Home SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
Article Open Access

SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis

  • Huijin Zhao , Yuanyi Ding and Lan Zhang
Published/Copyright: February 14, 2023
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 18 Issue 1

Abstract

Gastric cancer (GC) is a common cancer worldwide with high mortality. Sirtuin 1 (SIRT1) and apurinic/apyrimidinic endodeoxyribonuclease 1 (APE1) are abnormally expressed in GC cells and related to p53, which is involved in ferroptosis. Thus, we explore the mechanism via which SIRT1, APE1, and p53 impact ferroptosis in GC cells. Specifically, GC cells were transfected with small-interfering RNA for SIRT1 (SiSIRT1) or small-interfering RNA for APE1 (SiAPE1) or with short-hairpin RNA for p53, and the cell viability, Fe2+, malondialdehyde (MDA), and glutathione (GSH) contents were detected by cell counting kit-8 assay and enzyme-linked immunosorbent assay. Western blot, immunofluorescence, and quantitative real-time polymerase chain reaction were conducted to quantify SIRT1, APE1, p53, solute carrier family 7 member 11 (SLC7A11), and glutathione peroxidase 4 (GPX4) levels in GC cells. Silencing of SIRT1 decreased viability, GSH content, and expressions of GPX4 and SLC7A11, while increased Fe2+, MDA content, and p53 expression in GC cells. Such aforementioned effects were reversed by APE1 overexpression. Also, SiAPE1 generated the same effects as SiSIRT1 on the above aspects, which was offset by p53 silencing. In short, SIRT1/APE1 promotes the growth of GC cells by targeting p53 to inhibit ferroptosis.

Keywords: SIRT1; APE1; p53; ferroptosis; gastric cancer

1 Introduction

Gastric cancer (GC) is a common malignancy all over the world with the fourth highest mortality rate [1]. In the initial stage, GC is mainly treated by surgery; however, patients after treatment still face risk of complications without obvious improvement [2]. Unfortunately, most patients are already in the late stage at first diagnosis, where the tumor metastases and chemotherapeutic resistance occur [3]. Recently, the programmed cell death ligand 1 and human epidermal growth factor receptor 2 have been proven to prolong the survival of patients with GC [4], signifying the feasibility of targeted therapy toward GC [5]. Thus, further research on the molecular mechanisms of GC is conducive to the development of targeted therapies for GC.

Ferroptosis is a form of non-apoptotic cell death characterized by iron-dependent lipid peroxidation [6]. Accumulating studies have demonstrated the involvement of ferroptosis in many cancers including GC [7,8,9]. Accordingly, ferroptosis has been recognized as a novel therapeutic target to eliminate cancer cells, which is not limited by chemotherapeutic resistance [10]. Previous studies have suggested that multiple pathways are implicated in the regulation of ferroptosis, including Nrf2, p53, and solute carrier family 7 member 11 (SLC7A11) [11]. It has been reported that p53 knockdown inhibited ferroptosis by regulating SLC7A11 and glutathione peroxidase 4 (GPX4) expressions in osteocytes [12]. In addition, Tanshinone IIA induces ferroptosis in GC cells through p53-mediated downregulation of SLC7A11 [13]. These studies indicated that p53 indeed mediated ferroptosis in cells. However, the mechanism via which ferroptosis participates in the development of GC cells needs further experiment.

Sirtuin 1 (SIRT1) is the founding member of class III histone deacetylases. In GC, SIRT1 is identified as a marker for prognosis and is involved in cell proliferation, cell cycle, autophagy, and drug resistance [14,15,16]. A previous study has demonstrated that SIRT1 is lowly expressed in GC following the silence of VEGF and causes the upregulation of p53 [17]. Ma et al. [18] also pointed out that SIRT1 could inhibit the ferroptosis-induced cell death through inhibiting the acetylation and protein levels of p53 in cardiomyocytes. Furthermore, SIRT1 could facilitate the development of cancer cells by deacetylating p53 [19]. Nonetheless, the function of SIRT1 and p53 in ferroptosis of GC has not been reported.

Moreover, it has been reported that SIRT1 silencing leads to the death of human embryonic stem cells via suppressing apurinic/apyrimidinic endodeoxyribonuclease 1 (APE1), a member of DNA repair enzymes [20]. APE1 is associated with tumorigenesis and indicates the poor prognosis of patients with GC [21]. Meanwhile, it is involved in DNA damage response and repair in GC [22]. In addition, APE1 participates in redox homeostasis, and its overexpression decreases the reactive oxygen species (ROS) content [23,24,25]. Of note, the ROS content is a main characteristic of ferroptosis [26]. Furthermore, APE1 is negatively regulated by p53, which is a regulatory factor in ferroptosis, and the interaction between these two boosts the degradation of p53 [27,28]. In colon cancer cells, the p53-mediated cell death is activated when the endonuclease activity of APE1 is retarded [29]. In GC cells, the APE1 expression is upregulated and APE1 silencing causes the cell death by inducing DNA damage [30,31]. DNA damage is repaired by p53, which, however, is hindered by the silencing of APE1 [32]. As such, APE1 may inhibit ferroptosis to prevent cell death [23]. It is worthy to fathom out the association between APE1 with SIRT1 or p53 in the ferroptosis in GC cells.

In light of this, an in vitro GC model was established using two GC cell lines in this study aiming to explore the regulatory network of SIRT1, APE1, and p53 in ferroptosis of GC cells.

2 Materials and methods

2.1 Cells and culture

Human GC cell lines including SNU-1 (CRL-5971) and AGS (CRL-1739) were acquired from the American Type Culture Collection (ATCC, Manassas, VA, USA). These GC cells, accordingly, were grown in the Rosewell Park Memorial Institute-1640 medium (30-2001, ATCC, USA) supplemented with 10% fetal bovine serum (S9020; Solarbio, Beijing, China) and 1% antibiotic/antifungal reagent (B1356-108, BIOEXPLORER Life Sciences, Boulder, CO, USA) at 37°C with 5% CO2. According to the cell growth conditions, the medium was changed every 2 days.

2.2 Cell transfection

The transfection was conducted using Lipofectamine® 3000 (L3000008; Solarbio) according to the manufacturer’s instructions. The plasmid overexpressing APE1 was constructed with pcDNA vector (V38520; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The empty pcDNA vector was used as a negative control (NC). Besides, the small-interfering RNA for SIRT1 (SiSIRT1, 5′-ATGGAGAAACATGTTATATATAC-3′), small-interfering RNA for APE1 (SiAPE1, 5′-CGGTATCGATAAGCTTGATATCG-3′), short-hairpin RNA for p53 (Shp53, 5′-CACCATCCACTACAACTACAT-3′), small-interfering RNA for NC (SiNC; A06001), and short-hairpin RNA for NC (ShNC; C03002) were designed and constructed by GenePharma (Shanghai, China).

Subsequently, SiNC, NC, SiSIRT1, SiAPE1, Shp53, and plasmid overexpressing APE1 were separately transfected into GC cells, while SiNC and NC, SiSIRT1 and plasmid overexpressing APE1, SiNC and ShNC, or SiAPE1 and Shp53 were co-transfected into other GC cells. After incubation for 48 h, these GC cells were collected for later experiments.

2.3 Quantitative real-time polymerase chain reaction (qRT-PCR)

Total RNA was extracted from GC cells with Total RNA Extractor (B511311; Sangon, Shanghai, China) and the purity was determined by NanoDrop™ One/OneC UV-Vis Spectrophotometer (701-058112; Thermo Fisher Scientific, Inc.). Then, 1 µg RNA was reversely transcribed into complementary DNA (cDNA) with Thermo Scientific RevertAid RT kit (K1691; Thermo Fisher Scientific, Inc.). Subsequently, the cDNAs were subjected to qRT-PCR with the specific primers of SIRT1, APE1, or p53 using Maxima SYBR Green/ROX qPCR (K0223, Thermo Fisher Scientific, Inc.) in the Mx3005P system (Agilent Technologies, Inc., CA, USA). The expressions of SIRT1, APE1, and p53 were calculated and determined using the 2−ΔΔCt method with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the normalization control [33]. The reaction conditions of PCR were as follows: 10 min at 95°C and then 40 cycles of 15 s at 94°C, 30 s at 58°C, and 15 s at 72°C. The sequences of primers are shown in Table 1.

Table 1

All primers in qRT-PCR experiments in this study

ID Forward sequence (5′–3′) Reverse sequence (5′–3′)
SIRT1 TAGCCTTGTCAGATAAGGAAGGA ACAGCTTCACAGTCAACTTTGT
APE1 CCAGCCCTGTATGAGGACC GGAGCTGACCAGTATTGATGAGA
p53 CAGCACATGACGGAGGTTGT TCATCCAAATACTCCACACGC
GAPDH GTCTCCTCTGACTTCAACAGCG ACCACCCTGTTGCTGTAGCCAA

2.4 Cell counting kit-8 (CCK-8) assay

GC cells were collected at the logarithmic phase and resuspended in phosphate-buffered solution (PBS; P4474, Sigma-Aldrich, St. Louis, MO, USA). Subsequently, 100 µL of cell resuspension was added to 96-well plates and the density was adjusted to 1 × 103 cells per well. Next, GC cells were transfected as aforementioned and cultured in a cell incubator (51033546, Thomas Scientific, Swedesboro, NJ, USA) at 37°C with 5% CO2 for 48 h. After that, 10 µL CCK-8 solution (C0037; Beyotime, Shanghai, China) was added to every well and incubated at 37°C for 4 h. The optical density (OD) value of every well was measured by an ELISA microplate reader (ELx808, Bio Tek, Winooski, VT, USA) at the wavelength of 450 nm.

2.5 Measurement of Fe2+ content

The Iron Assay Kit (MAK025; Sigma-Aldrich) was applied to determine the Fe2+ content in GC cells, AGS and SNU-1. In detail, GC cells (5 × 105) were homogenized in Iron Assay Buffer and centrifuged (1,600 × g) at 4°C for 10 min, followed by the collection of supernatant. Then, 50 µL of supernatant was mixed with 5 µL of Iron Assay Buffer in 96-well plates and incubated at 25°C for 30 min in the dark. Thereafter, 100 µL of Iron Probe was added to every well and cultured at 25°C for 60 min avoiding light. Finally, the OD value was measured at the wavelength of 593 nm with an ELISA microplate reader.

2.6 Lipid peroxidation assay

The concentration of malondialdehyde (MDA) in GC cells was detected by Lipid Peroxidation (MDA) Assay Kit (ab118970; Abcam, UK). GC cells were first cultivated with thiobarbituric acid (TBA) solution at 95°C for 1 h and then lysed with RIPA lysis buffer (C500005; Sangon). After the mixture was centrifuged (13,000 × g) at 4°C for 5 min, the supernatant was collected. Next, the supernatant and the standard were chilled in ice bath for 10 min. The samples were finally transferred to a new 96-well microplate and the OD value was calculated using an microplate ELISA reader at the wavelength of 532 nm.

The glutathione (GSH) level in GC cells was determined by GSH ELISA Kit (D751008; Sangon). The GC cells were washed with cold PBS and digested with trypsin (C0202; Beyotime). Post centrifugation at 1,000 × g for 5 min, cells were collected and washed with PBS three times. The supernatant was collected for detection following the resuspension of cells with PBS and the centrifugation at 1,500 × g for 10 min. The 50 µL of standard and supernatant were separately added to the standard well and sample wells and mixed with 50 µL of working fluid (100 µg/mL) created by the mixture of standard and standard/sample diluent 1, followed by incubation for 45 min. After the incubation, the working fluid was removed, and 350 µL of washing solution was added to every well for 2 min. Thereafter, the samples were incubated with 100 µL of horseradish peroxidase (HRP)-conjugated streptavidin working solution at 37°C for 30 min. Next, 300 µL of washing solution was used to wash each well four times. After staining with 90 µL of chromogenic agent at 37°C for 15 min without light, 50 µL of stop solution was used to terminate the reaction and the OD value was measured by an ELISA microplate reader at the wavelength of 450 nm.

2.7 Immunofluorescence

GC cells at the logarithmic phase were collected and washed twice with PBS for 5 min. Then, cells were fixed with 4% paraformaldehyde (P1110; Solarbio) and washed three times with PBS for 5 min. Next, these cells were transparentized with Triton X-100 (A110694; Sangon) at room temperature for 10 min, rinsed with PBS, and incubated in an immunofluorescence blocking buffer (ab126587; Abcam) at room temperature for 30 min. Thereafter, cells were incubated with anti-GPX4 antibody (1 µg/mL, ab40993; Abcam) at 4°C overnight, followed by being washed three times with PBS for 5 min. Afterwards, cells were cultured with Goat Anti-Rabbit IgG H&L (Alexa Fluor® 647) (1:1000, ab150083; Abcam) at room temperature for 1 h in the dark. Subsequently, cells were washed with PBS thrice for 5 min and stained with 4′,6-diamidino-2-phenylindole (E607303; Sangon), followed by being sealed with cover-glass (F518112; Sangon) away from light. The image was observed under a fluorescence microscope (Leica DM 6000B; Leica, Wetzlar, Germany) at the magnification of ×200.

2.8 Western blot

The proteins of cells were lysed in RIPA lysis buffer, and their concentrations were measured by Bicinchoninic Acid Assay (BCA) Protein Assay Kit (GK10009; Glpbio, Montclair, CA, USA). Following this, they were added to the protein loading buffer (C516031; Sangon) and heated at 95°C for 5 min to ensure the denaturation. Then, the proteins were separated by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (P0678; Beyotime) and transferred onto polyvinylidene difluoride membranes (88585; Thermo Fisher Scientific, Inc.). Subsequently, the membranes were blocked with bovine serum albumin (37520; Thermo Fisher Scientific, Inc.) for 1 h and incubated with the primary antibodies against p53, SLC7A11, GPX4, or GAPDH (a loading control) at 4°C overnight. The expressions of proteins were normalized to that of GAPDH. After washing three times with tris-buffered saline wash buffer with Tween 20 (TBST; 28352; Thermo Fisher Scientific, Inc.) for 5 min, the proteins were incubated with secondary antibodies including goat anti-rabbit IgG H&L (HRP) and rabbit anti-mouse IgG H&L (HRP) for 1 h and washed three times with TBST for 5 min. The protein bands were visualized with High Sensitivity ECL Substrate Kit (ab133406; Abcam) and analyzed with an iBright™ CL1500 Imaging System (A44114; Thermo Fisher Scientific, Inc.). The information about all antibodies in this experiment is exhibited in Table 2.

Table 2

All antibodies information and sources in western blot in this study

ID Catalog number Company (country) Molecular weight (kDa) Dilution ratio/concentration
p53 ab26 Abcam (Cambridge, UK) 53 1 µg/mL
SLC7A11 ab175186 Abcam (Cambridge, UK) 55 1:1,000
GPX4 ab125066 Abcam (Cambridge, UK) 17 1:1,000
GAPDH ab8245 Abcam (Cambridge, UK) 37 1:10,000
Goat anti-rabbit IgG H&L (HRP) ab6702 Abcam (Cambridge, UK) 1:2,000
Rabbit anti-mouse IgG H&L (HRP) ab6728 Abcam (Cambridge, UK) 1:2,000

2.9 Statistical analysis

All experiments in this study were repeated three times. All data were analyzed using GraphPad Prism 8.0 software (GraphPad, Inc., San Diego, CA, USA) and presented as mean ± standard deviation. The comparison among multiple groups was conducted by one-way analysis of variance. The data with P < 0.05 were defined to be statistically significant.

3 Results

3.1 APE1 overexpression reversed the effects of SIRT1 silencing on cell viability and contents of GSH, Fe2+, and MDA in SNU-1 and AGS cells

The relevant results of qRT-PCR are shown in Figure 1a–d. It was obvious that the SIRT1 expression was notably downregulated after the transfection of SiSIRT1 in both SNU-1 (Figure 1a, P < 0.001) and AGS (Figure 1b, P < 0.001) cells. The expression of APE1, contrarily, was clearly upregulated after the transfection of plasmid overexpressing APE1 in SNU-1 (Figure 1c, P < 0.001) and AGS (Figure 1d, P < 0.001) cells. These results indicated the successful transfection of SiSIRT1 and plasmid overexpressing APE1.

Figure 1 APE1 reversed the effects of SiSIRT1 on cell viability, Fe2+ content, and lipid peroxidation level in GC cells. (a–d) The expressions of SIRT1 and APE1 were determined by qRT-PCR in SNU-1 and AGS cells after the transfection of SiSIRT1 or APE1 overexpression plasmid. GAPDH was used as an internal reference. (e–l) The GC cells SNU-1 and AGS after transfection were separately divided into three groups: SiNC + NC, SiSIRT1, and SiSIRT1 + APE1. (e and f) The cell viability was detected by CCK-8 assay in SNU-1 and AGS cells with/without transfection. (g and h) The Iron Assay Kit was utilized to determine the Fe2+ content in SNU-1 and AGS cells following the transfection or not. (i–l) The MDA and GSH contents were detected in SNU-1 and AGS cells by Lipid Peroxidation (MDA) Assay Kit and GSH ELISA Kit, respectively, after the transfection or not. *** P < 0.001 vs SiNC; ^^^ P < 0.001, vs NC; +++ P < 0.001 vs SiNC + NC; ΔΔ P < 0.01, ΔΔΔ P < 0.001 vs SiSIRT1.
Figure 1

APE1 reversed the effects of SiSIRT1 on cell viability, Fe2+ content, and lipid peroxidation level in GC cells. (a–d) The expressions of SIRT1 and APE1 were determined by qRT-PCR in SNU-1 and AGS cells after the transfection of SiSIRT1 or APE1 overexpression plasmid. GAPDH was used as an internal reference. (e–l) The GC cells SNU-1 and AGS after transfection were separately divided into three groups: SiNC + NC, SiSIRT1, and SiSIRT1 + APE1. (e and f) The cell viability was detected by CCK-8 assay in SNU-1 and AGS cells with/without transfection. (g and h) The Iron Assay Kit was utilized to determine the Fe2+ content in SNU-1 and AGS cells following the transfection or not. (i–l) The MDA and GSH contents were detected in SNU-1 and AGS cells by Lipid Peroxidation (MDA) Assay Kit and GSH ELISA Kit, respectively, after the transfection or not. *** P < 0.001 vs SiNC; ^^^ P < 0.001, vs NC; +++ P < 0.001 vs SiNC + NC; ΔΔ P < 0.01, ΔΔΔ P < 0.001 vs SiSIRT1.

According to Figure 1e and f, the cell viability was significantly decreased after SIRT1 silencing in SNU-1 (Figure 1e, P < 0.001) and AGS (Figure 1f, P < 0.001) cells, the change of which was obviously offset by APE1 overexpression (Figure 1e and f, P < 0.01). Compared with the cells transfected with SiNC and NC, the memorably increased Fe2+ content was evident in SNU-1 (Figure 1g, P < 0.001) and AGS (Figure 1h, P < 0.001) cells transfected with SiSIRT1. Likewise, this impact of SiSIRT1 was neutralized by APE1 overexpression (Figure 1g and h, P < 0.001).

The graphical representation of GSH and MDA contents is shown in Figure 1i–l. Transfection of SiSIRT1 caused the overtly increased MDA content and the dramatically decreased GSH content in SNU-1 (Figure 1i and j, P < 0.001) and AGS (Figure 1k and l, P < 0.001) cells, the trend of which was offset by overexpressed APE1 (Figure 1i–l, P < 0.001). Collectively speaking, SIRT1 silencing decreased cell viability and GSH content but increased Fe2+ and MDA contents in SNU-1 and AGS cells. Such impacts, however, were reversed by APE1 overexpression.

3.2 APE1 overexpression reversed the effects of SIRT1 silencing on GPX4, SLC7A11, and p53 levels in SNU-1 and AGS cells

The results of immunofluorescence assay are presented in Figure 2a and b. It could be noticed that after SIRT1 silencing in SNU-1 and AGS cells, the GPX4 level was decreased, while such level was then elevated with the additional transfection of APE1 overexpression plasmid.

Figure 2 APE1 overexpression reversed the effect of SIRT1 silencing on GPX4 expression in GC cells. (a and b) The GC cells SNU-1 and AGS after transfection were separately divided into three groups: SiNC + NC, SiSIRT1, and SiSIRT1 + APE1. (a and b) The GPX4 expression was determined by immunofluorescence in GC cells after transfection (at a magnification of ×200, scale bar: 50 µm).
Figure 2

APE1 overexpression reversed the effect of SIRT1 silencing on GPX4 expression in GC cells. (a and b) The GC cells SNU-1 and AGS after transfection were separately divided into three groups: SiNC + NC, SiSIRT1, and SiSIRT1 + APE1. (a and b) The GPX4 expression was determined by immunofluorescence in GC cells after transfection (at a magnification of ×200, scale bar: 50 µm).

Based on the assay of Western blot, we found that following the transfection of SiSIRT1, the p53 protein level was remarkably augmented but SLC7A11 and GPX4 levels were signally lessened in SNU-1 (Figure 3a and b, P < 0.001) and AGS cells (Figure 3c and d, P < 0.001). Besides, in SNU-1 (Figure 3a and b, P < 0.001) and AGS (Figure 3c and d, P < 0.001) cells with the transfection of SiSIRT1, APE1 overexpression decreased p53 level but increased SLC7A11 and GPX4 levels. Taken together, the overexpression of APE1 reversed the effects of SIRT1 silencing on GPX4, SLC7A11, and p53 levels in SNU-1 and AGS cells.

Figure 3 APE1 overexpression offset the effects of SIRT1 silencing on p53, SLC7A11, and GPX4 expressions in GC cells. (a–d) The SNU-1 and AGS cells after transfection were separately assigned into three groups: SiNC + NC, SiSIRT1, and SiSIRT1 + APE1. (a–d) The relevant results of Western blot showed the expressions of p53, SLC7A11, and GPX4 in GC cells after transfection. GAPDH was used as an internal reference.+++ P < 0.001 vs SiNC + NC; ΔΔΔ P < 0.001 vs SiSIRT1.
Figure 3

APE1 overexpression offset the effects of SIRT1 silencing on p53, SLC7A11, and GPX4 expressions in GC cells. (a–d) The SNU-1 and AGS cells after transfection were separately assigned into three groups: SiNC + NC, SiSIRT1, and SiSIRT1 + APE1. (a–d) The relevant results of Western blot showed the expressions of p53, SLC7A11, and GPX4 in GC cells after transfection. GAPDH was used as an internal reference.+++ P < 0.001 vs SiNC + NC; ΔΔΔ P < 0.001 vs SiSIRT1.

3.3 p53 silencing offset the effects of APE1 depletion on cell viability and contents of GSH, Fe2+, and MDA in SNU-1 and AGS cells

The results of qRT-PCR (Figure 4a–d) demonstrated that the expression of APE1 was evidently downregulated after the transfection with SiAPE1 in SNU-1 (Figure 4a, P < 0.001) and AGS cells (Figure 4b, P < 0.001). Likewise, the expression of p53 was also markedly downregulated after transfection with Shp53 in SNU-1 (Figure 4c, P < 0.001) and AGS (Figure 4d, P < 0.001) cells.

Figure 4 Shp53 neutralized the effects of SiAPE1 on cell viability, and contents of GSH, Fe2+, and MDA in GC cells. (a–d) The expressions of APE1 and p53 were determined by qRT-PCR in SNU-1 and AGS cells after the transfection with SiAPE1 or Shp53. GAPDH was used as an internal reference. (e–l) SNU-1 and AGS cells after transfection were separately distributed into three groups: SiNC + ShNC, SiAPE1, and SiAPE1 + Shp53. (e and f) The viability of SNU-1 and AGS cells after transfection or not was detected by CCK-8 assay. (g and h) The Iron Assay Kit was applied to determine the Fe2+ content in SNU-1 and AGS cells after transfection or not. (i–l) The MDA and GSH contents were detected by Lipid Peroxidation (MDA) Assay Kit and GSH ELISA Kit, respectively, in SNU-1 and AGS cells after transfection or not. *** P < 0.001 vs SiNC; εεε P < 0.001 vs ShNC; ‡‡‡ P < 0.001 vs SiNC + ShNC; †† P < 0.01, ††† P < 0.001 vs SiAPE1.
Figure 4

Shp53 neutralized the effects of SiAPE1 on cell viability, and contents of GSH, Fe2+, and MDA in GC cells. (a–d) The expressions of APE1 and p53 were determined by qRT-PCR in SNU-1 and AGS cells after the transfection with SiAPE1 or Shp53. GAPDH was used as an internal reference. (e–l) SNU-1 and AGS cells after transfection were separately distributed into three groups: SiNC + ShNC, SiAPE1, and SiAPE1 + Shp53. (e and f) The viability of SNU-1 and AGS cells after transfection or not was detected by CCK-8 assay. (g and h) The Iron Assay Kit was applied to determine the Fe2+ content in SNU-1 and AGS cells after transfection or not. (i–l) The MDA and GSH contents were detected by Lipid Peroxidation (MDA) Assay Kit and GSH ELISA Kit, respectively, in SNU-1 and AGS cells after transfection or not. *** P < 0.001 vs SiNC; εεε P < 0.001 vs ShNC; ‡‡‡ P < 0.001 vs SiNC + ShNC; †† P < 0.01, ††† P < 0.001 vs SiAPE1.

In line with the data presented in Figure 4e and f, the cell viability was obviously suppressed after APE1 silencing in SUN-1 (Figure 4e, P < 0.001) and AGS (Figure 4f, P < 0.001) cells, but p53 silencing abrogated APE1 silencing-induced suppression of cell viability (Figure 4e and f, P < 0.01). Moreover, the transfection of SiAPE1 observably increased the Fe2+ content in SNU-1 (Figure 4g, P < 0.001) and AGS (Figure 4h, P < 0.001) cells; however, such effect was evidently offset after the transfection of Shp53 (Figure 4g and h, P < 0.001).

In addition, it was demonstrated that after APE1 silencing, the MDA content was memorably increased, while the GSH content was prominently decreased in SNU-1 (Figure 4i and j, P < 0.001) and AGS (Figure 4k and l, P < 0.001) cells. Such levels of MDA and GSH were pronouncedly reversed following the knockdown of p53 (Figure 4i–l, P < 0.001). In short, APE1 silencing decreased cell viability and GSH content yet increased Fe2+ and MDA contents in SNU-1 and AGS cells, while these effects were reversed by p53 silencing.

3.4 p53 silencing neutralized the effects of APE1 silencing on GPX4, SLC7A11, and p53 levels in SNU-1 and AGS cells

As depicted in Figure 5a and b, GPX4 expression was downregulated after APE1 silencing in SNU-1 and AGS cells but was then restored by p53 silencing.

Figure 5 Shp53 reversed the effect of SiAPE1 on GPX4 expression in GC cells. (a and b) The SNU-1 and AGS cells after transfection were separately divided into three groups: SiNC + ShNC, SiAPE1, and SiAPE1 + Shp53. (a and b) The GPX4 expression was determined by immunofluorescence in transfected GC cells (at a magnification of ×200, scale bar: 50 µm).
Figure 5

Shp53 reversed the effect of SiAPE1 on GPX4 expression in GC cells. (a and b) The SNU-1 and AGS cells after transfection were separately divided into three groups: SiNC + ShNC, SiAPE1, and SiAPE1 + Shp53. (a and b) The GPX4 expression was determined by immunofluorescence in transfected GC cells (at a magnification of ×200, scale bar: 50 µm).

Based on the data (Figure 6a–d), after the silence of APE1, the p53 expression was notably promoted, while SLC7A11 and GPX4 expressions were prominently inhibited in SNU-1 (Figure 6a and b, P < 0.001) and AGS (Figure 6c and d, P < 0.001) cells. The changes in the expressions of these aforementioned proteins were significantly reversed by p53 silencing (Figure 6a–d, P < 0.01). In conclusion, APE1 silencing downregulated GPX4 and SLC7A11 levels yet upregulated p53 level in SNU-1 and AGS cells, the effects of which were offset by p53 silencing.

Figure 6 Shp53 offset the effects of SiAPE1 on p53, SLC7A11, and GPX4 expressions in GC cells. (a–d) The SNU-1 and AGS cells after transfection were separately divided into three groups: SiNC + ShNC, SiAPE1, and SiAPE1 + Shp53. (a–d) Western blot results showed the expressions of p53, SLC7A11, and GPX4 in GC cells after transfection. GAPDH was used as an internal reference. ‡‡‡ P < 0.001 vs SiNC + ShNC; †† P < 0.01, ††† P < 0.001 vs SiAPE1.
Figure 6

Shp53 offset the effects of SiAPE1 on p53, SLC7A11, and GPX4 expressions in GC cells. (a–d) The SNU-1 and AGS cells after transfection were separately divided into three groups: SiNC + ShNC, SiAPE1, and SiAPE1 + Shp53. (a–d) Western blot results showed the expressions of p53, SLC7A11, and GPX4 in GC cells after transfection. GAPDH was used as an internal reference. ‡‡‡ P < 0.001 vs SiNC + ShNC; †† P < 0.01, ††† P < 0.001 vs SiAPE1.

4 Discussion

In the present study, we found that SIRT1 silencing promoted p53 expression and ferroptosis yet inhibited the viability of GC cells, and APE1 overexpression reversed these effects of SIRT1 silencing on GC cells. Moreover, the depletion of APE1 had the similar effect to SIRT1 silencing in the GC cells, and the knockdown of p53 reversed the effects of APE1 silencing on GC cells. In conclusion, SIRT1/APE1 participates in the development of GC by targeting p53 to regulate ferroptosis.

Existing study has already demonstrated that SIRT1 is involved in the cell proliferation, apoptosis, and survival through regulating target gene expression and protein activities [34]. However, the function of SIRT1 in cancer is debatable [35]. It has been reported that the depletion of SIRT1 promotes the proliferation and migration of GC cells through signal transducer and activator of transcription (STAT3) signal pathway and nuclear factor-kappa B/Cyclin D1 [35,36]. Also, Deng et al. [37] found that miR-34a inhibits proliferation and boosts apoptosis of GC cells by inhibiting SIRT1. In addition, Hirai et al. [38] identified that the application of tenovin-6, a kind of SIRT1 inhibitor, causes GC cell death through activating death receptor 5, implying that the biological functions of SIRT1, including regulation of gene expression and DNA damage repair, are essential for the development of GC cells. In our study, we found that SIRT1 silencing caused the decrease in the viability of SNU-1 and AGS cells, which signified the role of SIRT1 as an oncogene and suggested that SIRT1 indeed played a role in modulating cell viability.

Besides, some other studies pointed out that SIRT1 is implicated in the inhibition of ferroptosis [39,40,41]. Su et al. [42] discovered that the ROS level is increased but GPX4 and SIRT1 expressions are decreased in ferric ammonium citrate (FAC)-induced THP-1 macrophages, the trends of which were reversed by SIRT1 overexpression. GPX4 is an inhibitor of ferroptosis [43,44], and its expression is positively regulated by the GSH content. Moreover, the depletion of GPX4 usually results in the onset of ferroptosis [45,46,47]. In addition, SLC7A11 is the other main regulator of ferroptosis like GPX4 and belongs to the system XC [48]. SLC7A11 has the capabilities of eliminating ROS and facilitating the GSH production so as to maintain the redox homeostasis and inhibit ferroptosis [49]. We uncovered that in GC cells with SIRT1 silencing, GSH content and GPX4 expression were diminished, while the Fe2+ content and the level of MDA, a marker of oxidative stress-induced lipid peroxidation [50], were all augmented. These findings thus reflected that SIRT1 silencing promoted the ferroptosis of GC cells. Furthermore, a previous study identified that p53 is activated by SIRT1 silencing and inhibits the level of SLC7A11 [51]. In this study, we confirmed that following the silence of SIRT1, the expressions of p53 [52] (a positive factor of ferroptosis) and SLC7A11 were upregulated and downregulated in GC cells, respectively, which further proved the positive effects of SIRT1 silencing in ferroptosis.

A previous study recognized that SIRT1 silencing decreases the expression of APE1 and causes the death of human embryonic stem cell [20]. Our results revealed that the effect of SIRT1 silencing on cell viability was reversed by APE1 overexpression, which proved the regulatory relation between SIRT1 and APE1. APE1 has also been evidenced to play a crucial role in ferroptosis due to its antioxidant property [23,53]. It has been reported that APE1 overexpression decreases the accumulation of ROS and increases the GSH content in myocardial ischemia–reperfusion-induced cardiomyocytes [54]. The relation between APE1 with GPX4 or SLC7A11 has not been reported, but previous studies have recognized that APE1 and GPX4 are regulated by SIRT1 in cardiomyocytes and kidney [18,55]. In our study, when compared with those in cells transfected with SiSIRT1 alone, cell viability, GSH content, GPX4 level, and SLC7A11 level were increased but p53 level, Fe2+ content, and MDA content were decreased in cells co-transfected with SiSIRT1 and APE1 overexpression plasmid. It could be then concluded that APE1 silencing inhibited cell viability and promoted ferroptosis, while SIRT1 silencing promoted ferroptosis by inhibiting APE1 expression.

APE1 is confirmed to be lowly expressed in GC cells [30] and be closely associated with p53 [56,57]. The negative regulatory network between APE1 and p53 has been already proved in lung endothelium [28]. Zhu et al. found that the interaction of APE1 and p53 promotes the degradation of p53 in other cancer cells like non-small-lung cancer cells and cervical cancer cells [57]. However, the specific relationship between APE1 and p53 in GC cells remains to be clarified. Our discoveries revealed that p53 silencing elevated the cell viability, GPX4 expression, and SLC7A11 expression, while diminishing the Fe2+ content, MDA content, and p53 expression in GC cells transfected with ShAPE1. These discoveries indicated that APE1 might inhibit ferroptosis via inactivating p53-mediated signal pathway.

5 Conclusions

Collectively speaking, we identify that SIRT1 and APE1 can regulate ferroptosis in GC cells and affect the development of GC cells by targeting p53. However, it should be noticed that there may exist some other signal pathways and factors of ferroptosis involved. Accordingly, the regulatory network targeting ferroptosis in GC cells needs to be validated in further experiments.

tel: +86-311-86095588

Acknowledgements

Not applicable.

  1. Funding information: Not applicable.

  2. Author contributions: Substantial contributions to conception and design: Huijin Zhao. Data acquisition, data analysis, and interpretation: Yuanyi Ding and Lan Zhang. Drafting the article or critically revising it for important intellectual content: Huijin Zhao. Final approval of the version to be published: All authors. Agreement to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of the work are appropriately investigated and resolved: Huijin Zhao, Yuanyi Ding, and Lan Zhang.

  3. Conflict of interest: The authors declare no conflicts of interest.

  4. Data availability statement: The analyzed data sets generated during the study are available from the corresponding author on reasonable request.

References

[1] Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71(3):209–49.10.3322/caac.21660Search in Google Scholar PubMed

[2] Cha JH, Jang JS. Correlation between healing type of lesion and recurrence in gastric neoplastic lesions after endoscopic submucosal dissection. Turk J Gastroenterol. 2020;31(1):36–41.10.5152/tjg.2020.18764Search in Google Scholar PubMed PubMed Central

[3] Sexton RE, Al Hallak MN, Diab M, Azmi AS. Gastric cancer: A comprehensive review of current and future treatment strategies. Cancer Metastasis Rev. 2020;39(4):1179–203.10.1007/s10555-020-09925-3Search in Google Scholar PubMed PubMed Central

[4] Joshi SS, Badgwell BD. Current treatment and recent progress in gastric cancer. CA Cancer J Clin. 2021;71(3):264–79.10.3322/caac.21657Search in Google Scholar PubMed PubMed Central

[5] Patel TH, Cecchini M. Targeted therapies in advanced gastric cancer. Curr Treat Options Oncol. 2020;21(9):70.10.1007/s11864-020-00774-4Search in Google Scholar PubMed

[6] Fu D, Wang C, Yu L, Yu R. Induction of ferroptosis by ATF3 elevation alleviates cisplatin resistance in gastric cancer by restraining Nrf2/Keap1/xCT signaling. Cell Mol Biol Lett. 2021;26(1):26.10.1186/s11658-021-00271-ySearch in Google Scholar PubMed PubMed Central

[7] Ni H, Qin H, Sun C, Liu Y, Ruan G, Guo Q, et al. MiR-375 reduces the stemness of gastric cancer cells through triggering ferroptosis. Stem Cell Res Ther. 2021;12(1):325.10.1186/s13287-021-02394-7Search in Google Scholar PubMed PubMed Central

[8] Yao MY, Liu T, Zhang L, Wang MJ, Yang Y, Gao J. Role of ferroptosis in neurological diseases. Neurosci Lett. 2021;747:135614.10.1016/j.neulet.2020.135614Search in Google Scholar PubMed

[9] Chen X, Kang R, Kroemer G, Tang D. Targeting ferroptosis in pancreatic cancer: A double-edged sword. Trends Cancer. 2021;7(10):891–901.10.1016/j.trecan.2021.04.005Search in Google Scholar PubMed

[10] Hassannia B, Vandenabeele P, Vanden Berghe T. Targeting ferroptosis to iron out cancer. Cancer Cell. 2019;35(6):830–49.10.1016/j.ccell.2019.04.002Search in Google Scholar PubMed

[11] Koppula P, Zhuang L, Gan B. Cystine transporter SLC7A11/xCT in cancer: Ferroptosis, nutrient dependency, and cancer therapy. Protein cell. 2021;12(8):599–620.10.1007/s13238-020-00789-5Search in Google Scholar PubMed PubMed Central

[12] Sun F, Zhou JL, Liu ZL, Jiang ZW, Peng H. Dexamethasone induces ferroptosis via P53/SLC7A11/GPX4 pathway in glucocorticoid-induced osteonecrosis of the femoral head. Biochem Biophys Res Commun. 2022;602:149–55.10.1016/j.bbrc.2022.02.112Search in Google Scholar PubMed

[13] Guan Z, Chen J, Li X, Dong N. Tanshinone IIA induces ferroptosis in gastric cancer cells through p53-mediated SLC7A11 down-regulation. Bioscience reports. 2020;40:8.10.1042/BSR20201807Search in Google Scholar PubMed PubMed Central

[14] Qiu G, Li X, Che X, Wei C, He S, Lu J, et al. SIRT1 is a regulator of autophagy: Implications in gastric cancer progression and treatment. FEBS letters. 2015;589(16):2034–42.10.1016/j.febslet.2015.05.042Search in Google Scholar PubMed

[15] Liu H, Liu N, Zhao Y, Zhu X, Wang C, Liu Q, et al. Oncogenic USP22 supports gastric cancer growth and metastasis by activating c-Myc/NAMPT/SIRT1-dependent FOXO1 and YAP signaling. Aging. 2019;11(21):9643–60.10.18632/aging.102410Search in Google Scholar PubMed PubMed Central

[16] Zhang W, Liao K, Liu D. MiRNA-12129 suppresses cell proliferation and block cell cycle progression by targeting SIRT1 in GASTRIC cancer. Technology in Cancer research & Treatment. 2020;19:1533033820928144.10.1177/1533033820928144Search in Google Scholar PubMed PubMed Central

[17] Sun P, Yu H, Zhang WQ, Hu M, Lv R. Lentivirus-mediated siRNA targeting VEGF inhibits gastric cancer growth in vivo. Oncol Rep. 2012;28(5):1687–92.10.3892/or.2012.1966Search in Google Scholar PubMed

[18] Ma S, Sun L, Wu W, Wu J, Sun Z, Ren J. USP22 protects against myocardial ischemia-reperfusion injury via the SIRT1-p53/SLC7A11-dependent inhibition of ferroptosis-induced cardiomyocyte death. Front Physiol. 2020;11:551318.10.3389/fphys.2020.551318Search in Google Scholar PubMed PubMed Central

[19] Lin XL, Li K, Yang Z, Chen B, Zhang T. Dulcitol suppresses proliferation and migration of hepatocellular carcinoma via regulating SIRT1/p53 pathway. Phytomedicine. 2020;66:153112.10.1016/j.phymed.2019.153112Search in Google Scholar PubMed

[20] Jang J, Huh YJ, Cho HJ, Lee B, Park J, Hwang DY, et al. SIRT1 enhances the survival of human embryonic stem cells by promoting DNA repair. Stem Cell Reports. 2017;9(2):629–41.10.1016/j.stemcr.2017.06.001Search in Google Scholar PubMed PubMed Central

[21] Qing Y, Li Q, Ren T, Xia W, Peng Y, Liu GL, et al. Upregulation of PD-L1 and APE1 is associated with tumorigenesis and poor prognosis of gastric cancer. Drug Des Dev Ther. 2015;9:901–9.10.2147/DDDT.S75152Search in Google Scholar PubMed PubMed Central

[22] Manoel-Caetano FS, Rossi AFT, Calvet de Morais G, Severino FE, Silva AE. Upregulation of the APE1 and H2AX genes and miRNAs involved in DNA damage response and repair in gastric cancer. Genes Diseases. 2019;6(2):176–84.10.1016/j.gendis.2019.03.007Search in Google Scholar PubMed PubMed Central

[23] Guo N, Chen Y, Zhang Y, Deng Y, Zeng F, Li X. Potential role of APEX1 during ferroptosis. Front Oncol. 2022;12:798304.10.3389/fonc.2022.798304Search in Google Scholar PubMed PubMed Central

[24] den Hartog G, Chattopadhyay R, Ablack A, Hall EH, Butcher LD, Bhattacharyya A, et al. Regulation of rac1 and reactive oxygen species production in response to infection of gastrointestinal epithelia. PLoS Pathog. 2016;12(1):e1005382.10.1371/journal.ppat.1005382Search in Google Scholar PubMed PubMed Central

[25] Kang B, Mu S, Yang Q, Guo S, Chen X, Guo H. Ape1 protects against MPP + -induced neurotoxicity through ERK1/2 signaling in PC12 cells. Neuroreport. 2017;28(1):10–6.10.1097/WNR.0000000000000712Search in Google Scholar PubMed

[26] Li J, Cao F, Yin HL, Huang ZJ, Lin ZT, Mao N, et al. Ferroptosis: Past, present and future. Cell Death Dis. 2020;11(2):88.10.1038/s41419-020-2298-2Search in Google Scholar PubMed PubMed Central

[27] Tarangelo A, Magtanong L, Bieging-Rolett KT, Li Y, Ye J, Attardi LD, et al. p53 suppresses metabolic stress-induced ferroptosis in cancer cells. Cell Rep. 2018;22(3):569–75.10.1016/j.celrep.2017.12.077Search in Google Scholar PubMed PubMed Central

[28] Uddin MA, Akhter MS, Siejka A, Catravas JD, Barabutis N. P53 supports endothelial barrier function via APE1/Ref1 suppression. Immunobiology. 2019;224(4):532–8.10.1016/j.imbio.2019.04.008Search in Google Scholar PubMed PubMed Central

[29] McNeill DR, Narayana A, Wong HK, Wilson 3rd DM. Inhibition of Ape1 nuclease activity by lead, iron, and cadmium. Environ Health Perspect. 2004;112(7):799–804.10.1289/ehp.7038Search in Google Scholar PubMed PubMed Central

[30] Ajucarmelprecilla A, Pandi J, Dhandapani R, Ramanathan S, Chinnappan J, Paramasivam R, et al. In Silico identification of hub genes as observing biomarkers for gastric cancer metastasis. Evidence Based Complementary Altern Med. 2022;2022:6316158.10.1155/2022/6316158Search in Google Scholar PubMed PubMed Central

[31] Manoel-Caetano FS, Rossi AFT, Ribeiro ML, Prates J, Oliani SM, Silva AE. Hydrogen peroxide and Helicobacter pylori extract treatment combined with APE1 knockdown induce DNA damage. G2/M arrest and cell death in gastric cancer cell line. DNA Repair (Amst). 2020;96:102976.10.1016/j.dnarep.2020.102976Search in Google Scholar PubMed

[32] Cun Y, Dai N, Li M, Xiong C, Zhang Q, Sui J, et al. APE1/Ref-1 enhances DNA binding activity of mutant p53 in a redox-dependent manner. Oncol Rep. 2014;31(2):901–9.10.3892/or.2013.2892Search in Google Scholar PubMed

[33] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25(4):402–8.10.1006/meth.2001.1262Search in Google Scholar PubMed

[34] Yuan H, Su L, Chen WY. The emerging and diverse roles of sirtuins in cancer: A clinical perspective. Onco Targets Ther. 2013;6:1399–416.10.2147/OTT.S37750Search in Google Scholar PubMed PubMed Central

[35] Yang Q, Wang B, Gao W, Huang S, Liu Z, Li W, et al. SIRT1 is downregulated in gastric cancer and leads to G1-phase arrest via NF-kappaB/Cyclin D1 signaling. Mol Cancer Res. 2013;11(12):1497–507.10.1158/1541-7786.MCR-13-0214Search in Google Scholar PubMed

[36] Zhang S, Yang Y, Huang S, Deng C, Zhou S, Yang J, et al. SIRT1 inhibits gastric cancer proliferation and metastasis via STAT3/MMP-13 signaling. J Cell Physiol. 2019;234(9):15395–406.10.1002/jcp.28186Search in Google Scholar PubMed

[37] Deng X, Zheng H, Li D, Xue Y, Wang Q, Yan S, et al. MicroRNA-34a regulates proliferation and apoptosis of gastric cancer cells by targeting silent information regulator 1. Exp Ther Med. 2018;15(4):3705–14.10.3892/etm.2018.5920Search in Google Scholar PubMed PubMed Central

[38] Hirai S, Endo S, Saito R, Hirose M, Ueno T, Suzuki H, et al. Antitumor effects of a sirtuin inhibitor, tenovin-6, against gastric cancer cells via death receptor 5 up-regulation. PLoS One. 2014;9(7):e102831.10.1371/journal.pone.0102831Search in Google Scholar PubMed PubMed Central

[39] Dang R, Wang M, Li X, Wang H, Liu L, Wu Q, et al. Edaravone ameliorates depressive and anxiety-like behaviors via Sirt1/Nrf2/HO-1/Gpx4 pathway. J Neuroinflammation. 2022;19(1):41.10.1186/s12974-022-02400-6Search in Google Scholar PubMed PubMed Central

[40] Qiongyue Z, Xin Y, Meng P, Sulin M, Yanlin W, Xinyi L, et al. Post-treatment with irisin attenuates acute kidney injury in sepsis mice through anti-ferroptosis via the SIRT1/Nrf2 pathway. Front Pharmacol. 2022;13:857067.10.3389/fphar.2022.857067Search in Google Scholar PubMed PubMed Central

[41] Wang C, Liu T, Tong Y, Cui R, Qu K, Liu C, et al. Ulinastatin protects against acetaminophen-induced liver injury by alleviating ferroptosis via the SIRT1/NRF2/HO-1 pathway. Am J Transl Res. 2021;13(6):6031–42.Search in Google Scholar

[42] Su G, Yang W, Wang S, Geng C, Guan X. SIRT1-autophagy axis inhibits excess iron-induced ferroptosis of foam cells and subsequently increases IL-1Beta and IL-18. Biochem Biophys Res Commun. 2021;561:33–9.10.1016/j.bbrc.2021.05.011Search in Google Scholar PubMed

[43] Doll S, Freitas FP, Shah R, Aldrovandi M, da Silva MC, Ingold I, et al. FSP1 is a glutathione-independent ferroptosis suppressor. Nature. 2019;575(7784):693–8.10.1038/s41586-019-1707-0Search in Google Scholar PubMed

[44] Mao C, Liu X, Zhang Y, Lei G, Yan Y, Lee H, et al. DHODH-mediated ferroptosis defence is a targetable vulnerability in cancer. Nature. 2021;593(7860):586–90.10.1038/s41586-021-03539-7Search in Google Scholar PubMed PubMed Central

[45] Jelinek A, Heyder L, Daude M, Plessner M, Krippner S, Grosse R, et al. Mitochondrial rescue prevents glutathione peroxidase-dependent ferroptosis. Free Radic Biol Med. 2018;117:45–57.10.1016/j.freeradbiomed.2018.01.019Search in Google Scholar PubMed

[46] Zhang Y, Lu X, Tai B, Li W, Li T. Ferroptosis and its multifaceted roles in cerebral stroke. Front Cell Neurosci. 2021;15:615372.10.3389/fncel.2021.615372Search in Google Scholar PubMed PubMed Central

[47] Kitakata H, Endo J, Matsushima H, Yamamoto S, Ikura H, Hirai A, et al. MITOL/MARCH5 determines the susceptibility of cardiomyocytes to doxorubicin-induced ferroptosis by regulating GSH homeostasis. J Mol Cell Cardiol. 2021;161:116–29.10.1016/j.yjmcc.2021.08.006Search in Google Scholar PubMed

[48] Lei G, Zhang Y, Koppula P, Liu X, Zhang J, Lin SH, et al. The role of ferroptosis in ionizing radiation-induced cell death and tumor suppression. Cell Res. 2020;30(2):146–62.10.1038/s41422-019-0263-3Search in Google Scholar PubMed PubMed Central

[49] Hu P, Xu Y, Jiang Y, Huang J, Liu Y, Wang D, et al. The mechanism of the imbalance between proliferation and ferroptosis in pulmonary artery smooth muscle cells based on the activation of SLC7A11. Eur J Pharmacol. 2022;928:175093.10.1016/j.ejphar.2022.175093Search in Google Scholar PubMed

[50] Park MW, Cha HW, Kim J, Kim JH, Yang H, Yoon S, et al. NOX4 promotes ferroptosis of astrocytes by oxidative stress-induced lipid peroxidation via the impairment of mitochondrial metabolism in Alzheimer’s diseases. Redox Biol. 2021;41:101947.10.1016/j.redox.2021.101947Search in Google Scholar PubMed PubMed Central

[51] Xie Y, Zhu S, Song X, Sun X, Fan Y, Liu J, et al. The tumor suppressor p53 limits ferroptosis by blocking DPP4 activity. Cell Rep. 2017;20(7):1692–704.10.1016/j.celrep.2017.07.055Search in Google Scholar PubMed

[52] Jiang L, Kon N, Li T, Wang SJ, Su T, Hibshoosh H, et al. Ferroptosis as a p53-mediated activity during tumour suppression. Nature. 2015;520(7545):57–62.10.1038/nature14344Search in Google Scholar PubMed PubMed Central

[53] Sriramajayam K, Peng D, Lu H, Zhou S, Bhat N, McDonald OG, et al. Activation of NRF2 by APE1/REF1 is redox-dependent in Barrett’s related esophageal adenocarcinoma cells. Redox Biol. 2021;43:101970.10.1016/j.redox.2021.101970Search in Google Scholar PubMed PubMed Central

[54] Hao J, Du H, Liu F, Lu JC, Yang XC, Cui W. Apurinic/apyrimidinic endonuclease/redox factor 1 (APE1) alleviates myocardial hypoxia-reoxygenation injury by inhibiting oxidative stress and ameliorating mitochondrial dysfunction. Exp Ther Med. 2019;17(3):2143–51.10.3892/etm.2019.7212Search in Google Scholar PubMed PubMed Central

[55] Fang D, Wang Y, Zhang Z, Yang D, Gu D, He B, et al. Calorie restriction protects against contrast-induced nephropathy via SIRT1/GPX4 activation. Oxid Med Cell Longev. 2021;2021:2999296.10.1155/2021/2999296Search in Google Scholar PubMed PubMed Central

[56] Codrich M, Comelli M, Malfatti MC, Mio C, Ayyildiz D, Zhang C, et al. Inhibition of APE1-endonuclease activity affects cell metabolism in colon cancer cells via a p53-dependent pathway. DNA Repair. 2019;82:102675.10.1016/j.dnarep.2019.102675Search in Google Scholar PubMed PubMed Central

[57] Zhu J, Zhang C, Qing Y, Cheng Y, Jiang X, Li M, et al. Genistein induces apoptosis by stabilizing intracellular p53 protein through an APE1-mediated pathway. Free Radic Biol Med. 2015;86:209–18.10.1016/j.freeradbiomed.2015.05.030Search in Google Scholar PubMed

Received: 2022-07-18
Revised: 2022-11-21
Accepted: 2022-11-22
Published Online: 2023-02-14

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
https://doi.org/10.1515/med-2022-0620
Keywords for this article
SIRT1; APE1; p53; ferroptosis; gastric cancer
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 10.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2022-0620/html
Scroll to top button