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
- Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
- Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
- Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
- Special issue The evolving saga of RNAs from bench to bedside - Part I
- FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
- Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
- Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer