Home Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
Article Open Access

Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment

  • Min Wang , Min Liu , Jiawen Zheng , Li Xiong and Ping Wang EMAIL logo
Published/Copyright: April 6, 2023
Download Article (PDF)
Open Medicine
From the journal Open Medicine Volume 18 Issue 1

Abstract

Diabetes mellitus (DM) increases the destruction of periodontal tissue and impairs osteogenesis differentiation. Exendin-4 (Ex-4), a glucagon-like peptide-1 (GLP-1) analogue, can be used for treating DM and promotes bone regeneration. The aim of this study was to explore the effect and mechanism of Ex-4 on improving the osteogenesis of periodontal ligament stem cells (PDLSCs) in a high glucose environment. Alkaline phosphatase staining and alizarin red staining were used to detect the osteogenic differentiation of PDLSCs. The results showed that 10 nM Ex-4 could reduce the osteogenesis inhibition of PDLSCs induced by high glucose. RT-PCR and western blot results showed that Ex-4 increased the osteogenesis-related gene expression of ALP, Runx2, and Osx, and upregulated the phosphorylation of P38, JNK, and ERK1/2; the peak effect was observed in the range 0.5–1.0 h. Mitogen-activated protein kinase (MAPK) inhibitors PD98059, SB203580, and SP600125 blocked the effects of Ex-4 on MAPK activation and decreased the expression of ALP, Runx2, and Osx in PDLSCs. Moreover, after Ex-4 treatment, the total β-catenin, p-GSK3β, LEF, and Runx2 protein levels increased under normal or high glucose environments. In conclusion, our results indicated that Ex-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of PDLSCs in a high glucose environment.

Keywords: Exendin-4; osteogenic differentiation; PDLSCs; high glucose; MAPK signaling; WNT signaling

1 Introduction

Periodontitis is a destructive inflammatory disease caused by biofilm plaques; it destroys periodontal supporting tissues, including gums, periodontal membranes, alveolar bones, and cementum, and it is the main cause of adult tooth loss [1,2]. Currently, the main treatments for patients with periodontitis include periodontal scaling, flap turnover, and guided tissue regeneration. With the increasingly rapid progress of tissue engineering, periodontal regeneration has become a popular research area [3,4]. Periodontal ligament stem cells (PDLSCs) are the most promising seed cells in periodontal tissue engineering because of their easy sampling and multi-directional differentiation potential [5]. However, periodontitis is often accompanied by diabetes, and studies have shown that the prevalence of diabetes in patients with periodontitis is the highest in Asian countries (17.2%, n = 16,647) [6]. Diabetic status aggravates periodontal damage and hinders the repair of periodontal tissues, thus decreasing the regeneration rate in tissue engineering [7,8,9]. Therefore, determining how to enhance the osteogenic ability of PDLSCs in a high glucose environment is important for periodontal tissue repair and regeneration.

GLP-1 (glucagon-like peptide 1) is a kind of incretin synthesized and secreted by L cells of the intestine stimulated by food. It has a wide range of physiological functions, such as promoting the synthesis and release of insulin and reducing blood sugar concentration. However, GLP-1 is extremely unstable in vivo, easily degraded by DPP-4, and its serum half-life in vivo is only 2 min; therefore, its action time is very short [10]. Exendin-4 (Ex-4) is a peptide hormone, which was originally isolated from salivary secretions of Heloderma suspectum and has 53% homology with GLP-1. It stimulates the secretion of insulin by pancreatic β-cells, thereby controlling blood glucose levels. In vivo, Ex-4 has a similar biological function to that of GLP-1 but its half-life is longer and its degradation tendency is lower, so it is currently widely used in the clinical treatment of type 2 diabetes [11]. Recent reports have demonstrated that Ex-4 is an important regulator of bone growth and remodeling. Animal experiments have shown that Ex-4 and GLP-1 receptors promote the osteogenic differentiation of bone marrow stem cells and MC3T3-E1 preosteoblasts [12,13,14]. A recent study has also demonstrated that 10 nmol/L Ex-4 promotes migration and osteogenic differentiation of PDLSCs [15]. Our preliminary experiments have shown that the osteogenic inhibition induced by high glucose in PDLSCs is alleviated by 10 nM Ex-4 [16], although the molecular pathways involved in PDLSCs remain unclear. mitogen-activated protein kinase (MAPK) and WNT pathways play an important role in many biological processes such as cell growth, development, and metabolic balance. It is found that the MAPK pathway is particularly important for the differentiation of osteoblasts and the regulation and control of bone development [17]. Ex-4 can promote the osteogenic differentiation of MC3T3-E1 cells by activating the MAPK pathway [12]. The Wnt/β-catenin pathway can promote the differentiation of osteoblasts by upregulating osteogenic regulatory factors and also plays an important role in regulating bone development and increasing bone mass [18]. Therefore, we hypothesized that Ex-4 may promote the osteogenesis of PDLSCs in a high glucose environment by regulating MAPK and WNT pathways.

The purpose of this study was to explore the osteogenesis regulatory mechanisms of Ex-4 in PDLSCs under high glucose conditions and to provide a new method for the clinical treatment of diabetic periodontitis.

2 Materials and methods

2.1 Isolation and culture of PDLSCs

The premolars of healthy people were collected from orthodontic patients (18–26 years of age) who visited the Department of Orthodontics of the First Affiliated Hospital of Chongqing Medical University. Consent was obtained from all patients. After the removal of excess epithelial and granulation tissue, the teeth were washed repeatedly with phosphate-buffered saline (PBS; Hyclone, USA). The periodontal membrane was scraped softly from a third of the root and then digested with collagenase type I (3 mg/mL, Sigma-Aldrich, USA) in a water bath at 37°C for 10 min. Finally, the tissues were transferred to 25 T cell culture flasks containing fetal bovine serum (Hyclone, USA) at 37°C in a humidified atmosphere containing 5% CO2. After culturing for 4 h, alpha modification of eagle’s medium (α-MEM) (Gibco, USA) supplemented with 10% fetal bovine serum (FBS) and 1% streptomycin solution (Sigma-Aldrich, USA) was added to the culture medium and changed every 3 days. PDLSCs from P3 to P5 were used for subsequent experiments.

