Home Medicine Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
Article Open Access

Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3

  • , , and EMAIL logo
Published/Copyright: April 10, 2023

Abstract

Considering the role of glycolysis inhibition as a novel therapeutic strategy for cancer, including breast cancer (BC), we wondered whether glycolysis could affect BC progression by regulating transmembrane O-mannosyltransferase-targeting cadherins 3 (TMTC3). Following the intervention, lactic acid production in BC cells was monitored, and viability, proliferation, and apoptosis assays were performed. The expressions of TMTC3 and endoplasmic reticulum (ER) stress- and apoptosis-related factors Caspase-12, C/EBP homologous protein (CHOP), glucose-regulated protein 78 (GRP78), B-cell lymphoma-2 (Bcl-2), and Bcl-2 associated X (Bax) were quantified. TMTC3 was lowly expressed in BC tissue and cell. The promotion of glycolysis via glucose represses TMTC3 expression and apoptosis yet enhances lactic acid production and growth of BC cell, along with promoted levels of Caspase-12, CHOP, GRP78, and Bcl-2 yet repressed level of Bax, while the contrary results were evidenced after 2-deoxyglycouse intervention. Overexpressed TMTC3 additionally abrogated the effects of glycolysis on increasing the viability and proliferation yet inhibiting the apoptosis of BC cells, with the increased expressions of Caspase-12, CHOP, and GRP78, and Bcl-2 yet decreased level of Bax. Collectively, inhibiting glycolysis restrained the growth and attenuated the ER stress of BC cell by regulating TMTC3.

1 Introduction

As a heterogenous disease where both genetic and environmental factors are involved, breast cancer (BC), currently, is the leading cause of cancer-associated burden for women along with a continuing increase in the incidence, despite the progression of and devotion to laboratory, epidemiological, and clinical research studies [1,2]. At present, therapeutic strategies for BC mainly include surgical operation, chemotherapy, endocrinotherapy, and molecular-targeted therapy [3]. However, some undesired effects have been demonstrated to emerge as well with the development of resistance to drug and radiation [4]. In addition, due to the technical challenges, the clinical practice of gene therapy is still at its infancy [5]. Therefore, further viable therapeutic options are urgently required for the treatment of BC in clinical practice.

Cancer cells have been proposed to have a different metabolism compared with that of normal cells from which they are derived, and the elevated metabolism has allowed them to sustain higher proliferative rate and resist the cell death signals, as indicated by the capability of utilizing glycolysis as their primary metabolic mode, even in the presence of sufficient oxygen [6]. Such phenomenon is termed as Warburg effect or aerobic glycolysis. Aerobic glycolysis is a crucial metabolic adaptation of cancer cells. Frequently witnessed in cancers, aerobic glycolysis is one of the earliest known evidence related to the metabolic alteration in the neoplasms (including BC) and has been scientifically recognized as a hallmark for the metabolism in the cancer cells, the targeting of which may be contributory to providing therapeutic strategies for cancer [7,8,9]. In addition, aberrant glycolysis is commonly associated with drug resistance in cancer treatment; therefore, targeting glycolysis may be a novel strategy to develop new drugs to benefit patients with drug resistance [10,11].

Aerobic glycolysis can regulate BC proliferation and cell survival. Tang et al. reported that glycolysis-related genes (PRKACB, STMN1, and ZNF292) might provide an effective prognostic predictor for individualized management of BC patients [12]. In BC, transcription factor SIX1 directly increases the expression of many glycolytic genes, promoting the Warburg effect and tumor growth in vitro and in vivo [9]. Betulinic acid suppresses BC metastasis by targeting GRP78-mediated glycolysis and endoplasmic reticulum (ER) stress apoptotic pathway [13]. Targeting the function of the glucose metabolism might be a promising therapeutic strategy for BC. Nevertheless, the intrinsic mechanism concerning the effects of aerobic glycolysis in BC remains inadequately understood, making it critical to further identify the initial oncogenic signaling so as to develop some viable strategies for the inhibition of glycolysis [14].

Transmembrane O-mannosyltransferase-targeting cadherins 3 (TMTC3) is a member of four ER transmembrane O-mannosyltransferases, each of which is characterized by the existence of four repeats in the tetratricopeptides [15]. Recent discoveries have unveiled that TMTC3 contributes to the O-mannosylation of E-cadherin, the cellular adherence, and the embryonic gastrulation [16]. Dysregulation of glycosylation is one of the important mechanisms leading to tumor heterogeneity [17]. The abnormal expression of glycosyltransferase and its glycan structure are the common features of the occurrence, development, and metastasis of malignant tumors [18]. ER stress is involved in the processes of cellular interactions with the tumor microenvironment, affecting tumor malignant growth, angiogenesis, and progression [19,20,21]. In addition, the participation of TMTC3 in ER stress response has been pointed out as well, together with the modulation on the activity of proteasome and the expression of transcript X-box binding protein 1 [22]. What makes us curious is the discovery addressing the implication of TMTC3 in BC [23].

Based on the above information, we wondered whether glycolysis could affect BC progression by regulating TMTC3. In this study, we explored the interaction between the glycolysis and TMTC3 in BC, the results of which are reported as follows.

2 Materials and methods

2.1 Bioinformatics analysis

In order to sort the candidate gene for our study, we downloaded the data from the datasets GSE110960 (effect of restricted glycolysis on gene expression in MCF-7 cells) and GSE111204 (effect of restricted glycolysis on gene expression in MDA-MB-231 cells) from Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo/).

The common differentially expressed genes (DEGs) were sorted using GEO2R (https://www.ncbi.nlm.nih.gov/geo/geo2r/), and a Venn diagram was subsequently drawn to identify the common DEGs using Venny online software (version 2.1.0, http://bioinfogp.cnb.csic.es/tools/venny/).

2.2 Clinical sample collection

To determine the role of TMTC3 played in BC, 30 paired cancer (defined as “Tumor”) and adjacent tissues (defined as “Normal”) were collected from the Department of Pathology in China−Japan Union Hospital of Jilin University, all of which were harvested from patients admitted from February 2019 to January 2020. All tissues collected were rinsed with saline (IN9000, Solarbio Lifesciences, China) and snap frozen in liquid nitrogen as appropriate.

2.3 Cell culture

All cell lines and the materials used for cell culture were ordered from Procell (Wuhan, China, https://www.procell.com.cn/) unless specified otherwise. Human breast epithelial cell MCF-10A (CL-0525) and BC cell lines MCF-7 (CL-0149), MDA-MB-231 (CL-0150), MDA-MB-436 (CL-0383), and SK-BR-3 (CL-0211) were ordered and cultured as needed.

MCF-10A cells were maintained in Dulbecco’s modified Eagle’s medium/F12 medium (PM150312) blended with 5% horse serum (164215), 20 ng/mL of epidermal growth factor (P00033, Solarbio Lifesciences, China), 0.5 μg/mL of hydrocortisone (G8450, Solarbio Lifesciences, China), 10 μg/mL of insulin (I8830, Solarbio Lifesciences, China), 1% non-essential amino acid (PB180424), and 1% penicillin−streptomycin (PB180120). MCF-7 cell was cultured in minimum essential medium (PM150140) with 0.01 mg/mL of insulin. Leibovitz’s L-15 medium (PM151010) was used to ensure the growth of MDA-MB-231 and MDA-MB-436 cells. SK-BR-3 cell was grown in McCoy’s 5A medium (PM150710). All media for BC cells were supplemented with 10% fetal bovine serum (164210) and 1% penicillin−streptomycin.

All cells were finally incubated in the Sanyo MCO-18AIC(UV) CO2 incubator (SA-MC018, Marshall Scientific, LLC., Hampton, NH, USA) at 37°C and 5% CO2. As TMTC3 was lowly expressed in MCF-7 and MDA-MB-231 cells, these two cells were used for subsequent studies.

2.4 Cell treatment and transfection

For cell treatment, both MCF-7 and MDA-MB-231 cells were cultured in the following manner: cells in the control group were cultured normally with no supplementation, while those in the glucose and 2-deoxyglucose groups were cultured in the medium with the supplementation of glucose (10 mM, G8150, Solarbio Lifesciences, China) and 2-deoxyglucose (50 mM, D8930, Solarbio Lifesciences, China), respectively [24].

For transfection, TMTC3 overexpression plasmid was constructed based on the vector pcDNA 3.1 (V790-20, Invitrogen, Carlsbad, CA, USA), and the empty pcDNA 3.1 was used as the negative control (NC).

BC cells MCF-7 and MDA-MB-231 (1 × 106 cells/well) were first seeded in a six-well plate with complete medium at 37°C and 5% CO2 to be 90% confluent at the time point of transfection. Then, the transfection on both MCF-7 and MDA-MB-231 cells were successfully performed with the help of lipofectamine 2000 transfection reagent (11668-030, Invitrogen, USA) as per the protocols of the manufacturer. After 48 h, all cells were harvested for subsequent studies.

2.5 Lactic acid production determination assay

All procedures of lactic acid production assay were repeated as illustrated previously [25]. The concentration of lactic acid in the harvested lysates was determined using a lactate assay kit (D799851, Sangon Biotech, Shanghai, China) in accordance with the protocols of the manufacturer. MCF-7 and MDA-MB-231 cells (5 × 105 cells/well) with or without transfection were cultured in six-well plates and resuspended in extraction buffer I, followed by lysis at a power of 300 W for 3  min in total (3  s of ultrasonication, at an interval of 7 s) using an XC-II D ultrasonic cell crusher (Nanjing Ningkai Instrument Co., Ltd, Nanjing, China). The lysates were harvested after centrifugation at 12,000 × g at 4°C for 10 min in a 5810 Centrifuge (Eppendorf, Hamburg, Germany). A volume of 0.8 mL of the supernatant was collected and added with 0.15 mL of extraction buffer II, followed by another centrifugation at 12,000 × g at 4°C for 10 min. The absorbance at 570 nm was monitored by Varioskan LUX multimode microplate reader (VLBLATD2; ThermoFisher Scientific, Waltham, MA, USA).

2.6 Cell-Counting Kit-8 (CCK-8) assay

MCF-7 and MDA-MB-231 cells (2 × 103 cells/well) with different intervention were cultured within 96-well plates at 37°C and 5% CO2 for 24 and 48 h, and 10 μL of CCK-8 solution (CA1210; Solarbio Lifesciences, China) was added into each well of the plates for a further 4-h incubation in the incubator. The optical density (OD) value was measured using Varioskan LUX multimode microplate reader at an absorbance of 450 nm.

Then, the cell viability was calculated using the following formula:

Cell viability ( % ) = OD dosage OD blank OD no dosage OD blank × 100 % .

The ODdosage represented the OD value of the wells containing transfected and treated cells and CCK-8 reagent, ODblank symbolized the OD value of the wells with the medium and CCK-8 reagent only, and ODno dosage was the OD value of the wells to which untransfected or untreated cells were added.

2.7 Colony formation assay

Following the intervention as needed, MCF-7 and MDA-MB-231 cells (1 × 103 cells/well) were seeded in six-well plates at 37°C and 5% CO2 for 14 days, and the colonies formed were fixed with 4% paraformaldehyde (P1110; Solarbio Lifesciences, China) for 15 min and stained with crystal violet (C8470; Solarbio Lifesciences, China) for 30 min. All colonies formed were then observed and photographed using a digital camera (OM-D E-M5 Mark III; Olympus, Tokyo, Japan). The colony formation rates of cells in each group were calculated by the software SigmaPlot 12.0 (Systat Software, Inc., San Jose, CA, USA).

2.8 Flow cytometry assay

We collected 1 × 106 transfected MCF-7 and MDA-MB-231 cells, washed with phosphate buffered saline (P1010; Solarbio Lifesciences, China) and suspended using 1 mL of binding buffer (1×), followed by centrifugation at 300 × g in a 5810 Centrifuge. The supernatant was abandoned subsequently. All cells were then resuspended with 1 mL of binding buffer (1×), and the density was adjusted to 1 × 106 cells/mL. A volume of 100 μL of cells suspension was added into each tube, and 5 μL of Annexin V-FITC was also added. A gentle blend was performed at room temperature (RT) for 5 min avoiding light, after which 5 μL of propidium iodide (PI) was added into the tube and all cells were additionally incubated at RT for 5 min in the dark. The apoptosis was detected using an Annexin V-FITC/PI apoptosis detection kit (CA1020, Solarbio Lifesciences, China) using a S1000EON flow cytometer (Stratedigm, Inc., San Jose, CA, USA), and all data were analyzed using Kaluza C Analysis Software 1.12 (Beckman Coulter, Indianapolis, IN, USA).

2.9 RNA isolation and reverse-transcription quantitative PCR

Total RNA in tissues (both tumor and normal) and cells (BC cells and human breast epithelial cell MCF-10A) was isolated using a total RNA extraction reagent (R1100; Solarbio Lifesciences, China) as guided by the manufacturer, and all isolated RNA samples were preserved in −80°C. The measurement on the isolated RNA was conducted in the NanoDrop lite spectrophotometer (ND-LITE; ThermoFisher Scientific, USA). All procedures of PCR were then performed by a one-Step RT-PCR kit (T2210; Solarbio Lifesciences, China) and operated in CFX384 Touch real-time PCR system (Bio-Rad, Hercules, CA, USA) under the following detailed conditions: 50°C for 20 min for reverse transcription, 95°C for 3 min for pre-denaturation, followed by 40 cycles of 95°C for 15 s for denaturation, and 60°C for 25 s for final extension.

Relative expressions were quantified using the 2−ΔΔCT method, with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the internal reference [26]. The sequences of primers are listed in Table 1.

Table 1

Primer for quantitative real-time PCR

Gene Forward primer Reverse primer
TMTC3 ATAGTAGGTGTGGTTACTGC AATACTGTTAAGGGACGGTA
GAPDH CCTCAACTACATGGTTTACA TGTTGTCATACTTCTCATGG

2.10 Western blot

Relative protein expression was calculated using western blot as confirmed in a previous study [27]. All materials used were the products of Elabsciences (Wuhan, China) unless specified. Total protein in transfected MCF-7 and MDA-MB-231 cells was lysed and extracted using radio-immunoprecipitation assay lysis buffer (E-BC-R327), and the concentration was quantified using bicinchoninic acid (BCA) method with a BCA protein kit (E-BC-K318). A volume of 20 μL of protein lysates was electrophoresed with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (E-IR-R305) and quickly transferred into polyvinylidene fluoride membrane (E-BC-R266). Then the membrane was blocked by 5% skimmed milk at RT for 2 h and incubated in primary and secondary antibodies (the condition for the incubation with the primary antibodies was 4°C overnight and that for secondary antibodies was RT for 1 h).

For subsequent procedures of visualization, the membrane was rinsed using tris-buffer saline tween (E-BC-R335) three times, and was visualized using an enhanced chemiluminescent substrate detection kit (E-BC-R347) within an imaging system (Tanon 5200CE, Tanon, Shanghai, China), and gray values of each band were calculated by ImageJ 5.0 (Bio-Rad, USA).

The primary antibodies (Abcam, Cambridge, UK) used here were those against Caspase-12 (ab62484, 42 kDa), C/EBP homologous protein (CHOP, ab11419, 31 kDa), glucose-regulated protein 78 (GRP78, ab21685, 75 kDa), B-cell lymphoma-2 (Bcl-2, ab182858, 26 kDa), Bcl-2 associated X (Bax, ab32503, 21 kDa), and housekeeping control GAPDH (ab8245, 36 kDa), and the secondary antibodies were the horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (E-AB-1003) and HRP-conjugated goat anti-mouse IgG (E-AB-1001). All antibodies (both primary and secondary) were diluted to a ratio of 1:2,000 for our current study.

2.11 Statistical analyses

All statistical analyses were implemented with Graphpad Prism 8.0 (GraphPad, Inc., La Jolla, CA, USA), where all data were the indication of three independent tests and expressed as mean ± standard deviation (SD). Statistical significance, which was determined with one-way analysis of variance followed by Bonferroni post hoc test and paired t test as appropriate, was defined when p-value was lower than 0.05.

  1. Ethics statement: The ethics committee of China−Japan Union Hospital of Jilin University has carefully reviewed and approved the conduction of our study (endorse number: 2021-KYLL-030008). Meanwhile, all recruited patients have signed the informed consent in written form and agreed to the usage of their tissues in our study.

3 Results

3.1 TMTC3 was lowly expressed in BC tissue and cell

To sort the candidate gene for our study, we first downloaded the datasets of GSE110960 (effect of restricted glycolysis on gene expression in MCF-7 cells) and GSE111204 (effect of restricted glycolysis on gene expression in MDA-MB-231 cells) from GEO. A Venn diagram was subsequently drawn to sort the common DEGs, 12 of which were then identified, including TMTC3 (Figure 1a). TMTC3 contributes to the O-mannosylation of E-cadherin, and dysregulation of glycosylation is one of the important mechanisms leading to tumor heterogeneity; in addition, TMTC3 is involved in the regulation of ERS, and ERS affected the malignant growth and progression of tumors. Thus, TMTC3 was used for our studies.

Figure 1 
                  TMTC3 was lowly expressed in BC tissue and cell. (a) Dataset GSE110960 (effect of restricted glycolysis on gene expression in MCF-7 cells) and GSE111204 (effect of restricted glycolysis on gene expression in MDA-MB-231 cells) were used to sort the candidate gene for our study, which was available from GEO (https://www.ncbi.nlm.nih.gov/geo/). A Venn diagram was drawn based on the results. (b) Relative TMTC3 expression in BC (tumor) and adjacent (normal) tissue was calculated via reverse-transcription quantitative PCR (n = 30 for each group). GAPDH was used as the internal control. (c) Relative TMTC3 expression in BC cells (MCF-7, MDA-MB-231, MDA-MB-436, and SK-BR-3) and breast epithelial cell MCF-10A was quantified with reverse-transcription quantitative PCR. GAPDH was used as the internal control. All data were expressed as mean ± SD, which was indicative of three independent tests. ***
                     p < 0.001, vs MCF-10A. TMTC3: transmembrane O-mannosyltransferase targeting cadherins 3; BC: breast cancer.
Figure 1

TMTC3 was lowly expressed in BC tissue and cell. (a) Dataset GSE110960 (effect of restricted glycolysis on gene expression in MCF-7 cells) and GSE111204 (effect of restricted glycolysis on gene expression in MDA-MB-231 cells) were used to sort the candidate gene for our study, which was available from GEO (https://www.ncbi.nlm.nih.gov/geo/). A Venn diagram was drawn based on the results. (b) Relative TMTC3 expression in BC (tumor) and adjacent (normal) tissue was calculated via reverse-transcription quantitative PCR (n = 30 for each group). GAPDH was used as the internal control. (c) Relative TMTC3 expression in BC cells (MCF-7, MDA-MB-231, MDA-MB-436, and SK-BR-3) and breast epithelial cell MCF-10A was quantified with reverse-transcription quantitative PCR. GAPDH was used as the internal control. All data were expressed as mean ± SD, which was indicative of three independent tests. *** p < 0.001, vs MCF-10A. TMTC3: transmembrane O-mannosyltransferase targeting cadherins 3; BC: breast cancer.

Then we measured TMTC3 expression in both BC and adjacent tissue, and a low TMTC3 expression was evidenced in BC tissue (Figure 1b, p < 0.001). Likewise, we also detected the expression of TMTC3 in BC cells and breast epithelial cell MCF-10A, and the result showed that TMTC3 expression was lower in BC cells (MCF-7, MDA-MB-231, MDA-MB-436, SK-BR-3) than that in MCF-10A cells (Figure 1c, p < 0.001). Among these BC cells, TMTC3 expression in MCF-7 and MDA-MB-231 cells was lower than other BC cells, and thus these two cells were used for our subsequent studies.

3.2 Glycolysis promotion represses TMTC3 expression yet enhances lactic acid production and growth of BC cell, while inhibition elicited contrary results

For subsequent procedures, we cultured both MCF-7 and MDA-MB-231 cells in their respective media supplemented with glycose or 2-deoxyglucose, which have been suggested to promote or repress glycolysis [24]. In the beginning, we measured TMTC3 expression in BC cells after the cells were cultured in the media supplemented with glycose or 2-deoxyglucose, and it was found that the expression of TMTC3 was repressed following the supplementation of glycose, whereas 2-deoxyglucose supplementation elevated TMTC3 expression in BC cells (Figure 2a, p < 0.01).

Figure 2 
                  Glycolysis promotion represses TMTC3 expression yet enhances the lactic acid production and growth of BC cell, while the inhibition did contrarily. (a) The effects of glucose (which promoted glycolysis) and 2-deoxyglucose (which repressed glycolysis) on TMTC3 expression in BC cells MCF-7 and MDA-MB-231 were confirmed with reverse-transcription quantitative PCR. GAPDH was used as internal control. (b–e) The effects of glucose and 2-deoxyglucose on lactic acid production (b), viability (c), proliferation (d), and apoptosis (e) of BC cells MCF-7 and MDA-MB-231 were evaluated via lactic acid production, CCK-8, colony formation and flow cytometry assays, respectively. All data were expressed as mean ± SD, which was indicative of three independent tests. *
                     p < 0.05, **
                     p < 0.01, ***
                     p < 0.001, vs control. OD: optical density.
Figure 2

Glycolysis promotion represses TMTC3 expression yet enhances the lactic acid production and growth of BC cell, while the inhibition did contrarily. (a) The effects of glucose (which promoted glycolysis) and 2-deoxyglucose (which repressed glycolysis) on TMTC3 expression in BC cells MCF-7 and MDA-MB-231 were confirmed with reverse-transcription quantitative PCR. GAPDH was used as internal control. (b–e) The effects of glucose and 2-deoxyglucose on lactic acid production (b), viability (c), proliferation (d), and apoptosis (e) of BC cells MCF-7 and MDA-MB-231 were evaluated via lactic acid production, CCK-8, colony formation and flow cytometry assays, respectively. All data were expressed as mean ± SD, which was indicative of three independent tests. * p < 0.05, ** p < 0.01, *** p < 0.001, vs control. OD: optical density.

Lactic acid was one of the end-products of aerobic glycolysis, which had both the capability to change the tumor microenvironment and an impact on cancer-associated cells [28]. It was also demonstrated that after the supplementation of glycose, the concentration of lactic acid in BC cells was evidently raised, while the additional supplementation of 2-deoxyglucose reduced the concentration of lactic acid (Figure 2b, p < 0.001). When it comes to viability (Figure 2c), proliferation (Figure 2d), and apoptosis (Figure 2e), it was discovered that the supplementation of glycose raised the viability and colony formation rate yet reduced apoptosis in BC cells (Figure 2c–e, P < 0.05); however, contrary results were displayed in the BC cells when the culture medium was added with 2-deoxyglucose. That is, the supplementation of 2-deoxyglucose decreased the viability at 24 and 48 h and colony formation rate yet increased apoptosis in BC cells (Figure 2c–e, p < 0.01). The aforementioned results suggested that promoting glycolysis using glucose represses TMTC3 expression yet enhances lactic acid production and growth in BC cells, whereas inhibiting glycolysis via 2-deoxyglucose increased TMTC3 expression yet repressed the growth of BC cells.

To additionally confirm the mechanisms, we measured the expressions of both ER stress- and apoptosis-related factors in BC cells, as evidenced by the interaction among ER stress, apoptosis, and glycolysis [29,30]. All ER stress-related factors, including Caspase-12, CHOP, and GRP78, and apoptosis-related factor Bcl-2 were promoted but another apoptosis-related factor Bax was suppressed in BC cells cultured in the medium with glucose (Figure 3a–f, p < 0.01). However, in those cells maintained in the medium with 2-deoxyglucose, the decreased levels on ER stress-related factors, including Caspase-12, CHOP, and GRP78, and apoptosis-related factor Bcl-2 were exhibited yet that of apoptosis-related factor Bax was increased (Figure 3a–f, p < 0.05).

Figure 3 
                  Glycolysis posed a regulatory effect on the expressions of factors related to both ER stress and apoptosis in BC cell. (a–f) The effects of glucose and 2-deoxyglucose on ER stress- and apoptosis-related factors (Caspase-12 (b), CHOP (c), GRP78 (d), Bcl-2 (e), and Bax (f)) in BC cells MCF-7 and MDA-MB-231 were unveiled with Western blot. GAPDH was used as internal control. All data were expressed as mean ± SD, which was indicative of three independent tests. *
                     p < 0.05, **
                     p < 0.01, ***
                     p < 0.001, vs control. ER: endoplasmic reticulum; CHOP: C/EBP homologous protein; GRP78: glucose-regulated protein 78; Bax: Bcl-2 associated X; Bcl-2: B-cell lymphoma-2.
Figure 3

Glycolysis posed a regulatory effect on the expressions of factors related to both ER stress and apoptosis in BC cell. (a–f) The effects of glucose and 2-deoxyglucose on ER stress- and apoptosis-related factors (Caspase-12 (b), CHOP (c), GRP78 (d), Bcl-2 (e), and Bax (f)) in BC cells MCF-7 and MDA-MB-231 were unveiled with Western blot. GAPDH was used as internal control. All data were expressed as mean ± SD, which was indicative of three independent tests. * p < 0.05, ** p < 0.01, *** p < 0.001, vs control. ER: endoplasmic reticulum; CHOP: C/EBP homologous protein; GRP78: glucose-regulated protein 78; Bax: Bcl-2 associated X; Bcl-2: B-cell lymphoma-2.

3.3 Overexpressed TMTC3 abrogated the effects of glycolysis in BC cells

To further confirm the interaction between glycolysis and TMTC3 in BC cells, we transfected TMTC3 overexpression plasmid into BC cells, which were subsequently cultured in the medium supplemented with glycose. The successful transfection was evidenced by the increased TMTC3 expression in BC cells which have been maintained in the medium with glycose (Figure 4a, p < 0.001). No evident effect on the lactic acid concentration in BC cells was displayed in BC cells following the transfection of TMTC3 overexpression plasmid (Figure 4b), whereas it was clear that TMTC3 overexpression decreased the viability and colony formation yet enhanced the apoptosis of BC cells cultured with glycose (Figure 4c–e, p < 0.01). Herein, we concluded that overexpressed TMTC3 could have abrogated the effects of glycolysis promotion on the malignant behaviors of BC cells.

Figure 4 
                  Overexpressed TMTC3 abrogated the effects of glycolysis. (a) The effects of glucose and TMTC3 on TMTC3 expression in BC cells MCF-7 and MDA-MB-231 were unveiled in accordance with the results of reverse-transcription quantitative PCR. GAPDH was used as internal control. (b–e) The effects of glucose and TMTC3 on the lactic acid production (b), viability (c), proliferation (d), and apoptosis (e) of BC cells MCF-7 and MDA-MB-231 were evaluated via lactic acid production, CCK-8, colony formation and flow cytometry assays, respectively. All data were expressed as mean ± SD, which was indicative of three independent tests. **
                     p < 0.01, ***
                     p < 0.001, vs glucose + NC. NC: negative control.
Figure 4

Overexpressed TMTC3 abrogated the effects of glycolysis. (a) The effects of glucose and TMTC3 on TMTC3 expression in BC cells MCF-7 and MDA-MB-231 were unveiled in accordance with the results of reverse-transcription quantitative PCR. GAPDH was used as internal control. (b–e) The effects of glucose and TMTC3 on the lactic acid production (b), viability (c), proliferation (d), and apoptosis (e) of BC cells MCF-7 and MDA-MB-231 were evaluated via lactic acid production, CCK-8, colony formation and flow cytometry assays, respectively. All data were expressed as mean ± SD, which was indicative of three independent tests. ** p < 0.01, *** p < 0.001, vs glucose + NC. NC: negative control.

As for the ER stress- and apoptosis-related factors, TMTC3 overexpression diminished the effects of glycose on promoting Caspase-12, CHOP, GRP78, and Bcl-2 yet repressing Bax in BC cells (Figure 5a–f, p < 0.001). The results thus suggested that TMTC3 overexpression reversed the regulatory effects of glycolysis on the ER stress- and apoptosis-related factors in BC cells.

Figure 5 
                  Both TMTC3 and glycolysis posed regulatory effects on the expressions of both ER stress- and apoptosis-related factors in BC cell. (a–f) The effects of glucose and TMTC3 on ER stress- and apoptosis-related factors (Caspase-12 (b), CHOP (c), GRP78 (d), Bcl-2 (e), and Bax (f)) in BC cells MCF-7 and MDA-MB-231 were unveiled with Western blot. GAPDH was used as internal control. All data were expressed as mean ± SD, which was indicative of three independent tests. ***
                     p < 0.001, vs glucose + NC.
Figure 5

Both TMTC3 and glycolysis posed regulatory effects on the expressions of both ER stress- and apoptosis-related factors in BC cell. (a–f) The effects of glucose and TMTC3 on ER stress- and apoptosis-related factors (Caspase-12 (b), CHOP (c), GRP78 (d), Bcl-2 (e), and Bax (f)) in BC cells MCF-7 and MDA-MB-231 were unveiled with Western blot. GAPDH was used as internal control. All data were expressed as mean ± SD, which was indicative of three independent tests. *** p < 0.001, vs glucose + NC.

4 Discussion

In this study, we investigated the effects of glycolysis and TMTC3 in BC. We found that glycolysis promoted the proliferation and ER stress but inhibited the apoptosis of BC cells by inhibiting TMTC3. This finding enriches the research on the mechanism of glycolysis in BC and provides a new therapeutic target for BC-targeted therapy.

Recent years have witnessed the emergence of cellular metabolism as a major biological node which governs the cellular behavior; multiple molecular mechanisms, both intrinsic and extrinsic, have been suggested to converge to alter the core cellular metabolism and provide support for the basic needs used for the division of cells [31,32]. The critical determinant role of cellular metabolism in the viability and function of cancer cells has been additionally addressed, and tumorigenesis is dependent on the reprogramming of cellular metabolism as the consequence of direct and indirect oncogenic mutations [33,34]. Different from the normal differentiated cells, which are primarily dependent on mitochondrial oxidative phosphorylation for the generation of the energy required for cellular process, cancer cells, instead, rely on the aerobic glycolysis [35]. For a long time, glycolysis has been seen as the major metabolic process for energy production and anabolic growth in cancer cells, and glycolytic inhibition in cancer cells has been considered as a novel strategy for overcoming the drug resistance related to mitochondrial respiratory defect and hypoxia [36,37]. Therefore, it is of great value to gain further and better understanding on the molecular mechanism of aerobic glycolysis so as to identify and recognize novel therapeutic targets for cancer [25]. The GRP78-mediated glycolysis in BC is shown to be targeted by betulinic acid, which represses the metastasis of BC, for instance [13]. In our current study, we also proposed that the inhibition of glycolysis with 2-deoxyglucose was associated with lactic acid production and repressed growth of BC cells, providing another evidence on the interaction between the inhibition of glycolysis and the repressive growth of BC cells.

Increasing evidence has also highlighted the regulation of aerobic glycolysis in the process of carcinogenesis, lactate production for carcinogenesis could be the propose and explanation for Warburg Effect [38,39]. As the end-product of aerobic glycolysis formed and utilized under the fully aerobic conditions, lactate is the fuel source for cancer cells to promote inflammation, angiogenesis, metastasis, immune evasion, etc. [40]. Meanwhile, the fundamental role of aerobic glycolysis in supporting cell growth and the use of aerobic glycolysis during rapid proliferation have been addressed in many cells at the same time, where aerobic glycolysis links the high glucose fermentation rate to the unrestrained proliferation and progression of cancer cells [41,42]. Glycolysis, additionally, can provide the “building blocks” for the macromolecule synthesis of proliferated cancer cells, including carbon skeletons, nicotinamide adenine dinucleotide phosphate, and adenosine triphosphate, which, in turn, rewires the metabolic pathway for the survival and growth of cancer cells [43]. Associated with the high glucose intake and lactate generation rate, glycolysis prevents the apoptosis of cancer cells due to the regulation of cellular metabolites on the function of pro- or anti-apoptotic proteins, which, in turn, control the metabolism via the limitation of glycolysis [30,44]. As one of the major protein families implicated in the regulation of cell death and aberrantly expressed in cancers, the Bcl-2 family of proteins is one of the critical mediators for the metabolic pathways [45]. The balance on the Bcl-2 family of proteins via glucose metabolism may be a pivotal aspect regarding how aerobic glycolysis leaves an effect on cell fate, providing evidence on the importance of the metabolic shift to the survival of cancer cells [45,46]. Several proteins from Bcl-2 family proteins, such as Mcl-1, NOXA, and Bad, have been shown to be involved in the reprogrammed metabolism in cancer cells [45]. In our current study, we also evidenced the interaction between glycolysis and the apoptosis of BC cells. Specifically, the promotion of glycolysis inhibits the apoptosis of BC cells, with the increased level of Bcl-2 yet the decreased expression of Bax, whereas the inhibition of aerobic glycolysis did conversely.

Furthermore, as a hallmark in multiple solid malignancies, ER stress, as well as its associated unfolded protein response, initiates multiple survival mechanisms in cancer cells, and a prior discovery has evidenced the implication of ER stress in Chromium (Cr)(vi)-induced glycolysis in lung carcinoma cell A549, where phenylbutyric acid, the inhibitor of ER stress, unleashes a repressive effect on Cr(vi)-induced glycolysis [47]. It is also shown that the administration of 2-deoxyglucose is associated with decreased cell viability and increased ER stress in neuroblastoma cells, with the upregulation on both ER molecular chaperone GRP78 and the pro-death protein CHOP [48]. A contrary result, however, was confirmed in our study, from which we discovered that the promotion of glycolysis using glucose enhanced the ER stress in BC cells, along with the upregulated levels of CHOP, GRP78, and Caspase-12 (a central caspase implicated in the ER stress-mediated apoptosis [49]), providing another evidence concerning the participation of ER stress in the progression of BC.

In accordance with the previous publications, the TMTC proteins are those located in the ER and predicted to be implicated in both calcium ion (Ca2+) regulation and protein folding [22,50]. Meanwhile, the biallelic TMTC3 mutations result in cobblestone lissencephaly, intellectual disability, and epilepsy, in addition to the highlight on its possible implication in BC [23,51,52]. In our current study, we not only reconfirmed the role of TMTC3 played in BC but also provided evidence regarding the possible interaction between TMTC3 and glycolysis. In other words, in addition to the confirmation suggesting the low expression of TMTC3 in BC, overexpressed TMTC3 abrogated the effects of glucose on promoting the growth of BC cells, along with the downregulation on glucose-induced increased Caspase-12, GRP78, and Bcl-2 expressions yet decreased Bax expression, thus emphasizing both the implication of TMTC3 and the interaction between TMTC3 and glycolysis in BC cells.

It should be noted that despite the confirmation on the implication of TMTC3 and the interaction between TMTC3 and glycolysis in BC, all results were concluded based on the experiments in vitro. The effects of TMTC3 in vivo were lack of an equivalent verification, which is one of the major shortcomings of our current study, making further validating studies required to complete the results of our study. In addition, whether glycolysis can affect the development of BC by regulating other genes needs to be a more comprehensive and in-depth study.

5 Conclusion

Taken together, we have provided another evidence concerning the implication of glycolysis in BC. Specifically, we confirm that the inhibition of glycolysis is associated with the repressed viability and proliferation but enhanced apoptosis in BC cells. In addition, we not only recognize the implication of TMTC3, a member of ER transmembrane O-mannosyltransferase, in BC, but also unveil the interaction between TMTC3 and glycolysis in BC. In addition, the overexpression of TMTC3 abolishes the effects of glucose on the growth and ER stress of BC cells. We hope the result from our current study can be used as the theoretical basis for the research on the possible participation of glycolysis and TMTC3 in BC, with a potentially viable therapeutic method for BC.


tel: +86-0431-84995999

Acknowledgments

Not applicable.

  1. Funding information: This work was supported by the China Postdoctoral Science Foundation Grant (No. 2019M651216).

  2. Conflict of interest: The authors declare no conflicts of interest.

  3. Author contributions: Xue Hu designed research and wrote the paper, Baoliang Guo and Tong Sun analyzed data, Wan Wang and Xue Hu performed research.

  4. Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.

References

[1] Barzaman K, Karami J, Zarei Z, Hosseinzadeh A, Kazemi MH, Moradi-Kalbolandi S, et al. Breast cancer: Biology, biomarkers, and treatments. Int Immunopharmacol. 2020;84:106535.10.1016/j.intimp.2020.106535Search in Google Scholar PubMed

[2] Britt KL, Cuzick J, Phillips KA. Key steps for effective breast cancer prevention. Nat Rev Cancer. 2020;20(8):417–36.10.1038/s41568-020-0266-xSearch in Google Scholar PubMed

[3] Yu LY, Tang J, Zhang CM, Zeng WJ, Yan H, Li MP, et al. New immunotherapy strategies in breast cancer. Int J Env Res Public Health. 2017;14(1):68.10.3390/ijerph14010068Search in Google Scholar PubMed PubMed Central

[4] Tomar D, Yadav AS, Kumar D, Bhadauriya G, Kundu GC. Non-coding RNAs as potential therapeutic targets in breast cancer. Biochim Biophys Acta Gene Regul Mech. 2020;1863(4):194378.10.1016/j.bbagrm.2019.04.005Search in Google Scholar PubMed

[5] Nastiuk KL, Krolewski JJ. Opportunities and challenges in combination gene cancer therapy. Adv Drug Deliv Rev. 2016;98:35–40.10.1016/j.addr.2015.12.005Search in Google Scholar PubMed PubMed Central

[6] Akins NS, Nielson TC, Le HV. Inhibition of glycolysis and glutaminolysis: An emerging drug discovery approach to combat cancer. Curr Top Med Chem. 2018;18(6):494–504.10.2174/1568026618666180523111351Search in Google Scholar PubMed PubMed Central

[7] Ganapathy-Kanniappan S. Molecular intricacies of aerobic glycolysis in cancer: current insights into the classic metabolic phenotype. Crit Rev Biochem Mol Biol. 2018;53(6):667–82.10.1080/10409238.2018.1556578Search in Google Scholar PubMed

[8] Wu Z, Wu J, Zhao Q, Fu S, Jin J. Emerging roles of aerobic glycolysis in breast cancer. Clin Transl Oncol. 2020;22(5):631–46.10.1007/s12094-019-02187-8Search in Google Scholar PubMed

[9] Li L, Liang Y, Kang L, Liu Y, Gao S, Chen S, et al. Transcriptional regulation of the Warburg effect in cancer by SIX1. Cancer Cell. 2018;33(3):368–85.e7.10.1016/j.ccell.2018.01.010Search in Google Scholar PubMed

[10] Peng J, Cui Y, Xu S, Wu X, Huang Y, Zhou W, et al. Altered glycolysis results in drug-resistant in clinical tumor therapy. Oncol Lett. 2021;21(5):369.10.3892/ol.2021.12630Search in Google Scholar PubMed PubMed Central

[11] Varghese E, Samuel SM, Líšková A, Samec M, Kubatka P, Büsselberg D. Targeting glucose metabolism to overcome resistance to anticancer chemotherapy in breast cancer. Cancers. 2020;12(8):2252.10.3390/cancers12082252Search in Google Scholar PubMed PubMed Central

[12] Tang J, Luo Y, Wu G. A glycolysis-related gene expression signature in predicting recurrence of breast cancer. Aging. 2020;12(24):24983–94.10.18632/aging.103806Search in Google Scholar PubMed PubMed Central

[13] Zheng Y, Liu P, Wang N, Wang S, Yang B, Li M, et al. Betulinic acid suppresses breast cancer metastasis by targeting GRP78-mediated glycolysis and ER stress apoptotic pathway. Oxid Med Cell Longev. 2019;2019:8781690.10.1155/2019/8781690Search in Google Scholar PubMed PubMed Central

[14] Sheng H, Tang W. Glycolysis inhibitors for anticancer therapy: A review of recent patents. Recent Pat Anticancer Drug Discov. 2016;11(3):297–308.10.2174/1574892811666160415160104Search in Google Scholar PubMed

[15] Hana S, Karthik D, Shan J, El Hayek S, Chouchane L, Megarbane A. A report on a family with TMTC3-related syndrome and review. Case Rep Med. 2020;2020:7163038.10.1155/2020/7163038Search in Google Scholar PubMed PubMed Central

[16] Graham JB, Sunryd JC, Mathavan K, Weir E, Larsen ISB, Halim A, et al. Endoplasmic reticulum transmembrane protein TMTC3 contributes to O-mannosylation of E-cadherin, cellular adherence, and embryonic gastrulation. Mol Biol Cell. 2020;31(3):167–83.10.1091/mbc.E19-07-0408Search in Google Scholar PubMed PubMed Central

[17] Munkley J, Elliott DJ. Hallmarks of glycosylation in cancer. Oncotarget. 2016;7(23):35478–89.10.18632/oncotarget.8155Search in Google Scholar PubMed PubMed Central

[18] Mohamed Abd-El-Halim Y, El Kaoutari A, Silvy F, Rubis M, Bigonnet M, Roques J, et al. A glycosyltransferase gene signature to detect pancreatic ductal adenocarcinoma patients with poor prognosis. EBioMedicine. 2021;71:103541.10.1016/j.ebiom.2021.103541Search in Google Scholar PubMed PubMed Central

[19] Rodvold JJ, Mahadevan NR, Zanetti M. Immune modulation by ER stress and inflammation in the tumor microenvironment. Cancer Lett. 2016;380(1):227–36.10.1016/j.canlet.2015.09.009Search in Google Scholar PubMed

[20] Liu H, Wang H, Chen D, Gu C, Huang J, Mi K. Endoplasmic reticulum stress inhibits 3D Matrigel-induced vasculogenic mimicry of breast cancer cells via TGF-β1/Smad2/3 and β-catenin signaling. FEBS open bio. 2021;11(9):2607–18.10.1002/2211-5463.13259Search in Google Scholar PubMed PubMed Central

[21] Chen X, Cubillos-Ruiz JR. Endoplasmic reticulum stress signals in the tumour and its microenvironment. Nat Rev Cancer. 2021;21(2):71–88.10.1038/s41568-020-00312-2Search in Google Scholar PubMed PubMed Central

[22] Racapé M, Duong Van Huyen JP, Danger R, Giral M, Bleicher F, Foucher Y, et al. The involvement of SMILE/TMTC3 in endoplasmic reticulum stress response. PLoS One. 2011;6(5):e19321.10.1371/journal.pone.0019321Search in Google Scholar PubMed PubMed Central

[23] Boujemaa M, Hamdi Y, Mejri N, Romdhane L, Ghedira K, Bouaziz H, et al. Germline copy number variations in BRCA1/2 negative families: Role in the molecular etiology of hereditary breast cancer in Tunisia. PLoS One. 2021;16(1):e0245362.10.1371/journal.pone.0245362Search in Google Scholar PubMed PubMed Central

[24] McConville TH, Annavajhala MK, Giddins MJ, Macesic N, Herrera CM, Rozenberg FD, et al. CrrB positively regulates high-level polymyxin resistance and virulence in Klebsiella pneumoniae. Cell Rep. 2020;33(4):108313.10.1016/j.celrep.2020.108313Search in Google Scholar PubMed PubMed Central

[25] Jiao L, Wang S, Zheng Y, Wang N, Yang B, Wang D, et al. Betulinic acid suppresses breast cancer aerobic glycolysis via caveolin-1/NF-κB/c-Myc pathway. Biochem Pharmacol. 2019;161:149–62.10.1016/j.bcp.2019.01.016Search in Google Scholar PubMed

[26] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif). 2001;25(4):402–8.10.1006/meth.2001.1262Search in Google Scholar PubMed

[27] Ding M, Fu Y, Guo F, Chen H, Fu X, Tan W, et al. Long non-coding RNA MAFG-AS1 knockdown blocks malignant progression in breast cancer cells by inactivating JAK2/STAT3 signaling pathway via MAFG-AS1/miR-3196/TFAP2A axis. Int J Clin Exp Pathol. 2020;13(10):2455–73.Search in Google Scholar

[28] Jin J, Qiu S, Wang P, Liang X, Huang F, Wu H, et al. Cardamonin inhibits breast cancer growth by repressing HIF-1α-dependent metabolic reprogramming. J Exp Clin Cancer Res. 2019;38(1):377.10.1186/s13046-019-1351-4Search in Google Scholar PubMed PubMed Central

[29] Gao Z, Dlamini MB, Ge H, Jiang L, Geng C, Li Q, et al. ATF4-mediated autophagy-dependent glycolysis plays an important role in attenuating apoptosis induced by Cr (VI) in A549 cells. Toxicol Lett. 2020;331:178–87.10.1016/j.toxlet.2020.06.015Search in Google Scholar PubMed

[30] Chen X, Wei L, Yang L, Guo W, Guo Q, Zhou Y. Glycolysis inhibition and apoptosis induction in human prostate cancer cells by FV-429-mediated regulation of AR-AKT-HK2 signaling network. Food Chem Toxicol. 2020;143:111517.10.1016/j.fct.2020.111517Search in Google Scholar PubMed

[31] Boon R, Silveira GG, Mostoslavsky R. Nuclear metabolism and the regulation of the epigenome. Nat Metab. 2020;2(11):1190–203.10.1038/s42255-020-00285-4Search in Google Scholar PubMed

[32] Cairns RA, Harris IS, Mak TW. Regulation of cancer cell metabolism. Nat Rev Cancer. 2011;11(2):85–95.10.1038/nrc2981Search in Google Scholar PubMed

[33] Leone RD, Powell JD. Metabolism of immune cells in cancer. Nat Rev Cancer. 2020;20(9):516–31.10.1038/s41568-020-0273-ySearch in Google Scholar PubMed PubMed Central

[34] Pavlova NN, Thompson CB. The emerging hallmarks of cancer metabolism. Cell Metab. 2016;23(1):27–47.10.1016/j.cmet.2015.12.006Search in Google Scholar PubMed PubMed Central

[35] Vander Heiden MG, Cantley LC, Thompson CB. Understanding the Warburg effect: the metabolic requirements of cell proliferation. Science. 2009;324(5930):1029–33.10.1126/science.1160809Search in Google Scholar PubMed PubMed Central

[36] Porporato PE, Filigheddu N, Pedro JMB, Kroemer G, Galluzzi L. Mitochondrial metabolism and cancer. Cell Res. 2018;28(3):265–80.10.1038/cr.2017.155Search in Google Scholar PubMed PubMed Central

[37] Akram M. Mini-review on glycolysis and cancer. J Cancer Educ. 2013;28(3):454–7.10.1007/s13187-013-0486-9Search in Google Scholar PubMed

[38] Kobliakov VA. The mechanisms of regulation of aerobic glycolysis (Warburg Effect) by oncoproteins in carcinogenesis. Biochem (Mosc). 2019;84(10):1117–28.10.1134/S0006297919100018Search in Google Scholar PubMed

[39] San-Millán I, Brooks GA. Reexamining cancer metabolism: Lactate production for carcinogenesis could be the purpose and explanation of the Warburg effect. Carcinogenesis. 2017;38(2):119–33.10.1093/carcin/bgw127Search in Google Scholar PubMed PubMed Central

[40] Vinasco K, Mitchell HM, Kaakoush NO, Castaño-Rodríguez N. Microbial carcinogenesis: Lactic acid bacteria in gastric cancer. Biochim Biophys Acta Rev Cancer. 2019;1872(2):188309.10.1016/j.bbcan.2019.07.004Search in Google Scholar PubMed

[41] Lunt SY, Vander Heiden MG. Aerobic glycolysis: Meeting the metabolic requirements of cell proliferation. Annu Rev Cell Dev Biol. 2011;27:441–64.10.1146/annurev-cellbio-092910-154237Search in Google Scholar PubMed

[42] Hu Q, Qin Y, Ji S, Xu W, Liu W, Sun Q, et al. UHRF1 promotes aerobic glycolysis and proliferation via suppression of SIRT4 in pancreatic cancer. Cancer Lett. 2019;452:226–36.10.1016/j.canlet.2019.03.024Search in Google Scholar PubMed

[43] Cantor JR, Sabatini DM. Cancer cell metabolism: One hallmark, many faces. Cancer Discov. 2012;2(10):881–98.10.1158/2159-8290.CD-12-0345Search in Google Scholar PubMed PubMed Central

[44] Matsuura K, Canfield K, Feng W, Kurokawa M. Metabolic regulation of apoptosis in cancer. Int Rev Cell Mol Biol. 2016;327:43–87.10.1016/bs.ircmb.2016.06.006Search in Google Scholar PubMed PubMed Central

[45] Li C, Zhang G, Zhao L, Ma Z, Chen H. Metabolic reprogramming in cancer cells: glycolysis, glutaminolysis, and Bcl-2 proteins as novel therapeutic targets for cancer. World J Surg Oncol. 2016;14(1):15.10.1186/s12957-016-0769-9Search in Google Scholar PubMed PubMed Central

[46] Coloff JL, Macintyre AN, Nichols AG, Liu T, Gallo CA, Plas DR, et al. Akt-dependent glucose metabolism promotes Mcl-1 synthesis to maintain cell survival and resistance to Bcl-2 inhibition. Cancer Res. 2011;71(15):5204–13.10.1158/0008-5472.CAN-10-4531Search in Google Scholar PubMed PubMed Central

[47] Sisinni L, Pietrafesa M, Lepore S, Maddalena F, Condelli V, Esposito F, et al. Endoplasmic reticulum stress and unfolded protein response in breast cancer: the balance between apoptosis and autophagy and its role in drug resistance. Int J Mol Sci. 2019;20(4):857.10.3390/ijms20040857Search in Google Scholar PubMed PubMed Central

[48] Graham RM, Hernandez F, Puerta N, De Angulo G, Webster KA, Vanni S. Resveratrol augments ER stress and the cytotoxic effects of glycolytic inhibition in neuroblastoma by downregulating Akt in a mechanism independent of SIRT1. Exp Mol Med. 2016;48(2):e210.10.1038/emm.2015.116Search in Google Scholar PubMed PubMed Central

[49] Szegezdi E, Fitzgerald U, Samali A. Caspase-12 and ER-stress-mediated apoptosis: the story so far. Ann N Y Acad Sci. 2003;1010:186–94.10.1196/annals.1299.032Search in Google Scholar PubMed

[50] Sunryd JC, Cheon B, Graham JB, Giorda KM, Fissore RA, Hebert DN. TMTC1 and TMTC2 are novel endoplasmic reticulum tetratricopeptide repeat-containing adapter proteins involved in calcium homeostasis. J Biol Chem. 2014;289(23):16085–99.10.1074/jbc.M114.554071Search in Google Scholar PubMed PubMed Central

[51] Liu G, Zhou Q, Lin H, Li N, Ye H, Wang J. Novel compound variants of the TMTC3 gene cause cobblestone lissencephaly-like syndrome: A case report. Exp Ther Med. 2020;20(5):97.10.3892/etm.2020.9226Search in Google Scholar PubMed PubMed Central

[52] Farhan SMK, Nixon KCJ, Everest M, Edwards TN, Long S, Segal D, et al. Identification of a novel synaptic protein, TMTC3, involved in periventricular nodular heterotopia with intellectual disability and epilepsy. Hum Mol Genet. 2017;26(21):4278–89.10.1093/hmg/ddx316Search in Google Scholar PubMed PubMed Central

Received: 2022-07-06
Revised: 2022-12-05
Accepted: 2022-12-11
Published Online: 2023-04-10

© 2023 the author(s), published by De Gruyter

This work is licensed under the Creative Commons Attribution 4.0 International License.

Articles in the same Issue

  1. Research Articles
  2. Exosomes derived from mesenchymal stem cells overexpressing miR-210 inhibits neuronal inflammation and contribute to neurite outgrowth through modulating microglia polarization
  3. Current situation of acute ST-segment elevation myocardial infarction in a county hospital chest pain center during an epidemic of novel coronavirus pneumonia
  4. circ-IARS depletion inhibits the progression of non-small-cell lung cancer by circ-IARS/miR-1252-5p/HDGF ceRNA pathway
  5. circRNA ITGA7 restrains growth and enhances radiosensitivity by up-regulating SMAD4 in colorectal carcinoma
  6. WDR79 promotes aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) by the suppression of SIRT4
  7. Up-regulation of collagen type V alpha 2 (COL5A2) promotes malignant phenotypes in gastric cancer cell via inducing epithelial–mesenchymal transition (EMT)
  8. Inhibition of TERC inhibits neural apoptosis and inflammation in spinal cord injury through Akt activation and p-38 inhibition via the miR-34a-5p/XBP-1 axis
  9. 3D-printed polyether-ether-ketone/n-TiO2 composite enhances the cytocompatibility and osteogenic differentiation of MC3T3-E1 cells by downregulating miR-154-5p
  10. Propofol-mediated circ_0000735 downregulation restrains tumor growth by decreasing integrin-β1 expression in non-small cell lung cancer
  11. PVT1/miR-16/CCND1 axis regulates gastric cancer progression
  12. Silencing of circ_002136 sensitizes gastric cancer to paclitaxel by targeting the miR-16-5p/HMGA1 axis
  13. Short-term outcomes after simultaneous gastrectomy plus cholecystectomy in gastric cancer: A pooling up analysis
  14. SCARA5 inhibits oral squamous cell carcinoma via inactivating the STAT3 and PI3K/AKT signaling pathways
  15. Molecular mechanism by which the Notch signaling pathway regulates autophagy in a rat model of pulmonary fibrosis in pigeon breeder’s lung
  16. lncRNA TPT1-AS1 promotes cell migration and invasion in esophageal squamous-cell carcinomas by regulating the miR-26a/HMGA1 axis
  17. SIRT1/APE1 promotes the viability of gastric cancer cells by inhibiting p53 to suppress ferroptosis
  18. Glycoprotein non-metastatic melanoma B interacts with epidermal growth factor receptor to regulate neural stem cell survival and differentiation
  19. Treatments for brain metastases from EGFR/ALK-negative/unselected NSCLC: A network meta-analysis
  20. Association of osteoporosis and skeletal muscle loss with serum type I collagen carboxyl-terminal peptide β glypeptide: A cross-sectional study in elder Chinese population
  21. circ_0000376 knockdown suppresses non-small cell lung cancer cell tumor properties by the miR-545-3p/PDPK1 pathway
  22. Delivery in a vertical birth chair supported by freedom of movement during labor: A randomized control trial
  23. UBE2J1 knockdown promotes cell apoptosis in endometrial cancer via regulating PI3K/AKT and MDM2/p53 signaling
  24. Metabolic resuscitation therapy in critically ill patients with sepsis and septic shock: A pilot prospective randomized controlled trial
  25. Lycopene ameliorates locomotor activity and urinary frequency induced by pelvic venous congestion in rats
  26. UHRF1-induced connexin26 methylation is involved in hearing damage triggered by intermittent hypoxia in neonatal rats
  27. LINC00511 promotes melanoma progression by targeting miR-610/NUCB2
  28. Ultra-high-performance liquid chromatography-tandem mass spectrometry analysis of serum metabolomic characteristics in people with different vitamin D levels
  29. Role of Jumonji domain-containing protein D3 and its inhibitor GSK-J4 in Hashimoto’s thyroiditis
  30. circ_0014736 induces GPR4 to regulate the biological behaviors of human placental trophoblast cells through miR-942-5p in preeclampsia
  31. Monitoring of sirolimus in the whole blood samples from pediatric patients with lymphatic anomalies
  32. Effects of osteogenic growth peptide C-terminal pentapeptide and its analogue on bone remodeling in an osteoporosis rat model
  33. A novel autophagy-related long non-coding RNAs signature predicting progression-free interval and I-131 therapy benefits in papillary thyroid carcinoma
  34. WGCNA-based identification of potential targets and pathways in response to treatment in locally advanced breast cancer patients
  35. Radiomics model using preoperative computed tomography angiography images to differentiate new from old emboli of acute lower limb arterial embolism
  36. Dysregulated lncRNAs are involved in the progress of myocardial infarction by constructing regulatory networks
  37. Single-arm trial to evaluate the efficacy and safety of baclofen in treatment of intractable hiccup caused by malignant tumor chemotherapy
  38. Genetic polymorphisms of MRPS30-DT and NINJ2 may influence lung cancer risk
  39. Efficacy of immune checkpoint inhibitors in patients with KRAS-mutant advanced non-small cell lung cancer: A retrospective analysis
  40. Pyroptosis-based risk score predicts prognosis and drug sensitivity in lung adenocarcinoma
  41. Upregulation of lncRNA LANCL1-AS1 inhibits the progression of non-small-cell lung cancer via the miR-3680-3p/GMFG axis
  42. CircRANBP17 modulated KDM1A to regulate neuroblastoma progression by sponging miR-27b-3p
  43. Exosomal miR-93-5p regulated the progression of osteoarthritis by targeting ADAMTS9
  44. Downregulation of RBM17 enhances cisplatin sensitivity and inhibits cell invasion in human hypopharyngeal cancer cells
  45. HDAC5-mediated PRAME regulates the proliferation, migration, invasion, and EMT of laryngeal squamous cell carcinoma via the PI3K/AKT/mTOR signaling pathway
  46. The association between sleep duration, quality, and nonalcoholic fatty liver disease: A cross-sectional study
  47. Myostatin silencing inhibits podocyte apoptosis in membranous nephropathy through Smad3/PKA/NOX4 signaling pathway
  48. A novel long noncoding RNA AC125257.1 facilitates colorectal cancer progression by targeting miR-133a-3p/CASC5 axis
  49. Impact of omicron wave and associated control measures in Shanghai on health management and psychosocial well-being of patients with chronic conditions
  50. Clinicopathological characteristics and prognosis of young patients aged ≤45 years old with non-small cell lung cancer
  51. TMT-based comprehensive proteomic profiling identifies serum prognostic signatures of acute myeloid leukemia
  52. The dose limits of teeth protection for patients with nasopharyngeal carcinoma undergoing radiotherapy based on the early oral health-related quality of life
  53. miR-30b-5p targeting GRIN2A inhibits hippocampal damage in epilepsy
  54. Long non-coding RNA AL137789.1 promoted malignant biological behaviors and immune escape of pancreatic carcinoma cells
  55. IRF6 and FGF1 polymorphisms in non-syndromic cleft lip with or without cleft palate in the Polish population
  56. Comprehensive analysis of the role of SFXN family in breast cancer
  57. Efficacy of bronchoscopic intratumoral injection of endostar and cisplatin in lung squamous cell carcinoma patients underwent conventional chemoradiotherapy
  58. Silencing of long noncoding RNA MIAT inhibits the viability and proliferation of breast cancer cells by promoting miR-378a-5p expression
  59. AG1024, an IGF-1 receptor inhibitor, ameliorates renal injury in rats with diabetic nephropathy via the SOCS/JAK2/STAT pathway
  60. Downregulation of KIAA1199 alleviated the activation, proliferation, and migration of hepatic stellate cells by the inhibition of epithelial–mesenchymal transition
  61. Exendin-4 regulates the MAPK and WNT signaling pathways to alleviate the osteogenic inhibition of periodontal ligament stem cells in a high glucose environment
  62. Inhibition of glycolysis represses the growth and alleviates the endoplasmic reticulum stress of breast cancer cells by regulating TMTC3
  63. The function of lncRNA EMX2OS/miR-653-5p and its regulatory mechanism in lung adenocarcinoma
  64. Tectorigenin alleviates the apoptosis and inflammation in spinal cord injury cell model through inhibiting insulin-like growth factor-binding protein 6
  65. Ultrasound examination supporting CT or MRI in the evaluation of cervical lymphadenopathy in patients with irradiation-treated head and neck cancer
  66. F-box and WD repeat domain containing 7 inhibits the activation of hepatic stellate cells by degrading delta-like ligand 1 to block Notch signaling pathway
  67. Knockdown of circ_0005615 enhances the radiosensitivity of colorectal cancer by regulating the miR-665/NOTCH1 axis
  68. Long noncoding RNA Mhrt alleviates angiotensin II-induced cardiac hypertrophy phenotypes by mediating the miR-765/Wnt family member 7B pathway
  69. Effect of miR-499-5p/SOX6 axis on atrial fibrosis in rats with atrial fibrillation
  70. Cholesterol induces inflammation and reduces glucose utilization
  71. circ_0004904 regulates the trophoblast cell in preeclampsia via miR-19b-3p/ARRDC3 axis
  72. NECAB3 promotes the migration and invasion of liver cancer cells through HIF-1α/RIT1 signaling pathway
  73. The poor performance of cardiovascular risk scores in identifying patients with idiopathic inflammatory myopathies at high cardiovascular risk
  74. miR-2053 inhibits the growth of ovarian cancer cells by downregulating SOX4
  75. Nucleophosmin 1 associating with engulfment and cell motility protein 1 regulates hepatocellular carcinoma cell chemotaxis and metastasis
  76. α-Hederin regulates macrophage polarization to relieve sepsis-induced lung and liver injuries in mice
  77. Changes of microbiota level in urinary tract infections: A meta-analysis
  78. Identification of key enzalutamide-resistance-related genes in castration-resistant prostate cancer and verification of RAD51 functions
  79. Falls during oxaliplatin-based chemotherapy for gastrointestinal malignancies – (lessons learned from) a prospective study
  80. Outcomes of low-risk birth care during the Covid-19 pandemic: A cohort study from a tertiary care center in Lithuania
  81. Vitamin D protects intestines from liver cirrhosis-induced inflammation and oxidative stress by inhibiting the TLR4/MyD88/NF-κB signaling pathway
  82. Integrated transcriptome analysis identifies APPL1/RPS6KB2/GALK1 as immune-related metastasis factors in breast cancer
  83. Genomic analysis of immunogenic cell death-related subtypes for predicting prognosis and immunotherapy outcomes in glioblastoma multiforme
  84. Circular RNA Circ_0038467 promotes the maturation of miRNA-203 to increase lipopolysaccharide-induced apoptosis of chondrocytes
  85. An economic evaluation of fine-needle cytology as the primary diagnostic tool in the diagnosis of lymphadenopathy
  86. Midazolam impedes lung carcinoma cell proliferation and migration via EGFR/MEK/ERK signaling pathway
  87. Network pharmacology combined with molecular docking and experimental validation to reveal the pharmacological mechanism of naringin against renal fibrosis
  88. PTPN12 down-regulated by miR-146b-3p gene affects the malignant progression of laryngeal squamous cell carcinoma
  89. miR-141-3p accelerates ovarian cancer progression and promotes M2-like macrophage polarization by targeting the Keap1-Nrf2 pathway
  90. lncRNA OIP5-AS1 attenuates the osteoarthritis progression in IL-1β-stimulated chondrocytes
  91. Overexpression of LINC00607 inhibits cell growth and aggressiveness by regulating the miR-1289/EFNA5 axis in non-small-cell lung cancer
  92. Subjective well-being in informal caregivers during the COVID-19 pandemic
  93. Nrf2 protects against myocardial ischemia-reperfusion injury in diabetic rats by inhibiting Drp1-mediated mitochondrial fission
  94. Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
  95. Bladder cancer screening: The new selection and prediction model
  96. circNFATC3 facilitated the progression of oral squamous cell carcinoma via the miR-520h/LDHA axis
  97. Prone position effect in intensive care patients with SARS-COV-2 pneumonia
  98. Clinical observation on the efficacy of Tongdu Tuina manipulation in the treatment of primary enuresis in children
  99. Dihydroartemisinin ameliorates cerebral I/R injury in rats via regulating VWF and autophagy-mediated SIRT1/FOXO1 pathway
  100. Knockdown of circ_0113656 assuages oxidized low-density lipoprotein-induced vascular smooth muscle cell injury through the miR-188-3p/IGF2 pathway
  101. Low Ang-(1–7) and high des-Arg9 bradykinin serum levels are correlated with cardiovascular risk factors in patients with COVID-19
  102. Effect of maternal age and body mass index on induction of labor with oral misoprostol for premature rupture of membrane at term: A retrospective cross-sectional study
  103. Potential protective effects of Huanglian Jiedu Decoction against COVID-19-associated acute kidney injury: A network-based pharmacological and molecular docking study
  104. Clinical significance of serum MBD3 detection in girls with central precocious puberty
  105. Clinical features of varicella-zoster virus caused neurological diseases detected by metagenomic next-generation sequencing
  106. Collagen treatment of complex anorectal fistula: 3 years follow-up
  107. LncRNA CASC15 inhibition relieves renal fibrosis in diabetic nephropathy through down-regulating SP-A by sponging to miR-424
  108. Efficacy analysis of empirical bismuth quadruple therapy, high-dose dual therapy, and resistance gene-based triple therapy as a first-line Helicobacter pylori eradication regimen – An open-label, randomized trial
  109. SMOC2 plays a role in heart failure via regulating TGF-β1/Smad3 pathway-mediated autophagy
  110. A prospective cohort study of the impact of chronic disease on fall injuries in middle-aged and older adults
  111. circRNA THBS1 silencing inhibits the malignant biological behavior of cervical cancer cells via the regulation of miR-543/HMGB2 axis
  112. hsa_circ_0000285 sponging miR-582-3p promotes neuroblastoma progression by regulating the Wnt/β-catenin signaling pathway
  113. Long non-coding RNA GNAS-AS1 knockdown inhibits proliferation and epithelial–mesenchymal transition of lung adenocarcinoma cells via the microRNA-433-3p/Rab3A axis
  114. lncRNA UCA1 regulates miR-132/Lrrfip1 axis to promote vascular smooth muscle cell proliferation
  115. Twenty-four-color full spectrum flow cytometry panel for minimal residual disease detection in acute myeloid leukemia
  116. Hsa-miR-223-3p participates in the process of anthracycline-induced cardiomyocyte damage by regulating NFIA gene
  117. Anti-inflammatory effect of ApoE23 on Salmonella typhimurium-induced sepsis in mice
  118. Analysis of somatic mutations and key driving factors of cervical cancer progression
  119. Hsa_circ_0028007 regulates the progression of nasopharyngeal carcinoma through the miR-1179/SQLE axis
  120. Variations in sexual function after laparoendoscopic single-site hysterectomy in women with benign gynecologic diseases
  121. Effects of pharmacological delay with roxadustat on multi-territory perforator flap survival in rats
  122. Analysis of heroin effects on calcium channels in rat cardiomyocytes based on transcriptomics and metabolomics
  123. Risk factors of recurrent bacterial vaginosis among women of reproductive age: A cross-sectional study
  124. Alkbh5 plays indispensable roles in maintaining self-renewal of hematopoietic stem cells
  125. Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients
  126. Correlation between microvessel maturity and ISUP grades assessed using contrast-enhanced transrectal ultrasonography in prostate cancer
  127. The protective effect of caffeic acid phenethyl ester in the nephrotoxicity induced by α-cypermethrin
  128. Norepinephrine alleviates cyclosporin A-induced nephrotoxicity by enhancing the expression of SFRP1
  129. Effect of RUNX1/FOXP3 axis on apoptosis of T and B lymphocytes and immunosuppression in sepsis
  130. The function of Foxp1 represses β-adrenergic receptor transcription in the occurrence and development of bladder cancer through STAT3 activity
  131. Risk model and validation of carbapenem-resistant Klebsiella pneumoniae infection in patients with cerebrovascular disease in the ICU
  132. Calycosin protects against chronic prostatitis in rats via inhibition of the p38MAPK/NF-κB pathway
  133. Pan-cancer analysis of the PDE4DIP gene with potential prognostic and immunotherapeutic values in multiple cancers including acute myeloid leukemia
  134. The safety and immunogenicity to inactivated COVID-19 vaccine in patients with hyperlipemia
  135. Circ-UBR4 regulates the proliferation, migration, inflammation, and apoptosis in ox-LDL-induced vascular smooth muscle cells via miR-515-5p/IGF2 axis
  136. Clinical characteristics of current COVID-19 rehabilitation outpatients in China
  137. Luteolin alleviates ulcerative colitis in rats via regulating immune response, oxidative stress, and metabolic profiling
  138. miR-199a-5p inhibits aortic valve calcification by targeting ATF6 and GRP78 in valve interstitial cells
  139. The application of iliac fascia space block combined with esketamine intravenous general anesthesia in PFNA surgery of the elderly: A prospective, single-center, controlled trial
  140. Elevated blood acetoacetate levels reduce major adverse cardiac and cerebrovascular events risk in acute myocardial infarction
  141. The effects of progesterone on the healing of obstetric anal sphincter damage in female rats
  142. Identification of cuproptosis-related genes for predicting the development of prostate cancer
  143. Lumican silencing ameliorates β-glycerophosphate-mediated vascular smooth muscle cell calcification by attenuating the inhibition of APOB on KIF2C activity
  144. Targeting PTBP1 blocks glutamine metabolism to improve the cisplatin sensitivity of hepatocarcinoma cells through modulating the mRNA stability of glutaminase
  145. A single center prospective study: Influences of different hip flexion angles on the measurement of lumbar spine bone mineral density by dual energy X-ray absorptiometry
  146. Clinical analysis of AN69ST membrane continuous venous hemofiltration in the treatment of severe sepsis
  147. Antibiotics therapy combined with probiotics administered intravaginally for the treatment of bacterial vaginosis: A systematic review and meta-analysis
  148. Construction of a ceRNA network to reveal a vascular invasion associated prognostic model in hepatocellular carcinoma
  149. A pan-cancer analysis of STAT3 expression and genetic alterations in human tumors
  150. A prognostic signature based on seven T-cell-related cell clustering genes in bladder urothelial carcinoma
  151. Pepsin concentration in oral lavage fluid of rabbit reflux model constructed by dilating the lower esophageal sphincter
  152. The antihypertensive felodipine shows synergistic activity with immune checkpoint blockade and inhibits tumor growth via NFAT1 in LUSC
  153. Tanshinone IIA attenuates valvular interstitial cells’ calcification induced by oxidized low density lipoprotein via reducing endoplasmic reticulum stress
  154. AS-IV enhances the antitumor effects of propofol in NSCLC cells by inhibiting autophagy
  155. Establishment of two oxaliplatin-resistant gallbladder cancer cell lines and comprehensive analysis of dysregulated genes
  156. Trial protocol: Feasibility of neuromodulation with connectivity-guided intermittent theta-burst stimulation for improving cognition in multiple sclerosis
  157. LncRNA LINC00592 mediates the promoter methylation of WIF1 to promote the development of bladder cancer
  158. Factors associated with gastrointestinal dysmotility in critically ill patients
  159. Mechanisms by which spinal cord stimulation intervenes in atrial fibrillation: The involvement of the endothelin-1 and nerve growth factor/p75NTR pathways
  160. Analysis of two-gene signatures and related drugs in small-cell lung cancer by bioinformatics
  161. Silencing USP19 alleviates cigarette smoke extract-induced mitochondrial dysfunction in BEAS-2B cells by targeting FUNDC1
  162. Menstrual irregularities associated with COVID-19 vaccines among women in Saudi Arabia: A survey during 2022
  163. Ferroptosis involves in Schwann cell death in diabetic peripheral neuropathy
  164. The effect of AQP4 on tau protein aggregation in neurodegeneration and persistent neuroinflammation after cerebral microinfarcts
  165. Activation of UBEC2 by transcription factor MYBL2 affects DNA damage and promotes gastric cancer progression and cisplatin resistance
  166. Analysis of clinical characteristics in proximal and distal reflux monitoring among patients with gastroesophageal reflux disease
  167. Exosomal circ-0020887 and circ-0009590 as novel biomarkers for the diagnosis and prediction of short-term adverse cardiovascular outcomes in STEMI patients
  168. Upregulated microRNA-429 confers endometrial stromal cell dysfunction by targeting HIF1AN and regulating the HIF1A/VEGF pathway
  169. Bibliometrics and knowledge map analysis of ultrasound-guided regional anesthesia
  170. Knockdown of NUPR1 inhibits angiogenesis in lung cancer through IRE1/XBP1 and PERK/eIF2α/ATF4 signaling pathways
  171. D-dimer trends predict COVID-19 patient’s prognosis: A retrospective chart review study
  172. WTAP affects intracranial aneurysm progression by regulating m6A methylation modification
  173. Using of endoscopic polypectomy in patients with diagnosed malignant colorectal polyp – The cross-sectional clinical study
  174. Anti-S100A4 antibody administration alleviates bronchial epithelial–mesenchymal transition in asthmatic mice
  175. Prognostic evaluation of system immune-inflammatory index and prognostic nutritional index in double expressor diffuse large B-cell lymphoma
  176. Prevalence and antibiogram of bacteria causing urinary tract infection among patients with chronic kidney disease
  177. Reactive oxygen species within the vaginal space: An additional promoter of cervical intraepithelial neoplasia and uterine cervical cancer development?
  178. Identification of disulfidptosis-related genes and immune infiltration in lower-grade glioma
  179. A new technique for uterine-preserving pelvic organ prolapse surgery: Laparoscopic rectus abdominis hysteropexy for uterine prolapse by comparing with traditional techniques
  180. Self-isolation of an Italian long-term care facility during COVID-19 pandemic: A comparison study on care-related infectious episodes
  181. A comparative study on the overlapping effects of clinically applicable therapeutic interventions in patients with central nervous system damage
  182. Low intensity extracorporeal shockwave therapy for chronic pelvic pain syndrome: Long-term follow-up
  183. The diagnostic accuracy of touch imprint cytology for sentinel lymph node metastases of breast cancer: An up-to-date meta-analysis of 4,073 patients
  184. Mortality associated with Sjögren’s syndrome in the United States in the 1999–2020 period: A multiple cause-of-death study
  185. CircMMP11 as a prognostic biomarker mediates miR-361-3p/HMGB1 axis to accelerate malignant progression of hepatocellular carcinoma
  186. Analysis of the clinical characteristics and prognosis of adult de novo acute myeloid leukemia (none APL) with PTPN11 mutations
  187. KMT2A maintains stemness of gastric cancer cells through regulating Wnt/β-catenin signaling-activated transcriptional factor KLF11
  188. Evaluation of placental oxygenation by near-infrared spectroscopy in relation to ultrasound maturation grade in physiological term pregnancies
  189. The role of ultrasonographic findings for PIK3CA-mutated, hormone receptor-positive, human epidermal growth factor receptor-2-negative breast cancer
  190. Construction of immunogenic cell death-related molecular subtypes and prognostic signature in colorectal cancer
  191. Long-term prognostic value of high-sensitivity cardiac troponin-I in patients with idiopathic dilated cardiomyopathy
  192. Establishing a novel Fanconi anemia signaling pathway-associated prognostic model and tumor clustering for pediatric acute myeloid leukemia patients
  193. Integrative bioinformatics analysis reveals STAT2 as a novel biomarker of inflammation-related cardiac dysfunction in atrial fibrillation
  194. Adipose-derived stem cells repair radiation-induced chronic lung injury via inhibiting TGF-β1/Smad 3 signaling pathway
  195. Real-world practice of idiopathic pulmonary fibrosis: Results from a 2000–2016 cohort
  196. lncRNA LENGA sponges miR-378 to promote myocardial fibrosis in atrial fibrillation
  197. Diagnostic value of urinary Tamm-Horsfall protein and 24 h urine osmolality for recurrent calcium oxalate stones of the upper urinary tract: Cross-sectional study
  198. The value of color Doppler ultrasonography combined with serum tumor markers in differential diagnosis of gastric stromal tumor and gastric cancer
  199. The spike protein of SARS-CoV-2 induces inflammation and EMT of lung epithelial cells and fibroblasts through the upregulation of GADD45A
  200. Mycophenolate mofetil versus cyclophosphamide plus in patients with connective tissue disease-associated interstitial lung disease: Efficacy and safety analysis
  201. MiR-1278 targets CALD1 and suppresses the progression of gastric cancer via the MAPK pathway
  202. Metabolomic analysis of serum short-chain fatty acid concentrations in a mouse of MPTP-induced Parkinson’s disease after dietary supplementation with branched-chain amino acids
  203. Cimifugin inhibits adipogenesis and TNF-α-induced insulin resistance in 3T3-L1 cells
  204. Predictors of gastrointestinal complaints in patients on metformin therapy
  205. Prescribing patterns in patients with chronic obstructive pulmonary disease and atrial fibrillation
  206. A retrospective analysis of the effect of latent tuberculosis infection on clinical pregnancy outcomes of in vitro fertilization–fresh embryo transferred in infertile women
  207. Appropriateness and clinical outcomes of short sustained low-efficiency dialysis: A national experience
  208. miR-29 regulates metabolism by inhibiting JNK-1 expression in non-obese patients with type 2 diabetes mellitus and NAFLD
  209. Clinical features and management of lymphoepithelial cyst
  210. Serum VEGF, high-sensitivity CRP, and cystatin-C assist in the diagnosis of type 2 diabetic retinopathy complicated with hyperuricemia
  211. ENPP1 ameliorates vascular calcification via inhibiting the osteogenic transformation of VSMCs and generating PPi
  212. Significance of monitoring the levels of thyroid hormone antibodies and glucose and lipid metabolism antibodies in patients suffer from type 2 diabetes
  213. The causal relationship between immune cells and different kidney diseases: A Mendelian randomization study
  214. Interleukin 33, soluble suppression of tumorigenicity 2, interleukin 27, and galectin 3 as predictors for outcome in patients admitted to intensive care units
  215. Identification of diagnostic immune-related gene biomarkers for predicting heart failure after acute myocardial infarction
  216. Long-term administration of probiotics prevents gastrointestinal mucosal barrier dysfunction in septic mice partly by upregulating the 5-HT degradation pathway
  217. miR-192 inhibits the activation of hepatic stellate cells by targeting Rictor
  218. Diagnostic and prognostic value of MR-pro ADM, procalcitonin, and copeptin in sepsis
  219. Review Articles
  220. Prenatal diagnosis of fetal defects and its implications on the delivery mode
  221. Electromagnetic fields exposure on fetal and childhood abnormalities: Systematic review and meta-analysis
  222. Characteristics of antibiotic resistance mechanisms and genes of Klebsiella pneumoniae
  223. Saddle pulmonary embolism in the setting of COVID-19 infection: A systematic review of case reports and case series
  224. Vitamin C and epigenetics: A short physiological overview
  225. Ebselen: A promising therapy protecting cardiomyocytes from excess iron in iron-overloaded thalassemia patients
  226. Aspirin versus LMWH for VTE prophylaxis after orthopedic surgery
  227. Mechanism of rhubarb in the treatment of hyperlipidemia: A recent review
  228. Surgical management and outcomes of traumatic global brachial plexus injury: A concise review and our center approach
  229. The progress of autoimmune hepatitis research and future challenges
  230. METTL16 in human diseases: What should we do next?
  231. New insights into the prevention of ureteral stents encrustation
  232. VISTA as a prospective immune checkpoint in gynecological malignant tumors: A review of the literature
  233. Case Reports
  234. Mycobacterium xenopi infection of the kidney and lymph nodes: A case report
  235. Genetic mutation of SLC6A20 (c.1072T > C) in a family with nephrolithiasis: A case report
  236. Chronic hepatitis B complicated with secondary hemochromatosis was cured clinically: A case report
  237. Liver abscess complicated with multiple organ invasive infection caused by hematogenous disseminated hypervirulent Klebsiella pneumoniae: A case report
  238. Urokinase-based lock solutions for catheter salvage: A case of an upcoming kidney transplant recipient
  239. Two case reports of maturity-onset diabetes of the young type 3 caused by the hepatocyte nuclear factor 1α gene mutation
  240. Immune checkpoint inhibitor-related pancreatitis: What is known and what is not
  241. Does total hip arthroplasty result in intercostal nerve injury? A case report and literature review
  242. Clinicopathological characteristics and diagnosis of hepatic sinusoidal obstruction syndrome caused by Tusanqi – Case report and literature review
  243. Synchronous triple primary gastrointestinal malignant tumors treated with laparoscopic surgery: A case report
  244. CT-guided percutaneous microwave ablation combined with bone cement injection for the treatment of transverse metastases: A case report
  245. Malignant hyperthermia: Report on a successful rescue of a case with the highest temperature of 44.2°C
  246. Anesthetic management of fetal pulmonary valvuloplasty: A case report
  247. Rapid Communication
  248. Impact of COVID-19 lockdown on glycemic levels during pregnancy: A retrospective analysis
  249. Erratum
  250. Erratum to “Inhibition of miR-21 improves pulmonary vascular responses in bronchopulmonary dysplasia by targeting the DDAH1/ADMA/NO pathway”
  251. Erratum to: “Fer exacerbates renal fibrosis and can be targeted by miR-29c-3p”
  252. Retraction
  253. Retraction of “Study to compare the effect of casirivimab and imdevimab, remdesivir, and favipiravir on progression and multi-organ function of hospitalized COVID-19 patients”
  254. Retraction of “circ_0062491 alleviates periodontitis via the miR-142-5p/IGF1 axis”
  255. Retraction of “miR-223-3p alleviates TGF-β-induced epithelial-mesenchymal transition and extracellular matrix deposition by targeting SP3 in endometrial epithelial cells”
  256. Retraction of “SLCO4A1-AS1 mediates pancreatic cancer development via miR-4673/KIF21B axis”
  257. Retraction of “circRNA_0001679/miR-338-3p/DUSP16 axis aggravates acute lung injury”
  258. Retraction of “lncRNA ACTA2-AS1 inhibits malignant phenotypes of gastric cancer cells”
  259. Special issue Linking Pathobiological Mechanisms to Clinical Application for cardiovascular diseases
  260. Effect of cardiac rehabilitation therapy on depressed patients with cardiac insufficiency after cardiac surgery
  261. Special issue The evolving saga of RNAs from bench to bedside - Part I
  262. FBLIM1 mRNA is a novel prognostic biomarker and is associated with immune infiltrates in glioma
  263. Special Issue Computational Intelligence Methodologies Meets Recurrent Cancers - Part III
  264. Development of a machine learning-based signature utilizing inflammatory response genes for predicting prognosis and immune microenvironment in ovarian cancer
Downloaded on 1.4.2026 from https://www.degruyterbrill.com/document/doi/10.1515/med-2023-0635/html
Scroll to top button