  1. Ethics approval and consent to participate: This study was carried out in accordance with the Declaration of Helsinki principles and the guidelines of the Ethics Committee of the First Affiliated Hospital of Chongqing Medical University, and the approval reference number is 201810401. Furthermore, all subjects have given their written informed consent.

2.2 Identification of PDLSCs

To determine the characteristics of PDLSCs, we detected the colony-forming ability and multi-directional differentiation ability of PDLSCs. PDLSCs were inoculated into 6 cm2 cell culture dishes. They were then cultured in a growth medium for 14 days, and about 2 mL of crystal violet dye solution (Beyotime, China) was added to each dish and the clone formation rate was calculated. When the number of cells in an aggregation exceeded 50, it was scored as a colony. For osteogenic experiments, PDLSCs were cultured in an osteogenic induction medium comprising α-MEM, 10% FBS, 1% streptomycin solution, 1 µM dexamethasone, 50 µg/mL ascorbic acid, and 3 µM β-glycerophosphate (Sigma-Aldrich, USA). After 21 days, alizarin red staining was used to assess the degree of osteogenic differentiation. For adipogenesis, PDLSCs were cultured in an adipogenic induction medium consisting of α-MEM, 10% FBS, 1% streptomycin solution, 1 µM dexamethasone, 10 µM insulin, 200 µM indomethacin, and 0.5 mM 3-isobutyl-1-methylxanthine (all from Sigma-Aldrich, USA). After 14 days, Oil Red O staining was used to detect the lipid droplets.

2.3 Alkaline phosphatase staining

PDLSCs were induced in an osteogenic induction medium containing 5.5 mM d-glucose (Sigma, USA) (NG), NG + 10 nM Ex-4 (NG + Ex-4), 30 mM d-glucose (HG), or HG + 10 nM Ex-4 (HG + Ex-4) for 7 days. ALP staining solution (Beyotime, China) was prepared according to the protocol of the alkaline phosphatase staining kit, and 500 μL of the ALP staining solution was added to the well to be tested, and incubated for 15 min at room temperature in the dark. Subsequently, all staining solution was aspirated, and the well was gently rinsed with ultrapure water, photographed, and observed.

2.4 Alizarin red staining

PDLSCs were cultured in the osteogenic induction medium for 21 days. Then, the cells were fixed with 4% paraformaldehyde at room temperature in the dark for 30 min and stained with alizarin red (Suolaibao, Beijing, China) for 30 min; the dye solution was then discarded. After careful washing with PBS three times, the cells were observed and photographed under an inverted microscope.

2.5 Quantitative real-time polymerase chain reaction (qRT-PCR)

PDLSCs were osteogenically cultured with NG or 30 mM mannitol for 7 days. PDLSCs were also cultured with NG + 10 nM Ex-4, HG, or HG + 10 nM Ex-4 for 7 or 14 days, and osteogenesis was induced. The MAPK-specific inhibitors, 25 µM PD98059, 25 µM SB203580, and 10 µM SP600125 (MCE, USA), were also used to treat the cells. The expression of ALP, Osx, and Runx2 was detected with RT-PCR. Total RNA was extracted from the PDLSCs with TRIzol reagent (Invitrogen, USA). RNA (1,000 ng) was then transcribed into cDNA using a PrimeScript™ RT reagent kit with gDNA Eraser (Takara, Japan). Finally, an SYBR Premix Ex Taq II kit (Takara, Japan) was used for RT-PCR. A total of 10 µL PCR system contained 2 µL of cDNA, 0.5 µL of each diluted primer, 5 µL of SYBR green, and 2 µL of distilled water. The primer sequences used in this research are listed in Table 1. The results were analyzed with the comparative 2−ΔΔCt method.

Table 1

Sense and antisense primer sequences used for real-time PCR

Primers Sequences
Runx2 Forward (5′–3′): GTCTCACTGCCTCTCACTTG
Reverse (5′–3′): CACACATCTCCTCCCTTCTG
ALP Forward (5′–3′): CCATACAGGATGGCAGTGAAGG
Reverse (5′–3′): TTGACCTCCTCGGAAGACACTC
Osx Forward (5′–3′): TGAGGAGGAAGTTCACTATGG
Reverse (5′–3′): TTCTTTGTGCCTGCTTTGC
β-Actin Forward (5′–3′): CCTGGCACCCAGCACAAT
Reverse (5′–3′): GGGCCGGACTCGTCATAC

2.6 Western blot analysis

The levels of key proteins in MAPK and WNT pathways were tested by western blotting. PDLSCs were treated with 10 nM Ex-4 for 0, 0.5, 1, 1.5, 2, or 3 h. For inhibition experiments, cells were pretreated with the specific inhibitors PD98059 (25 µM), SB203580 (25 µM), or SP600125 (10 µM) (MCE, USA) for 4 h, then incubated with Ex-4 (10 nM) for 0.5 or 1 h, and cellular proteins were extracted. A BCA protein assay kit (Beyotime Biotechnology) was used to detect and quantify the protein concentrations of PDLSCs. Then, 20 μg of total protein was separated with 12% SDS-PAGE and transferred to polyvinylidene fluoride membranes (Millipore, USA). The membrane was blocked in 5% skim milk and incubated on a shaker at room temperature for 2 h. Membranes were incubated overnight at 4°C with primary antibodies to p38, p-p38, ERK1/2, p-ERK1/2, JNK, p-JNK, GSK3β, p-GSK3β (Ser9), LEF, β-catenin, GAPDH, tubulin (Cell Signaling Technology, USA) and Runx2 (HuaBio, China) diluted 1:1,000, and was then incubated with secondary antibodies (Cell Signaling Technology, USA) for 1 h at room temperature. Proteins were visualized with Hypersensitive ECL Chemiluminescence kits (Beyotime, China) and analyzed using Image J software.

2.7 Statistical analyses

All statistical calculations were analyzed using Prism software (version 8.0). The differences between the two groups of data were compared with Student’s t-test, and multiple groups of data were evaluated with one-way ANOVA. Differences were considered significant at p < 0.05.

3 Results

3.1 Isolation and identification of PDLSCs

Primary periodontal ligament cells were successfully extracted from periodontal ligament tissue (Figure 1a). Under microscopic examination, the cells were seen to have grown in long spindle shapes (Figure 1b). At 21 days after osteogenesis induction, alizarin red staining showed that calcium nodules had formed (Figure 1c); 14 days after induction of adipogenesis, oil red O staining showed the formation of lipid droplets (Figure 1d). The PDLSCs formed high-density clones after 2 weeks of growth (Figure 1e). Our results indicated that PDLSCs had multi-directional differentiation potential.

Figure 1 Extraction and identification of PDLSCs. (a) Primitive cells grow out of the surrounding tissue mass. (b) Morphology of PDLSCs. (c) PDLSCs formed calcium nodules stained with Alizarin Red S after 21 days of osteogenesis induction. (d) After 14 days of induction of lipogenesis, lipid droplets were assessed by oil red o staining. (e) Plate clone formation experiment and crystal violet staining were carried out after 14 days of culture.
Figure 1

Extraction and identification of PDLSCs. (a) Primitive cells grow out of the surrounding tissue mass. (b) Morphology of PDLSCs. (c) PDLSCs formed calcium nodules stained with Alizarin Red S after 21 days of osteogenesis induction. (d) After 14 days of induction of lipogenesis, lipid droplets were assessed by oil red o staining. (e) Plate clone formation experiment and crystal violet staining were carried out after 14 days of culture.

3.2 Influence of Ex-4 on the osteogenic differentiation of PDLSCs under high glucose conditions

Ex-4 is used as an antidiabetic agent in clinical settings, and studies have shown that Ex-4 promotes osteogenesis. Therefore, we investigated whether Ex-4 promotes the osteogenesis of PDLSCs under high glucose conditions. In order to eliminate the influence of osmotic pressure on the osteogenic ability of PDLSCs, PDLSCs were cultured in an osteoblast induction medium and treated with mannitol (30 mM) for 7 days. RT-PCR indicated no significant differences in the expression of osteogenic differentiation-associated genes (including Runx2, ALP, and Osx) between the 30 mM mannitol group and control group (p > 0.05) (Figure 2a). Our findings demonstrated that the inhibition of PDLSC osteogenesis by high glucose was independent of osmotic pressure.

Figure 2 Influences of Ex-4 on the osteogenic differentiation of PDLSCs in a high glucose environment. (a) RT-PCR was used to detect the expression of ALP, Runx2, and Osx in PDLSCs cultured in 30 mmol mannitol for 7 days. (b–d) PDLSCs were osteogenically cultured for 7 and 14 days, and the expression of ALP, Osx, and Runx2 was detected with RT-PCR. (e) Alkaline phosphatase staining was used to detect the ALP activity of PDLSCs on the 7th day. Scale bars = 500 μm. (f) Mineralized nodules were detected with alizarin red staining on the 21st day. Nodules (15×) were observed under a microscope. Scale bars = 500 μm. Data are expressed as the average of three independent experiments + SEM (*p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001).
Figure 2

Influences of Ex-4 on the osteogenic differentiation of PDLSCs in a high glucose environment. (a) RT-PCR was used to detect the expression of ALP, Runx2, and Osx in PDLSCs cultured in 30 mmol mannitol for 7 days. (b–d) PDLSCs were osteogenically cultured for 7 and 14 days, and the expression of ALP, Osx, and Runx2 was detected with RT-PCR. (e) Alkaline phosphatase staining was used to detect the ALP activity of PDLSCs on the 7th day. Scale bars = 500 μm. (f) Mineralized nodules were detected with alizarin red staining on the 21st day. Nodules (15×) were observed under a microscope. Scale bars = 500 μm. Data are expressed as the average of three independent experiments + SEM (*p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001).

We then used 10 nM Ex-4 to treat PDLSCs in normal or high glucose environments. After 7 and 14 days of osteogenic culture, we detected the changes in osteogenesis-related gene expression by RT-PCR. The results showed that mRNA expression of osteogenic genes (ALP, Runx2, and Osx) after treatment with 10 nM Ex-4 was markedly higher than that of the control group on the 14th day (p < 0.01). Under HG conditions, the mRNA levels of ALP, Osx, and Runx2 were lower than that of the control group on the 7th day, and the mRNA levels of ALP and Runx2 were markedly lower than that of the control group on the 14th day (p < 0.05). The RT-PCR results also indicated that the effects of inhibition of high glucose on osteogenic genes in PDLSCs were clearly decreased by co-treatment with Ex-4 for 14 days (p < 0.01) (Figure 2b–d). These results further indicated that Ex-4 has a positive effect on the osteogenesis of PDLSCs in a high glucose environment.

We further detected the changes in osteogenesis by ALP staining and alizarin red staining. After 7 and 21 days of osteogenic culture, the results indicated that the ALP activity and number of calcium nodules formed in the high glucose group strongly decreased. After treatment with Ex-4, the ALP activity and the number of calcium nodules in HG + Ex-4 were greater than those in the HG group (Figure 2e and f). These results indicated that Ex-4 alleviated the osteogenic inhibition of PDLSCs under a high glucose environment.

3.3 Influence of Ex-4 on MAPK signaling in PDLSCs

GLP-1 and its analogues have been shown to affect osteoblasts through MAPK pathways. Therefore, we explored the possible role of the MAPK pathway in Ex-4’s regulation of the osteogenic differentiation of PDLSCs. After Ex-4 treatment, the expression of three MAPK kinases (p38, ERK1/2, and p38) and their phosphorylation were detected at different times. Western blotting indicated that Ex-4 promoted the phosphorylation of MAPKs in PDLSCs between 0.5 and 1.0 h. The phosphorylation of p38 peaked around 1.0 h, those of extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK) both peaked around 0.5 h (p < 0.01) (Figure 3a–c).

Figure 3 Influences of Ex-4 on MAPK phosphorylation in PDLSCs. (a–c) The phosphorylation of p38, ERK1/2, and JNK was detected by WB after 0, 0.5, 1, 1.5, 2, and 3 h of Ex-4 treatment of PDLSCs, compared with 0 h. (d–f) Cells were pretreated with 25 μM PD98059, 25 μM SB203580, or 10 μM SP600125 before incubation with 10 nM Ex-4 or 30 mM HG for 0.5 h. Total proteins were extracted to detect the phosphorylation of p38, ERK1/2, and JNK. Data are expressed as the average of three independent experiments + SEM (*p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001).
Figure 3

Influences of Ex-4 on MAPK phosphorylation in PDLSCs. (a–c) The phosphorylation of p38, ERK1/2, and JNK was detected by WB after 0, 0.5, 1, 1.5, 2, and 3 h of Ex-4 treatment of PDLSCs, compared with 0 h. (d–f) Cells were pretreated with 25 μM PD98059, 25 μM SB203580, or 10 μM SP600125 before incubation with 10 nM Ex-4 or 30 mM HG for 0.5 h. Total proteins were extracted to detect the phosphorylation of p38, ERK1/2, and JNK. Data are expressed as the average of three independent experiments + SEM (*p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001).

To further verify the effects of Ex-4 via the MAPK pathway, we pretreated cells with MAPK inhibitors (including 25 µM PD98059, 25 µM SP 600125, and 10 µM SB203580) for 4 h, and then treated the cells with 10 nM Ex-4 or 30 mM HG for approximately 30 min. Western blotting detection showed that Ex-4 promoted greater MAPK phosphorylation of ERK1/2, p38, and JNK than that in the control group, and the phosphorylation of p38 and ERK1/2 in the HG group decreased. Compared with that in the HG group, the phosphorylation of MAPKs in the HG + Ex-4 group was also elevated. Furthermore, MAPK inhibitor treatment significantly decreased the phosphorylation of MAPKs by Ex-4. Thus, Ex-4 activates the MAPK pathway in a high glucose environment (Figure 3d–f).

3.4 Influence of Ex-4 on osteogenesis in PDLSCs is blocked by MAPK inhibitors

MAPK inhibitors were added, and their influence on the mRNA expression of ALP, Runx2, and Osx was assessed. Compared with those in the NG + Ex-4 group, the mRNA levels of ALP, Runx2, and Osx in the NG + Ex-4 + SB203580 group were 92, 72, and 82% lower, respectively. Compared with those in the HG + Ex-4 group, the levels were approximately 80, 69, and 71% lower in the HG + Ex-4 + SB203580, respectively (p < 0.01). Similarly, for SP600125, compared with the NG + Ex-4 group, the mRNA levels of ALP, Runx2, and OSX were reduced to approximately 98, 53, and 28%, respectively, in the NG + Ex-4 + SP600125 group, and compared with HG + Ex-4, they were reduced to about 95, 38, and 20% (p < 0.05) in the HG + Ex-4 + SP600125 group. PD98059 likewise reduced all the mRNA expressions; compared with the NG + Ex-4 group, it decreased the expressions of ALP, Runx2, and OSX to about 89, 70, and 73% in the NG + Ex-4 + PD98059 group, and compared with the HG + Ex-4 group the expressions decreased to 59, 65, and 38% in the HG + Ex-4 + PD98059 group, respectively (p < 0.05) (Figure 4a–c). Alizarin red staining indicated that the calcified nodules in the inhibitor groups were much lower than those in the control groups, thus further indicating that the MAPK inhibitor blocked the effect of Ex-4 on the osteogenesis of PDLSCs (Figure 4d).

Figure 4 The influence of Ex-4 on osteogenesis in PDLSCs is blocked by MAPK inhibitors. (a–c) PDLSCs were switched to a differentiation medium and treated with PD98058, SB203580, or SP600125 in the presence or absence of 10 nM Ex-4 or 30 mM high glucose. Total RNA was extracted on day 7, and quantitative PCR was performed. (d) Mineralized nodules were detected with alizarin red staining, scale bars = 500 μm. Data are expressed as the average of three independent experiments + SEM (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).
Figure 4

The influence of Ex-4 on osteogenesis in PDLSCs is blocked by MAPK inhibitors. (a–c) PDLSCs were switched to a differentiation medium and treated with PD98058, SB203580, or SP600125 in the presence or absence of 10 nM Ex-4 or 30 mM high glucose. Total RNA was extracted on day 7, and quantitative PCR was performed. (d) Mineralized nodules were detected with alizarin red staining, scale bars = 500 μm. Data are expressed as the average of three independent experiments + SEM (*p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001).

3.5 Influence of Ex-4 on WNT signaling in PDLSCs under high glucose conditions

The WNT signaling pathway also plays an important role in the osteogenesis of stem cells, and studies have found that Ex-4 can promote the bone formation of type 2 diabetic rats through the WNT signaling pathway [19]. Therefore, we speculate that Ex-4 may promote the bone formation of PDLSCs in a high glucose environment through the WNT signaling pathway. PDLSCs were cultured in 30 mM high glucose or 10 nM Ex-4 for 7 days, and the protein levels of β-catenin, p-GSK-3β, GSK-3β, LEF, and Runx2 were detected. Western blotting showed that compared with the NG control group, p-GSK-3β was significantly higher in the NG + Ex-4 group and lower in the HG group. Compared with that in the HG group, the expression of p-GSK-3β in the HG + Ex-4 group was also higher, but the total protein of GSK-3β showed no clear difference (Figure 5a). The expression of total β-catenin and LEF increased after Ex-4 treatment, whereas that in the HG group decreased. Co-treatment with Ex-4 under high glucose conditions significantly increased β-catenin and LEF expression (Figure 5b). The expression of Runx2 in the NG + Ex-4 group was significantly higher, whereas that in the HG group was significantly lower than that in the NG control group. Co-treatment with Ex-4 under high glucose, compared with HG treatment alone, significantly increased Runx2 expression (p < 0.05) (Figure 5c).

Figure 5 The influence of Ex-4 on WNT signaling in PDLSCs under high glucose conditions. (a–c) Western blots showing the expression of p-GSK3β, GSK3β, LEF, β-catenin, and Runx2 after PDLSC treatment with 10 nM Ex-4 or 30 mM HG in an osteogenic medium for 7 days. Data are expressed as the average of three independent experiments + SEM (*p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001).
Figure 5

The influence of Ex-4 on WNT signaling in PDLSCs under high glucose conditions. (a–c) Western blots showing the expression of p-GSK3β, GSK3β, LEF, β-catenin, and Runx2 after PDLSC treatment with 10 nM Ex-4 or 30 mM HG in an osteogenic medium for 7 days. Data are expressed as the average of three independent experiments + SEM (*p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001).

4 Discussion

In the present study, we found the GLP1 receptor agonist Ex-4 exerted a direct action on PDLSCs in a high glucose environment. Ex-4 alleviated the osteogenic inhibition of PDLSCs induced by high glucose, and promoted the osteogenic differentiation of PDLSCs in a normal glucose environment. Ex-4 also upregulated the activity of MAPK and WNT signaling pathways, which are known to play a key role in osteoblast differentiation and bone development. Taken together, these results imply that Ex-4 may play an active role in the osteogenesis of PDLSCs by regulating MAPK and WNT pathways in a high glucose environment.

Studies have shown a bidirectional relationship between diabetes and periodontitis. For patients with periodontitis and diabetes, hyperglycemia can accelerate the destruction of periodontal tissue and promote alveolar bone absorption [20]. ALP is an enzyme secreted by osteoblasts, and its high activity and expression are the specific sign of early differentiation of osteoblasts [21]. Runx2 is one of the earliest and most specific marker genes involved in bone formation [22], and Osx is an osteoblast-specific transcription factor necessary for bone formation [23]. In the present study, we found that the expression of the osteogenic genes ALP, Runx2, and Osx in PDLSCs decreased under high glucose conditions and the calcium nodules also decreased, as detected by alizarin red staining. Therefore, our results showed that a high glucose environment damaged the osteogenesis of PDLSCs.

Ex-4, an analogue of GLP-1, is used as a drug to treat type 2 diabetes. Recent studies have demonstrated that GLP-1 and its analogues play active roles in bone metabolism and have attracted increasing attention. In animal experiments, Nuche-Berenguer et al. have found that GLP-1 and Ex-4 had osteogenic roles in diabetes and can reverse the osteopenia associated with hyperlipidemia [24]. Moreover, Ex-4 stimulates the secretion of insulin, inhibits the secretion of glucagon and regulates gastric emptying, controls glucose levels, and promotes bone formation [25,26]. In addition to indirectly inhibiting bone resorption by lowering blood sugar, Ex-4 also directly inhibits bone resorption and promotes bone formation, thereby increasing bone mass [27,28]. Here, in vitro, our data showed that 10 nM Ex-4 rapidly increased the expression of the osteogenic genes ALP, Runx2, and Osx. Ex-4 restored the expression of damaged osteogenic genes under high glucose conditions. Nonetheless, we conclude that Ex-4 has a positive effect on the PDLSC differentiation under a high glucose environment. This conclusion is in line with many previous research findings.

To further investigate the osteogenic mechanism of Ex-4 in PDLSCs, we studied the effects of Ex-4 on the activation of the MAPK and WNT signaling pathways. MAPK signaling pathways regulate a series of biological activities, such as growth, reproduction, and death. It is particularly important for the differentiation of osteoblasts and the regulation and control of bone development [17]. Four MAPK signal transduction pathways are known in eukaryotic cells: the ERK, JNK (also known as SAPK), and p38 and ERK5 pathways [29,30,31,32]. Recent studies have shown that GLP-1 and its analogues affect osteoblasts through MAPK pathways [12,33]. Feng et al. have confirmed that Ex-4 rapidly activated the MAPK pathway in MC3T3-E1 cells, whereas blocking the MAPK pathways with an inhibitor consequently inhibited osteogenesis [12]. According to our results, Ex-4 activated MAPK pathways in a short time, and the phosphorylation of ERK1/2 and JNK reached a peak at 0.5 h, and that of p38 reached its peak at 1 h. However, studies about the role of Ex-4 in the MAPK pathway under a high glucose environment have remained controversial. Several research studies have reported that Ex-4 downregulates the phosphorylation of ERK and p38 MAPK in peripheral blood mononuclear cells of patients with type 2 diabetes, so as to reduce oxidative stress and the pro-inflammatory reaction [34,35]. Conversely, results from other studies have demonstrated that Ex-4 can accelerate glucose transport in adipocytes by activating MAPKs [36]. Our data showed that phosphorylation of p38 and ERK1/2 decreased under a high glucose environment, but Ex-4 promoted the phosphorylation of the MAPK pathway in both normal and high glucose groups. To further confirm the role of MAPK pathway in the osteogenesis of PDLSCs, we chose an MAPK pathway inhibitor to act on PDLSCs. SB203580 is a p38-specific inhibitor, which can permeate cells and inhibit the subsequent activation of MAPKAPK-2 and MAP-KAPP-3, thus inhibiting the p38 pathway [37]. PD98059 is a selective inhibitor of ERK1/2; it binds to the upstream MEK1 protein kinase of ERK, thereby inhibiting its phosphorylation and blocking its signal transduction, thus inhibiting the activation of the downstream ERK1/2 [38]. SP600125 is a specific inhibitor of the JNK pathway; it reversibly competes with ATP, thus inhibiting the phosphorylation of JNK [39]. When we added ERK, JNK, and p38 blockers (PD98059, SP600125, and SB203580) under a high glucose environment, the ALP, Runx2, and Osx mRNA levels in PDLSCs significantly decreased. We suspected that ERK1/2 and P38 pathways of the MAPK pathway play a major role in the early osteogenesis of PDLSCs, while the JNK pathway may be mainly related to the inflammatory reaction in cells, or participate in the late osteogenic differentiation of PDLSCs. In conclusion, our results demonstrated that Ex-4 may promote the osteogenesis of PDLSCs by activating MAPK pathways under high glucose conditions. Furthermore, p38, ERK1/2, and JNK proteins are sensitive to intracellular oxidative stress [40,41]. People with diabetes have a complex internal environment. Advanced glycation end products formed by long-term hyperglycemia activate RAGE-mediated oxidative stress and then induce osteoblasts to produce ROS, thus inhibiting their proliferation and osteogenic differentiation [42]. Our research group has also found that Ex-4 regulates ROS levels in cells, thereby affecting PDLSC proliferation and osteogenesis [16]. Whether Ex-4 might regulate the MAPK pathway by decreasing ROS production to alleviate the osteogenesis inhibition of PDLSCs under high glucose requires further investigation.

The classical WNT signaling pathway is closely associated with the regulation of osteoblast differentiation. The pathway is mainly composed of ligands (WNT family molecules), transmembrane receptors (Frizzled family molecules and LRP-5/6), cytoplasmic regulatory proteins (Dsh, APC, Axin, GSK-3β, and β-catenin), and nuclear transcription factor families (TCF/LEF) [43]. GSK-3β, a very important negative regulator in the classic Wnt pathway, phosphorylates β-catenin, thus leading to the ubiquitination and degradation of β-catenin [44]. Runx2, a key gene in osteogenesis, plays a significant role in promoting osteogenesis through the classic WNT pathway [45,46]. Previous studies have found that Ex-4 treatment activates the WNT pathway to promote bone formation in diabetic rats. In addition, Kim et al. have further suggested that Ex-4 may bind the GLP-1 receptor in a manner mediated by protein kinase A and act on the WNT/β-catenin pathway in bone cells, thereby promoting bone formation [19]. Our results showed that after Ex-4 treatment, the levels of p-GSK3β, total β-catenin, and LEF increased under normal and high glucose environments. Thus, we concluded that Ex-4 renders the GSK3β-mediated complex ineffective by activating GSK3β phosphorylation, promoting β-catenin nuclear translocation and interaction with LEF, and finally, increasing the expression of the osteogenesis-related gene Runx2. However, our experiments have several limitations, we only selected a part of the WNT pathway proteins to study, but the expression changes in the β-catenin phosphorylation level were not further explored, and the relationship between Ex-4 and classical WNT pathway requires further research.

5 Conclusion

Our experiments demonstrated that the osteogenesis of PDLSCs was inhibited in a high glucose environment, but Ex-4 (10 nM) alleviated the inhibition of osteogenesis in PDLSCs by regulating the MAPK and WNT signaling pathways (Figure 6). Our findings may provide a new therapeutic target for patients with periodontitis and diabetes.

Figure 6 Hypothetical model of the signaling pathway through which Ex-4 alleviates osteogenesis in PDLSCs under a high glucose environment. High glucose increases the production of reactive oxygen species, whereas Ex-4 inhibits the production of ROS and activates the MAPK and WNT pathways, thus promoting the osteogenic differentiation of PDLSCs.
Figure 6

Hypothetical model of the signaling pathway through which Ex-4 alleviates osteogenesis in PDLSCs under a high glucose environment. High glucose increases the production of reactive oxygen species, whereas Ex-4 inhibits the production of ROS and activates the MAPK and WNT pathways, thus promoting the osteogenic differentiation of PDLSCs.

tel: +8613452146621

Acknowledgments

Not applicable.

  1. Funding information: This research was supported by the Basic Research and Frontier Exploration Project of Chongqing Municipal Science and Technology Commission (cstc2018jcyjAX0829).

  2. Author contributions: PW designed the study and edited the manuscript. MW, ML, JZ, and LX performed the experiments and analyzed the data. MW wrote the original draft. All authors read and approved the final manuscript.

  3. Conflict of interest: The authors have no conflict of interest to declare.

  4. Data availability statement: The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Appendix

Figure A1 Effect of MAPK inhibitor concentration on PDLSCs cell viability.
Figure A1

Effect of MAPK inhibitor concentration on PDLSCs cell viability.

Figure A2 A workflow chart of the experiment.
Figure A2

A workflow chart of the experiment.

References

[1] Kinane DF, Stathopoulou PG, Papapanou PN. Periodontal diseases. Nat Rev Dis Primers. 2017;3:17038. 10.1038/nrdp.2017.38.Search in Google Scholar PubMed

[2] Pihlstrom BL, Michalowicz BS, Johnson NW. Periodontal diseases. Lancet (London, Engl). 2005;366(9499):1809–20. 10.1016/s0140-6736(05)67728-8.Search in Google Scholar PubMed

[3] Hernández-Monjaraz B, Santiago-Osorio E, Monroy-García A, Ledesma-Martínez E, Mendoza-Núñez VM. Mesenchymal stem cells of dental origin for inducing tissue regeneration in periodontitis: A mini-review. Int J Mol Sci. 2018;19(4):944. 10.3390/ijms19040944.Search in Google Scholar PubMed PubMed Central

[4] Dave JR, Tomar GB. Dental tissue-derived mesenchymal stem cells: Applications in tissue engineering. Crit Rev Biomed Eng. 2018;46(5):429–68. 10.1615/CritRevBiomedEng.2018027342.Search in Google Scholar PubMed

[5] Zhu W, Liang M. Periodontal ligament stem cells: Current status, concerns, and future prospects. Stem Cell Int. 2015;2015:972313. 10.1155/2015/972313.Search in Google Scholar PubMed PubMed Central

[6] Ziukaite L, Slot D, Van der Weijden F. Prevalence of diabetes mellitus in people clinically diagnosed with periodontitis: A systematic review and meta-analysis of epidemiologic studies. J Clin Periodontol. 2018;45(6):650–62. 10.1111/jcpe.12839.Search in Google Scholar PubMed

[7] Lalla E, Papapanou PN. Diabetes mellitus and periodontitis: A tale of two common interrelated diseases. Nat Rev Endocrinol. 2011;7(12):738–48. 10.1038/nrendo.2011.106.Search in Google Scholar PubMed

[8] Graves DT, Ding Z, Yang Y. The impact of diabetes on periodontal diseases. Periodontol 2000. 2020;82(1):214–24. 10.1111/prd.12318.Search in Google Scholar PubMed

[9] Mathew JE, Jacob JJ, Kalra S. Periodontitis management in diabetes care. J Pak Med Assoc. 2021;71(8):2097–9.Search in Google Scholar

[10] Holst JJ. The physiology of glucagon-like peptide 1. Physiol Rev. 2007;87(4):1409–39. 10.1152/physrev.00034.2006.Search in Google Scholar PubMed

[11] Escalada FJ. The physiology of glucagon-like peptide-1 and its role in the pathophysiology of type 2 diabetes mellitus. Med Clin. 2014;143(Suppl 2):2–7. 10.1016/s0025-7753(14)70101-0.Search in Google Scholar PubMed

[12] Feng Y, Su L, Zhong X, Guohong W, Xiao H, Li Y, et al. Exendin-4 promotes proliferation and differentiation of MC3T3-E1 osteoblasts by MAPKs activation. J Mol Endocrinol. 2016;56(3):189–99. 10.1530/jme-15-0264.Search in Google Scholar

[13] Meng J, Ma X, Wang N, Jia M, Bi L, Wang Y, et al. Activation of GLP-1 receptor promotes bone marrow stromal cell osteogenic differentiation through β-catenin. Stem Cell Rep. 2016;6(4):579–91. 10.1016/j.stemcr.2016.02.002.Search in Google Scholar

[14] Ma X, Meng J, Jia M, Bi L, Zhou Y, Wang Y, et al. Exendin-4, a glucagon-like peptide-1 receptor agonist, prevents osteopenia by promoting bone formation and suppressing bone resorption in aged ovariectomized rats. J Bone Min Res. 2013;28(7):1641–52. 10.1002/jbmr.1898.Search in Google Scholar

[15] Liang QY, Du LQ, Zhang R, Ding T, Ge SH. Effects of exenatide-4 on proliferation, migration and osteogenic differentiation of human periodontal ligament stem cells. Shanghai kou qiang yi xue = Shanghai J Stomatol. 2020;29(3):225–30.Search in Google Scholar

[16] Guo Z, Chen R, Zhang F, Ding M, Wang P. Exendin-4 relieves the inhibitory effects of high glucose on the proliferation and osteoblastic differentiation of periodontal ligament stem cells. Arch Oral Biol. 2018;91:9–16. 10.1016/j.archoralbio.2018.03.014.Search in Google Scholar

[17] Greenblatt MB, Shim JH, Glimcher LH. Mitogen-activated protein kinase pathways in osteoblasts. Annu Rev Cell Dev Biol. 2013;29:63–79. 10.1146/annurev-cellbio-101512-122347.Search in Google Scholar

[18] Kim JH, Liu X, Wang J, Chen X, Zhang H, Kim SH, et al. Wnt signaling in bone formation and its therapeutic potential for bone diseases. Ther Adv Musculoskelet Dis. 2013;5(1):13–31. 10.1177/1759720x12466608.Search in Google Scholar

[19] Kim JY, Lee SK, Jo KJ, Song DY, Lim DM, Park KY, et al. Exendin-4 increases bone mineral density in type 2 diabetic OLETF rats potentially through the down-regulation of SOST/sclerostin in osteocytes. Life Sci. 2013;92(10):533–40. 10.1016/j.lfs.2013.01.001.Search in Google Scholar

[20] Wu YY, Xiao E, Graves DT. Diabetes mellitus related bone metabolism and periodontal disease. Int J Oral Sci. 2015;7(2):63–72. 10.1038/ijos.2015.2.Search in Google Scholar

[21] de Pollak C, Arnaud E, Renier D, Marie PJ. Age-related changes in bone formation, osteoblastic cell proliferation, and differentiation during postnatal osteogenesis in human calvaria. J Cell Biochem. 1997;64(1):128–39.10.1002/(SICI)1097-4644(199701)64:1<128::AID-JCB15>3.0.CO;2-HSearch in Google Scholar

[22] Douglas TEL, Vandrovcová M, Kročilová N, Keppler JK, Zárubová J, Skirtach AG, et al. Application of whey protein isolate in bone regeneration: Effects on growth and osteogenic differentiation of bone-forming cells. J Dairy Sci. 2018;101(1):28–36. 10.3168/jds.2017-13119.Search in Google Scholar

[23] Nakashima K, Zhou X, Kunkel G, Zhang Z, Deng JM, Behringer RR, et al. The novel zinc finger-containing transcription factor osterix is required for osteoblast differentiation and bone formation. Cell. 2002;108(1):17–29. 10.1016/s0092-8674(01)00622-5.Search in Google Scholar PubMed

[24] Nuche-Berenguer B, Lozano D, Gutiérrez-Rojas I, Moreno P, Mariñoso ML, Esbrit P, et al. GLP-1 and exendin-4 can reverse hyperlipidic-related osteopenia. J Endocrinol. 2011;209(2):203–10. 10.1530/joe-11-0015.Search in Google Scholar

[25] Sasaki S, Miyatsuka T, Matsuoka TA, Takahara M, Yamamoto Y, Yasuda T, et al. Activation of GLP-1 and gastrin signalling induces in vivo reprogramming of pancreatic exocrine cells into beta cells in mice. Diabetologia. 2015;58(11):2582–91. 10.1007/s00125-015-3728-z.Search in Google Scholar PubMed

[26] Hare KJ, Knop FK, Asmar M, Madsbad S, Deacon CF, Holst JJ, et al. Preserved inhibitory potency of GLP-1 on glucagon secretion in type 2 diabetes mellitus. J Clin Endocrinol Metab. 2009;94(12):4679–87. 10.1210/jc.2009-0921.Search in Google Scholar PubMed

[27] He J, Wang C, Sun Y, Lu B, Cui J, Dong N, et al. Exendin-4 protects bone marrow-derived mesenchymal stem cells against oxygen/glucose and serum deprivation-induced apoptosis through the activation of the cAMP/PKA signaling pathway and the attenuation of ER stress. Int J Mol Med. 2016;37(4):889–900. 10.3892/ijmm.2016.2509.Search in Google Scholar PubMed PubMed Central

[28] Deng B, Zhu W, Duan Y, Hu Y, Chen X, Song S, et al. Exendin‑4 promotes osteogenic differentiation of adipose‑derived stem cells and facilitates bone repair. Mol Med Rep. 2019;20(6):4933–42. 10.3892/mmr.2019.10764.Search in Google Scholar PubMed PubMed Central

[29] Liang X, So YH, Cui J, Ma K, Xu X, Zhao Y, et al. The low-dose ionizing radiation stimulates cell proliferation via activation of the MAPK/ERK pathway in rat cultured mesenchymal stem cells. J Radiat Res. 2011;52(3):380–6. 10.1269/jrr.10121.Search in Google Scholar PubMed

[30] Fu L, Tang T, Miao Y, Zhang S, Qu Z, Dai K. Stimulation of osteogenic differentiation and inhibition of adipogenic differentiation in bone marrow stromal cells by alendronate via ERK and JNK activation. Bone. 2008;43(1):40–7. 10.1016/j.bone.2008.03.008.Search in Google Scholar PubMed

[31] Wang Y, Luo S, Zhang D, Qu X, Tan Y. Sika pilose antler type I collagen promotes BMSC differentiation via the ERK1/2 and p38-MAPK signal pathways. Pharm Biol. 2017;55(1):2196–204. 10.1080/13880209.2017.1397177.Search in Google Scholar PubMed PubMed Central

[32] Choi YH, Gu YM, Oh JW, Lee KY. Osterix is regulated by Erk1/2 during osteoblast differentiation. Biochem Biophys Res Commun. 2011;415(3):472–8. 10.1016/j.bbrc.2011.10.097.Search in Google Scholar PubMed

[33] Wu X, Li S, Xue P, Li Y. Liraglutide, a glucagon-like peptide-1 receptor agonist, facilitates osteogenic proliferation and differentiation in MC3T3-E1 cells through phosphoinositide 3-kinase (PI3K)/protein kinase B (AKT), extracellular signal-related kinase (ERK)1/2, and cAMP/protein kinase A (PKA) signaling pathways involving beta-catenin. Exp Cell Res. 2017;360(2):281–91. 10.1016/j.yexcr.2017.09.018.Search in Google Scholar PubMed

[34] He L, Wong C, Cheung K, Yau H, Fu A, Zhao H, et al. Anti-inflammatory effects of exendin-4, a glucagon-like peptide-1 analog, on human peripheral lymphocytes in patients with type 2 diabetes. J Diabetes Invest. 2013;4(4):382–92. 10.1111/jdi.12063.Search in Google Scholar PubMed PubMed Central

[35] González N, Acitores A, Sancho V, Valverde I, Villanueva-Peñacarrillo M. Effect of GLP-1 on glucose transport and its cell signalling in human myocytes. Regul Pept. 2005;126(3):203–11. 10.1016/j.regpep.2004.10.002.Search in Google Scholar PubMed

[36] Sancho V, Nuche B, Arnés L, Cancelas J, González N, Díaz-Miguel M, et al. The action of GLP-1 and exendins upon glucose transport in normal human adipocytes, and on kinase activity as compared to morbidly obese patients. Int J Mol Med. 2007;19(6):961–6.10.3892/ijmm.19.6.961Search in Google Scholar

[37] Chen Y, Wang E, Sun Z, Song Z, Ye Z, Zhang Z. P38 MAPK inhibitor SB203580 attenuates the toxicity of ropivacaine on PC12 cells. Zhong nan da xue xue bao Yi xue ban = J Cent South Univ Med Sci. 2019;44(9):985–9. 10.11817/j.issn.1672-7347.2019.180602.Search in Google Scholar PubMed

[38] Alessi DR, Cuenda A, Cohen P, Dudley DT, Saltiel AR. PD 098059 is a specific inhibitor of the activation of mitogen-activated protein kinase kinase in vitro and in vivo. J Biol Chem. 1995;270(46):27489–94. 10.1074/jbc.270.46.27489.Search in Google Scholar PubMed

[39] Bennett BL, Sasaki DT, Murray BW, O’Leary EC, Sakata ST, Xu W, et al. SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase. Proc Natl Acad Sci U S A. 2001;98(24):13681–6. 10.1073/pnas.251194298.Search in Google Scholar PubMed PubMed Central

[40] Yuan H, Zhang X, Huang X, Lu Y, Tang W, Man Y, et al. NADPH oxidase 2-derived reactive oxygen species mediate FFAs-induced dysfunction and apoptosis of β-cells via JNK, p38 MAPK and p53 pathways. PLoS One. 2010;5(12):e15726. 10.1371/journal.pone.0015726.Search in Google Scholar PubMed PubMed Central

[41] Wang X, Liu JZ, Hu JX, Wu H, Li YL, Chen HL, et al. ROS-activated p38 MAPK/ERK-Akt cascade plays a central role in palmitic acid-stimulated hepatocyte proliferation. Free Radic Biol Med. 2011;51(2):539–51. 10.1016/j.freeradbiomed.2011.04.019.Search in Google Scholar PubMed

[42] Bigarella C, Liang R, Ghaffari S. Stem cells and the impact of ROS signaling. Development. 2014;141:4206–18.10.1242/dev.107086Search in Google Scholar PubMed PubMed Central

[43] Nusse R. Wnt signaling and stem cell control. Cell Res. 2008;18(5):523–7. 10.1038/cr.2008.47.Search in Google Scholar PubMed

[44] Katoh M, Katoh M. WNT signaling pathway and stem cell signaling network. Clin Cancer Research Off J Am Assoc Cancer Res. 2007;13(14):4042–5. 10.1158/1078-0432.Ccr-06-2316.Search in Google Scholar

[45] Gaur T, Lengner CJ, Hovhannisyan H, Bhat RA, Bodine PV, Komm BS, et al. Canonical WNT signaling promotes osteogenesis by directly stimulating Runx2 gene expression. J Biol Chem. 2005;280(39):33132–40. 10.1074/jbc.M500608200.Search in Google Scholar PubMed

[46] Hamidouche Z, Haÿ E, Vaudin P, Charbord P, Schüle R, Marie PJ, et al. FHL2 mediates dexamethasone-induced mesenchymal cell differentiation into osteoblasts by activating Wnt/beta-catenin signaling-dependent Runx2 expression. FASEB J Off Publ Fed Am Soc Exp Biol. 2008;22(11):3813–22. 10.1096/fj.08-106302.Search in Google Scholar PubMed

Received: 2022-10-06
Revised: 2023-03-01
Accepted: 2023-03-14
Published Online: 2023-04-06

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
https://doi.org/10.1515/med-2023-0692
Keywords for this article
Exendin-4; osteogenic differentiation; PDLSCs; high glucose; MAPK signaling; WNT signaling
Creative Commons
BY 4.0

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Sign up now to receive a 20% welcome discount
Institutional Access
How does access work?
Have an idea on how to improve our website?
Please write us.
© 2025 De Gruyter Brill
Downloaded on 9.9.2025 from https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0692/html
Scroll to top button